JP2018515421A - Manufacture of multiple dose injection-prepared dendritic cell vaccine - Google Patents

Abstract

This embodiment relates to an injectable multi-dose antigen pulsed dendritic cell (DC) vaccine approved by the FDA. In one embodiment, the activated antigen loaded DC vaccine comprises an initial immunization dose and multiple “booster” doses. Also provided is a method of blocking both HER-2 and HER-3 as a treatment in causing permanent tumor aging in HER-2-expressing breast cancer. Also provided is a combination of anti-estrogen therapy and anti-HER2 dendritic cell vaccine for ER positive / HER2 positive DCIS breast cancer patients.

Description

[Cross-reference of related applications]
This application was filed on May 22, 2015, US Provisional Patent Application No. 62 / 025,673, filed July 17, 2014, the entire contents of which are each incorporated herein by reference. US Provisional Patent Application No. 62 / 165,445, US Provisional Patent Application No. 62 / 025,685 filed on July 17, 2014, US Provisional Patent Application No. 62 filed on July 24, 2014 Claims priority of / 029,774.

DESCRIPTION OF FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT This invention was made with Federal support under contract number R01 CA096997 awarded by the National Institutes of Health. The federal government has certain rights to the invention.

  Dendritic cells (DCs) are white blood cells that acquire protein antigens from even microbial or cancerous cells and present or “present” these antigens to T cells. T cells are thus activated by DC and then initiate a systemic immune response that challenges the threat. Conventional vaccines against microorganisms contain additives known as “adjuvants” that enhance DC activity and amplify vaccine-induced immune responses by many possible means within the vaccinated individual. However, vaccine requirements for cancer present many unique problems. For example, conventional adjuvants do not provide the DC with an appropriate signal that allows the DC to initiate optimal immunity against the cancer. The tumor itself also creates an environment that can affect the proper activation of DCs.

  A common solution to this problem is to remove DCs from cancer patients, load them with tumor antigens in vitro, and then provide a specific activation signal to the cells before re-administering them to the body That is. This ensures proper DC activation that has been eliminated by the influence of the tumor environment. When returned to the body, DCs interact with T cells to initiate strong antitumor immunity. Extra-corporalized DC has solved many effectiveness problems, but historically this has been a price constraint. For example, because DC vaccines consist of living cells, special cell processing and vaccine production facilities were required at the actual location of the medical center that administers the treatment. This is an expensive and inefficient way to deliver therapy, because each institution that administers such treatment must build and maintain its own facilities for special applications Because.

  Currently, management of breast cancer relies on a combination of early diagnosis and aggressive treatment, which may include one or more treatments such as surgery, radiation therapy, chemotherapy and hormone therapy. Herceptin (trastuzumab) was developed as a targeted therapy for HER2 / ErbB2-positive breast cancer cells and is often used with other therapies including the mitotic inhibitor paclitaxel (sold under the trade name Taxol).

  Herceptin's effectiveness as monotherapy is estimated to be less than 30%; combinatorial treatment with microtubule stabilizing drugs such as paclitaxel increases efficacy to about 60% (Burris et al., 2000, Semin Oncol, 27: 19-23). Treatment with Herceptin results in the accumulation of the Cdk inhibitor p27 and subsequent G1 / S cell cycle arrest, paclitaxel stops the transition to mitosis, which can lead to cell death. However, despite great expectations, high doses of Herceptin or paclitaxel result in undesirable side effects. In addition, cancer often can be resistant to Herceptin and / or paclitaxel.

Burris et al., 2000, Semin Oncol, 27: 19-23.

  Thus, there is an unmet need for compositions and effective methods for producing maximal therapeutic DC vaccines and new methods of treating cancer using Herceptin. Thus, there is a need in the art to have additional immunotherapeutic approaches for treating or preventing breast cancer and other malignancies. The present invention satisfies this need.

  The following detailed description of preferred embodiments of the invention is better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. However, it is to be understood that the invention is not limited to the arrangement and instrumentality of the embodiments shown in the drawings.

It is a chart which shows the survival rate and yield of DC1 cryopreserved. When cells were directly thawed and counted, cell recovery was an average of 89% and viability was 95%. It is a chart which showed that there was no significant difference in a cell survival rate (p = .4807) and recovery rate (p = .1220). FIG. 6 is a chart showing that both populations had similar initial (7 hours after LPS addition) IL-12p70 secretion (p = 0.768). The population continued to show comparable IL-12p70 secretion levels over the 30 hour observation period and there was no significant difference between the populations. There was no significant difference between the populations, and IL-1β (p = 0.7960), IL-1α (p = 0.0841), Rantes (p = 0.902), MDC (p = 0.1514) , IL-10 (p = 0.1937), MIP-1α (p = 0.2673), IP-10 (p = 0.7366), IL-6 (p = 0.24), IL-5 (p = 0) 0735), TNF-β (p = 0.9422), IL-15 (p = 0.8878), MIP-1β (p = 0.9217), TNF-α (p = 0.8972), IL- 8 is a chart showing production of 8 (p = 0.7844). FIG. 6 is a chart showing IFN-γ production from DCs that have been cryopreserved and not cryopreserved. FIG. 3 shows that Th1 cytokines TNF-α and IFN-γ synergistically induce senescence in breast cancer cells, and the required dose is inversely correlated with HER2 expression. FIG. 6A. The SK-BR-3 breast cancer line was incubated with 10 ng / ml TNF-α and 100 U / ml IFN-γ for 5 days, subcultured in the absence of cytokines, and then SA-β- Stained for galactosidase (SA-β-gal) expression (senescence marker) and compared to untreated control cells. Only paired cytokines induced senescence. Top panel, representative data from one of three independent experiments. Lower panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). FIG. 6B. Cell lysates of the cells described in A were analyzed by western blotting for p15INKb and p16INK4a expression. Vinculin was used as a loading control. FIG. 6C. T-47D breast cancer cells were untreated (1) or at the following concentrations of TNF-α and INF-γ: 10 ng / ml and 100 U / mL (2), 50 ng / ml and 500 U / mL (3), 75 ng / Incubated with ml and 750 U / mL (4), 100 ng / ml and 1000 U / mL (5) for 5 days and subcultured two more times in the absence of cytokines. Cells were then stained for SA-β-gal and compared to control untreated cells or those treated with 8 μM etoposide as a positive control (6). Upper panel, representative data from one of three independent experiments. Lower panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). FIG. 6D. Combined treatment with the Th1 cytokines IFN-γ and TNF-α resulted in greater aging compared to untreated controls, SK-BR-3 (10 ng / ml TNF-α + 100 U / ml IFN-γ). And T-47D (100 ng / ml TNF-α + 1000 U / ml IFN-γ) cells; MDA-MB-231 cells (200 ng / ml TNF-α + 2000 U / ml IFN-γ) are double IFN It remained largely unaffected by -γ + TNF-α treatment. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Figure 2 shows that HER2 induces senescence and apoptosis in MDA-MB-231 breast cancer cells. FIG. 7A. MDA-transfected with wtHER2 (pcDNAHER2) or empty vector (pcDNA3) treated with the listed concentrations of TNF-α and IFN-γ for 5 days and subcultured twice in the absence of cytokines SA-β-gal staining was performed in MB-231 cells. Left panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Right panel, representative data from one of three independent experiments. FIG. 7B. Cell lysates of the cells described in A were analyzed by Western blotting for p15INKb expression and cleaved caspase 3 expression. Vinculin was used as a loading control. Inset. Western blot of MDA-MB-231 cells stably transfected with pcDNAHER2 or pcDNA3 probed with HER2-specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. It is a figure which shows that the expression in the state which blocked | blocked HER2 and HER3 together enhances aging induction and apoptosis by TNF-α and IFN-γ, which are Th1 cytokines, in SK-BR-3 breast cancer cells. FIG. 8A. Transfected with non-target (NT), HER2, HER3 or a combination of HER2 and HER3 siRNA, then treated with the listed concentrations of TNF-α and IFN-γ for 5 days and passaged 2 more times in the absence of cytokines SA-β-gal staining was performed on subcultured SK-BR-3 cells. Left panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Right panel, representative data from one of three independent experiments. FIG. 8B. Cell lysates of the cells described in A were analyzed by Western blotting for p15INKb expression and cleaved caspase 3 expression. Inset. Western blot of SK-BR-3 transfected with NT, HER2 or HER3 siRNA probed with HER2 and HER3 specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. FIG. 4 shows that the combination of HER2 inhibition and HER2-HER3 dimerization inhibition enhances senescence induction and apoptosis in SK-BR-3 breast cancer cells by Th1 cytokines, TNF-α and IFN-γ. FIG. 9A. Untreated (1) or treated with 10 ng / ml TNF-α and 100 U / ml IFN-γ (2) or 10 μg / ml trastuzumab (Tzm), pertuzumab (Per) (3) or a combination of both treatments SA-β-gal staining was performed on SK-BR-3 that was treated with (4) for 5 days and subcultured two more times in the absence of antibody and cytokine. Left panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Right panel, representative data from one of three independent experiments. FIG. 9B. Cell lysates of the cells described in A were analyzed by western blotting for p15INKb or cleaved caspase 3 expression. Vinculin was used as a loading control. Similar results were observed in three independent experiments. FIG. 9C. Induction of apoptosis in untreated or treated SK-BR-3 cells as described above was performed by staining for Annexin V and PI and analyzed by flow cytometry. The top panel, plot, is representative data from one of three independent experiments. Lower panel, densitometric analysis. Data are expressed as the mean ± SEM of annexin V ⁺ PI ⁺ cells from three independent experiments. FIG. 4 shows that combined treatment with trastuzumab and pertuzumab enhances CD4 ⁺ Th1-mediated aging and apoptosis of HER2-overexpressing human breast cancer cells. FIG. 10A. Using the transwell system, 0.5 × 10 ⁵ SK-BR-3 cells can contain 5 × 10 ⁵ cells with or without 10 μg / ml trastuzumab (Tzm) and pertuzumab (Per). Pulsed with CD4 ⁺ T cells alone (CD4 ⁺ only), CD4 ⁺ T cells + 0.5 × 10 ⁵ HER2 class II peptides (DC H) or irrelevant class II BRAP or survivin peptides (DC B or DC S), respectively Co-cultured for 5 days with type 1 polarized mature DC and immature DC pulsed with CD4 ⁺ T cells + HER2 (iDC H). The cells were then subcultured two more times in the absence of blocking antibodies and immune system cells, then stained for SA-β-gal expression and compared to untreated control cells. Upper panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Lower panel, representative data from one of three independent experiments. FIG. 10B. Increased p15INK4b and cleaved caspase-3 expression suggests induced senescence and apoptosis of SK-BR-3 cells, respectively, when co-cultured with DC H / CD4 ⁺ T cells in the presence of trastuzumab and pertuzumab However, this was not the case from the DC B, DC S and iDC H groups. Vinculin was used as a loading control. Results are representative of 3 independent experiments. FIG. 3 shows that Th1 cytokines TNF-α and IFN-γ sensitize trastuzumab and pertuzumab resistant breast cancer cells to senescence and apoptosis induction. FIG. 11A. SA-β-gal staining was treated with 50 ng / ml TNF-α and 500 U / ml IFN-γ (2), or 10 μg / ml trastuzumab (Tzm) for untreated (1) or 5 days, respectively. ), Treated with pertuzumab (Per) (3), or treated with the same concentration of trastuzumab, pertuzumab and a combination of TNF-α, IFN-γ (4), and two more passages in the absence of antibody and cytokines Performed on cultured HCC-1419 and JIMT-1 cells. Upper panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Lower panel, representative data from one of three independent experiments. FIG. 11B. Cell lysates of the cells described in FIG. 11A were analyzed by Western blotting for p15INKb or cleaved caspase 3 expression. Vinculin was used as a loading control. Similar results were observed in three independent experiments. IFNGR and TNFR are expressed at the same level in breast cancer cell lines independent of their HER2 levels. IFNGR determined by Western blot in immobilized MCF-10A mammalian epithelial cells and breast cancer cell lines (SK-BR-3, BT-474, MCF-7, T-47D and MDA-MB-231), Expression of TNFR and HER2. Vinculin was used as a loading control. Similar results were observed in three independent experiments. It is a figure which shows that the expression in the state which blocked | interrupted HER2 and HER3 together enhances the senescence induction by TNF-α and IFN-γ, which are Th1 cytokines, in MCF-7 breast cancer cells. FIG. 13A. Transfected with non-target (NT), HER2, HER3 or a combination of HER2 and HER3 siRNA, then treated with the listed concentrations of TNF-α and IFN-γ for 5 days and passaged 2 more times in the absence of cytokines SA-β-gal staining was performed on subcultured MCF-7 cells. Left panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Right panel, representative data from one of three independent experiments. FIG. 13B. Cell lysates of the cells described in A were analyzed by western blotting for p15INKb or cleaved caspase 3 expression. Inset. Western blot of MCF-7 cells transfected with NT, HER2 or HER3 or a combination of HER2 and HER3 siRNA probed with HER2 and HER3 specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. It is a figure which shows the effect with respect to aging of SK-BR-3 and apoptosis of the cytokine produced by Th1. FIG. 14A. Using the transwell system, 0.5 × 10 ⁵ SK-BR-3 cells were transformed into 5 × 10 ⁵ CD4 ⁺ T cells alone (CD4 ⁺ only), CD4 ⁺ T cells + 0.5 × 10 ⁵ Type 1 polarized mature DC pulsed with one HER2 class II peptide (DC H) or an irrelevant class II BRAF peptide (DC B), respectively, and pulsed with CD4 ⁺ T cells + HER2 (iDC H) or BRAF (iDC B) Co-cultured with immature DC for 5 days. The cells were then subcultured two more times in the absence of immune system cells, then stained for SA-β-gal expression and compared to untreated control cells. Compared to the IgG isotype control, senescence induced in SK-BR-3 treated with CD4 ⁺ / DC H was partially due to neutralizing IFN-γ and TNF-α with specific antibodies. Rescued (75.27% rescue). Upper panel, densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). Lower panel, representative data from one of three independent experiments. FIG. 14B. When co-cultured with DC H / CD4 ⁺ T cells, increased p15INK4b and cleaved caspase-3 expression compared to DC B, iDC H and iDC B groups is indicative of senescence and apoptosis of SK-BR-3 cells. Suggests induction. Compared to the IgG isotype control, senescence and apoptosis induced in SK-BR-3 treated with CD4 ⁺ / DC H was partially due to neutralizing IFN-γ and TNF-α specific antibodies. I was rescued. Vinculin was used as a loading control. Results are representative of three experiments. It is a figure which shows the effect of trastuzumab and pertuzumab with respect to AKT activation by heregulin in a breast cancer cell line. FIG. 16A. Serum-deficient T-47D, HCC-1419 and JIMT-1 cells were treated with trastuzumab (Tzm) and pertuzumab (Per 10 μg / ml, 90 minutes) and stimulated with (HRG, 20 ng / ml, 5 minutes) It was done. Upper panel, representative data from one of three independent experiments. Lower panel, densitometric analysis. Data are expressed as% of HRG response in the absence of trastuzumab and pertuzumab, mean ± SEM D. (N = 3). FIG. 16 shows the vaccination procedure. HER2pos DCIS patients diagnosed by biopsy were enrolled in the study. Patient monocytes were collected by leukapheresis and elution. Monocytes were rapidly matured into type 1 DC and the anti-HER2 CD4 Th1 immune response before vaccination was measured. Patients were vaccinated 4-6 times a week (+/- anti-estrogen therapy). Patient monocytes were collected again by a second leukapheresis and elution and the anti-HER2 CD4 Th1 immune response after vaccination was measured. After vaccination, the patient underwent surgical resection and cured the remaining disease. Clinical response was measured in surgical specimens and immune response was measured in sentinel lymph nodes (SLN). 17A-17B show the results of SKBR3 and MCF7 breast cancer cell lines treated with Th1 cytokines (IFNamic and TNFα), tamoxifen metabolites (4-hydroxy-tamoxifen, “4HT”), or both. SKBR3 (ERneg) (FIG. 17A) increased anti-tumor activity in response to Th1 cytokine treatment, but not in response to anti-estrogen treatment or combination treatment. MCF7 (ERpos) (FIG. 17B) did not increase anti-tumor activity in response to either Th1 cytokine treatment or anti-estrogen treatment, but the combination resulted in increased metabolic activity. FIG. 18 shows the patient distribution of anti-estrogen (“AE”) combination therapy and anti-HER2 DC1 vaccination trial. The HER-2 positive rate was defined as> 5% of immunohistochemical HER-2 protein expression 2+ or 3+ strength cells. AE therapy (tamoxifen, letrozole, or anastrozole) was given at the same time as DC vaccination. FIG. 19 is a histogram showing complete pathological response rates comparing patients with ER status and AE treatment (ERneg; ERpos w / o AE; ERpos w AE). FIGS. 20A-20B show a study patient's subsequent breast events comparing patients by pathological complete response (“pCR”) (FIG. 20A) and ER status and AE treatment (FIG. 20B). Figures 21A-21C show CD4 + systemic immune responses measured in peripheral blood. Each metric of Th1 response (responsiveness (FIG. 21A); response repertoire (FIG. 21B) and cumulative response (FIG. 21C)) significantly increased the immune response after anti-HER2 DC1 vaccination. However, the immune response before and after vaccination was similar in all three groups. 22A-22C show the CD4 + local immune response measured in the patient's sentinel lymph node. The post-vaccination immune response was determined for each index (responsiveness (FIG. 22A), response repertoire (FIG. 22B) or cumulative response (FIG. 22C) in ERpos patients who received AE compared to ERpos patients who did not receive AE. FIG. 23 shows the CD8 + systemic immune response measured in peripheral blood. Responsiveness of patients with ERneg status and patients with ERpos status with and without anti-estrogen treatment (ERpos w / o AE; ERpos wAE) is shown. FIG. 24 shows the BRAFV600E-DC1 vaccine that has overcome veramefenib resistance in BRAF-mutant mouse melanoma.

