JP2019019109A - Neutrophil extracellular trap formation promoter - Google Patents

Abstract

To provide a neutrophil extracellular trap formation promoter and a pharmaceutical composition containing the promoter.SOLUTION: A neutrophil extracellular trap formation promoter contains at least one selected from the group consisting of sulfasalazine, 4,4'-diaminodiphenyl sulfone, sulfanyl amide and pharmaceutically acceptable salt thereof.SELECTED DRAWING: None

Description

  The present invention relates to a neutrophil extracellular trap formation promoter and a pharmaceutical composition containing the promoter.

  As a new mechanism for protecting neutrophils from infection, a neutrophil extracellular trap (NET) has attracted attention. NET is a mechanism in which activated neutrophils release their chromatin in a reticulated manner outside cells and capture and remove bacteria and viruses. NET formation is involved in the pathology of a wide variety of diseases.

  Cell death of neutrophils that form NETs is called NETosis, but when neutrophils are killed by NETosis, intracellular substances including damage-related molecular patterns (DAMPs) are released, causing tissue damage or delayed regeneration There is a possibility (see Non-Patent Document 1). For example, since neutrophils obtained from diabetic humans and mice are sensitive to NETosis, wound healing is delayed in diabetic mice (see Non-Patent Document 2). In individuals with ischemic reperfusion injury, NET formation is mediated by TLR signaling and exacerbates the damage (see Non-Patent Document 3).

  On the other hand, there are several diseases where NET formation has a beneficial effect on pathology. For example, neutrophils cause NET formation at the site of gout inflammation, and the formation of NET results in resolution of inflammation by degrading inflammatory cytokines (see Non-Patent Document 4). In addition, neutrophils detect human immunodeficiency virus (HIV) -1 through Toll-like receptors (TLR), TLR7 and TLR8 that recognize viral nucleic acids. Involvement of TLR7 and TLR8 induces NET formation, resulting in NET-dependent HIV-1 exclusion (see Non-Patent Document 5).

  Thus, since NET formation can have a positive or negative effect on various diseases, compounds capable of controlling NET formation are expected to be useful in the treatment of these diseases. Yes. In particular, promotion of NET formation is expected as a new treatment for infectious diseases (see Non-Patent Documents 6 and 7).

  Heretofore, for example, 4,4'-diaminodiphenylsulfone (DDS) and sulfanilamide have been used to treat infections. 4,4'-Diaminodiphenylsulfone (DDS) has been used for infection by bacteria, fungi, protozoa and the like, and in particular, has been used as a therapeutic drug for leprosy. Sulfanilamide has also been used as an antibiotic. Such sulfa drugs exhibit antibacterial action by inhibiting folic acid synthesis of fungi.

  In recent years, global epidemics of highly lethal infectious diseases are feared, and the development of new treatments for infectious diseases is desired. In particular, antiviral drugs are expected to play a major role in the eradication of infectious diseases, and societal needs for new drug development for viruses are increasing.

Jorch SK, Kubes P .: An emerging role for neutrophil extracellular traps in noninfectious disease. Nat Med. 2017 Mar 7; 23 (3): 279-287. Wong SL, Demers M, Martinod K, Gallant M, Wang Y, Goldfine AB, Kahn CR, Wagner DD .: Diabetes primes neutrophils to undergo NETosis, which impairs wound healing. Nat Med. 2015 Jul; 21 (7): 815- 9. Huang H, Tohme S, Al-Khafaji AB, Tai S, Loughran P, Chen L, Wang S, Kim J, Billiar T, Wang Y, Tsung A .: Damage-associated molecular pattern-activated neutrophil extracellular trap exacerbates sterile inflammatory liver injury Hepatology. 2015 Aug; 62 (2): 600-14. Schauer C, Janko C, Munoz LE, Zhao Y, Kienhoefer D, Frey B, Lell M, Manger B, Rech J, Naschberger E, Holmdahl R, Krenn V, Harrer T, Jeremic I, Bilyy R, Schett G, Hoffmann M , Herrmann M .: Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Nat Med. 2014 May; 20 (5): 511-7. Saitoh T, Komano J, Saitoh Y, Misawa T, Takahama M, Kozaki T, Uehata T, Iwasaki H, Omori H, Yamaoka S, Yamamoto N, Akira S .: Neutrophil extracellular traps mediate a host defense response to human immunodeficiency virus- 1. Cell Host Microbe. 2012 Jul 19; 12 (1): 109-16. Brinkmann V, Reichard U, Goosmann C, Fauler B, Uhlemann Y, Weiss DS, Weinrauch Y, Zychlinsky A .: Neutrophil extracellular traps kill bacteria. Science. 2004 Mar 5; 303 (5663): 1532-5. Tatsuya Saitoh, Jun Komano, Yasunori Saitoh, Takuma Misawa, Michihiro Takahama, Tatsuya Kozaki, Takuya Uehata, Hidenori Iwasaki, Hiroko Omori, Shoji Yamaoka, Naoki Yamamoto, Shizuo Akira: Neutrophil Extracellular Traps Mediate a Host Defense Response to Human Immunodeficiency Virus-1 Cell Host Microbe, 2012; 19; 12 (1): 109-16

  An object of this invention is to provide the pharmaceutical composition containing a neutrophil extracellular trap formation promoter and a neutrophil extracellular trap formation promoter.

To date, many antibiotics and antiviral drugs have been clinically applied as infectious disease therapeutic agents, but there has been little progress in the development of drugs targeting the defense mechanism of immune cells, especially neutrophils.
As a result of intensive studies, the present inventors have found that sulfasalazine (SSZ), sulfanilamide, and 4,4′-diaminodiphenylsulfone (DDS) are responsible for NET formation, ie, neutrophil extracellular trap, both in vitro and in vivo. Found to promote formation. Specifically, these substances significantly promote phorbol 12-myristate 13-acetate (PMA) -induced NETosis and also favor isolated mouse and human preferences. NET formation was significantly promoted in neutrophils. Similarly, these substances also reduced the number of neutrophils activated under inflammatory conditions by inducing NETosis in vivo. Furthermore, the present inventors thought that promotion of NET formation was promoted by peroxidation of phospholipid.
As described above, sulfanilamide and 4,4′-diaminodiphenylsulfone (DDS) have been conventionally used for the treatment of infectious diseases, but control these by inhibiting fungal and protozoan folate synthesis. Met. On the other hand, sulfasalazine (SSZ) has been generally used as a therapeutic agent for inflammatory bowel diseases (ulcerative colitis, Crohn's disease, etc.) and rheumatoid arthritis. Sulfasalazine (SSZ), sulfanilamide, and 4,4′-diaminodiphenylsulfone (DDS) have not been previously known to promote NET formation and were first discovered by the present inventors. is there.
As described above, the present inventors enhance the neutrophil defense mechanism by promoting NET formation with sulfasalazine (SSZ), sulfanilamide and 4,4′-diaminodiphenylsulfone (DDS). And discovered the possibility that these substances can be applied as novel infectious disease therapeutic agents for various infectious diseases.

The present invention is based on the above findings, namely:
(1) A neutrophil extracellular trap formation promoter comprising at least one selected from the group consisting of sulfasalazine, 4,4′-diaminodiphenylsulfone, sulfanilamide, and pharmaceutically acceptable salts thereof;
(2) The neutrophil extracellular trap according to claim 1, comprising one selected from the group consisting of sulfasalazine, 4,4'-diaminodiphenylsulfone, sulfanilamide, and pharmaceutically acceptable salts thereof. Formation promoter;
(3) A pharmaceutical composition comprising the neutrophil extracellular trap formation promoter according to (1) or (2) above;
(4) The pharmaceutical composition according to (3) above, which is a pharmaceutical composition for treating infectious diseases;
(5) The pharmaceutical composition according to (4), wherein the infectious disease is an infectious disease caused by fungi, bacteria, protozoa and viruses;
(6) The pharmaceutical composition according to (4) or (5), wherein the infectious disease is an infectious disease caused by a virus;
(7) It relates to a pharmaceutical composition for treating infectious diseases, comprising sulfasalazine or a pharmaceutically acceptable salt thereof.

  ADVANTAGE OF THE INVENTION According to this invention, the pharmaceutical composition for the treatment of infectious disease containing the novel neutrophil extracellular trap formation promoter and the said neutrophil extracellular trap formation promoter can be provided.