  The present invention provides compositions and methods for producing an FDA approved injectable multi-dose antigen-pulsed dendritic cell vaccine for personalized treatment and prevention of cancer or other disorders. In one embodiment, the present invention provides compositions and methods for producing an FDA approved multi-dose antigen pulse type 1 polarized dendritic cell vaccine (DC1).

  In one embodiment, the present invention requires an antigen loaded and pre-activated state, ie “syringe ready, ie, additional facility and quality control / assurance steps (eg, by FDA order). A method for cryopreserving dendritic cells as a multi-dose aliquot suitable for immediate injection into a patient without the need for any additional cell processing is provided.

  In one embodiment, the present invention provides a method for efficiently producing an injectable multiple dose antigen pulse dendritic cell vaccine, preferably an injectable multiple dose antigen pulse type 1 polarized dendritic cell vaccine. To do.

  In one embodiment, an FDA-approved injectable multi-dose antigen pulsed dendritic cell vaccine is produced by collecting DCs in leukapheresis of a single patient. Preferably, leukocyte depletion and dendritic cell vaccine production is a centralized vaccine production in which the DC is engineered to create an activated antigen-loaded DC vaccine consisting of its initial immunization dose and multiple “booster” doses Performed at a first location that can be a facility. The benefit of the present invention is that all quality control / quality assurance steps according to FDA orders are performed at a central facility, and after completion and release, all vaccine doses are stored frozen for continuous administration to patients. To be sent to a remote medical center. In one embodiment, the FDA approved injectable multi-dose antigen-dendritic cell vaccine of the present invention does not require any mandated quality control / quality assurance steps at the site of administration.

  In another aspect, the invention includes altering an immune response in a tumor such that a therapy effective to treat cancer is such that immune cells in the tumor site are more effective at attacking tumor cells. Based on the discovery. In some cases, effective treatment includes improving immune cell migration and activity in the tumor site. Thus, the present invention uses a dendritic cell vaccine with a composition that inhibits one or more of HER-2 and HER-3 (eg, trastuzumab, pertuzumab, etc.) as a treatment regimen for treating cancer Compositions and methods are provided.

  In one embodiment, the present invention provides compositions and methods for using a dendritic cell vaccine with blockade of one or more of HER-2 and HER-3 as a treatment regimen for treating cancer. provide. In another embodiment, the present invention provides compositions and methods using dendritic cell vaccines with HER-2 and HER-3 blockade by addition of TNF-α and IFN-γ. In another embodiment, the invention provides a composition that blocks one or more of HER-2 and HER-3 by the addition of TNF-α and IFN-γ as a treatment regimen for treating cancer, and Provide a method.

  In one embodiment, the treatment regimen of the present invention comprises an oncodriver for an anti-oncodriver Th1 immune response (eg, TNF-α and IFN-γ) and one or more of HER-2 and HER-3. Includes combination therapy to induce blockade.

  In one embodiment, the treatment regimen of the present invention can be used to treat cancer and is therefore considered a type of anti-cancer therapy. In another embodiment, the treatment regimen of the present invention comprises surgery, chemotherapy, radiation therapy (eg, X-ray), gene therapy, immunotherapy, hormone therapy, viral therapy, DNA therapy, RNA therapy, protein therapy, cell therapy. Can be used in combination with another anti-cancer therapy, including but not limited to nanotherapy.

  In one embodiment, the treatment regimen of the present invention is used prior to receiving other anticancer therapies. In another embodiment, the treatment regimen of the present invention is used concurrently with receiving other anti-cancer therapies. In another embodiment, the treatment regimen of the present invention is used after receiving other anti-cancer therapies.

  In another embodiment, concurrent neoadjuvant anti-estrogen therapy and anti-HER2 DC1 vaccination increase the rate of immune response in local sentinel lymph nodes and pathological complete response in HER2pos / ERpos DCIS patients.

Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.

  In general, the terminology used herein and laboratory procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and hybridization are well known in the art and commonly employed.

  Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures generally involve conventional methods in the art and various general references (eg, Sambrook and Russell, 2012, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbold, Cold Spring Harbold, Cold Spring Harbold, Et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

  The terminology used herein and the laboratory procedures used in analytical chemistry and organic synthesis described below are well known in the art and commonly employed. Standard techniques and modifications thereof are used for chemical synthesis and chemical analysis.

  Each of the following terms used herein has the meaning associated with it in this section.

  The articles “a” and “an” are used herein to refer to one or more (ie, at least one) of the grammatical objects of the article. For example, “an element” means one element or more than one element.

  As used herein, “about” refers to a measurable value, such as amount, duration, etc., where the specified value is such that such variation is appropriate to perform the disclosed method. Is intended to encompass ± 20%, or ± 10%, or ± 5%, or ± 1%, or ± 0.1% variation from

  The term “abnormal” when used in relation to an organism, tissue, cell or component thereof is “normal” in at least one observable or detectable characteristic (eg, age, treatment, time, etc.). Refers to an organism, tissue, cell or component thereof that is different from the organism, tissue, cell or component thereof presenting each (expected) feature. Normal or expected characteristics for one cell or tissue type may be abnormal for different cell or tissue types.

  The term “antigen” or “ag” as used herein is defined as a molecule that elicits an immune response. This immune response can include either antibody production or activation of specific immunocompetent cells, or both. One skilled in the art understands that any macromolecule, including virtually any protein or peptide, serves as an antigen. Furthermore, the antigen can be derived from recombinant or genomic DNA. One skilled in the art will recognize that when this term is used herein, any DNA comprising a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response will thus encode an “antigen”. To understand the. Furthermore, those skilled in the art will appreciate that the antigen need not be encoded solely by the full-length nucleotide sequence of the gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit a desired immune response. it is obvious. Furthermore, those skilled in the art understand that the antigen need not be encoded by a “gene” at all. It will be readily apparent that the antigen can be produced synthetically or derived from a biological sample. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells or biological fluids.

  An “antigen presenting cell” (APC) is a cell that can activate T cells and includes, but is not limited to, monocytes / macrophages, B cells and dendritic cells (DC).

  “Antigen-loaded APC” or “antigen pulsed APC” includes APCs that have been exposed to and activated by an antigen. For example, APC can be Ag loaded in vitro, for example during culture in the presence of antigen. APC can also be loaded in vivo by exposure to an antigen. “Antigen-loaded APC” is traditionally one of two methods: (1) a small peptide fragment, known as an antigenic peptide, is “pulsed” directly outside of APC; or (2) APC is the total protein Or prepared by incubating with protein particles, which are then digested by APC. These proteins are digested by APC into small peptide fragments that are ultimately transported and presented on the APC surface. Furthermore, antigen-loaded APCs can also be created by introducing a polynucleotide encoding an antigen into a cell.

  An “anti-HER2 response” is an immune response specific for HER2 protein.

  “Apoptosis” is a process of programmed cell death. Caspase-3 is a dead protease that is frequently activated.

  The term “autoimmune disease” as used herein is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of inappropriate and excessive responses to self-antigens. Examples of autoimmune diseases include, among others, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (type I), dystrophic epidermolysis bullosa, Epididymis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, Examples include, but are not limited to, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis.

  As used herein, the term “self” is meant to refer to any material derived from the same individual as it is later reintroduced.

  The term “B cell” as used herein is defined as a cell derived from bone marrow and / or spleen. B cells develop into plasma cells that produce antibodies.

  As used herein, the term “cancer” is an excess of cells whose unique trait—loss of normal control—results in uncontrolled proliferation, loss of differentiation, invasion of local tissue, and / or metastasis. Defined as proliferation. Examples include but are not limited to breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer and lung cancer.

  “Surface CD4 + Th1 cells”, “Th1 cells”, “CD4 + T helper type 1 cells”, “CD4 + T cells” and the like are defined as subtypes of T helper cells that express the surface protein CD4, and are cytokine IFN-γ. . See also “T helper cells”.

  “Cumulative response” is a composite of a group of patients expressed as the sum of reaction spots (spot-forming cells “SFC” per 106 cells from IFN-γ ELISPOT analysis) from all six MHC class II binding peptides given Means immune response. Patient group.

  The term “cryopreserved” or “cryopreservation” as used herein refers to cells that have been resuspended in cryopreservation media and frozen at a temperature of about −70 ° C. or lower.

  “DC vaccination”, “DC immunization”, “DC1 immunization”, etc. utilize autologous dendritic cells to recognize specific molecules using the immune system and acquire specific responses to them. Refers to strategy.

  The term “dendritic cell” (DC) is an antigen presenting cell that can be present in vivo, in vitro, ex vivo or in a host or subject, or derived from hematopoietic stem cells or monocytes. Dendritic cells and their progenitor cells can be isolated from a variety of lymphoid organs such as the spleen, lymph nodes, and bone marrow and peripheral blood. DC has a characteristic form having a thin sheet (foliate foot) extending from a dendritic cell body in a plurality of directions. Typically, dendritic cells express high levels of MHC and costimulatory (eg, B7-1 and B7-2) molecules. Dendritic cells can induce antigen-specific differentiation of T cells in vitro and can elicit primary T cell responses in vitro and in vivo.

  As used herein, “activated DC” is DC that has been exposed to a Toll-like receptor agonist. Activated DC may or may not be loaded with antigen.

  The term “mature DC” as used herein is defined as dendritic cells that express molecules including high levels of MHC class II, CD80 (B7.1) and CD86 (B7.2). In contrast, immature dendritic cells express low levels of MHC class II, CD80 (B7.1) and CD86 (B7.2) molecules and can still take up antigen. “Mature DC” also refers to antigen presenting cells present in a host or subject that are in vivo, in vitro, ex vivo, or DC1-polarized (ie, can fully promote cellular immunity).

  A “disease” is a health condition of an animal, where the animal cannot maintain homeostasis and if the disease is not ameliorated, the animal's health continues to deteriorate.

  A “disorder” in an animal is a health condition in which the animal can maintain homeostasis, but is less favorable than the absence of the disorder. When left untreated, the disorder does not necessarily cause a further decline in the animal's health.

  A disease or disorder is “ameliorated” if the severity or frequency of at least one sign or symptom of the disease or disorder experienced by the patient is reduced.

  As used herein, an “effective amount” or “therapeutically effective amount” is used interchangeably and is a compound, formulation, material or composition effective to achieve a particular biological result as described herein. Refers to the amount of a thing. Such results can include, but are not limited to, prevention of viral infection as determined by any means suitable in the art.

  “Endogenous” as used herein refers to any material derived from or produced within an organism, cell, tissue or system.

  As used herein, the term “exogenous” refers to any material that is introduced or produced externally from an organism, cell, tissue or system.

  An “estrogen receptor (ER) positive” cancer is a cancer that yields a positive result in a test for expression of ER. Conversely, “ER negative” cancers give a negative result when tested for such expression. The analysis of the state of the ER can be performed by any method known in the art.

  The term “cryopreservation medium” as used herein refers to a cell sample in preparation for freezing so that at least some of the cells in the cell sample can be recovered and remain viable after thawing. Refers to any medium mixed with.

  “HER2” is a member of the human epidermal growth factor receptor (“EGFR”) family. HER2 is overexpressed in about 20-25% of human breast cancers and is expressed in many other cancers

  A “HER receptor” is a receptor protein tyrosine kinase that belongs to the HER receptor family and includes EGFR (ErbB1, HER1), HER2 (ErbB2), HER3 (ErbB3) and HER4 (ErbB4) receptors. In general, the HER receptor contains an extracellular domain that binds a HER ligand and / or another HER receptor molecule; a lipophilic transmembrane domain; a conserved intracellular tyrosine kinase domain; and several Can be dimerized with a carboxyl-terminal signaling domain with a tyrosine residue that can be phosphorylated. The HER receptor may be a “native sequence” HER receptor or an “amino acid sequence variant” thereof. Preferably, the HER receptor is a native sequence human HER receptor.

  “HER pathway” refers to a signaling network mediated by the HER receptor family.

  “HER activation” refers to activation or phosphorylation of any one or more HER receptors. In general, HER activation results in signal transduction (eg, caused by the intracellular kinase domain of a HER receptor phosphorylated tyrosine residue in a HER receptor or substrate polypeptide). HER activation can be mediated by a HER ligand that is bound to a HER dimer containing the HER receptor of interest. A HER ligand bound to a HER dimer activates the kinase domain of one or more HER receptors in the dimer, thereby phosphorylating and / or tyrosine residues in one or more HER receptors. Alternatively, phosphorylation of tyrosine residues in additional substrate polypeptide (s) such as Akt or MAPK intracellular kinase can result.

“HER2 binding peptide”, “HER2 MHC class II binding peptide”, “binding peptide”, “HER2 peptide”, “immunogenic MHC class II binding peptide”, “antigen binding peptide”, “HER2 epitope”, specification As used in, refers to a target found in about 20-25% of MHC class II peptides, total human breast cancer and equivalents derived from or based on the sequence of the HER2 / neu protein. The HER2 extracellular domain “ECD” refers to a HER2 domain containing a fragment thereof, either immobilized extracellularly or circulating in the cell membrane. The HER2 intracellular domain “ICD” refers to the domain of the HER2 / neu protein in the cytoplasm of the cell. According to a preferred embodiment, the HER2 epitope or otherwise binding peptide comprises 6 HER2 binding peptides including 3 HER2 ECD peptides and 3 HER2 ICD peptides.
Preferred HER2 ECD peptides are
Peptide 42-56: HLDMLRHLYQGCQVV (SEQ ID NO: 1).
Peptide 98-114: RLRIVRGGTQLFEDNYAL (SEQ ID NO: 2). And Peptide 328-345: TQRCEKCSKPCARVCYGL (SEQ ID NO: 3).
Preferred HER2 ICD peptides are
Peptide 776-790: GVGSPYVSRLLGICL (SEQ ID NO: 4).
Peptide 927-941: PAREIPDLLEKGER (SEQ ID NO: 5). And peptide 1166-1180: TLERPKTLSPGKNGV (SEQ ID NO: 6).
In embodiments where the patient has HLA-A2 pos / A2.1, the blood group MHC class I peptide or epitope is
Peptide 369-377: KIFGSLAFL (SEQ ID NO: 7). And peptide 689-697: RLLQETELV (SEQ ID NO: 8)

  “HER2pos” is a classification or molecular subtype of certain types of breast cancer as well as many other types of cancer. HER2 positivity is currently defined by 2+ or 3+ in intensity of gene amplification and pathological staining by FISH (fluorescence in situ hybridization) assay.

  “HER2neg” is defined by the lack of gene amplification by FISH and can in most cases encompass pathological staining in the range of 0-2 +.

  The term “hyperproliferative disorder” is defined as a disorder resulting from the hyperproliferation of cells. Exemplary hyperproliferative diseases include, but are not limited to, cancer or autoimmune diseases. Other hyperproliferative diseases can include, for example, vascular occlusion, restenosis, atherosclerosis, or inflammatory bowel disease.

  The term “inhibit” as used herein means, for example, suppressing or blocking activity or function by about 10 percent compared to a control value. Preferably, the activity is inhibited or blocked by 50%, more preferably 75%, even more preferably 95% compared to the control value. As used herein, “inhibit” reduces or completely reduces the expression, stability, function or activity of a molecule, reaction, interaction, gene, mRNA and / or protein by a measurable amount. It also means preventing. Inhibitors, for example, bind to proteins, genes and mRNA, partially or completely block stimulation, reduce activation, prevent, delay, inactivate, desensitize, or Compounds that down-regulate stability, expression, function and activity, eg, antagonists.

  “Instructional material” as used herein includes publications, records, diagrams or any other medium of expression used to convey the usefulness of the compositions and methods of the present invention. The instructional material of the kit of the present invention can be attached to a container containing the nucleic acid, peptide and / or composition of the present invention or shipped together with a container containing the nucleic acid, peptide and / or composition of the present invention. it can. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.

  “Isolated” means altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not “isolated”, but the same nucleic acid or peptide that is partially or completely separated from coexisting materials in its natural state is “Isolated”. An isolated nucleic acid or protein can exist in substantially pure form or can exist in a non-natural environment such as, for example, a host cell.

For each group of subjects analyzed for anti-HER2 CD4 + Th1 immune response, a “metric” of CD4 + Th1 response (or Th1 response) is defined: (a) overall anti-HER2 responsiveness (> 1 response to reactive peptide) Expressed as a percentage of subjects). (B) Response repertoire (expressed as the average number of reactive peptides recognized by each subject group); (c) Reactive spots from six MHC class II binding peptides from each subject group (IFN-γ ELISPOT analysis) Cumulative response expressed as the sum of spot forming cells “SFC” per 10 ⁶ cells.

  As used herein, the term “modulating” is compared to the level of response in a subject in the absence of treatment or compound and / or otherwise in the same but untreated subject, It is meant to mediate a detectable increase or decrease in the level of response in the subject. The term encompasses perturbing and / or affecting a natural signal or response, thereby mediating a beneficial therapeutic response in a subject, preferably a human.

  As used herein, “neoadjuvant therapy” for breast cancer refers to primary therapy (ie, surgery). “Adjuvant therapy” is treatment after primary therapy to increase the chances of long-term survival.

  As used herein, a “population” includes a reference to an isolated culture, including a culture of uniform, substantially homogeneous, or heterogeneous cells. In general, a “population” can also be regarded as a culture of “isolated” cells.

  As used herein, a “recombinant cell” is a host cell that contains a recombinant polynucleotide.

  “Responsiveness” or “anti-HER2 responsiveness” is used interchangeably herein and means the percentage of subjects that respond to at least one of the six binding peptides.

  The “response repertoire” is defined as the average number of reactive peptides (“n”) recognized by each subject group.

  As used herein, a “sample” or “biological sample” refers to biological material from a subject, including but not limited to organs, tissues, exosomes, blood, plasma, saliva, urine and other body fluids. means. A sample can be any source of material obtained from a subject.

  “Aging” refers to a cell that can no longer divide, but is still alive and metabolically active. Senescent cells are characterized by 4B and p16INK4a, including essentially irreversible growth arrest and expression of SA-β-gal, P15INK.

  “Signal 1” as used herein generally refers to the first biochemical signal transmitted from activated DCs to T cells. Signal 1 is provided by an antigen expressed on the surface of the DC and is sensed by the T cell through the T cell receptor.

  As used herein, “signal 2” refers to a second signal provided from DC to T cells. Signal 2 is provided by “costimulatory” molecules in activated DCs, which are usually CD80 and / or CD86 (although other costimulatory molecules are known), and by T cells through the surface receptor CD28. Perceived.

  “Signal 3” as used herein generally refers to a signal generated from a soluble protein (usually a cytokine) provided by activated DC. These are sensed through receptors on T lymphocytes. The third signal instructs the T cell which trait or functional characteristics should be acquired to best deal with the current threat.

  As used herein, the term “specifically binds” recognizes and binds to another molecule or feature, such as an antibody, but does not substantially recognize another molecule or feature in the sample. A molecule that does not bind to it.

  The terms “subject”, “patient”, “individual” and the like are used interchangeably herein and refer to any animal or cell thereof, either in vitro or in situ, that is amenable to the invention described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.

  “T / C” is defined as trastuzumab and chemotherapy. This refers to patients who received both post-breast cancer surgery / pretrastuzumab and chemotherapy.

  The term “T cell” as used herein is defined as a thymus-derived cell that participates in various cellular immune responses.

  The term “T helper” as used herein with respect to cells refers to lymphocytes (a type of white blood cell or a subgroup of leukocytes) that can be identified by those skilled in the art. In particular, T helper cells according to the present disclosure include effector Th cells (such as Th1, Th2 and Th17), which cytokines, proteins or peptides that stimulate or interact with other leukocytes. Secrete.

  As used herein, a “Th1 T cell” is a T cell that produces high levels of the cytokine IFN-γ and is considered to be highly effective against host cells and certain pathogenic microorganisms that live inside cancer. Point to.

  As used herein, “Th17T cells” produce high levels of cytokines IL-17 and IL-22 and are considered to be highly effective against certain pathogenic microorganisms that live on the mucosal surface. Point to.

  A “therapeutically effective amount” is an amount of a compound of the invention that, when administered to a patient, ameliorates a symptom of the disease. The amount of a compound of the invention that constitutes a “therapeutically effective amount” will vary depending on the compound, the disease state and its severity, the age of the patient to be treated, and the like. A therapeutically effective amount can be routinely determined by one of ordinary skill in the art in light of his knowledge and the present disclosure.

  The terms “treat”, “treating” and “treatment” refer to a therapeutic or prophylactic means as described herein. A method of “treatment” is to prevent, heal, delay, reduce severity, or ameliorate one or more symptoms of a disease or relapsed disease, or in the absence of such treatment. To a subject in need of such treatment, such as a subject afflicted with a disease or disorder, or who may ultimately suffer from such a disease or disorder to prolong the survival of the subject beyond prediction Of administration of the composition of the present invention.

  The term “Toll-like receptor” or “TLR” as used herein is defined as a class of proteins that play a role in the innate immune system. TLRs are single transmembrane non-catalytic receptors that recognize structurally conserved molecules from microorganisms. TLRs activate immune cell responses when bound to ligands.

  The term “Toll-like receptor agonist” or “TLR agonist” as used herein is defined as a ligand that binds to the TLR to activate an immune cell response.

  The term “vaccine” as used herein is defined as the material used to elicit an immune response after its administration to an animal, preferably a mammal, more preferably a human. Upon introduction into a subject, a vaccine can elicit an immune response including, but not limited to, antibodies, cytokine production and / or other cellular responses.

  Scope: Throughout this disclosure, various aspects of this invention can be expressed in a range format. The description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, descriptions of ranges such as 1 to 6 include subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and so on. It should be considered as specifically disclosing individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3 and 6. This is true regardless of the width of the range.

DESCRIPTION The present invention involves the preparation of DCs. In one embodiment, the DC preparation is greater than 90% pure. In another embodiment, the DC preparation is fully activated. For example, DCs are activated by cytokines and / or Toll-like receptor ligands, and this state is fully maintained by the cryopreservation technique of the present invention. The benefits of the DC preparations of the present invention are that a single leukocyte depletion (patient collection) can be thawed as needed at a remote treatment site without requiring any specialized cell processing facility or further quality control testing. Can be efficiently cryopreserved in the initial vaccine + multiple (eg, 10 or more) “booster” doses.

  As contemplated herein, the present invention produces DCs with superior functionality in generating stronger signals to T cells, resulting in stronger DC-based vaccines, and freezing. Provide a way to save. By effectively cryopreserving such cells, the sample can be stored and thawed for later use, thereby necessitating repeated component removal and elution during vaccine production. Can be reduced. It is beneficial to be able to freeze the DCs and then later thaw them. Because one round of vaccine production is divided into small portions, frozen, and then given a “booster” inoculation that boosts immunity over weeks, months or years, one at a time This means that it can be administered to patients one by one.

  In one embodiment, the present invention comprises an FDA-approved injectable multi-dose antigen pulsed dendritic cell vaccine produced by collecting DCs in leukapheresis of a single patient. The FDA approved multi-dose antigen-pulsed dendritic cell vaccine for injection includes an initial immunization dose and multiple “booster” doses. FDA approved multi-dose antigen pulsed dendritic cell vaccines for cryogenic storage and for a series of administrations to patients without special requirements at the site of administration (eg, QC / QA steps according to FDA orders) , Can be sent to a remote medical center.

  The present invention relates to antigen presentation and those in the production of various cytokines and chemokines such that cryopreserved and subsequently thawed activated DCs are as clinically effective as freshly harvested and activated DCs. Also relates to the cryopreservation of these activated DCs in a manner that preserves their potency as well as functionality after thawing.

  The invention also relates to inducing tumor senescence and apoptosis in cells by blocking one or more of HER-2 and HER-3 and activating anti-HER-2 CD4 Th1 cells. Thus, the present invention includes combinations and methods for promoting an anti-oncodriver Th1 immune response by oncodriver blockade for HER-2 to promote tumor aging in HER-2 expressing breast cancer. In one embodiment, promoting anti-oncodriver Th1 immunity comprises TNF-α and IFN-γ. In one embodiment, on-codriver blockade for HER-2 includes any composition that blocks HER-2, including but not limited to trastuzumab and pertuzumab.

  In one embodiment, the invention provides for blocking one or more of HER-2 and HER-3 and adding TNF-α and IFN-γ to induce senescence of HER-2-expressing breast cancer. Compositions and methods for combination are included. In one embodiment, TNF-α and IFN-γ are secreted from CD4 Th1 cells.

  In one embodiment, HER2 is required in the TNF-α and IFN-γ mechanisms that induce breast cancer cell senescence and apoptosis.

  In one embodiment, TNF-α and IFN-γ restore sensitivity to trastuzumab and pertuzumab to breast cancer resistant cells. In one embodiment, the Th1 cytokines IFN-γ and IFN-α reverse resistance to therapeutic agents that broadly affect cancer patients.

DC-based immunotherapy DCs are derived from pluripotent monocytes that serve as antigen presenting cells (APCs). DCs are universal in peripheral tissues where they are ready to capture antigen. Upon capture of the antigen, the DC processes the antigen into small peptides and moves towards secondary lymphoid organs. Within the lymphoid organ, DCs present antigenic peptides to naive T cells, thereby initiating a cascade of signals that polarize T cell differentiation. Upon exposure, DCs present antigen molecules bound to either MHC class I or class II binding peptides and activate CD8 ⁺ or CD4 ⁺ T cells, respectively (Steinman, 1991, Annu. Rev. Immunol. 9: 271-296; Bancherau et al., 1998, Nature 392, 245-252; Steinman et al., 2007, Nature 449: 419-426; Ginhoux et al., 2007, J. Exp. 3133-3146; Banerjec et al., 2006, Blood 108: 2655-2661; Sallusto et al., 1999, J. Exp. Med. 189: 611-614; Reid et al., 2000, Curr. Opin. unol.12: 114~121 pages; Bykovskaia et al., 1999, J.Leukoc.Biol 66:.. 659~666 pages; Clark et al., 2000, Microbes Infect 2: 257~272 pages).

  DCs are involved in the induction, coordination and regulation of the adaptive immune response and also serve to integrate communication between the natural and adaptive arm effectors of the immune system. These features made DC a strong candidate for immunotherapy. DC has the unique ability to sample the environment by macropinocytosis and receptor-dependent endocytosis (Geroer et al., 2008, J. Immunol. 181: 155-164; Stoitzner et al., 2008, Cancer. Immunol.Immunother 57: 1665-1673; Lanzevecchia A., 1996, Curr.Opin.Immunol.8: 348-354; Delamarre et al.

  DC also requires a maturation signal to enhance its antigen presentation ability. DCs up-regulate the expression of surface molecules such as CD80 and CD86 (also known as second signal molecules) by providing additional maturation signals such as TNF-α, CD40L or calcium signaling agents ( Czernieki et al., 1997, J. Immunol. 159: 3823-3837; Bedrosian et al., 2000, J. Immunother. 23: 311-320; Maryliard et al., 2004, Cancer Res. Brossart et al., 1998, Blood 92: 4238-4247; Jin et al., 2004, Hum. Immunol. 65: 93-103). It has been established that a mixture of cytokines including TNF-α, IL-1β, IL-6 and prostaglandin E2 (PGE2) has the ability to mature DC (Jonuleit et al., 2000, Arch. Derm. Res. 292: 325-332). DCs can also be matured by calcium ionophores before being pulsed with antigen.

  In addition to pathogen recognition receptors such as PKR and MDA-5 (Kalali et al., 2008, J. Immunol. 181: 2694-2704; Nallagatla et al., 2008, RNA Biol. 5 (3): 140-144) Thus, DC also contains a series of receptors known as Toll-like receptors (TLRs) that can also sense risks from pathogens. When these TLRs are induced, a series of activity changes are induced in DC, which leads to T cell maturation and signal transduction (Boulart et al., 2008, Cancer Immunol. Immunother. 57 (11): 1589-1597. Kaisho et al., 2003, Curr.Mol.Med.3 (4): 373-385; Pulendran et al., 2001, Science 293 (5528): 253-256; Napoitiani et al., 2005, Nat. 6 (8): 769-776). DCs can activate and expand diverse arms of cell-mediated responses such as natural killer γ-δT cells and α-βT cells, and once activated, DCs retain their immunizing capacity. (Steinman, 1991, Annu. Rev. Immunol. 9: 271-296; Bancherau et al., 1998, Nature 392: 245-252; Reid et al., 2000, Curr. Opin. Immunol. 12: 114-121. (Bykovskskaia et al., 1999, J. Leukoc. Biol. 66: 659-666; Clark et al., 2000, Microbes Infect. 2: 257-272).

  The present invention elicits a clinically effective immune response when mature and antigen-loaded DC activated by a Toll-like receptor agonist, preferably when used early in the disease process DC that can be used. The DCs of the present invention have the ability to produce desirable levels of cytokines and chemokines and to induce apoptosis of tumor cells.

  In one embodiment, the present invention provides a method for large-scale production of antigen-pulsed dendritic cell vaccines. In one embodiment, the method comprises rapidly maturating dendritic cells, cryopreserving the dendritic cells, and thawing the cryopreserved cells, wherein the thawed dendritic cells The cells produce an amount of at least one cytokine effective to generate a T cell response.

  In one embodiment, maturation of dendritic cells comprises contacting the cells with IFN-γ and LPS.

  In one embodiment, the thawed cells maintain a DC1 phenotype and drive a Th1 polarized immune response.

  In one embodiment, the thawed cells maintain the ability to primarily sensitize T cells.

Generation of Loaded (Pulsed) Immune Cells The present invention includes cells that have been exposed to or “pulsed” with an antigen. For example, APCs such as DC can be Ag loaded, for example, in vitro by culturing ex vivo in the presence of antigen or in vivo by exposure to antigen.

  One skilled in the art will also readily appreciate that APC can be “pulsed” in a manner that exposes the APC to the antigen for a time sufficient to facilitate presentation of the antigen on the surface of the APC. For example, APC can be exposed to an antigen in the form of a small peptide fragment known as an antigenic peptide and directly “pulsed” outside of the APC (Melita-Damani et al., 1994), or APC is It can be incubated with whole protein or protein particles, which are then digested by APC. All these proteins are digested into small peptide fragments by APC and finally transported to the APC surface for presentation (Cohen et al., 1994). Antigens in the form of peptides can be exposed to cells by the standard “pulse” technique described herein.