FIG. 1 shows a schematic diagram of NET formation by activated neutrophils. Activated neutrophils release their own chromatin in a reticulated manner and capture and remove bacteria and viruses. Figures 2 (a)-(j) show that SSZ accelerates cell death of activated neutrophils by NETosis. FIG. 2 (a) shows data when mouse neutrophils were stimulated for 3.5 hours with various concentrations of PMA alone (middle panel) and SSZ and 1 μM PMA (right panel). Cells were stained with cytox green. The percentage of dead cells was determined by counting the number of cytox green positive cells using IN Cell Analyzer 2000. Average of three samples in one test and s. d. Indicates. ^* Compared with P <0.01, one-way ANOVA, PMA (-) and SSZ (-). Data are representative of two independent experiments. FIG. 2 (b) shows a morphological analysis of SSZ-treated activated neutrophils. Cells were incubated with 1 μM PMA, 1 mM SSZ, or 1 μM PMA + 1 mM SSZ for 3.5 hours. Cells were stained with Cytox Green and Hoechest 33342 and visualized using a fluorescent microscope (original size, x20). The data shown is representative of two independent experiments. FIGS. 2 (c) and 2 (d) show increased histone H3 citrullination in SSZ-treated activated neutrophils. Mouse neutrophils were stimulated with various concentrations of PMA and / or SSZ for 4 hours. Cells were fixed and stained with anti-citH3 polyclonal antibody (Abcam) for DNA (DAPI). In FIG.2 (c), the ratio of the NET-formed cell was determined by measuring the number of citH3 positive cells using Imaga-J software. In one test, the average of three samples and the s. d. Indicates. ^* Compared with P <0.01, one-way ANOVA, PMA (-) and SSZ (-). Data are representative of two independent experiments. In FIG. 2 (d), NET formation was visualized on a fluorescence microscope table. Full size, x20. Data are representative of two independent experiments. FIG. 2 (e) shows the effect of the PAD4 inhibitor, GSK484, on SSZ-induced NET formation. Mouse neutrophils were stimulated with 1 μM or 1 μM PMA + 1 mM SSZ for 4 hours in the presence or absence of 20 μM. NET formation was visualized as described in FIG. 2 (d). Full size, x20. Data are representative of two independent experiments. FIG. 2 (f) shows data when mouse neutrophils were stimulated for 4 hours with various concentrations of ionomycin alone (left) or 5 μM ionomycin + SSZ (right). The percentage of NET-formed cells was determined by anti-cith3 polyclonal antibody as described in FIG. 2 (i). Average of three samples in one test and s. d. Is shown. ^* Compared with P <0.01, one-way ANOVA, 5 μM ionomycin. Data are representative of two independent experiments. FIG. 2 (g) shows data when mouse neutrophils were stimulated with 5 μM ionomycin alone or 5 μM ionomycin + SSZ for 4 hours. NET formation was visualized with anti-citH3 polyclonal antibody as described in FIG. 2 (d). Full size, x20. Data are representative of two independent experiments. FIG. 2 (h) shows data obtained when human peripheral neutrophils were stimulated with various concentrations of PMA or / and SSZ for 2.5 hours. Cells were stained with cytox green. The percentage of dead cells was determined by counting the number of cytox green positive cells using Image-J software. Average of three samples in one test and s. d. Is shown. ^* P <0.01, NS: no significant difference. one-way ANOVA. Compare with PMA (-) (left) or 0.8 nM PMA (right). Data are representative of two independent experiments. FIG. 2 (i) shows morphological analysis of SSZ-treated human activated neutrophils. Human neutrophils were stimulated with 0.8 nM PMA or / and 1 mM SSZ for 2.5 hours. Cells were stained with cytox green and Hoechest 33342 and visualized using a fluorescence microscope. FIG. 2 (j) shows data when human neutrophils were stimulated with 0.8 nM PMA alone or 0.8 nM PMA + 1 mM SSZ for 2.5 hours. NET formation was visualized for DNA (DAPI) by staining with anti-citH3 monoclonal antibody (clone 11-11B-4F). FIG. 2 (i) and FIG. Data are representative of two independent experiments. FIGS. 3 (a)-(d) show that SSZ induces neutrophil death in vivo. FIG. 3 (a) shows data when 16 mg SSZ or PBS was injected intraperitoneally into wild type mice. After 4 or 24 hours, the absolute number of CD45.2 ⁺ Ly-6C ^- Ly-6G ⁺ neutrophils was determined by counting the cells on a microscope and analyzing using flow cytometry. Average of 3 mice and s. d. Indicates. The average cell numbers in PBS- and SSZ-injected mice at different time points were compared. NS indicates that there is no significant difference between the two groups (two-way ANOVA). Data are representative of two independent experiments. FIGS. 3 (b)-(d) show data when 1 mg zymosan and 16 mg SSZ or PBS were administered intraperitoneally to wild type mice. After 4 hours, peritoneal cells were collected. FIG. 3 (d) counted the total cell number (left) and CD45.2 ⁺ Ly-6C ^- Ly-6G ⁺ neutrophil count (right) as described in FIG. 3 (a). In FIG. 3 (c), peritoneal cells were stained with 7-AAD, and the ratio of the number of dead cells (7-AAD ⁺ cells) was determined using flow cytometry. Values are the mean and s. Of mice (6 (SSZ (−)) and 7 (SSZ +)) per group (b, c). d. Indicates. ^* P <0.005, ^** P <0.001, Student's t-test. In FIG. 3 (d), peritoneal cells were visualized with an anti-citH3 polyclonal antibody as described above. Full size, x20. Data are representative of two independent experiments. FIG. 3 (b)-(d) shows data when 1 mg zymosan and 16 mg SSZ or PBS were intraperitoneally administered to wild type mice. After 4 hours, peritoneal cells were collected. FIG. 3 (d) counted the total cell number (left) and CD45.2 + Ly-6C-Ly-6G + neutrophil count (right) as described in FIG. 3 (a). In FIG. 3 (c), peritoneal cells were stained with 7-AAD, and the percentage of dead cells (7-AAD + cells) was determined using flow cytometry. Values are the mean and s. Of mice (6 (SSZ (−)) and 7 (SSZ +)) per group (b, c). d. Indicates. * P <0.005, ** P <0.001, Student's t-test. In FIG. 3 (d), peritoneal cells were visualized with an anti-citH3 polyclonal antibody as described above. Full size, x20. Data are representative of two independent experiments. FIG. 3 (b)-(d) shows data when 1 mg zymosan and 16 mg SSZ or PBS were intraperitoneally administered to wild type mice. After 4 hours, peritoneal cells were collected. FIG. 3 (d) counted the total cell number (left) and CD45.2 + Ly-6C-Ly-6G + neutrophil count (right) as described in FIG. 3 (a). In FIG. 3 (c), peritoneal cells were stained with 7-AAD, and the percentage of dead cells (7-AAD + cells) was determined using flow cytometry. Values are the mean and s. Of mice (6 (SSZ (−)) and 7 (SSZ +)) per group (b, c). d. Indicates. * P <0.005, ** P <0.001, Student's t-test. In FIG. 3 (d), peritoneal cells were visualized with an anti-citH3 polyclonal antibody as described above. Full size, x20. Data are representative of two independent experiments. Figures 4 (a)-(f) show that SSZ does not enhance ROS production in activated neutrophils. 4 (a) and 4 (b) show the effect of DPI, an NADPH oxidase inhibitor, on NET formation. Mouse neutrophils were stimulated with PMA in the presence or absence of 1 mM SSZ and 40 μM DPI for 3.5 hours (FIG. 4 (a)) or 4 hours (FIG. 4 (b)). In FIG. 4 (a), the proportion of NET-formed cells using cytox green was determined. Average of three samples in one test and s. d. Indicates. ^* P <0.05, ^** P <0.01, one-way ANOVA. Data are representative of two independent experiments. In FIG. 4 (b), NET formation was visualized for DNA (DAPI) by staining with anti-citH3 polyclonal antibody. Full size, x20. Data are representative of two independent experiments. 4 (c)-(f) show the effect of SSZ on ROS production. Mouse neutrophils were preincubated with the ROS indicator DCFH-DA for 5 minutes and then various concentrations of PMA and / or SSZ ((c) and (d)), or ionomycin and / or SSA ( (E) and (f)) were stimulated for 15 minutes. In FIGS. 4 (c) and (e), POS production was analyzed by flow cytometry. In FIGS. 4 (d) and (f), ROS generation was quantified using mean fluorescence intensity (MFI). In one test, the average of three samples and the s. d. Indicates. ^* Compared with P <0.01, one-way ANOVA, 1 μM PMA (d) and 5 μM ionomycin (f). Data are representative of 3 independent experiments. 4 (c)-(f) show the effect of SSZ on ROS production. Mouse neutrophils were preincubated with the ROS indicator DCFH-DA for 5 minutes and then various concentrations of PMA and / or SSZ ((c) and (d)), or ionomycin and / or SSA ( (E) and (f)) were stimulated for 15 minutes. In FIGS. 4 (c) and (e), POS production was analyzed by flow cytometry. In FIGS. 4 (d) and (f), ROS generation was quantified using mean fluorescence intensity (MFI). In one test, the average of three samples and the s. d. Indicates. * P <0.01, compared to one-way ANOVA, 1 μM PMA (d) and 5 μM ionomycin (f). Data are representative of 3 independent experiments. 