  While not wishing to be bound by any particular theory, foreign or autoantigen forms of the antigen are processed by the APC of the present invention to retain the immunogenic form of the antigen. An immunogenic form of an antigen includes the meaning of processing the antigen by fragmentation to produce a form of the antigen that can be recognized and stimulated by immune cells, eg, T cells. Preferably, such foreign antigens or autoantigens are proteins that are processed into peptides by APC. Related peptides produced by APC can be extracted and purified for use as immunogenic compositions. Peptides processed by APC can also be used to induce tolerance to proteins processed by APC.

  Antigen-loaded APC, also known as “pulse APC” of the present invention, is generated by exposing APC to an antigen in vitro or in vivo. When APC is pulsed in vitro, the APC is sown in a culture dish and exposed to the antigen for a sufficient amount of time for the antigen to bind to the APC. The amount and time required to achieve binding of the antigen to APC can be determined by using methods known in the art or disclosed herein. Other methods known to those skilled in the art, such as immunoassays or binding assays, can be used to detect the presence of an antigen on APC after exposure to the antigen.

  In a further embodiment of the invention, APC can be transfected with a vector that allows expression of a particular protein by APC. The protein expressed by APC is then processed and presented on the cell surface. The transfected APC can then be used as an immunogenic composition to generate an immune response against the protein encoded by the vector.

  As discussed elsewhere herein, vectors are prepared to contain specific polynucleotides that encode and express proteins for which an immunogenic response is desired. Preferably, retroviral vectors are used to infect cells. More preferably, an adenoviral vector is used to infect cells.

  In another embodiment, the vector modifies the viral vector to encode a protein or portion thereof that is recognized by a receptor on APC, whereby occupation of the APC receptor by the vector reduces vector endocytosis. APC can be targeted by initiating and allowing processing and presentation of the antigen encoded by the nucleic acid of the viral vector. The nucleic acid delivered by the virus may be natural for the virus, which when expressed on APC is then processed and presented on the AHC MHC receptor.

  As contemplated herein, a variety of methods can be used to transfect a polynucleotide into a host cell. The methods include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, colloidal dispersion (ie macromolecular complexes, nanocapsules, microspheres, beads and oil-in-water emulsions, micelles, mixed micelles) And lipid based systems, including but not limited to liposomes). These methods are understood in the art and are described in the published literature so that those skilled in the art can perform these methods.

  In another embodiment, an antigen-encoding polynucleotide can be cloned into an expression vector and the vector introduced into the APC in order to generate charged APC in another way. Various types of vectors and methods for introducing nucleic acids into cells are discussed in the available published literature. For example, an expression vector can be transfected into a host cell by physical, chemical or biological means. For example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Mol. It will be readily appreciated that the introduction of an expression vector comprising a polynucleotide encoding an antigen results in a pulsed cell.

  The present invention includes various methods for pulsing APC including, but not limited to, loading APC with a whole antigen in the form of protein, cDNA or mRNA. However, it should not be understood that the present invention is limited to the particular form of antigen used to pulse APC. Rather, the present invention encompasses other methods known in the art for generating antigen-loaded APCs. Preferably, APCs are transfected with mRNA encoding a defined antigen. MRNA corresponding to a gene product whose sequence is known can be readily generated in vitro using reverse transcriptase-polymerase (RT-PCR) combined with appropriate primers and transcription reaction. Transfection of APC with mRNA is advantageous over other antigen loading techniques for generating pulsed APC. For example, the ability to amplify RNA from microscopic amounts of tissue, ie tumor tissue, opens up the use of APC for vaccination of a large number of patients.

  In order for an antigen composition to be useful as a vaccine, the antigen composition must induce an immune response to the antigen in a cell, tissue or mammal (eg, a human). As used herein, an “immunological composition” expresses or presents an antigen (eg, a peptide or polypeptide), a nucleic acid encoding the antigen (eg, an antigen expression vector), or an antigen or cellular component. Cells may be included. In a specific embodiment, the antigen composition comprises or encodes all or a portion of any antigen described herein, or an immunofunctional equivalent thereof. In other embodiments, the antigen composition is in a mixture comprising additional immunostimulatory agents or nucleic acids encoding such agents. Immunostimulatory agents include, but are not limited to, additional antigens, immunomodulators, antigen presenting cells or adjuvants. In other embodiments, one or more additional agent (s) are covalently bound to the antigen or immunostimulatory agent in any combination. In certain embodiments, the antigen composition is conjugated to or comprises an anchor motif amino acid of HLA.

  The vaccines contemplated herein can differ in terms of their nucleic acids and / or cellular components. In a non-limiting example, the nucleic acid encoding the antigen can also be formulated with an adjuvant. Of course, it is understood that the various compositions described herein may further include additional components. For example, one or more vaccine components can be included in a lipid or liposome. In another non-limiting example, the vaccine can include one or more adjuvants. The vaccine of the present invention and its various components can be prepared and / or administered by any method disclosed herein or known to those of skill in the art in light of this disclosure.

  The antigen composition of the present invention is chemically synthesized by solid phase synthesis and purified by HPLC from other products of chemical reaction, or a nucleic acid sequence (eg, DNA sequence) encoding a peptide or polypeptide containing the antigen of the present invention It is understood that can be made by methods well known in the art, including, but not limited to, in vitro translation systems or production by expression in living cells. In addition, the antigen composition can include cellular components isolated from a biological sample. The antigen composition is isolated, dialyzed on a large scale to remove one or more undesirable low molecular weight molecules, and / or lyophilized for easier formulation in the desired vehicle. . If present, it is further understood that it is preferred that amino acid additions, mutations, chemical modifications, etc. performed in the vaccine component do not substantially interfere with antigen recognition of the epitope sequence.

  Peptides or polypeptides corresponding to one or more antigenic determinants of the invention generally must be at least 5 amino acid residues or 6 amino acid residues in length, with a maximum of about 10, about 15, It may comprise about 20, about 25, about 30, about 35, about 40, about 45 or about 50 residues. Peptide sequences are described, for example, in Applied Biosystems, Inc. , Foster City, CA (Foster City, CA) and can be synthesized by methods known to those skilled in the art such as peptide synthesis using an automated peptide synthesizer.

  Longer peptides or polypeptides can also be prepared, for example, by recombinant means. In certain embodiments, for example, encoding the antigen compositions and / or components described herein to generate antigen compositions for the various compositions and methods of the invention in vitro or in vivo. Nucleic acids can be used. For example, in certain embodiments, the nucleic acid encoding the antigen is contained, for example, in a vector in a recombinant cell. The nucleic acid can be expressed to produce a peptide or polypeptide that includes an antigenic sequence. The peptide or polypeptide can be secreted from the cell or contained as part of or within the cell.

  In certain embodiments, an immune response can be enhanced by transforming or inoculating a mammal with a nucleic acid encoding an antigen. One or more cells contained within the target mammal then express the sequence encoded by the nucleic acid after administration of the nucleic acid to the mammal. A vaccine can also be in the form of a nucleic acid (eg, cDNA or RNA) encoding, for example, all or part of the peptide or polypeptide sequence of the antigen. In vivo expression by nucleic acids can be, for example, by a plasmid type vector, a viral vector or a virus / plasmid construct vector.

  In another embodiment, the nucleic acid comprises a coding region that encodes all or part of a sequence encoding a suitable antigen or immunological functional equivalent thereof. Of course, the nucleic acid may include and / or encode additional sequences, including but not limited to those including one or more immunomodulatory agents or adjuvants.

Antigens As contemplated herein, the present invention may include the use of any antigen suitable to be loaded into the APC to elicit an immune response. In one embodiment, tumor antigens can be used. Tumor antigens can be divided into two broad categories: common tumor antigens; and unique tumor antigens. While common antigens are expressed by many tumors, unique tumor antigens can be attributed to mutations induced by physical or chemical carcinogens and are therefore expressed only by individual tumors. In certain embodiments, a common tumor antigen is loaded into the DC of the invention. In other embodiments, a unique tumor antigen is loaded into the DC of the invention.

  In the context of the present invention, “tumor antigen” refers to an antigen common to a particular hyperproliferative disorder. In certain embodiments, the hyperproliferative disorder antigen of the invention is a primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia, uterine cancer, cervix Derived from cancers including, but not limited to, adenocarcinoma such as cancer, bladder cancer, kidney cancer and breast cancer, prostate cancer, ovarian cancer, pancreatic cancer.

  Malignant tumors express a number of proteins that can serve as target antigens for immune attack. These molecules include, but are not limited to, tissue specific antigens such as MART-1, tyrosinase and GP100 in melanoma and prostate acid phosphatase (PAP) and prostate specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 / Neu / ErbB-2. Yet another group of target antigens are oncofetal antigens such as carcinoembryonic antigen (CEA). In B-cell lymphomas, tumor-specific idiotype immunoglobulins constitute truly tumor-specific immunoglobulin antigens that are unique to individual tumors. B cell differentiation antigens such as CD19, CD20 and CD37 are other candidates for target antigens in B cell lymphomas. Some of these antigens (CEA, HER-2, CD19.CD20, idiotype) have been used as targets for passive immunotherapy with monoclonal antibodies without great success.

  Tumor antigens and their antigenic cancer epitopes can be purified and isolated from natural sources such as primary clinical isolates, cell lines. Cancer peptides and their antigenic epitopes can also be obtained by chemical synthesis or by recombinant DNA techniques known in the art. Techniques for chemical synthesis are described in Steward et al. (1969); Bodansky et al. (1976); Meienhofer (1983); and Schroder et al. (1965). Furthermore, as described in Renkvist et al. (2001), many antigens are known in the art. Although analog or artificially modified epitopes are not specifically described, those skilled in the art will recognize how to obtain or generate them by standard means in the art. Other antigens identified by antibodies and detected by the Serex method (see Sahin et al. (1997) and Chen et al. (2000)) are confirmed in the Ludwig Institute for Cancer Research database.

  In yet another embodiment, the present invention may include a microbial antigen for presentation by APC. The microbial antigens considered herein can be of viral, bacterial or fungal origin. Examples of infectious viruses include: Retroviridae (eg, human immunodeficiency viruses such as HIV-1 or HIV-III (also referred to as HTLV-III, LAV or HTLV-III / LAV); and other such as HIV-IP Isolated strain); Picoraviridae (eg, poliovirus, hepatitis A virus; enterovirus, human coxsackie virus, rhinovirus, echovirus); Calciviridae (eg, strain causing gastroenteritis); Togaviridae (eg, equine encephalitis virus, rubella) Flavividae (eg, dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (eg, coronavirus); Rhabdoviridae For example, vesicular stomatitis virus, rabivirus); Filoviridae (eg, Ebola virus); Paramyxoviridae (eg, parainfluenza virus, mumps virus, measles virus, respiratory polynuclear virus); Orthomyxobiridae (eg, influenza virus); Bungavirid For example, Hunter virus, bunyavirus, flavovirus and nairovirus); Arena viridae (hemorrhagic fever virus); Reoviridae (eg reovirus, orbivirus and rotavirus); Birnaviridae; Hepadnaviridae (hepatitis B virus); Parvovirvovirus ; Papovaviridae ( Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) types 1 and 2, varicellazoster virus, cytomegalovirus (CMV), herpesvirus); Poxviridae Auravirus, vaccinia virus, poxvirus); and Iridoviridae (eg, African swine fever virus); and unclassified virus (eg, causative agent of spongiform encephalopathy, considered a defective satellite of hepatitis B virus) Pathogen, non-A, non-B hepatitis (class 1 = internally infected; class 2 = parenterally infected (ie, hepatitis C)); Norwalk and related viruses, and ast Virus), and the like.

  Examples of infectious bacteria: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (..... For example, M tuberculosis, M avium, M intracellulare, M kansasii, M gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus)), Streptococcus agalactiae (Group B Str. ptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp. Enterococcus sp. Haemophilus influenzae, Bacillus anthracis, corynebacterium diphtheriae, corynebacterium sp. , Erysiperothrix rhusiopathiae, Clostridium perfiringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multoclet. , Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema Treponema pertenue, Leptospira and Actinomyces israeliii.

  Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (ie, protists), including Plasmodium falciparum and Toxoplasma gondii.

DC activation A conventional DC-based vaccine that ultimately stimulates aseptic inflammation (predominantly in clinical trials) is a cytokine comprising a combination of TNF, IL-6, PGE2 and IL-1β While consisting of mature DCs generated using a cocktail mixture, in order to mature DCs and stimulate signal generation, the present invention instead utilizes TLR agonists.

  According to one aspect of the present invention, stimulation of DC with a combination of TLR ligands leads to an increase in IL-12 production. Furthermore, DC activation by a combination of TLR agonists results in a more pronounced CD4 and CD8 T cell response (Warger et al., 2006, Blood, 108: 544-550). Thus, DCs of the invention can secrete Th1-driven cytokines such as IL-12 upon exposure to these ligands that induce TLRs. For example, the addition of poly (I: C), a TLR3 agonist to IL-1β, TNF-α and IFN-γ, produces a strong type 1 polarized DC characterized by stable levels of IL-12 production (Heifler et al., 1996, Eur. J. Immunol., 26: 659-668). In certain embodiments, the antigen is loaded onto the DC prior to exposure to the TLR agonist. In other embodiments, the antigen can be loaded into the DC following exposure to the TLR agonist.

  According to one aspect of the invention, multiple dose antigens for injection are obtained by collecting DCs in leukocyte removal of a single patient, where the cells are activated by a biomolecule that stimulates bacterial infection (eg, LPS). A pulsed dendritic cell vaccine is produced. This unique activation method confers qualities to DCs that are not found in DCs matured by cytokine cocktails of TNF, IL-6, PGE2 and IL-1β (“conventional maturation”), which is aseptic. It also stimulates sexual inflammation (Lombardi et al., 2009, J. Immunol., 182: 3372-3379).

  In one embodiment, the DCs of the invention can be activated by a combination of a TLR4 agonist, a bacterial lipopolysaccharide (LPS), a TLR7 / 8 agonist, a resimid (R848), and / or IFN-γ. (Amati et al, 2006, Curr. Pharm. Des 12: 4247-4254). Activation of DCs with TLR4 agonists and bacterial LPS generates DCs that are at least substantially (phenotypically) identical to DC1 generated via conventional maturation methods. These DCs highly express surface molecules including CD83, CD80, CD86 and HLA-DR. In other embodiments, a TLR2 agonist such as lipoteichoic acid (LTA), a TLR3 agonist such as poly (I: C) and / or a TLR4 agonist such as MPL may be used. As contemplated herein, any TLR agonist or combination of TLR agonists can activate DCs, provided that such ligands stimulate the generation of cytokines and chemokine signals by activated DCs. Can be used. Many other TLR agonists are known in the art for use according to the present invention and can be found in the published literature.

  Even though there are phenotypic similarities between DCs and DCs matured in a conventional manner, the DCs of the present invention exhibit many significant advantages.

Cryopreservation After initiation and activation of the cells, the cells are harvested and the vaccine is cryopreserved. For example, peripheral blood monocytes are obtained by leukocyte removal. The cells are cultured for a period of time in serum free medium containing GM-CSF and IL-4, followed by a pulse of cells with the desired antigen. After pulsing the cells with the desired antigen, the antigen-pulsed dendritic cells are incubated with IFN-γ followed by a TLR agonist (eg, LPS). Activated antigen-pulsed dendritic cells are collected, cryopreserved in cryopreservation medium, and stored in liquid nitrogen. In one embodiment, the cryopreservation medium comprises 55% plasma light, 40% human serum albumin and 5% DMSO.

  The cryopreservation aspect of the present invention allows the generation of FDA approved multi-dose antigen pulsed dendritic cell vaccines for injection. An advantage of the present invention is that multi-dose antigen-pulsed dendritic cells retain their ability to generate a signal critical to T cell function after thawing. As contemplated herein, the present invention includes a variety of cryopreservation techniques and cryopreservation media that will be understood by those skilled in the art. For example, in certain embodiments, the cryopreservation medium comprises 55% plasma light, 40% human serum albumin and 5% DMSO. Thus, the present invention provides the ability to produce a multi-dose antigen-pulsed dendritic cell vaccine of the present invention, including an initial immunization dose and multiple “booster” doses, in a concentrated area. Thus, multi-dose antigen pulsed dendritic cell vaccines can be shipped to remote medical centers for continuous administration to patients at the point of administration without requiring special FDA quality control / quality assurance requirements. it can.