4 (c)-(f) show the effect of SSZ on ROS production. Mouse neutrophils were preincubated with the ROS indicator DCFH-DA for 5 minutes and then various concentrations of PMA and / or SSZ ((c) and (d)), or ionomycin and / or SSA ( (E) and (f)) were stimulated for 15 minutes. In FIGS. 4 (c) and (e), POS production was analyzed by flow cytometry. In FIGS. 4 (d) and (f), ROS generation was quantified using mean fluorescence intensity (MFI). In one test, the average of three samples and the s. d. Indicates. * P <0.01, compared to one-way ANOVA, 1 μM PMA (d) and 5 μM ionomycin (f). Data are representative of 3 independent experiments. 4 (c)-(f) show the effect of SSZ on ROS production. Mouse neutrophils were preincubated with the ROS indicator DCFH-DA for 5 minutes and then various concentrations of PMA and / or SSZ ((c) and (d)), or ionomycin and / or SSA ( (E) and (f)) were stimulated for 15 minutes. In FIGS. 4 (c) and (e), POS production was analyzed by flow cytometry. In FIGS. 4 (d) and (f), ROS generation was quantified using mean fluorescence intensity (MFI). In one test, the average of three samples and the s. d. Indicates. * P <0.01, compared to one-way ANOVA, 1 μM PMA (d) and 5 μM ionomycin (f). Data are representative of 3 independent experiments. FIGS. 5 (a)-(m) show that lipid peroxidation is essential for SSZ-induced NETosis. FIGS. 5 (a)-(d) show that mouse neutrophils are treated with various concentrations of PMA ((a) and (b)) or ionomycin ((c) and (d)) in the presence of 1 mM SSZ or Data are shown when stimulated in the absence and then C11-Bodypy ^581/591 was added. In FIGS. 5 (a) and (c), accumulation of lipid oxidation was analyzed using flow cytometry. 5B and 5D show the average fluorescence intensity (MFI) of C11-Bodypy analysis and the average fluorescence intensity (MFI) of C11-Bodypy analysis of three samples. ^* Compared with P <0.01, one-way ANOVA, 1 μM PMA (b) or 5 μM ionomycin (d). Data are representative of 3 independent experiments. FIGS. 5 (a)-(d) show that mouse neutrophils are treated with various concentrations of PMA ((a) and (b)) or ionomycin ((c) and (d)) in the presence of 1 mM SSZ or Data are shown when stimulated in the absence and then C11-Bodypy581 / 591 was added. In FIGS. 5 (a) and (c), accumulation of lipid oxidation was analyzed using flow cytometry. 5B and 5D show the average fluorescence intensity (MFI) of C11-Bodypy analysis and the average fluorescence intensity (MFI) of C11-Bodypy analysis of three samples. * P <0.01, compared to one-way ANOVA, 1 μM PMA (b) or 5 μM ionomycin (d). Data are representative of 3 independent experiments. FIGS. 5 (a)-(d) show that mouse neutrophils are treated with various concentrations of PMA ((a) and (b)) or ionomycin ((c) and (d)) in the presence of 1 mM SSZ or Data are shown when stimulated in the absence and then C11-Bodypy581 / 591 was added. In FIGS. 5 (a) and (c), accumulation of lipid oxidation was analyzed using flow cytometry. 5B and 5D show the average fluorescence intensity (MFI) of C11-Bodypy analysis and the average fluorescence intensity (MFI) of C11-Bodypy analysis of three samples. * P <0.01, compared to one-way ANOVA, 1 μM PMA (b) or 5 μM ionomycin (d). Data are representative of 3 independent experiments. FIGS. 5 (a)-(d) show that mouse neutrophils are treated with various concentrations of PMA ((a) and (b)) or ionomycin ((c) and (d)) in the presence of 1 mM SSZ or Data are shown when stimulated in the absence and then C11-Bodypy581 / 591 was added. In FIGS. 5 (a) and (c), accumulation of lipid oxidation was analyzed using flow cytometry. 5B and 5D show the average fluorescence intensity (MFI) of C11-Bodypy analysis and the average fluorescence intensity (MFI) of C11-Bodypy analysis of three samples. * P <0.01, compared to one-way ANOVA, 1 μM PMA (b) or 5 μM ionomycin (d). Data are representative of 3 independent experiments. FIGS. 5 (e) and (f) show that mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ for 1 hour in the presence or absence of antioxidants (400 μM Trolox or 200 μM 2-ME). Shows the data when The accumulation of lipid oxidation was measured as described above. FIG. 5 (f) shows the s. d. Together with the mean fluorescence intensity (MFI). ^* P <0.01, NS: no significant difference. one-way ANOVA. Data are representative of 3 independent experiments. FIGS. 5 (e) and (f) show that mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ for 1 hour in the presence or absence of antioxidants (400 μM Trolox or 200 μM 2-ME) Shows the data when The accumulation of lipid oxidation was measured as described above. FIG. 5 (f) shows the s. d. Together with the mean fluorescence intensity (MFI). * P <0.01, NS: no significant difference. one-way ANOVA. Data are representative of 3 independent experiments. Figures 5 (g) and (h) show the effect of antioxidants on SSZ-induced NET formation. Mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ in the presence or absence of various concentrations of Trolox and 2-ME. In FIG. 5 (g), the cells were stained with cytox green. The percentage of dead cells was determined by counting the number of cytox green positive cells using IN Cell Analyzer 2000. Average of three samples in one test and s. d. Indicates. ^* Compared with P <0.01, one-way ANOVA, 1 μM PMA + 1 mM SSZ. Data are representative of 3 independent experiments. In FIG. 5 (h), NET formation was visualized by staining with DAPI and the antibody citH3 antibody. Full size, x20. Data are representative of two independent experiments. Figures 5 (g) and (h) show the effect of antioxidants on SSZ-induced NET formation. Mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ in the presence or absence of various concentrations of Trolox and 2-ME. In FIG. 5 (g), the cells were stained with cytox green. The percentage of dead cells was determined by counting the number of cytox green positive cells using IN Cell Analyzer 2000. Average of three samples in one test and s. d. Indicates. * P <0.01, compared to one-way ANOVA, 1 μM PMA + 1 mM SSZ. Data are representative of 3 independent experiments. In FIG. 5 (h), NET formation was visualized by staining with DAPI and the antibody citH3 antibody. Full size, x20. Data are representative of two independent experiments. Figures 5 (i) and (j) show that Trolox inhibits SSZ-induced citrullination of histone H3 in the footpad. SSZ alone or SSZ + Trolox was injected into the footpads of wild type mice. In FIG. 5 (i), the footpads were excised 48 hours later and stained with Ly-6G Ab, DAPI and anti-citH3 polyclonal antibody (Abcam). Full size, x20. In FIG. 5 (j), the swelling of the toes was measured for a specified time. Average of 3 mice and s. d. Indicates. ^* P <0.001, NS: no significant difference. Compare with mice injected with one-way ANOVA, SSZ. In FIGS. 5 (k)-(m), human neutrophils were stimulated with 0.8 μM PMA + 1 mM SSZ with or without 400 μM Trolox for 2 hours. In FIG. 5 (k), the cells were stained with cytox green and Hoechst 33342. The percentage of photoreceptors was determined by counting the number of cytox green positive cells using Image J software. Average of three samples in one test and s. d. Indicates. ^* P <0.05, Student's t-test. In FIG. 5 (l), NET formation was visualized by staining with cytox green and hoechst 33342. In FIG. 5 (m), NET formation was visualized by staining with DAPI and anti-citH3 antibody (clone 11-11B-4F). In FIGS. 5 (l) and (m), full scale, x20, data are representative of 3 independent experiments. In FIGS. 5 (k)-(m), human neutrophils were stimulated with 0.8 μM PMA + 1 mM SSZ with or without 400 μM Trolox for 2 hours. In FIG. 5 (k), the cells were stained with cytox green and Hoechst 33342. The percentage of photoreceptors was determined by counting the number of cytox green positive cells using Image J software. Average of three samples in one test and s. d. Indicates. * P <0.05, Student's t-test. In FIG. 5 (l), NET formation was visualized by staining with cytox green and hoechst 33342. In FIG. 5 (m), NET formation was visualized by staining with DAPI and anti-citH3 antibody (clone 11-11B-4F). In FIGS. 5 (l) and (m), full scale, x20, data are representative of 3 independent experiments. In FIGS. 5 (k)-(m), human neutrophils were stimulated with 0.8 μM PMA + 1 mM SSZ with or without 400 μM Trolox for 2 hours. In FIG. 5 (k), the cells were stained with cytox green and Hoechst 33342. The percentage of photoreceptors was determined by counting the number of cytox green positive cells using Image J software. Average of three samples in one test and s. d. Indicates. * P <0.05, Student's t-test. In FIG. 5 (l), NET formation was visualized by staining with cytox green and hoechst 33342. In FIG. 5 (m), NET formation was visualized by staining with DAPI and anti-citH3 antibody (clone 11-11B-4F). In FIGS. 5 (l) and (m), full scale, x20, data are representative of 3 independent experiments. Figures 6 (a)-(h) show that SSZ promotes NETosis by a mechanism different from that of ferrotosis. FIG. 6 (a) shows xCT mRNA expression in PMA-stimulated mouse bone marrow neutrophils. Cells were stimulated with 1 μM PMA for 1 hour, 2 hours or 3 hours. Total RNA was prepared from these cells and the expression level of xCT mRNA was determined using qPCR. Expression levels were calculated as relative amounts and normalized at the level of 18s ribosomal RNA. Results are expressed as fold induction compared to the expression observed in naive neutrophils. Average of three samples in one test and s. d. Indicates. ^* P <0.01, NS: no significant difference. two-way ANOVA. Data are representative of two independent experiments. FIG. 6 (b) shows xCT mRNA expression in vivo in mouse peritoneal neutrophils. 