In one embodiment, the dendritic cell vaccine of the invention is cryopreserved in aliquots for multiple administrations. For example, the cells are stored frozen at a concentration of 30 × 10 ⁶ cells / mL. For example, a cryopreservation medium bag having a volume equal to the cell volume is prepared. While working quickly, a cryopreservation medium is added to the cell bag and the cells are transferred to a labeled cryovial. In one embodiment, the vial is frozen using a rate controlled freezer. For example, frozen vials are frozen at 1 ° C./min using an automatic speed control freezer and stored in gas phase nitrogen.

  In one embodiment, the vial is frozen using a rate controlled freezer. The vial is placed in a cryochamber and liquid nitrogen enters the chamber through an electronic solenoid valve. Since evaporation is almost instantaneous, controlling the rate at which liquid nitrogen enters the chamber directly controls the rate at which heat is absorbed and removed from the cryochamber and its contents.

  As contemplated herein, the present invention includes a variety of cryopreservation techniques and cryopreservation media that will be understood by those skilled in the art. For example, in certain embodiments, a cryopreservation medium for cultured cells can include about 55% plasma light, about 40% human serum albumin, and about 5% DMSO. In other embodiments, the cryopreservation medium can be serum free. In certain embodiments, rate-controlled freezing can be used, while other embodiments are cryopreservation media placed in a freezer at a temperature ranging, for example, from about -70 ° C to -80 ° C. The use of a shielded container containing a vial of cells mixed with. The present invention provides a method for preserving activated DCs in a manner that further facilitates the clinical application of such cells and reduces the need to repeat extensive removal methods and elutriation steps. . As contemplated herein, cryopreservation techniques can be used for both small and large batches.

  When considering the widespread use of activated DCs, the ability to provide a stable supply of cryopreserved activated DC represents a significant benefit that can facilitate a variety of therapeutic uses for such cells. For example, large scale cultures of activated DC can be performed according to the methods of the present invention so that individual doses of cells can later be used in any specific immunotherapy protocol and multiple “booster” doses. Can be stored frozen in appropriate sized aliquots. In certain embodiments, the activated DC can be stored frozen at a temperature of about −70 ° C. or lower for 2 to 24 weeks. At lower temperatures, such as about −120 ° C. or less, activated DC can be stored frozen for at least one year or more.

  In one exemplary embodiment, DC are suspended in human serum and about 5% DMSO (v / v). Alternatively, other serum types such as fetal calf serum can be used. Suspended cells can be aliquoted into smaller samples such as 1.8 ml vials and stored at about −70 ° C. or lower. In other embodiments, the cryopreservation medium can include about 20% serum and about 10% DMSO, and the suspended cells can be stored at about -180 ° C. Still further embodiments can include a medium containing about 55% plasma light and about 5% DMSO. Other exemplary cryopreservation media can include about 12% DMSO and about 25-40% serum.

  Although the invention described herein can include specific concentrations of serum, those skilled in the art may vary the exact amount of serum in the cryopreservation medium, and in some embodiments, may be totally different. Although not necessarily present, it should generally be understood to be in the range of about 1% to 30%. Of course, any serum concentration that results in about 50% cell viability and / or about 50% cell recovery rate can be used in any DC composition of the invention, as well as any of those described herein Can be used together with the cryopreservation method. When recovering cryopreserved cells in a selected cryopreservation medium, cell viability and cell recovery rates of preferably at least about 60%, more preferably at least about 70%, or even 80% are desired.

  Similarly, although the invention described herein may include a specific concentration of DMSO, those skilled in the art may not have DMSO at all in some embodiments, but in other embodiments, It should be appreciated that concentrations as high as about 5% to about 20% may be used in cryopreservation media and included in the cryopreservation methods described herein. In general, low concentrations of DMSO, such as between about 5% and about 10%, are preferred. However, after thawing, at least 50% cell viability and at least 50% cell recovery, preferably at least 60%, more preferably about 70%, more preferably about 80% and even more preferably about 90% or more cells. Any concentration of DMSO that results in viability and recovery can be used.

  While the invention described herein may include reference to rate controlled freezing, it will be appreciated by those skilled in the art that freezing methods in a rate controlled or non-rate controlled manner can be routinely used. Should be understood.

  It should also be understood by those skilled in the art that the various cryopreservation media described herein may contain serum or may be serum free. Examples of serum free media include XVIVO 10, XVIVO 15, XVIVO 20, StemPro and any commercially available serum free media. When utilizing serum-free freezing media, the cryopreservation methods of the present invention generally involve infectious agents, antibodies and foreign proteins that may be antigenic, and typically in serum-based freezing media. Does not contain any other foreign molecules found in

  Cryopreservation of the loaded antigen, active DC, can occur at any time after DC activation by the TLR agonist. In one embodiment, activated DC are stored frozen about 6-8 hours after exposure to the TLR agonist. Preferably, the time point chosen for cryopreserving activated cells should be based on maximization of cellular signal generation, particularly IL-12 production.

  The present invention provides compositions and methods for producing large-scale dendritic cell vaccines. In one embodiment, large-scale production of dendritic cell vaccines will produce FDA approved injectable multi-dose antigen pulsed dendritic cell vaccines for personalized treatment and prevention of cancer or other disorders. Make it possible. In one embodiment, the present invention provides compositions and methods for producing large scale antigen pulse type 1 polarized dendritic cell vaccine (DC1).

  In one embodiment, the present invention provides an antigen-loaded and pre-activated state, ie “syringe ready”, ie any additional requiring additional facilities and quality control / assurance steps (eg, by FDA instructions). There is provided a method for cryopreserving large-scale dendritic cells suitable for immediate injection into a patient that does not require any cell processing.

  In one embodiment, the present invention provides a method for efficiently producing an injectable multi-dose antigen pulse dendritic cell vaccine, preferably an injectable multi-dose antigen pulse type 1 polarized dendritic cell vaccine that exhibits maximum efficacy. I will provide a.

Packaging of Compositions or Kit Components Suitable containers for the compositions (or kit components) of the present invention include vials, syringes (eg, disposable syringes) and the like. These containers should be sterile.

  Where the composition / component is placed in a vial, the vial is preferably made of a glass or plastic material. The vial is preferably sterilized before the composition is added. In order to avoid problems with latex sensitive patients, the vial is preferably sealed with a latex-free stopper and preferably no latex is present in all packaging materials. A vial may contain a single dose of vaccine or may contain more than one dose (a “multi-dose” vial), eg, 10 doses. Preferred vials are made of colorless glass.

  The vial is fitted with a cap (eg, luer lock) so that a pre-filled syringe can be inserted into the cap and the syringe contents can be drained into the vial and the vial contents returned to the syringe. Can have. After removal of the syringe from the vial, a needle is then attached and the composition can be administered to the patient. The cap is preferably placed inside the seal or cover so that the seal or cover must be removed before the cap is available. The vial may have a cap that allows aseptic removal of its contents, particularly for multi-dose vials.

  When the composition / component is packed into a syringe, the syringe can have a needle attached to it. If the needle is not attached, another needle can be supplied to the syringe for assembly and use. Such a needle can be stored in the sheath. A safety needle is preferred. 1 inch 23 gauge, 1 inch 25 gauge and 5/8 inch 25 gauge needles are typical. The syringe can be provided with a peelable label that can be printed with lot number, season season and expiration date of contents to facilitate record keeping. The plunger in the syringe preferably has a stopper to prevent the plunger from being inadvertently removed during inhalation. The syringe may have a latex rubber cap and / or plunger. The disposable syringe contains a single dose of vaccine. The syringe generally has a tip cap for peeling off the tip before attaching the needle, and the tip cap is preferably made of butyl rubber. Where the syringe and needle are packaged separately, the needle is preferably provided with a butyl rubber sheath.

  The container can be marked to indicate a half dose volume, for example, to facilitate delivery to a child. For example, a syringe containing a 0.5 ml dose may have a mark indicating a volume of 0.25 ml.

  When glass containers (eg, syringes or vials) are used, it is preferable to use containers made of borosilicate glass rather than soda lime glass.

  The kit or composition can be packaged (eg, in the same box) with a leaflet containing details of the vaccine, eg, instructions for administration, details of antigens within the vaccine, and the like. The instructions may also include warnings such as, for example, keeping a ready-to-use solution of adrenaline in the case of an anaphylactic reaction following vaccination.

Methods for Treating Diseases The present invention also encompasses methods of treatment and / or prevention of pathogenic microorganisms, diseases caused by autoimmune disorders and / or hyperproliferative diseases.

  Diseases that can be treated or prevented by use of the present invention include those caused by viruses, bacteria, yeasts, parasites, protozoa, cancer cells, and the like. The pharmaceutical composition of the present invention can be used as a general-purpose immunostimulant (DC activation composition or system) and thus has use in the treatment of diseases. Representative diseases that can be treated and / or prevented using the pharmaceutical composition of the present invention include HIV, influenza, herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chickenpox Infectious diseases of viral origin such as papillomavirus; Infectious diseases of bacterial origin such as pneumonia, tuberculosis, syphilis; or infectious diseases of parasitic origin such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amebiasis However, it is not limited to that.

  Pre-neoplastic or hyperproliferative conditions that can be treated or prevented using the pharmaceutical compositions of the invention (transduced DCs, expression vectors, expression constructs, etc.) include colon polyps, Crohn's disease, ulcerative colitis, breast lesions, etc. Including, but not limited to.

  Cancers that can be treated using the compositions of the present invention include primary or metastatic melanoma, adenocarcinoma, squamous cell carcinoma, adenosquamous cell carcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Including but not limited to Hodgkin lymphoma, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer, multiple myeloma, neuroblastoma, NPC, bladder cancer, cervical cancer and the like.

  Other hyperproliferative diseases that can be treated using the DC activation system of the present invention are rheumatoid arthritis, inflammatory bowel disease, osteoarthritis, leiomyoma, adenoma, lipoma, hemangioma, fibroma, vascular occlusion, revascularization Includes, but is not limited to, stenosis, atherosclerosis, pre-neoplastic lesions (such as adenomatous hyperplasia, prostate intraepithelial neoplasia), in situ carcinoma, oral hairy leukoplakia or psoriasis.

  Autoimmune disorders that can be treated using the composition of the present invention include AIDS, Addison's disease, adult respiratory distress syndrome, allergy, anemia, asthma, atherosclerosis, tracheitis, cholecystitis, Crohn's disease, ulcerative colitis , Atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, erythema nodosum, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, multiple sclerosis, Myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, polymyositis, rheumatoid arthritis, scleroderma, Sjogren's syndrome and autoimmune thyroiditis; cancer, hemodialysis and extracorporeal circulation Including, but not limited to: viruses, bacteria, fungi, parasites, protozoa and parasite-like infections; and trauma.

  In methods of treatment, administration of the compositions of the present invention can be for either “prevention” or “therapy” purposes. When given prophylactically, in certain embodiments, a vaccine is given after the onset of one or more symptoms to prevent further symptoms from occurring or to prevent current symptoms from worsening. Despite being given, the compositions of the invention are given prior to any symptoms. Prophylactic administration of the composition serves to prevent or ameliorate any subsequent infection or disease. When given therapeutically, the pharmaceutical composition is given at or after the onset of symptoms of infection or disease. Thus, the present invention may be given before any anticipated exposure to a pathogen or disease state or after the onset of an infection or disease.

  An effective amount of the composition is that amount that achieves this selected result of an enhanced immune response, and such amount can be routinely determined by one of ordinary skill in the art. For example, an amount effective to treat a failure of the immune system against a cancer or pathogen is that amount necessary to cause activation of the immune system and result in the generation of an antigen-specific immune response upon exposure to the antigen. sell. The term is also a synonym for “sufficient amount”.

  The effective amount for any particular application may vary depending on factors such as the disease or condition being treated, the particular composition being administered, the size of the subject and / or the severity of the disease or condition. . One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.

Therapeutic applications The present invention includes the generation of antigen-loaded activated APCs that, when thawed from cryopreservation, produce significant levels of cytokines and chemokines, where the loaded antigen and activated APC are Used in the immunotherapy of mammals, preferably humans. The response to the antigen presented by the APC can be measured by monitoring the cytolytic T cell response, helper T cell response, and / or antigen response to the antigen using methods known in the art. .

  The present invention relates to a method of enhancing an immune response in a mammal, comprising generating immature DC from monocytes obtained from a mammal (eg, a patient); immature DC is converted into an antigenic composition. Activating the antigen-loaded DC with at least one TLR agonist; thawing the activated, antigen-loaded DC and then activating the antigen-loaded DC Administering a DC to a mammal in need thereof. The composition comprises at least one antigen and may further be a vaccine for ex vivo immunization and / or in vivo treatment in a mammal. Preferably the mammal is a human.

  Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, the cells are isolated from a mammal (preferably a human). The cells are administered to the mammalian recipient to provide a therapeutic effect. The mammalian recipient can be a human and the cell can be autologous with respect to the recipient. Alternatively, the cells can be allogeneic, syngeneic or xenogeneic with respect to the recipient.

  In one embodiment, peripheral blood monocytes are obtained from the patient by a combination of leukocyte removal and elutriation. Monocytes can be cultured overnight in SFM containing GM-CSF and IL-4. The next day, immature DCs are pulsed with the antigen, which can then be contacted with IFN-γ and LPS. Activated DC are then suspended in cryopreservation medium and frozen until ready for use in immunotherapy.

  Cryopreserved DC can be cultured ex vivo under conditions effective to produce percent cell recovery and survival comparable to newly activated DCs. DCs generated from cryopreserved samples can show the same stability as freshly prepared DCs. Furthermore, comparison of cryopreserved mature DC with freshly prepared DC can show substantially identical phenotype as well as signal generation profile. As considered herein, DCs are about 2 in both the small and large scales at various temperatures of about −70 ° C. to −80 ° C. in the various cryopreservation media described herein. Can be stored for ~ 24 weeks. At temperatures below about −120 ° C., the storage time can be extended indefinitely or beyond at least 24 weeks without affecting DC cell recovery, viability and functionality. For example, in certain embodiments, activated cells can be stored for at least one year and still retain their ability to generate a signal after thawing. As described throughout this specification, the present invention provides an effective recovery and survival profile upon cell thawing, and further, the cryopreservation conditions described herein allow DCs to retain their signal profile. Does not affect the ability to do.

  In an exemplary embodiment, cryopreservation resuspends cells in cryopreservation medium containing about 55% plasma light, about 40% human serum albumin and about 5% DMSO after DC activation. Can be implemented. The mixture is then aliquoted into 1.8 ml vials and frozen at about −80 ° C. overnight in a freezing chamber. The next day, the vial can then be transferred to a liquid nitrogen tank. After about 2-24 weeks of cryopreservation, frozen DCs can be thawed and examined for their recovery and viability. The recovery rate of such DC can be about 70% or more and the survival rate can be about 70% or more. In other embodiments, even DCs or monocytes can be cryopreserved prior to cell activation.

  Alternatively, a procedure for ex vivo expansion of hematopoietic stem cells and progenitor cells is described in US Pat. No. 5,199,942, which is hereby incorporated by reference in its entirety. Can be applied to any cell. In addition to the cell growth factors described in US Pat. No. 5,199,942, other factors such as flt3-L, IL-1, IL-3 and c-kit ligands are used for cell culture and proliferation. It can be used.

  A variety of cell selection techniques are known for identifying and isolating cells from a cell population. For example, monoclonal antibodies (or other specific cell binding proteins) can be used to bind to marker proteins or surface antigen proteins found on cells. Several such markers or cell surface antigens are known in the art.

Vaccine formulation The present invention further comprises a vaccine formulation suitable for use in immunotherapy. In certain embodiments, the vaccine formulation is used for the prevention and / or treatment of diseases such as cancer and infectious diseases. In one embodiment, administration of a vaccine according to the invention for the prevention and / or treatment of cancer to a patient is performed before or after surgery to remove the cancer, before chemotherapy for the treatment of cancer or After and before or after radiation therapy for the treatment of cancer, and any combination thereof. In other embodiments, the vaccine formulation may be administered in combination with or in combination with another composition or pharmaceutical product. It should be understood that the present invention can also be used to prevent cancer in individuals who do not have cancer but may be at risk of developing cancer.

  Administration of cancer vaccines prepared according to the present invention is broadly applicable to cancer prevention or treatment, which is determined in part by the selection of antigens that form part of the cancer vaccine. Cancers that can be suitably treated according to the practice of the present invention include, but are not limited to, lung, breast, ovary, cervix, colon, head and neck, pancreas, prostate, stomach, bladder, kidney, bone, liver , Cancer of the esophagus, brain, testis, uterus and various leukemias and lymphomas.

  In one embodiment, the vaccine according to the invention can be derived from the tumor or cancer cell to be treated. For example, in the treatment of lung cancer, lung cancer cells are treated as described above to produce a lung cancer vaccine. Similarly, breast cancer vaccines, colon cancer vaccines, pancreatic cancer vaccines, gastric cancer vaccines, bladder cancer vaccines, kidney cancer vaccines, etc., depending on practices for the prevention and / or treatment of tumors or cancer cells from which the vaccines were produced, Produced and adopted as an immunotherapeutic agent.

  In another embodiment, the vaccine according to the present invention is prepared by collecting the relevant antigens excreted by the pathogen into the medium to treat various infectious diseases affecting mammals as described in β You can also Due to heterogeneity in the types of immunogenic and protective antigens expressed by different organisms that cause the same disease, by preparing a vaccine from a pool of organisms that express different important antigens, A vaccine can be prepared.

  In another embodiment of the invention, the vaccine can be administered by intralymphatic injection into the groin lymph node. Alternatively, the vaccine can be administered intradermally or subcutaneously to the limbs, upper limbs and lower limbs of the patient being treated, depending on the vaccine target. In general, this approach is satisfactory for melanoma and other cancers, including prevention or treatment of infectious diseases, but other routes of administration such as intramuscular or in the bloodstream can also be used. .

  Further, the vaccine can be given with adjuvants and / or immunomodulators to enhance vaccine activity and patient response. Such adjuvants and / or immunomodulators are understood by those skilled in the art and are readily described in the available published literature.

  As contemplated herein, depending on the type of vaccine being produced, the production of the vaccine may optionally be suitable for growing cells in a bioreactor or fermentor or in bulk. It can be scaled up by culturing the cells in a container or device. In such a device, the medium is collected regularly, frequently or continuously in order to recover such material or antigen before any material or antigen is degraded in the medium.

  If desired, devices or compositions containing vaccines or antigens produced and recovered by the present invention and suitable for sustained or intermittent release are actually relatively slow into the body of such materials. Or it may be implanted in the body or administered locally for timed release.

  Other steps in vaccine preparation can be individualized to meet specific vaccine requirements. Such additional steps will be understood by those skilled in the art. For example, some collected antigenic material can be concentrated, in some cases treated with detergent, and ultracentrifuged to remove alloantigens in the transplant.

Combination Therapy The present invention provides an effective therapy for treating cancer, wherein the therapy alters the immune response in the tumor such that immune cells at the tumor site are more effective at attacking tumor cells. Including. In some cases, effective therapies include improving immune cell migration and activity at the tumor site. In one embodiment, the present invention provides compositions and methods of using a dendritic cell vaccine in combination with one or more inhibitors of HER2 and HER3 as a treatment regimen for treating cancer. In another embodiment, the treatment regimen includes the use of dendritic cell vaccines, one or more inhibitors of HER2 and HER3, and chemokine modulating agents. In one embodiment, the chemokine modulating agent is a chemokine activator. An example of a chemokine activator is a TLR8 agonist.

  In one embodiment, the present invention provides compositions and methods using a dendritic cell vaccine in combination with HER-2 and HER-3 blockade as a treatment regimen for treating cancer. In another embodiment, the present invention provides compositions and methods using dendritic cell vaccines in combination with blocking HER-2 and HER-3 by TNF-α and IFN-γ. In another embodiment, the present invention provides compositions and methods that block both HER-2 and HER-3 by TNF-α and IFN-γ as a treatment regimen for treating cancer.

  In one embodiment, the treatment regimen of the present invention can be used to treat cancer and can therefore be considered a type of anti-cancer therapy. In another embodiment, the treatment regimen of the present invention comprises surgery, chemotherapy, radiation therapy (eg, X-ray), gene therapy, immunotherapy, hormone therapy, viral therapy, DNA therapy, RNA therapy, protein therapy, cell therapy. And can be used in the context of combination therapy with another anti-cancer or anti-tumor therapy, including but not limited to nanotherapy.

  In one embodiment, the present invention includes a treatment regimen of the present invention in combination with another cancer medicament for the treatment or prevention of cancer in a subject. Other cancer medicaments are administered in synergistic amounts or with varying doses or with varying time schedules with the treatment regimen of the present invention. The invention also relates to kits and compositions relating to the combination of only the treatment regimen of the invention or the combination with the desired cancer medicament.

  In one embodiment, the treatment regimen of the present invention is used prior to receiving another anticancer therapy. In another embodiment, the treatment regimen of the invention is used concurrently with receiving another anti-cancer therapy. In another embodiment, the treatment regimen of the present invention is used after receiving another anti-cancer therapy.

  In some embodiments, the present invention provides a method of treating ER negative breast cancer in a subject. In some embodiments, the present invention provides a method of treating breast cancer that is ER negative and HER2 positive in a subject. In some embodiments, the breast cancer is metastatic breast cancer. In some embodiments, the breast cancer is in stage I, stage II or stage III.

  In another embodiment, the treatment regimen of the present invention can be used in combination with existing therapeutic agents used to treat cancer. In order to evaluate the potential therapeutic efficiency of the treatment regimen of the present invention in combination with an anti-tumor therapeutic agent as otherwise described herein, these combinations were tested for anti-tumor activity according to methods known in the art. Can be done.

  In one aspect, the present invention can be used in conjunction with therapeutic agents such as, but not limited to, chemotherapeutic agents, anti-cell proliferative agents or any combination thereof.

  The present invention should not be limited to any specific chemotherapeutic agent. Rather, any chemotherapeutic agent can be used with the treatment regimen of the present invention. For example, the following non-limiting representative classes: alkylating agents; nitrosourea; antimetabolites; antitumor antibiotics; plant alkaloids; taxanes; any conventional chemotherapy of hormonal agents and miscellaneous agents Agents are included in the present invention.

  Alkylating agents do so because of their ability to load many electronegative groups under conditions present in the cell, thereby preventing DNA replication and preventing cancer cells from growing. Named. Most alkylating agents are nonspecific for the cell cycle. In certain embodiments, they stop tumor growth by cross-linking guanine bases in the DNA duplex strand. Non-limiting examples include busulfan, carboplatin, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, ifosfamide, mechlorethamine, hydrochloride, melphalan, procarbazine, thiotapere and uracil mustard.

  Antimetabolites prevent the incorporation of bases into DNA during the synthetic (S) phase of the cell cycle and inhibit normal development and division. Non-limiting examples of antimetabolite drugs include drugs such as 5-fluorouracil, 6-mercaptopurine, capecitabine, cytosine arabinoside, floxuridine, fludarabine, gemcitabine, methotrexate and thioguanine.

  In general, there are a variety of antitumor antibiotics that prevent cell division by interfering with enzymes required for cell division or by changing the membrane surrounding the cell. Included in this class are anthracyclines such as doxorubicin that prevent cell division by disrupting the structure of DNA and terminating its function. These agents are nonspecific for the cell cycle. Non-limiting examples of anti-tumor antibiotics include dactinomycin, daunorubicin, doxorubicin, idarubicin, mitomycin-C and mitoxantrone.

  Plant alkaloids inhibit enzymes that prevent or stop mitosis or prevent cells from making proteins necessary for cell growth. Often used plant alkaloids include vinblastine, vincristine, vindesine and vinorelbine. However, the present invention should not be construed as limited to only these plant alkaloids.

  Taxanes affect cell structures called microtubules that are important in cell function. In normal cell growth, microtubules are formed when cells begin to divide, but once the cells stop dividing, the microtubules are disassembled or destroyed. Taxanes prohibit disassembly of microtubules so that cancer cells become too clogged with microtubules and cannot grow and divide. Non-limiting representative taxanes include paclitaxel and docetaxel.

  Hormonal agents and hormone-like drugs are utilized for certain types of cancer including, for example, leukemia, lymphoma and multiple myeloma. They are often employed with other types of chemotherapeutic agents to increase their effectiveness. Sex hormones are used to alter the action or production of female or male hormones and are used to slow the growth of breast, prostate and endometrial cancers. Inhibiting the production of these hormones (aromatase inhibitors) or inhibiting the action (tamoxifen) can often be used as a therapeutic aid. Some other tumors are also hormone dependent. Tamoxifen is a non-limiting example of a hormonal agent that interferes with the activity of estrogens that promote the growth of breast cancer cells.

  The miscellaneous agents include chemotherapeutic agents such as bleomycin, hydroxyurea, L-asparaginase and procarbazine, which are also useful in the present invention.

  Anti-cell proliferating agents can be further defined as apoptosis-inducing agents or cytotoxic agents. The apoptosis-inducing agent can be granzyme, a member of the Bcl-2 family, cytochrome C, caspase or a combination thereof. Typical granzymes include Granzyme A, Granzyme B, Granzyme C, Granzyme D, Granzyme E, Granzyme F, Granzyme G, Granzyme H, Granzyme I, Granzyme J, Granzyme K, Granzyme L, Granzyme M, Granzyme N or those The combination of is mentioned. In other specific embodiments, a member of the Bcl-2 family is, for example, Bax, Bak, Bcl-Xs, Bad, Bid, Bik, Hrk, Bok or combinations thereof.

  In a further aspect, the caspase is caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13, caspase 14 or them It is a combination. In certain embodiments, the cytotoxic agent is TNF-α, gelonin, prodigiosin, ribosome inhibitory protein (RIP), Pseudomonas exotoxin, Clostridium difficile toxin B, Helicobacter pylori pentylamine, V. Irofulvene, Diptheria toxin, mitogillin, ricin, botulinum toxin, cholera toxin, saporin 6 or combinations thereof.

  In one embodiment, the treatment regimen of the present invention is used with an anti-tumor agent, wherein the anti-tumor agent is an anti-tumor alkylating agent, an anti-tumor antimetabolite, an anti-tumor antibiotic, a plant-derived anti-tumor agent. Tumor agent, antitumor platinum complex, antitumor camptothecin derivative, antitumor tyrosine kinase inhibitor, monoclonal antibody, interferon, biological response modifier, hormonal antitumor agent, antitumor virus agent, angiogenesis inhibitor, Differentiation inducer, PI3K / mTOR / AKT inhibitor, cell cycle inhibitor, apoptosis inhibitor, hsp90 inhibitor, tubulin inhibitor, DNA repair inhibitor, anti-angiogenic agent, receptor tyrosine kinase inhibitor, topoisomerase inhibitor , Taxanes, agents targeting Her-2, hormone antagonists, agents targeting growth factor receptors Is a pharmaceutically acceptable salt thereof. In some embodiments, the anti-tumor agent is cytabine, capecitabine, valopicitabine or gemcitabine. In some embodiments, the anti-tumor agent is Avastin, Sutent, Nexavar, Recentin, ABT-869, Axinitib, Irinotecan, topotecan, paclitaxel, docetaxel, lapatinib, Herceptin, lapatinib, steroid steroid Selected from the group consisting of a systemic aromatase inhibitor, Fluvestrant, an inhibitor of epidermal growth factor receptor (EGFR), Cetuximab, Panitimab, an inhibitor of insulin-like growth factor 1 receptor (IGF1R), and CP-751871.

  In one embodiment, the anti-tumor agent is a chemotherapeutic agent. As used herein, chemotherapeutic agents are chemical compounds useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotaper and cyclophosphamide (CYTOXAN); alkyl sulfonates such as busulfan, improsulfan and piperosulfan; aziridines such as benzodopa, carbocon, methredopa and ureodopa; , Ethyleneimine and methylamylamine including triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethyllolomelamine; acetogenin (especially bratacin and bratacinone); delta-9-tetrahydrocannabinol (dronabinol) , MARINOL); beta-lapachone; lapachol; Ruchtin; betulinic acid; (synthetic analog topotecan (HYCAMTIN), CPT-11 (including irinotecan, CAMTOSAR), acetylcamptothecin, scopolectin and 9-aminocamptothecin) camptothecin; bryostatin; calistatin; (its adzelesin, calzeresin and biselecin synthetic analogs) CC-1065; podophyllotoxin; podophyllic acid; teniposide; cryptophycin (especially cryptophycin 1 and cryptophycin 8); dolastatin (including synthetic analogs, KW-2189 and CB1-TM1) duocarmycin Eluterobin; pancratistatin; sarcodictin; sponge statin; chlorambucil, chlornafadin, Nitrogen mustards such as lolophosphamide, estramustine, ifosfamide, mechloretamine, mechloretamine oxide hydrochloride, melphalan, novembicin, phenesterin, predonimustine, trophosphamide, uracil mustard; Nitrosoureas such as; Endiyne antibiotics (see, for example, calicheamicin, in particular calicheamicin gamma II and calicheamicin omega II (see, eg, Agnew, Chem Intl. Ed. Engl, 33: 183-186 (1994)) Dynemicin including dynemicin A; esperamicin; and neocardinostatin ( Antibiotics such as lomophore and related chromoprotein enediyne antibiotics chromophore), aclacinomycin, actinomycin, anthramycin, azaserine, bleomycin, kactinomycin, carabicin, carminomycin, cardinophyllin, chromomycin, dactino Mycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, (ADRIAMYCIN, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HCl liposome injection (DOXIL), liposomal doxorubicin TLC D- 99 (MYOCET), pegylated liposomal doxorubicin (CAELYX) and deoxyxorubicin Mitomycin such as doxorubicin, epirubicin, esorubicin, idarubicin, marcelomycin, mitomycin C, mycophenolic acid, nogaramycin, olivomycin, pepromycin, podophylomycin, puromycin, keramycin, rhodorubicin, streptonigrin, streptozocin, tubercidin, Antimetabolites such as Ubenimex, Dinostatin, Zorubicin; Methotrexate, Gemcitabine (GEMZAR), Tegafur (UFTORAL), Capecitabine (XELODA), Epothilone and 5-Fluorouracil (5-FU); Analogs: fludarabine, 6-mercaptopurine, thiamipurine, thioguani Purine analogs such as amcitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxyfluridine, enositabine, floxuridine and other anti-adrenals such as aminoglutethimide, mitotane and trilostane; folic acid such as folinic acid Acegraton; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; vestlabcil; bisantrene, edatraxate; defafamine; demecorsin; diazicon; Ethoglucid; gallium nitrate; hydroxyurea; lentinan; lonidinine; Maytansinoids, such as ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenmet; pirarubicin; rosoxanthrone; 2-ethylhydrazide; procarbazine, PSK polysaccharide product, JHS National Products, . Razoxan; Rhizoxin; Schizophyllan; Spirogermanium; Tenuazonic acid, Triadicon; 2,2 ', 2 "-Trichlorotriethylamine; Trichothecene (especially T-2 toxin, Veraculin A, Loridin A and Anguidine); Urethane; Dacarbazine; Mannomustine Mitoblonitol; mitactol; pipobroman; gacytosine; arabinoside ("Ara-C"); thiotaper; taxoids such as paclitaxel (TAXOL), paclitaxel albumin-modified nanoparticle E (ABRA) Docetaxel (TAXOTERE); chlorambucil; 6-thioguanine; mercaptopurine; methotrexate; cisplatin, o Platinum agents such as saliplatin and carboplatin; Vincas, including vinblastine (VELBAN), vincristine (ONCOVIN), vindesine (ELDISINE, FILDESIN) and vinorelbine (NAVELBINE), which prevents polymerization of tubulin from forming microtubules Etoposide (VP-16); Ifosfamide; Mitoxantrone; Leucovovin; Novantrone; Edatrexate; Daunomycin; Aminopterin; Ibandronate; Topoisomerase inhibitor RFS2000; Retinoids such as retinoic acid; clodronate (eg BONEFOSO or O TAC), etidronate (DIDROCAL), NE-58095, zoledronic acid / zoledronate (ZOMETA), alendronate (FOSAMAX), pamidronate (AREDIA), tiludronate (SKELID) or bisphosphonates such as risedronate (ACTONEL); troxacitabine (1,3 -Dioxolane nucleoside cytosine analogues); antisense oligonucleotides, in particular genes in signaling pathways involved in abnormal cell proliferation such as, for example, PKC-α, Raf, H-Ras and epidermal growth factor receptor (EGF-R) That inhibit the expression of THERTOPE. RTM. Vaccines such as vaccines and gene therapy vaccines, such as ALLOVECTIN vaccines, LEUVECTIN vaccines and VAXID vaccines; topoisomerase I inhibitors (eg LULTOTCAN); rmRH (eg ABARELIX); BAY-439006 (Sorafenib; Bayer); SU-11248 ( Perifosine; COX-2 inhibitors (eg celecoxib or etoroxib), proteosome inhibitors (eg PS341); bortezomib (VELCADE); CCL-779; tipifanib (R11577); orafenib, ABT510; oblimersen sodium (GENASENSE) Bcl-2 inhibitors such as; Pixanthrone; EGFR inhibitors; Tyrosine kinases And any of the pharmaceutically acceptable salts, acids or derivatives described above; and CHOP, which is an abbreviation for cyclophosphamide, doxorubicin, vincristine and prednisolone combination therapy, and oxali in combination with 5-FU and leucobobin Combination therapy of two or more of the above, such as FOLFOX, an abbreviation for treatment regimen with platin (ELOXATIN).