1 mg zymozan was administered intraperitoneally to wild type mice. After 4 hours, peritoneal cells were collected. Total RNA was prepared and xCT mRNA expression levels were determined as described above using qPCT. Average of 3 mice and s. d. Indicates. * P <0.05, Student's t-test. FIGS. 6 (c) and (d) show that elastin does not induce NET formation. Mouse neutrophils were stimulated with 1 μM PMA in the presence or absence of various concentrations of elastin. The percentage of NET formed cells was determined by counting the number of citH3 positives ((c)) and visualized by staining with DAPI and citH3 ((d)). Average of 3 samples and s. d. Is shown (c). Full size, x20 (d). Data are representative of 3 independent experiments. FIGS. 6 (c) and (d) show that elastin does not induce NET formation. Mouse neutrophils were stimulated with 1 μM PMA in the presence or absence of various concentrations of elastin. The percentage of NET formed cells was determined by counting the number of citH3 positives ((c)) and visualized by staining with DAPI and citH3 ((d)). Average of 3 samples and s. d. Is shown (c). Full size, x20 (d). Data are representative of 3 independent experiments. In FIGS. 6 (e) and (f), NET formation was observed in xCT mutant neutrophils. Bone marrow neutrophils obtained from xCTmu ^{/ wt} or xCTmu ^{/ mu} mice were stimulated by PMA in the presence or absence of SSZ. The frequency of NET formed cells was determined by counting the number of cytox green positives ((e)) or by counting the number of citH3 positive cells ((f)). Average of three samples in one test and s. d. Is shown. ^* P <0.01, NS: no significant difference. two-way ANOVA. Data are representative of two ((e)) or three ((f)) independent experiments. In FIGS. 6 (e) and (f), NET formation was observed in xCT mutant neutrophils. Bone marrow neutrophils obtained from xCTmu / wt or xCTmu / mu mice were stimulated by PMA in the presence or absence of SSZ. The frequency of NET formed cells was determined by counting the number of cytox green positives ((e)) or by counting the number of citH3 positive cells ((f)). Average of three samples in one test and s. d. Is shown. * P <0.01, NS: no significant difference. two-way ANOVA. Data are representative of two ((e)) or three ((f)) independent experiments. In FIG. 6 (g), NIH3T3 cells are cultured in the presence or absence of ferrotosis inhibitors (deferoxamine and ferrostatin-1), necrotosis inhibitor (necrostatin-1) or apoptosis inhibitor (z-VAD-fmk), Treated with elastin, SSZ or tBHP. Cell viability was assessed using the WST-8 assay according to the manufacturer's protocol. Average of three samples in one test and s. d. Is shown. ^* P <0.01, NS: no significant difference. one-way ANOVA. Comparison with inhibitor (-). Data are representative of two independent experiments. In FIG. 6 (h), mouse neutrophils were treated with PMA and SSZ in the presence or absence of ferrotosis inhibitor, necrotosis inhibitor or apoptosis inhibitor. NET formation was evaluated as shown in (e). Average of three samples in one test and s. d. Is shown. NS: no significant difference, one-way ANOVA, comparison with inhibitor (-). Data are representative of two independent experiments. Figures 7 (a)-(h) show structure-activity relationships in the NET-induced compound ring. FIG. 7 (a) shows the structures of SSZ, 5-aminosalicylic acid (5-ASA) and sulfapyridine. Figures 7 (b) and (c) show that sulfapyridine but not 5-ASA induces NETosis. Mouse bone marrow neutrophils were stimulated with various concentrations of sulfapyridine or 5-ASA for 3.5 hours ((b)) or 4 hours ((c)) in the presence of 1 μM PMA. The percentage of NET formed cells was determined by counting the number of cytox green positive cells ((b)), and NET formation was visualized by staining with DAPI and anti-citH3 Ab ((c)). In FIG. 7 (b), the average value of three samples and s. d. Is shown. ^* P <0.01, comparison with one-way ANOVA, PMA. In FIG. 7 (c), full scale, x20, data are representative of two independent experiments. Figures 7 (b) and (c) show that sulfapyridine but not 5-ASA induces NETosis. Mouse bone marrow neutrophils were stimulated with various concentrations of sulfapyridine or 5-ASA for 3.5 hours ((b)) or 4 hours ((c)) in the presence of 1 μM PMA. The percentage of NET formed cells was determined by counting the number of cytox green positive cells ((b)), and NET formation was visualized by staining with DAPI and anti-citH3 Ab ((c)). In FIG. 7 (b), the average value of three samples and s. d. Is shown. * P <0.01, comparison with one-way ANOVA, PMA. In FIG. 7 (c), full scale, x20, data are representative of two independent experiments. 7 (d)-(f) show that 5-ASA inhibited SSZ-induced NETosis. Mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ in the presence or absence of various 5-ASA. NET formation was evaluated using cytox green ((d)) or anti-citH3 Ab ((e), (f)). 7 (d) and (e), the average value of three samples and s. d. Is shown. ^* P <0.01, NS: no significant difference. one-way ANOVA. Comparison of PMA + SSZ. In FIG. 7 (f), full scale, × 20, data are representative of two independent experiments. 7 (d)-(f) show that 5-ASA inhibited SSZ-induced NETosis. Mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ in the presence or absence of various 5-ASA. NET formation was evaluated using cytox green ((d)) or anti-citH3 Ab ((e), (f)). 7 (d) and (e), the average value of three samples and s. d. Is shown. * P <0.01, NS: no significant difference. one-way ANOVA. Comparison of PMA + SSZ. In FIG. 7 (f), full scale, × 20, data are representative of two independent experiments. 7 (d)-(f) show that 5-ASA inhibited SSZ-induced NETosis. Mouse neutrophils were stimulated with 1 μM PMA alone, 1 μM PMA + 1 mM SSZ in the presence or absence of various 5-ASA. NET formation was evaluated using cytox green ((d)) or anti-citH3 Ab ((e), (f)). 7 (d) and (e), the average value of three samples and s. d. Is shown. * P <0.01, NS: no significant difference. one-way ANOVA. Comparison of PMA + SSZ. In FIG. 7 (f), full scale, × 20, data are representative of two independent experiments. In FIG. 7 (g), mouse neutrophils were stimulated for 3.5 hours in the presence of various concentrations of sulfanilamide and DDS. The percentage of NET-formed cells was measured using cytox green. Average of three samples in one test and s. d. Is shown. Data are representative of two independent experiments. In FIG. 7 (h), mouse neutrophils were stimulated with 1 μM PMA for 1 hour in the presence of 1 mM sulfanilamide, 100 μM DDS, and then C11-Bodypy ^581/591 was added to analyze lipid oxidation accumulation. Data are representative of two independent experiments. In FIGS. 8 (a) and (b), mouse neutrophils were incubated for 4 hours in the presence or absence of various concentrations of SSZ. FIG. 8 (a) shows a flow cytometric analysis of cell death of SSZ-treated neutrophils. Dead cells were detected by flow cytometry using double labeling with 7-AAD and Annexin V. The number of plots indicates the frequency of 7-AAD and annexin V positive cells. In FIG. 8 (b), the percentage of dead cells was quantified using the sum of the percentage of 7-AAD and / or annexin V positive cells 4 hours after SSZ treatment. In one experiment, the average of three wells and s. d. Indicates. Data are representative of two independent experiments. FIG. 8 (c) shows data when mouse neutrophils were treated with various concentrations of SSZ alone for 4 hours. Cells were stained with cytox green. The percentage of dead cells was determined by counting the number of cytox green positive cells using IN Cell Analyzer 2000. Average of three samples in one test and s. d. Indicates. FIG. 9 shows that SSZ and elastin induce cell death in NIH3T3 cells. NIH3T3 cells were treated with various concentrations of SSZ or elastin. Cell viability was assessed using Cell Counting kit-8 according to the manufacturer's protocol. Average of three samples in one test and s. d. Indicates. Data are representative of 3 independent experiments.