  In another embodiment, a combination of immunotherapy is used to treat estrogen receptor positive / HER2 positive (ERpos / HERpos) DCIS breast cancer patients. For example, anti-estrogen therapy such as tamoxifen is combined with an amti-HER2 dendritic cell vaccine to improve pathological complete response.

  These methods described herein are by no means exhaustive and methods for specific applications will be apparent to those skilled in the art. Furthermore, the effective amount of the composition can be further estimated by analogy with compounds known to have the desired effect.

Experimental example

  The invention is explained in more detail in connection with the following experimental examples. These examples are provided for illustrative purposes only, and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should not be construed as limited to the following examples, but should be construed as including any and all variations that become apparent as a result of the teaching provided herein. .

  Without further explanation, one of ordinary skill in the art, using the foregoing description and the following examples, can make and use the invention and practice the claimed methods. Accordingly, the following examples specifically point out preferred embodiments of the invention and should not be construed as limiting the remainder of the disclosure in any way.

Example 1
Cryopreserved pre-activated multi-dose dendritic cell vaccines In order to be able to produce these large scale vaccines, fully activated DC1 vaccines pulsed with tumor antigens are produced, thereby producing fully activated DC1 vaccines. A process of cryopreserving as a multi-dose syringe ready 6-pack DC1 vaccine was developed. DC1 is cryopreserved and activated as DC1, as described elsewhere herein. For example, they are stored frozen in 55% plasma light medium containing 40% human serum albumin and 5% DMSO. These vaccines are produced in the laboratory, extensively tested, and consistently meet quality standards set by the FDA for patient administration.

  The materials and methods employed in the experiments and examples disclosed herein are now described.

Preparation of fully activated DCs for cryopreservation Freshly elicited bone marrow monocytes were cultured in 6-well microplates (12 × 10 ⁶ cells / well). The medium consisted of Serum Free Medium (SFM Invitrogen Carlsbad CA). The final concentration of GMCSF added was 50 ng / ml and IL4 was 1000 U / ml. Cells were cultured overnight in 5% CO ₂ at 37 ° C. In some batches, after 16-20 hours, cells were pulsed with the appropriate peptide and cultured for an additional 6-8 hours, after which 1000 U / ml IFN-γ was added. Dendritic cells were matured with TLR agonists, LPS (TLR4, 10 ng / ml) or R848 (TLR8, 1 μg / ml). The maturation time was at least about 6 hours. Thereafter, DCs activated with TLR agonists were either cryopreserved or ready for immediate use.

  To induce the production of the Th1 polarized cytokine IL-12, DCs are activated with the cytokine IFN-γ, or a combination of the TLR agonist bacterial LPS and / or R848. This should induce T cells that produce IFN-γ. Alternatively, DC can be activated with a combination of ATP, bacterial LTA, LPS and prostaglandin E2 (PGE2). This can cause amplification of IL-23, IL-6 and IL-1β, resulting in an immune response dominated by IL-17 and IL-22 secreting Th17 cells.

Cryopreservation of DCs DC were collected by gently rubbing. All media and cells were kept on wet ice each time. Cells were gently washed by centrifuging at approximately 800 RPM for 10 minutes. Cells (eg, 10 × 10 ⁶ cells) were cryopreserved in freezing medium of 55% plasma light, 40% human serum albumin containing 5% DMSO and stored in liquid nitrogen.

  The results of the experiments presented here are described here.

Multi-dose DC1 vaccine Experiments were performed to assess cell recovery, viability and sterility. Briefly, peripheral blood monocytes were obtained by a combination of leukocyte depletion and counter current elimination, and cultured overnight in serum free medium containing GM-CSF and IL-4. The next day they were pulsed with HER-2 peptide, then with IFN-γ followed by LPS. DC1 was collected at 40 hours, cryopreserved in a freezing medium of 55% plasma light containing 5% DMSO, 40% human serum albumin and stored in liquid nitrogen. After one week, they were thawed to obtain shipping standards including viability, yield, endotoxin testing and aseptic culture. All 12 cultures had no bacterial growth and were less than 0.1 EU endotoxin. FIG. 1 shows the survival rate of cryopreserved DC1. As seen in FIG. 1, when cells were directly thawed and counted, the cell recovery rate averaged 89% and the survival rate was 95%. These data demonstrate that the cryopreservation and viability of the DC1 vaccine is maintained in media containing less than 7.5% DMSO acceptable to the FDA.

  It was observed that cell function was maintained after cryopreservation. IL-12 and Th1 chemokines were produced 36 hours after thawing of the multiple dose DC1 vaccine. Thawed cells produced high levels of IL-12 from 6 to 36 hours after thawing. These levels of IL-12 are comparable to prepared DC1 vaccines made from cryopreserved monocytes.

  The results presented herein demonstrate that a cryopreserved, pre-activated, multi-dose dendritic cell vaccine sensitized to the HER-2 tumor target antigen of breast cancer is therapeutically effective. However, the present invention is further applicable to various pathophysiological conditions.

  The multi-dose syringe readypack DC1 vaccine can be used in HER-2 non-expressing breast cancer. HER-2 is expressed in approximately 25% of all breast cancers. Breast cancer that does not produce detectable levels of HER-2 may be less susceptible to vaccination. To address this limitation, additional target proteins can be added to the vaccine. For example, many breast cancers that do not produce high levels of HER-2 instead produce other related proteins, including HER-1 and HER-3. While not wishing to be bound by any particular theory, it is believed that adding these other proteins to the vaccine will allow targeting of these other breast cancer phenotypes.

  The multi-dose syringe ready pack DC1 vaccine can be used for other cancer types besides breast cancer. Possible target proteins such as HER-1, HER-2 and HER-3 are ovarian, prostate, pancreas, colorectal, stomach, head and neck, and non-small cell lung cancer, and other common cancers May also be present in other types of cancer, including

  The multi-dose syringe readypack DC1 vaccine can be used to treat chronic infectious diseases including, but not limited to, chronic infections such as HIV or hepatitis C virus. Here, proteins specific for these viruses will replace HER-2 or other oncoproteins and mobilize the patient's immune response to these persistent infections. Enhanced immunity can greatly reduce the viral load and associated disease symptoms and progression, or help completely eliminate the infection.

  The multi-dose syringe ready pack DC1 vaccine can be used to treat autoimmune diseases. Diseases such as rheumatoid arthritis and lupus develop when the immune system mistakenly attacks the normal tissues of the body. Although current vaccine / immunotherapy formulations are designed to initiate and enhance immune responses, we do not wish to be bound by any particular theory, It is believed that in vitro signals can be provided to DCs during the production of vaccines that induce DCs to switch off.

(Example 2)
Cryopreservation of activated DC1 creates large-scale dendritic cell vaccines suitable for cancer treatment Dendritic cell-based vaccine therapy is a promising directed therapy for various cancers. Various strategies have been adopted to optimize DCs for CD4 + and CD8 + T cell sensitization to recognize tumor epitopes and mature DCs into a phenotype that elicits anti-tumor immunity, but interferon gamma (IFN- Experiments were designed to utilize methods that employ rapid maturation of monocytes in serum-free medium (SFM) using γ) and lipopolysaccharide (LPS), Toll-like receptor (TLR) 4 agonist As such, the immune response was polarized into a Th1-type response, resulting in mature DCs that could induce sensitization by an IL-12-dependent mechanism. The results demonstrate the ability of this vaccine strategy to be used as an adjunct therapy in early breast cancer. Lyophilization of dendritic cells (DC) in the mature state allows easier creation and reachability of individualized treatments.

Rapid maturation of dendritic cells Freshly matured DC (DC1) and matured lyophilized (cryoDC), then thawed DCs were analyzed for viability and recovery, as well as cell surface markers by flow cytometry. The phenotype maturity determined by expression was compared. Dendritic cell function was determined by measuring the production of various cytokines, particularly interleukin 12p70 (IL-12p70). The ability of these cells to stimulate naive CD4 + and CD8 + cells was also evaluated.

  There was no significant difference in survival rate (p = 0.4807) and recovery rate (p = 10.120) (FIG. 2).

  Both populations had similar initial (7 hours after LPS addition) IL-12p70 secretion (p = 0.768). The population showed comparable IL-12p70 secretion levels over a 30 hour observation period with no significant differences between the populations (FIG. 3).

  Population and IL-1β (p = 0.7690), IL-1α (p = 0.0841), Rantes (p = 0.902), MDC (p = 0.1514), IL-10 (p = 0.1937) ), MLP-1α (p = 0.2673), IP-10 (p = 0,7366), IL-6 (p = 0.24), IL-5 (p = 0.0735), TNF-β (p = 0.9422), IL-15 (p = 0.8878), MIP-1β (p = 0.9217), TNF-α (p = 0.8972), IL-8 (p = 0.7844) production There was no significant difference between. (FIG. 4).

  Cell surface markers, meaning DC maturity, show no significant difference in expression between DC1 and cryoDC. Both populations elicited non-specific alloantigen CD4 + T cell responses as well as antigen-specific CD8 + T cell recognition and Th1 polarization responses. CD80, 83 and 86 showed DC maturation and there was no significant difference in expression. Functional ability was induced by CD4 + T cells from different donors co-cultured with each population, resulting in non-specific alloantigen response and CD4 + T cells secreting INF-γ (DC1 107.40 ng / mL and cryoDC1 129.23 ng / mL). Antigen-specific sensitization elicited by co-culturing the two populations with tumor antigen-specific CD8 + T cells induces equivalent IFN-γ secretion for both groups, resulting in a TH1 polarization response (FIG. 5). .

  The results presented herein show that the rapid maturation method of DC1 can be cryopreserved in a functionally mature state, maintaining phenotype and function, and thus for global use in cancer therapy Demonstrate that it can be used to produce Syringe Ready DC1.

  While maintaining the DC1 phenotype to drive a Th1 polarized immune response, the results presented herein demonstrate that cryoDC maintained primarily the ability to sensitize T cells. This may also be related to the maturation strategy, as DC1 matured by IFN-γ and LPS exhibits an increased ability to sensitize CD4 + T cells primarily compared to DCs matured by cytokines.

  The present protocol for the preparation of cryopreserved mature DCs can be easily adapted to current good manufacturing practice guidelines, thereby increasing the availability of new therapies.

(Example 3)
CD4 T cell-derived cytokines and Herceptin sensitize HER-2 highly expressing breast cancer cells to CD8 T cell killing HER-2 highly expressing breast cancer cells are visible to CD8 T cells And have been demonstrated to down-regulate molecules on the cell surface that can be killed by these immune cells. In breast cancer cells that moderately and highly express HER-2 when interferon gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α), cytokines produced by CD4 cells, are combined with Herceptin, It has been shown to cause an increase in their class I molecule expression. As a result of this, CD8 T cells can better see breast cancer cells and kill them or produce cytokines to kill them.

  A trial was designed to evaluate the therapeutic effect of using Herceptin in combination with a dendritic cell vaccine (eg, DC1 vaccine).

  A Phase I DC1S vaccine trial was designed that used Herceptin in combination with the DC1 vaccine. For example, for patients with HER-2 highly expressing DC1S, a Phase I study was designed to receive DC1 vaccine in combination with two doses of Herceptin in weeks 1 and 4. Without wishing to be bound by any particular theory, it is believed that this combination increases the complete response rate from 30% to more than 50% in patients with HER-2 expressing DC1S.

  In addition, a Phase III DC1S vaccine trial was designed. For example, a vaccine trial was developed to prevent breast cancer recurrence in patients with estrogen independent (ER negative), HER-2 positive DC1S. The study has three treatment groups: 1) standard therapy (surgery and radiation), 2) receive DC1 vaccine before surgery, and 3) receive DC1 vaccine + Herceptin before surgery. While not wishing to be bound by any particular theory, patients who respond completely to treatment can avoid radiation after surgery. It is also believed that this study serves to demonstrate the prevention of recurrence with vaccines in patients with DC1S.

  In addition, a Phase I neoadjuvant DC1 vaccine was designed for use with Herceptin in patients with early invasive HER-2 positive breast cancer. For example, whether a combination of a vaccine with Herception and a chemokine modulator (eg, a chemokine activator) removes HER-2 expressing small invasive breast cancer prior to surgery and avoids the need for chemotherapy In order to test, a phase I study was designed. While not wishing to be bound by any particular theory, this neoadjuvant strategy (pre-operative) with the potential to add immune antibodies that disrupt the immune response is toxic for the treatment of breast cancer It is believed that the need for chemotherapy is eliminated and thus immunotherapy can be the standard of care for this disease. That is, the treatment regimens disclosed herein take the quest to eradicate breast cancer one step further using a natural immune response that can be repaired by the vaccine regimens of the invention. The regimens discussed herein can drive immune cells into the tumor by altering the immune response within the tumor and allow the immune cells to work longer by releasing the brakes on the immune cells. Combining the DC1 vaccine with Herceptin and adding a chemokine modulator would also improve immune cell migration and activity within the tumor in the breast.

  Without wishing to be bound by any particular theory, in many cancers, if there are a large number of excellent immune-fighting cells, the patient will perform better in any type of treatment. Conceivable. This means that if immune cells enter the tumor to fight the tumor before it is removed, the patient may perform better in other treatments, including surgery, chemotherapy and radiation, and respond better Means there is.

  While not wishing to be bound by any particular theory, effective therapies to treat cancer can quickly change the immune response within the tumor prior to surgery, and breast and other types of cancer An agent that improves the outcome of patients with This strategy is applicable to a variety of cancers including but not limited to colon cancer, melanoma, lung, brain, pancreas, prostate, esophagus and the like.

  Experiments to develop immunofluorescence assays to measure and quantify immune cells of the type that migrate into the breast after vaccination, types of chemokines that attract cells, and molecules they express to help remove cancer cells Designed. These assays allow multiple cell types to be visualized simultaneously and indicate where they are located within the tumor microtubule thorax. In at least some of the vaccinated patients, it has been observed that the tumor produces chemokines that mobilize cells into the environment and kill the tumor cells.

Example 4
Combination of HER-2 and HER-3 blockade The results presented herein show that the combination of HER-2 and HER-3 blockade causes permanent tumor aging in HER-2-expressing breast cancer Demonstrating that it is highly effective for anti-HER-2CD4Th1 cells.

  The combination of blocking HER-2 and HER-3 together and the addition of TNF-α and IFN-γ from CD4Th1 cells was observed to cause almost complete senescence of HER-2-expressing breast cancer. This has been demonstrated in various cell lines of both breast cancer cells that express high and moderate HER-2. The results demonstrate that this combination can be powerful for prevention and prevention of recurrence.

Methods Cell culture and treatment Human breast cancer cell lines, SK-BR-3, BT-474, MCF-7, T-47D, HCC-1419 and MDA-MB-231, obtained from American Type Culture Collection (Manassas, VA). And grown in RPMI-1640 (Life technologies, Grand Island, NY) supplemented with 10% FBS (Cellgro, Herndon, VA). JIMT-1 cells were obtained from Ohio State University (Columbus, OH) and grown in the same complete medium. Normal immortalized MCF-10 cells were obtained from Karmanos Cancer Institute (Detroit, MI) and 10 mM HEPES, 10 μg / ml insulin, 20 ng / ml EGF, 100 ng / ml cholera toxin, 30 mM sodium bicarbonate, Grown in RPMI-1640 medium supplemented with 0.5 μg / ml hydrocortisone and 5% horse fetal serum. All cells were grown at 37 ° C. in a humidified 5% CO ₂ incubator.