Hereinafter, the present invention will be described in more detail.
The present invention relates to a neutrophil extracellular trap formation promoter (hereinafter also referred to as “NET formation promoter”) and a pharmaceutical composition for treating infectious diseases.

A first aspect of the present invention is a NET formation accelerator, and the NET formation accelerator is sulfasalazine (hereinafter also referred to as “SSZ”), 4,4′-diaminodiphenyl sulfone (hereinafter also referred to as “DDS”). At least one selected from the group consisting of sulfanilamides and pharmaceutically acceptable salts thereof. The NET formation promoter of the present invention preferably comprises one selected from the group consisting of sulfasalazine, 4,4′-diaminodiphenyl sulfone, sulfanilamide, and pharmaceutically acceptable salts thereof. That is, the NET formation promoter of the present invention may contain one of these compounds alone, or may contain a combination of two or more of these compounds.

  These compounds may be synthesized according to synthesis methods known in the art or may be commercially available.

  The inventors have found that sulfasalazine, 4,4'-diaminodiphenyl sulfone and sulfanilamide promote the formation of neutrophil extracellular traps (NET). Specifically, by adding these compounds to activated neutrophils, the present inventors compared cells with activated neutrophils (subject activated neutrophils) not added. It was found to promote the formation of outer chromatin traps.

  The above compound may be contained in the NET formation promoter in the form of a pharmaceutically acceptable salt. Such pharmaceutically acceptable salts are those formed with the above compounds and bases that form non-toxic salts. Specific examples include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as magnesium salt and calcium salt, ammonium salt and the like.

  Here, the term “NET formation promoter” means a substance that promotes the formation of neutrophil extracellular trap (NET), and specifically, it is added to activated neutrophils. This means a substance that enhances extracellular chromatin traps compared to activated neutrophils that are not added (the activated neutrophils of interest). For example, it refers to a substance that enhances NET formation by 200% relative to the subject activated neutrophils. Preferably, it means a substance that enhances NET formation by 300%, more preferably 400%, even more preferably 500%, relative to the subject's activated neutrophils.

Detection of NET formation is performed by methods known in the art. NET formation can be detected, for example, by the method described in the Examples below. Specifically, neutrophils with NET formation were fixed in HBSS supplemented with 4% paraformaldehyde for 10 minutes at room temperature and supplemented with 10% normal goat serum, bovine serum albumin and 0.01% Tween 20. Incubate for 1 hour, then incubate cells with rabbit anti-histone H3 (citrulline R2 + R8 + R17) (citH3) antibody (Abcam) followed by anti-rabbit IgG antibody conjugated with Alexa Fluor 488 (Thermo Fisher Scientific) . Then, DNA is labeled using DAPI (Dojindo), cells are observed under a fluorescence microscope (BZ-X710), and the number of citH3-positive cells is measured using Image J software, thereby causing cells that cause NETosis. Can be quantified.
In addition, for example, the method described in Special Table 2010-505099, Brinkmann, V., Laube, B., Abu Abed, U., Goosmann, C., Zychlinsky, A. Neutrophil Extracellular Traps: How to Generate and Visualize Them It can also be detected according to the method described in J. Vis. Exp. (36), e1724, doi: 10.3791 / 1724 (2010).

  The second aspect of the present invention relates to a pharmaceutical composition comprising the NET formation promoter.

  The third aspect of the present invention is a pharmaceutical composition for promoting the formation of neutrophil extracellular traps, comprising sulfasalazine, 4,4′-diaminodiphenylsulfone, sulfanilamide, and pharmaceutically acceptable The pharmaceutical composition comprising at least one selected from the group consisting of salts thereof.

  The above-described pharmaceutical compositions of the second and third aspects of the present invention are preferably pharmaceutical compositions for treating infectious diseases.

  The fourth aspect of the present invention also relates to a pharmaceutical composition for treating infectious diseases comprising sulfasalazine or a pharmaceutically acceptable salt thereof.

  Hereinafter, the pharmaceutical compositions of the second aspect, the third aspect, and the fourth aspect of the present invention are collectively referred to as “the pharmaceutical composition of the present invention”.

  Here, “infection” refers to a disease caused by the invasion of pathogens such as bacteria, fungi, parasites (protozoa and helminths), and viruses into the host body. Here, examples of the host include mammals including humans, birds, reptiles, amphibians, fish and the like. Mammals include, for example, rats, mice, hamsters, monkeys and humans.

  In addition, the term “treatment” used in connection with an infectious disease includes not only treating the infectious disease but also suppressing or reducing the infectious disease.

  The pharmaceutical composition of the present invention may further contain pharmaceutically acceptable additives such as diluents, carriers, solubilizers, emulsifiers, preservatives, adjuvants, surfactants, disintegrants, lubricants and the like. . The pharmaceutical composition of the present invention can be prepared by mixing the above-mentioned compound or a pharmaceutically acceptable salt thereof with the aforementioned additive.

The administration route of the pharmaceutical composition is preferably the most effective for treatment, and may be oral administration or parenteral administration. Examples of parenteral administration include intratracheal administration, rectal administration, subcutaneous administration, intramuscular administration, intravenous administration, nasal administration, and intraperitoneal administration.
Examples of the dosage form of the pharmaceutical composition include known dosage forms in the art such as tablets, capsules, syrups, powders, granules and the like.

  According to the present invention, it is possible to promote NET formation in activated neutrophils by infectious diseases and enhance the infection defense mechanism in the host. From this, it is anticipated that the NTE formation promoter of this invention and the pharmaceutical composition containing the said promoter will provide the new treatment method with respect to an infectious disease.

  EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to these examples.

Peripheral blood C57BL / 6J mice derived from animals and human donors were purchased from CLEA JAPAN. xCTmu / mu mice (C57BL / 6 background) were previously created in our laboratory (Reference 1). All experiments using mice were approved by Tokyo Pharmaceutical University and the Animal Experiment Committee (L16-14) and were performed in accordance with applicable guidelines and rules. The use of peripheral blood from healthy human donors has been approved by the Human Ethics Committee (15-21).

Reagents The reagents used were purchased from the following manufacturers.
Deferoxamine, ferrostatin-1, erastin, sulfasalazine (SSZ), zymosan, diphenyleneiodonium chloride (DPI), 4,4'-diaminodiphenyl sulfone (DDS): Sigma.
Phorbol 12-myristate 13-acetate (PMA), sulfapyridine, 5-aminosalicylic acid (5-ASA), sulfanilamide: Wako Pure Chemical Industries, Ltd.
Necrostatin-1: FOCUS Biomolecules,
2-mercaptoethanol: MP Biomedicals,
z-VAD-fmk: Peptide institute,
Trolox: Tokyo Chemical Industry Co., Ltd.
GSK484: Cayman chemicals,
Ionomycin: Merck Millipore.

Production of monoclonal antibodies To produce anti-histone H3 (citrulline R2 + R8 + R17) antibody, human histone H3 (citrulline R2 + R8 + R17) emulsified in adjuvant (TiterMax Gold; TiterMax) on the footpads of Wistar rats (2-20: A (cit) ) RTKQTA (cit) RKSTGGKAP (cit) RKQ) derived peptide was inoculated subcutaneously. Splenocytes were fused with NSObcl2 myeloma cells (reference 2) using PEG1500 (Roche, Germany). Hybridoma cells were selected in DMEM / 10% FCS with HAT (Sigma) and 5% BM-Condimed (Roche). The hybridoma supernatant was tested by ELISA to obtain a monoclonal antibody that specifically detects human histone H3 (citrulline R2 + R8 + R17) peptide but not human non-citrullinated histone H3 peptide (11-11B-4F). The IgG fraction was purified using a protein G affinity column (GE Healthcare), and buffer exchange with PBS was performed using a PD-10 column (GE Healthcare). The antibody was biotinylated using EZ-Link Sulfo-NHS-LC-LC-Biotin (Thermo Fisher Scientific) according to the manufacturer's recommendations. In addition, the hybridoma strain mentioned above was named 11-11B-4F in the name of 11-11B-4F in the National Institute of Technology and Evaluation (NPMD) (address: 2-5-8 122, Kazusa-Kamashita, Kisarazu City, Chiba Prefecture) in 2017. Deposited on July 20th and given receipt number NITE ABP-02515.

Isolation of mouse and human neutrophils To obtain mouse neutrophils, bone marrow cells were isolated from the femur and tibia of C57BL / 6J WT, mutant mice. Bone marrow cells were incubated with an Fc blocker (2.4G2; Biolegend) and stained with biotinylated anti-Ly-6G (RB6-8C5; Biolegend) antibody. They were then incubated with anti-biotin-microbeads (Miltenyi Biotech). Ly-6 Ghigh cells were concentrated using magnetic sorting. The purity of the isolated neutrophils was 95% or higher when evaluated using flow cytometry (FACSverse; BD).
To obtain human neutrophils, peripheral blood was collected from healthy adult volunteers using heparin. Red blood cells were removed using the HetaSep ™ (STEMCELL Technologies) sedimentation method according to the manufacturer's protocol. Cells were then washed twice with RPMI 1640 medium and fractionated on a discontinuous Percoll PLUS (GE-Healthcare) gradient consisting of layers with a density of 75%, 65%, and 55%. After centrifuging the mixture at 120 × g for 10 minutes, the 65% and 75% layer interface was collected and washed twice with RPMI 1640 medium. All procedures were performed at room temperature. This preparation contained more than 95% CD15 + CD16 + Siglec-8-neutrophils by flow cytometric analysis. According to the trypan blue exclusion assay, cell viability was> 98%.

Cells and cell culture NIH3T3 fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM, WAKO) supplemented with 10% fetal bovine serum (GIBCO) and 1% penicillin-streptomycin at 37 ° C., 5% CO ₂ , 95% humidity. Maintained at.

In Vitro Cell Death Assay To detect SSZ-induced apoptosis and necrosis in isolated neutrophils, 1.4 × 10 ⁴ mouse neutrophils were incubated with SSZ. After 4 or 12 hours, cells were stained with FITC-Annexin V and 7-AAD (Biolegend). Subsequently, flow cytometry analysis was performed using BD FACSverse.
To assess NETosis of isolated mouse or human neutrophils, 4 × 10 ⁵ neutrophils were seeded in 35 mm poly-L-lysine coated glass bottom dishes (MATSUNAMI) and PMA and / or Stimulated with SSZ for 2 or 3 hours. Sytox green (0.5 μM, Thermo Fisher Scientific) and / or Hoest 33342 (1 μg / ml, Thermo Fisher Scientific) was then added to the cells. After 30 minutes, the frequency of NETosis was measured by counting the number of cytox green positive cells using IN Cell Analyzer 2000 (GE Healthcare) or Image-J software (NIH), and fluorescence microscopy (BZ- X710, Keyence) was used for morphological analysis.
To detect citrullination of histone H3 in mouse neutrophils, 4 × 10 ⁵ cells were seeded in 35 mm poly-L-lysine coated glass bottom dishes (MATSUNAMI) and stimulated with PMA, ionomycin and / or SSZ for 4 hours. did. Cells were then fixed with 4% paraformaldehyde for 10 minutes at room temperature and 1 for blocking in HBSS supplemented with 10% normal goat serum (Sigma), bovine serum albumin (Sigma) and 0.01% Tween 20. Incubated for hours. The cells were then incubated with rabbit anti-histone H3 (citrulline R2 + R8 + R17) (citH3) antibody (Abcam) and then incubated with anti-rabbit IgG antibody conjugated with Alexa Fluor 488 (Thermo Fisher Scientific). DNA was labeled with DAPI (Dojindo). We observed the cells under a fluorescence microscope (BZ-X710) and quantified the frequency of cells causing NETosis by measuring the number of citH3-positive cells using Image J software.
To detect the amount of histone H3 citrullination in human neutrophils, 4 × 10 ⁵ cells were seeded in 35 mm poly-L-lysine coated glass bottom dishes (MATSUNAMI) and stimulated with PMA for 2.5 hours. . Cells were fixed, blocked and then incubated with biotinylated anti-citH3 Ab (11-11B-4F) followed by streptavidin conjugated with Cy3 (Jackson lab). The frequency of cells undergoing NETosis was quantified as described above.
To assess the viability of NIH3T3 cells, tBHP, elastin or SSZ in the presence of a ferroptosis inhibitor (eg, deferoxamine or ferrostatin-1), necrotosis inhibitor (necrostatin-1) or apoptosis inhibitor (z) (Z-VAD-fmk). After 12 hours, cell viability was measured using Cell Counting kit-8 (DOJINDO) according to the manufacturer's method.

Detection of neutrophil cell death in vivo To determine the number of neutrophils in the peripheral blood or peritoneal cavity, mice were injected intraperitoneally with 16 mg SSZ and / or 1 mg zymosan. Four or 24 hours later, peripheral blood cells or peritoneal cells were collected and erythrocyte lysis was performed using Pharm Lyse (BD Biosciences) to obtain leukocytes.
Leukocytes were stained with PE-conjugated anti-Ly6C, PE-Cy7-conjugated anti-CD45.2, APC-Cy7-conjugated anti-Ly6G antibody and 7-AAD. The absolute number of CD45.2 + Ly-6C-Ly-6G + neutrophils and the percentage of dead cells (7-AAD + cells) can be determined by counting the relevant cells under a microscope using a hemocytometer and on BD FACSversion. It was determined by analyzing the cell number using flow cytometry. To detect histone H3 citrullination in mouse heel neutrophils, mice were injected subcutaneously with SSZ with and without Trolox. After 48 hours, the footpads were excised, embedded in OCT compound (Sakura) and frozen in cold hexane. Slices were made using the Kawamoto film method (ref. 3) (Leica). 5 μm thick frozen sections were prepared, air-dried and fixed with 100% ethanol and 4% paraformaldehyde. The sections were then stained with an anti-rabbit IgG antibody conjugated with Alexa Fluor 488 (Thermo fisher), first with Alexa647-conjugated anti-Ly6G and with a rabbit anti-citH3 antibody (Abcam). The DNA was labeled with DAPI and the cells were observed under an oral microscope.

Detection of intracellular ROS generation and lipid oxidation To detect the occurrence of ROS in cells, 1.4 × 10 ⁴ mouse neutrophils were collected in Hank's balanced salt solution (HBSS (+)) at 37 ° C. Incubated for 15 minutes in the presence of 10 μM DCFH-DA (Invitrogen) and stimulated with PMA or ionomycin at 37 ° C. in the presence or absence of SSZ. Flow cytometry analysis was performed using BD FACSverse.
To detect lipid oxidation, 1.4 × 10 ⁴ mouse neutrophils were seeded in round bottom 96-well plates and stimulated with PMA or ionomycin in the presence of SSZ or sulfa drugs. After 60 minutes, 2 μM C11-Bodypy ^581/591 (Thermo Fisher Scientific) was added to the cells for 30 minutes. Flow cytometry analysis was performed using BD FACSverse.

Quantitative RT-PCT
Total RNA was extracted from neutrophils using the RNeasy Mini kit (QIAGEN) according to the manufacturer's instructions. Complementary DNA was synthesized using the ReverseTra Ace qPCR master kit (TOYOBO). For complementary DNA, qPCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO). The reaction was performed using a real-time PCR system (StepOne Plus, Applied Biosystems). Expression levels are normalized to 18s ribosomal RNA and are displayed as fold induction for naive controls unless otherwise noted.
xCT (SLC7a11) includes the following PCR primers:
xCT-F: 5'AGAGCATCACCATCGTCAGA3 '
xCT-R: 5'GATTCATGTCCACAAGCACAC3 '
Was used.
For 18s ribosomal RNA, the following primers:
18s ribosomal RNA-F: 5'CGGACAGGATTGACAGATTG3 '
18s ribosomal RNA-R: 5'CAAATCGCTCCACCAACTAA3 '
Was used.

Statistical analysis Paired and unpaired two-tailed Student t-test and Mann-Whitney U test were used to compare the two groups. Multiple groups were compared using one-way and two-way ANOVA. All statistical analyzes were performed using Graph Pad Prism 7 software.

<Promotion of cell death of activated neutrophils by NETosis>
Several cell death related compounds were screened for NET enhancing activity in activated mouse neutrophils. Mouse bone marrow neutrophils required PMA (5 μM or more) for NETosis and NET formation, whereas low doses of PMA (1 μM) activated neutrophils without inducing NET formation (FIG. 2a).
SSZ promoted cell death in a dose-dependent manner in neutrophils activated with 1 μM PMA. On the other hand, when mouse neutrophils were treated with 1 mM SSZ alone for 4 hours, cell death did not occur. It has been reported that 24-hour treatment of SSZ in neutrophils induces apoptosis (Reference 4). In addition, when it processed for a short time, it has shown that there is no cell-killing effect of SSZ with respect to an untreated mouse | mouth neutrophil (FIG. 8a-c).
Morphological analysis showed that dead neutrophils treated with PMA and SSZ release chromosomal DNA into the extracellular space (this is a specific feature of NET) (FIG. 2b).
NETosis is accompanied by citrullination of histone H3 (Ref. 5). Immunohistochemical analysis using anti-citrullinated histone H3 antibody did not induce citrullination with low doses of PMA alone and SSZ alone, but treatment with SSZ and low dose PMA did not induce histone H3 citrullination. The number of dead neutrophils received was increased (Fig. 2c, d). Citrullination was inhibited by the addition of GSK484, a PAD4 inhibitor that confirms that the observed cell death is due to NETosis (FIG. 2e).
We also evaluated the effect of SSZ on neutrophils activated with ionomycin, another inducer of NETosis. By immunohistochemical analysis with anti-citrullinated histone H3 antibody, ionomycin induced NETosis in a dose-dependent manner (FIG. 2f, left), and SSZ was incubated in neutrophils incubated in the presence of a low dose (5 μg) of ionomycin. It was shown that NETosis was enhanced (FIG. 2f, right and FIG. 2g). From the above, it was confirmed that SSZ accelerates NETosis in mouse neutrophils.
Next, the effect of SSZ on human neutrophils was examined. Human neutrophils responded more sensitive to PMA than mouse neutrophils. For example, a low dose of 3.2 nM PMA alone induced NETosis in human neutrophils (Figure 2h, left). On the other hand, when neutrophils were pretreated with 0.8 nM PMA, SSZ enhanced NETosis in a dose-dependent manner (FIG. 2h, right, FIG. 2i and FIG. 2j).
These results indicated that SSZ enhances NETosis in mouse and human activated neutrophils.

<Induction of neutrophil cell death in vivo via NETosis>
Next, the effect of SSZ on neutrophil cell death in vivo was examined.
When SSZ was injected intraperitoneally into naive mice, the number of neutrophils in the blood did not decrease. This suggests that SSZ has no cytocidal effect on neutrophils in a physiological environment (FIG. 3a).
Subsequently, the effect of SSZ on activated neutrophils was examined.
Immediately after zymosan was administered intraperitoneally to mice, SSZ was administered or SSZ was not administered. As shown in FIG. 3b, a considerable number of immune cells, especially neutrophils, accumulated in the peritoneal cavity 4 hours after administration of zymosan alone. On the other hand, when administered with SSZ, the number of neutrophils decreased dramatically. Furthermore, the proportion of 7-AAD positive dead cells in wet cells was dramatically higher in mice administered both zymosan and SSZ. In mice administered with zymosan and SSZ, some of the peritoneal neutrophils showed an immune response to anti-citrullinated histone H3 antibody. This indicates that neutrophils are causing NETosis in vivo (FIG. 3d). These data suggest that SSZ causes neutrophil cell death and enhanced NET formation in vivo.

<ROS production in activated neutrophils>
As explained below, SSZ was shown not to enhance ROS production in activated neutrophils.
PMA-induced NETosis requires reactive oxygen species (ROS) production (Ref. 6). To explore the mechanism by which NETosis is accelerated by SSZ, we investigated whether SSZ affects ROS production in neutrophils.
First, the influence of diphenylene iodonium (DPI), which is an NADH oxidase inhibitor, on NETosis was evaluated. As shown in FIGS. 4a and b, DPI inhibited NETosis induced by high dose PMA or a combination of low dose PMA and SSZ. These results indicate that the observed SSZ-induced NETosis acceleration requires NADH oxidase-induced ROS production. Furthermore, this result suggests that SSZ can enhance ROS production in neutrophils.
Subsequently, the amount of ROS produced using DCFH-DA was measured. PMA stimulated ROS production in a dose-dependent manner (Fig. 4c, d). However, contrary to expectation, SSZ did not enhance ROS production in neutrophils administered low doses of PMA, rather 1 mM SSZ decreased ROS production in activated neutrophils (FIG. 4c, d). These results indicate that activation of NADH oxidase is required for SSZ-induced acceleration of NETosis, and that SSZ does not increase the amount of ROS produced in activated neutrophils.
Furthermore, we investigated the effect of SSZ on ROS production in ionomycin-treated neutrophils and found that SSZ did not enhance ROS production but rather decreased under these conditions (FIGS. 4e, f).

<Relationship between accelerated lipid oxidation and SSZ-induced NETosis>
The effect of SSZ on SSZ-related responses in activated neutrophils was then evaluated. As a result, it was found that SSZ accelerated lipid oxidation in neutrophils.
Lipid oxidation was measured using C11-Bodypy ^581/591 dye. The dye exhibits a fluorescence shift from red to green when oxidized. As shown in FIGS. 5a and b, PMA increases lipid oxidation in a dose-dependent manner. Low dose (1 μM) PMA induced a slight increase in oxidized C11-Bodipy, and SSZ dramatically accelerated lipid oxidation in neutrophils pretreated with low dose PMA (FIG. 5a, b).
We also found that SSZ also increased lipid oxidation in activated neutrophils treated with low dose (5 μM) inomycin (FIGS. 5c, d). This lipid peroxidation by SSZ was not inhibited by 2-ME but was inhibited by Trolox, an analogue of vitamin E. Trolox functions as an antioxidant against lipid oxidation (Fig. 5e, f). Consistent with these results, Trolox, but not 2-ME, suppressed low-dose PMA and SSZ-induced NETosis in an effective and dose-dependent manner (FIGS. 5f, g).
Next, the inhibitory effect of Trolox on SSZ-induced NETosis in vivo was measured. In the case of subcutaneous injection, SSZ caused a local inflammatory response and Ly-6G + neutrophil accumulation (FIG. 5i). Some of the accumulated neutrophils were immunoreactive with anti-citrullinated histone H3 antibody (FIG. 5i). This indicates that they were undergoing NETosis. This acute inflammation resulted in a temporary swelling of the footpads of these mice (FIG. 5j). However, co-administration of Trolox and SSZ did not affect neutrophil accumulation, but significantly reduced the number of citrullinated histone H3-positive neutrophils (FIG. 5i). Consequently, Trolox injection significantly improved footpad swelling in these mice (FIG. 5j).
Finally, the effect of Trolox on NETosis in human neutrophils was evaluated. Similar to the results observed in mouse neutrophils, Trolox almost completely inhibited low dose PMA and SSZ-induced NETosis (FIG. 5k, l, m).
These results indicate that SSZ enhanced NETosis in activated neutrophils by accelerating lipid oxidation.

<Mechanism to enhance SSZ NETosis>
As explained below, SSZ has been shown to enhance NETosis by a mechanism different from ferrotosis.
SSZ has been reported to induce ferrotosis in cancer cells by inhibiting the function of xCT (references 7 and 8). xCT is expressed in various cells and plays an important role in maintaining intracellular glutathione levels by transporting cystine into the cell. Thus, inhibiting xCT depletes glutathione in cells, which increases cell vulnerability in response to oxidative stress. In fact, xCT transcript expression levels were increased in neutrophils stimulated in vivo by PMA (FIG. 6a) or zymosan in vivo (FIG. 6b).
According to these results, it was examined whether xCT is involved in the acceleration of SSZ-induced NETosis. In these experiments, we first examined the effect of elastin, another inducer of ferrotosis acting by inhibiting xCT, on NETosis.
As shown in FIG. 9, less than 1 μM elastin can induce cell death in NIH3T3 cells, while 200 μM SSZ was required to kill all of the cells in 12 hours. This indicates that elastin is a very potent inducer of ferrotosis in NIH3T3 cells. However, elastin failed to accelerate NETosis in mouse neutrophils treated with low doses of PMA (FIGS. 6c, d).
Next, the effect of SSZ on xCT-deficient neutrophils obtained from xCT mutant mice (Reference 1) was analyzed. In these mice, N-ethyl-N-nitrosourea (ENU) caused a loss-of-function mutation in the xCT gene. Fetal fibroblasts and bone marrow derived macrophages obtained from these mice did not survive or proliferate in vitro without 2-ME.
In neutrophils prepared from these mice, PMOS alone was used to evaluate NETosis using cytox green. As a result, it was shown that there was no difference in the efficiency of NETosis induced by PMA alone between WT and xCT mutant neutrophils (FIG. 6e).
Furthermore, activated xCT mutant neutrophils are somewhat resistant to this stimulus compared to those from WT, but SSZ accelerated NETosis in activated xCT mutant neutrophils (FIG. 6e). ).
Moreover, NETosis was evaluated by PMA + SSZ using anti-citH3 Ab, and it was found that SSZ accelerates NETosis to the same extent in activated xCT mutant neutrophils and those obtained from WT mice ( FIG. 6f). These results clearly indicate that xCT is not a target of SSZ, since xCT does not affect the acceleration of NETosis by SSZ in activated neutrophils.
Oxidized lipid development is also involved in another cell death mode, ferrotosis, which may indicate that some cell death signaling mechanisms are shared between SSZ-induced NETosis and ferrotosis Suggest sex.
Thus, by comparing the effects of several cell death inhibitors on each type of cell death, the difference between the mechanism involved in ferrotosis and the mechanism involved in SSZ-induced NETosis was examined. In NIH3T3 cells, elastin or SSZ-induced ferrotosis was effectively inhibited by deferoxamine or ferrostatin-1, whereas necrostatin-1 and z-VAD had no inhibitory effect on ferrotosis (FIG. 6g). ). Deferoxamine and ferrostatin-1 also inhibited tert-butyl hydroperoxidase (tBHP) -induced ferrotosis-like cell death in NIH3T3 cells. On the other hand, deferoxamine did not inhibit PMA + SSZ-induced NETosis (FIG. 6h). Only a high dose (2.5 μM) of ferrostatin-1 partially inhibited NETosis by mPMA + SSZ, but was not as effective as in the case of ferroosis in NIH3T3 cells (FIG. 6h).
Taken together, these data indicate that lipid oxidation is involved in SSZ-induced NETosis and ferrotosis cell death signals, but the production and role of oxidized lipids in these two cell death pathways may differ. ing.

<Structure-activity relationship between NET-inducing compounds>
It has been widely reported that bacterial azoreductase in the colon converts SSZ to 5-aminosalicylic acid (5-ASA) and sulfapyridine (Ref. 9) (FIG. 7a). 5-ASA contributes to the anti-inflammatory activity of SSZ, and sulfapyridine is thought to cause some side effects (Reference 10). Therefore, the effect of these SSZ metabolites on NETosis was examined. As shown in FIGS. 7b and c, the effect is very weak compared to SSZ, but sulfapyridine enhances PMA-induced NETosis. In contrast, 5-ASA does not induce NETosis. More interestingly, 5-ASA inhibited PMA and SSZ-induced NETosis in a dose-dependent manner (FIGS. 7d, e and f). These results may support the reason that the incidence of SSZ-induced granulocytopenia remains very low when administered orally.

  To further elucidate the structure-activity relationship of SSZ, sulfasilamides and 4,4'-diaminodiphenyl sulfone (DDS) were tested for NETosis enhancing activity. Sulfanilamide and DDS were found to have NETosis enhancing activity (FIG. 7g). DDS showed similar NETosis enhancing activity at doses one order of magnitude lower than sulfanilamide (FIG. 7g). NETosis-inducing compounds also accelerated lipid oxidation in PMA-treated neutrophils according to the level of NETosis enhancing activity (FIG. 7h). These results support the view that sulfanilamide and DDS induce NETosis in the same manner as SSZ.

<Discussion>
The inventors have shown that SSZ accelerates phospholipid oxidation in activated neutrophils, resulting in enhanced NETosis. These findings, in conjunction with recent research on ferrotosis, hint at the role of oxidized phospholipids as a function or regulator of certain types of cell death. In the case of ferrotosis, glutamate and other small molecules that inhibit the Xc ^- cystine transporter system can cause GSH depletion, loss of cellular antioxidant capacity and confer cell vulnerability in response to ROS. Has been reported (reference 11). Small molecules that inhibit GPX4, a unique cellular enzyme involved in the reduction of oxidized lipids, also induce ferroosis, indicating that lipid oxidation plays an important role in this type of cell death . The inventors initially thought that SSZ increased lipid peroxidation by inhibiting the function of xCT. This is because this is the mechanism considered to be the basis of ferrotosis. However, it was concluded that SSZ promotes the accumulation of oxidized lipids and consequently induces NETosis in an xCT-independent manner. Furthermore, our data showed that ferrotosis inhibitors did not affect SSZ-induced NETosis. This finding supports the notion that SSZ-induced NETosis is distinct from the process of cell death involved in ferroosis. However, both types of cell death are involved in lipid oxidation. At this point, the molecules targeted by SSZ to induce lipid oxidation and the subsequent induction of NETosis are not known. One possibility is that SSZ inhibits the ability of this molecule to reduce oxidized phospholipids. Alternatively, SSZ may positively regulate unidentified molecules involved in lipid oxidation. In either case, identifying SSZ target molecules is expected to facilitate the characterization of the molecular paradigm underlying the regulation of NETosis and NET formation.
In conclusion, the inventors have shown that SSZ enhances NETosis by accelerating lipid oxidation. The relationship between the structure and activity of SSZ and its related compounds will allow the development of compounds with potential NET-induced activity by accelerating lipid oxidation. Phospholipid peroxidation is an important mechanism for accelerating NET formation. These findings expand our understanding of the development of NET modulating compounds.

Reference 1) Nabeyama A, Kurita A, Asano K, Miyake Y, Yasuda T, Miura I, Nishitai G, Arakawa S, Shimizu S, Wakana S, Yoshida H, Tanaka M .: xCT deficiency accelerates chemically induced tumorigenesis. Proc Natl Acad Sci US A. 2010 Apr 6; 107 (14): 6436-41.
2) Ray S, Diamond B .: Generation of a fusion partner to sample the repertoire of splenic B cells destined for apoptosis. Proc Natl Acad Sci US A. 1994 Jun 7; 91 (12): 5548-51.
3) Kawamoto T, Shimizu M .: A method for preparing 2- to 50-micron-thick fresh-frozen sections of large samples and undecalcified hard tissues. Histochem Cell Biol. 2000 May; 113 (5): 331-9.
4) Akahoshi T, Namai R, Sekiyama N, Tanaka S, Hosaka S, Kondo H .: Rapid induction of neutrophil apoptosis by sulfasalazine: implications of reactive oxygen species in the apoptotic process.J Leukoc Biol. 1997 Dec; 62 (6) : 817-26.
5) Wang Y, Li M, Stadler S, Correll S, Li P, Wang D, Hayama R, Leonelli L, Han H, Grigoryev SA, Allis CD, Coonrod SA .: Histone hypercitrullination mediates chromatin decondensation and neutrophil extracellular trap formation. J Cell Biol. 2009 Jan 26; 184 (2): 205-13.
6) Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, Weinrauch Y, Brinkmann V, Zychlinsky A. Novel cell death program leads to neutrophil extracellular traps .: J Cell Biol. 2007 Jan 15; 176 ( 2): 231-41.
7) Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Morrison B 3rd, Stockwell BR .: Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012 May 25; 149 (5): 1060-72.
8) Gout PW, Buckley AR, Simms CR, Bruchovsky N .: Sulfasalazine, a potent suppressor of lymphoma growth by inhibition of the x (c) -cystine transporter: a new action for an old drug.Leukemia. 2001 Oct; 15 ( 10): 1633-40.
9) Gionchetti P, Calabrese C, Tambasco R, Brugnera R, Straforini G, Liguori G, Fornarini GS, Riso D, Campieri M, Rizzello F .: Role of conventional therapies in the era of biological treatment in Crohn's disease.World J Gastroenterol 2011 Apr 14; 17 (14): 1797-806.
10) Das KM, Eastwood MA, McManus JP, Sircus W .: Adverse reactions during salicylazosulfapyridine therapy and the relation with drug metabolism and acetylator phenotype. N Engl J Med. 1973 Sep 6; 289 (10): 491-5.
11) Yang WS, Stockwell BR .: Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016 Mar; 26 (3): 165-76.

Claims (7)

  A neutrophil extracellular trap formation promoter comprising at least one selected from the group consisting of sulfasalazine, 4,4'-diaminodiphenylsulfone, sulfanilamide, and pharmaceutically acceptable salts thereof.   The neutrophil extracellular trap formation promoter according to claim 1, comprising one selected from the group consisting of sulfasalazine, 4,4'-diaminodiphenylsulfone, sulfanilamide, and pharmaceutically acceptable salts thereof. .   A pharmaceutical composition comprising the neutrophil extracellular trap formation promoter according to claim 1 or 2.   The pharmaceutical composition according to claim 3, which is a pharmaceutical composition for treating infectious diseases.   The pharmaceutical composition according to claim 4, wherein the infection is an infection caused by bacteria, fungi, parasites or viruses.   The pharmaceutical composition according to claim 4 or 5, wherein the infectious disease is an infectious disease caused by a virus.   A pharmaceutical composition for treating infectious diseases, comprising sulfasalazine or a pharmaceutically acceptable salt thereof.

Images