  300,000 breast cancer cells were treated with the indicated concentrations of human recombinant TNF-α (R & D Systems, Minneapolis, Minn.) And human recombinant IFN-γ (R & D Systems) for 5 days, then in the absence of cytokines And subcultured twice more. Cells were subjected to senescence-related β-galactosidase enzyme (SA-β-gal) detection or lysed and subjected to Western blot analysis for p15INK4b and p16INK4a.

  In some cases, cells were treated with 10 μg / ml trastuzumab and pertuzumab (Genetech, San Francisco, Calif.) As indicated. This treatment was combined with cytokines or human recombinant heregulin (R & D Systems).

Equal amounts of cells were transferred to 10 × 10 ⁵ human CD4 ⁺ T cells and 10 ⁵ mature (ie, type I polarization) in the chamber under the transwell system (BD Biosciences, San Jose, Calif.). Alternatively, it was co-cultured with immature human DC and cultured in the upper chamber. DC and CD4 ⁺ T cells were obtained from the subject of the selection test (Sharma et al., 2012, Cancer 118: 4354-4362). Mature and immature DCs were pulsed for 5 days at 37 ° C. with class II-derived HER2 or control unrelated (BRAF and survivin) peptides (20 μg / ml). Control wells contained only CD4 ⁺ T cells. In addition, 0.5 × 10 ⁵ cells were incubated for 5 days at 37 ° C. in the presence of DC / CD4 ⁺ T cell co-culture supernatant. In both approaches, the cells were then subcultured twice in the absence of cytokines and subjected to aging tests (SA-β-gal activity at pH 6 and Western blots of p15INK4b and p16INK4a) or apoptosis tests (of cleaved caspase-3). Western blot). The following antibodies were incubated 60 minutes prior to incubation with DC and DC4 + T cell co-cultures: polyclonal goat IgG anti-human TNF-α (0.06 μg / ml per 0.75 mg / ml TNF-α) and IFN-γ (5 ng Thr producing cytokines were neutralized by the addition of goat IgG isotype (all from R & D Systems) as a negative control as well as a corresponding negative control (0.3 μg / ml per ml IFN-γ).

Plasmid Transfection MDA-MB-231 cells were transiently transfected with 2 μg of wtHER2 expression vector (pcDNAHER2) for 48 hours. As a control, cells were transfected with 2 μg of empty vector (pcDNA3). Both vectors are described in Dr. Courtesy of Mark Greene (University of Pennsylvania, Philadelphia, PA). Cells were transfected with Turbofect (Thermo Scientific, Waltham, Mass.) In complete medium without antibody. Transduction efficiency was assessed by Western blot 48 hours after transfection. After 48 hours, the transfected cells were transferred to complete medium containing 0.4 mg / ml G418 (Life Technologies). After 15 days in culture, colonies resistant to G418 were selected by limiting dilution. Transfection efficiency was evaluated by Western blot.

RNA Interference (RNAi) Transfection Small Interfering RNA (siRNA) SMART Pool: ON TARGET Plus HER2 siRNA, HER3 siRNA and SMART Pool: ON-TARGETPLUS Non-targeting Pool was purchased from Dharmacon-Thermoscience. The following target sequences were used: HER2: UGGAAGAGAUUCACAGGUUA (SEQ ID NO: 9), GAGACCCGCUGAACAAUAC (SEQ ID NO: 10), GGAGGAAUGCCGAGUACAUUG (SEQ ID NO: 11), GCUCAUCGCUCCACAACCCAA (SEQ ID NO: 13) UG; ), AGAUUGUGCUCACGGGGACA (SEQ ID NO: 14), GCAGUGGAUUCGAGAAGUG (SEQ ID NO: 15), UCGUUCAUGUUGUAGAUAUUA (SEQ ID NO: 16); A (SEQ ID NO: 19), UGGUUUACAUGUUUUCCUA (SEQ ID NO: 20). 300,000 cells were transfected with siRNA sequence (25 nM) using RNAi Max Lipofectamine (Life Technologies) in serum-free medium and 1 hour later, 10% FBS was added to the medium. After 16 hours, cells were subjected to 48 hours of serum starvation followed by various designated treatments and Western blots to check expression levels.

SA-β-gal activity at pH 6 Cells were washed twice with PBS, fixed with 3% formaldehyde and washed again with PBS. Incubate with freshly prepared aging-related acid β-galactosidase (SA-β-gal) stain from Millipore (Billerica, MA) at 37 ° C. overnight (without CO ₂ ) as per manufacturer's instructions. . After scoring 300 cells using a bright field microscope (Evos CoreXL, Bothel, WA / 40X / 2048 × 1536, 3.2 μm / pixel; 3.1 Mp.), SA-b-gal positive in each sample (Blue) Color / Capture image: Color TIFF, PNG, JPG or BMP-2048x1536 pixels)

Western blot analysis Lysates were prepared from MCF-10A, SK-BR-3, and MCF-7, T-47D or MDA-MB-231 cells. 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 70% Tergitol, 0.1% SDS, 1 mM Mg ₂ Cl and protease inhibitor cocktail Sigma- Cells were lysed in a buffer containing Aldrich (St. Louis, MO). The lysate was centrifuged at 12,000 xg for 15 minutes at 4 ° C. The protein was solubilized in the same buffer (Life Technologies) and subjected to SDS-PAGE. Protein was electroblotted into PVDF. All of the following antibodies: p15INK4b (K-18), p16INK4a (50.1), IFN-γRα (C-20), HER3 (C-17), from Santa Cruz Biotechnology (Santa Cruz, CA); Sigma- Membranes were immunoblotted with vinculin from Aldrich (V9131); HER2 (29D8), cleaved caspase 3 (8G10) and TNF-R1 (C25C1) from Cell Signaling Technologies (Danvers, Mass.). After washing, the membrane was incubated with a secondary antibody (Bio-Rad, Hercules, CA) conjugated to HRP. Visualization was achieved using the enhanced chemiluminescence (ECL) Western blotting detection system Western Blot Analysis.

Analysis of cell death by flow cytometry SK-BR-3 cells were untreated, treated with IFN-γ (100 U / ml) and TNF-α (10 ng / ml), trastuzumab (10 μg / ml) and pertuzumab ( 10 μg / ml) or a combination of IFN-γ, TNF-α, trastuzumab and pertuzumab for 24 hours. After incubation, apoptosis induction was detected using FITC-Annexin V apoptosis detection kit (BD Biosciences) according to the manufacturer's instructions. Briefly, untreated and treated SKBR-3 cells were collected, washed with PBS, and resuspended in Annexin V binding buffer at a concentration of 1 × 10 ⁶ cells / ml. 100 μl of cell suspension was incubated with 5 μl PI and 5 μl FITC-annexin V for 15 minutes at room temperature in the dark. After incubation, 150 μl of annexin V binding buffer was added and analyzed using BD Accuri C6 flow cytometry (BD Biosciences) and data analyzed with CFlow Plus software. Cells irradiated with UV were used as a positive control.

Tumor development studies For xenograft experiments, SK-BR-3 cells (2 × 10 ⁶ cells in 200 μl of PBS) were transformed into 6 week old female athymic (nude) mice (Foxnu, Harlam Laboratories, 5 mice). Injection into the flank of / group). If the tumor is palpable, animals are s.c. with trastuzumab and pertuzumab (30 μg / kg). c. Treatment and then hrTNF-α and hrIFN-γ (10 ng / kg) s. c. Injected. Tumor formation was monitored by tactile sensation and tumor volume in mm ³ was measured twice a week with calipers: width 2 × length / 2. All animal experiments were performed in compliance with institutional guidelines.

Statistical analysis Untested students were t-tested (two-sided test) using GraphPad Prism (GraphPad Software, La Jolla, CA, USA). A P value of 0.05 or less was considered significant. * P <0.05, ** P <0.01, *** P <0.001.

Results Cytokines TNF-α and IFN-γ synergistically induce senescence in breast cancer cells When cytokines produced by immune system cells were able to induce specific senescence responses in tumor cells SK-BR-3 cells were incubated with human recombinant tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) alone or in combination at 37 ° C. for 5 days. The cells were then subcultured two more times and subjected to an aging test. The combination of both cytokines resulted in increased senescence-related acidic β-galactosidase (SA-β-gal) staining (FIG. 6A) and high senescence-related markers p15INK4b and p16INK4a compared to control untreated cells detected by Western blot or each cytokine alone. This resulted in senescence induction of SK-BR-3 cells, as evidenced by expression (FIG. 6B). Similar results were obtained in BT-474, MCF-7 and T-47D breast cancer cell lines (data not shown). Therefore, T-47D cells were treated with several concentrations of TNF-α, 10-100 ng / ml, and 100-1000 U / ml IFN-γ, or combinations thereof. We observed that the induction of the aging phenotype was dose dependent (FIG. 6C). Similar results were observed in SK-BR-3, BT-474 and MCF-7 cells.

Inverse correlation between HER2 expression level in breast cancer cells and doses of TNF-α and IFN-γ, Th1 cytokines required to induce senescence HER2 expression level is 5 days with TNF-α and IFN-γ Induced in SK-BR-3, BT-474, MCF-7, T-47D and MDA-MB-231 breast cancer cells by treatment at 37 ° C., followed by two additional passages without cytokines An experiment was designed to determine whether or not to play a role in aging. Indeed, compared to moderate HER2 expressing cell lines with high cytokine concentrations (T-47D, FIG. 6D and MCF-7, data not shown), low doses of TNF-α and IFN-γ caused HER2 The amount of SA-β-gal positive cells was increased in the high expression cell line (SK-BR-3, FIG. 6D and BT-474, data not shown). However, even the highest concentrations of TNF-α and IFN-γ were unable to induce senescence in the HER2 low expressing cell line MDA-MB-231 (FIG. 6D). These results clearly demonstrate the interphase between TNF-α and IFN-γ and HER2 expression levels that induce senescence.

HER2 is required for Th1 cytokines TNF-α and IFN-γ-mediated senescence and apoptosis in MDA-MB-231 breast cancer cells. Stably transfected and treated with high concentrations of TNF-α (200 ng / ml) and IFN-γ (2000 U / ml) for 5 days at 37 ° C., followed by two additional passages in the absence of cytokines. Only in cases, SA-β-gal positive cells (FIG. 7A) and p15INK4b expression (FIG. 7B) were strongly increased. In particular, when HER2-MDA-MB-231 cells were cultured with high concentrations of TNF-α and IFN-γ, not only were there relatively many blue senescent cells, but the amount of cells was remarkably low. As it turned out, the experiment was repeated and the cells were subjected to Western blot to detect active caspase 3 (FIG. 7B). Treatment of cells transfected with the control empty vector (pcDNA3) with increasing concentrations of TNF-α, 75-200 ng / ml and IFN-γ, 750-2000 U / ml in the same conditions as described above, There was no effect on senescence induction assessed by β-gal staining (FIG. 7A) or p15INK4b and cleaved caspase 3 expression (FIG. 7B). This finding strengthened that HER2 is required for the mechanism of TNF-α and IFN-γ induced senescence and apoptosis in breast cancer cells.

Cytokine receptors are expressed at similar levels in breast cancer cells HER-2 high expressing cell lines SK-BR-3 and BT-474, moderate MCF-7 and T-47D, and low HER2 normal A HER-2 low expressing MDA-MB-231 breast cancer cell line, such as an immortalized MCF-10 breast cancer cell line, showed similar IFN-γ and TNF-α receptor expression by Western blot analysis (FIG. 12). . This result demonstrates that the expression level of these two cytokine receptors is independent of the HER2 expression level. This is consistent with reports explaining the effects of these cytokines in various phases in normal breasts. TNF-α is involved in normal mammary gland proliferation, development and branching morphology (Lee et al., 2000, Endocrinology 141: 3764-3773). Expression of the receptor TNFR1 mediates breast epithelial cell proliferation induced by TNF-α, and activation of TNFR2 induces casein accumulation (Varela et al., 1996, Endocrinology 137: 4915-4924). Similarly, the active form of IFN-γ interacts with its receptor expressed on the surface of almost all normal cells (Ealick et al., 1991, Science 252; 698-702; Frrar et al., 1993). Annu. Rev. Immunol. 11: 571-611).

Combination of HER2 and HER3 expression blockade enhances senescence induction by h1 cytokines TNF-α and IFN-γ in breast cancer cells Senescence in HER-2 high and moderately expressed cell lines treated with a combination of cytokines And previous results showing an enhanced apoptotic phenotype led to the study of the effects of HER2 and HER3 knockdown by siRNA. The therapeutic effect of blocking HER2 / HER3 signaling in breast cancer has been demonstrated in several studies (Lee-Hoefrich et al., 2008, Cancer Res. 14: 5878-87; Berghoff et al., 2014, Breast 14: S0960-9776). The combined treatment of TNF-α and IFN-γ in HER3-deficient cells did not increase the number of senescent or apoptotic cells, but double knockdown by HER2 and HER3 siRNAs was not affected by SA-β- in SK-BR-3 cells. Gal staining (FIG. 8A) and p15INK4b expression level (FIG. 8B) were strongly increased. At the same time, a high level of apoptosis in cells treated with double knockdown and cytokines was observed by Western blot of active caspase 3 (FIG. 8A). Similar results were observed in MCF-7 cells (FIG. 13), BT474 and T47D cells.

Combination of HER2 inhibition and HER2-HER3 dimerization inhibition enhances senescence induction and apoptosis of Th1 cytokines TNF-α and IFN-γ in SK-BR-3 breast cancer cells Trastuzumab and pertuzumab are HER2-positive breast cancer An antibody that has been widely used in clinics to treat. To study Th1 cytokine-induced senescence and apoptosis in a translational approach, experiments were designed to pretreat SK-BR-3 cells with trastuzumab and pertuzumab, and then cells were treated with TNF-α and IFN-γ. For 5 days at 37 ° C., followed by two additional subcultures in the absence of cytokines and antibodies. Compared to cells treated with only cytokines, the amount of blue cells measured by SA-β-gal staining was greatly increased in cells that had undergone complete treatment (FIG. 9A), and p15INK4b measured by Western blot Increased expression was observed (FIG. 9B). Interestingly, this double treatment was directed against the induction of apoptosis by both increasing the active caspase 3 expression by Western blot (FIG. 9B) and increasing the amount of Annexin v and propidium iodide positive cells by flow cytometric analysis. Even had a significant effect (FIG. 9C).

Senescence and apoptosis of HER2-overexpressing human breast cancer cells via CD4 ⁺ Th1 To confirm that cytokines produced by immune system cells in vivo could also induce specific senescence and apoptosis in tumor cells Designed and co-cultured CD4 ⁺ T cells and SK-BR-3 breast cancer cells stimulated with HER2 class II peptides using a transwell culture system. The cells were co-cultured at 37 ° C. for 5 days and then subcultured two more times in complete medium without immune system cells. This co-culture showed SK-BR-3 cells as evidenced by an increased amount of SA-β-gal staining (FIG. 10A) and increased expression of p15INK4b and cleaved caspase 3 detected by Western blot (FIG. 10B). Caused aging and apoptosis. CD4 ⁺ T cells stimulated with either immature dendritic cells (DC) or mature DC plus unrelated class II (BRAF or survivin) peptides can induce senescence and apoptosis of SK-BR-3 cells. It was not possible (FIG. 10).

Observed senescence and apoptosis were greatly enhanced when SK-BR-3 cells were co-cultured with HER2 class II peptides stimulated with CD4 ^- T cells in transwells in the presence of trastuzumab and pertuzumab. This result was clearly demonstrated by SA-β-gal staining (FIG. 10A) and increased expression levels of p15INK4b and cleaved caspase 3 (FIG. 10B).

  As another approach, SK-BR-3 cells were co-cultured with supernatant from CD4 + T cell-mature DC co-cultures and a similar specific senescence response was observed. Th1-stimulated cytokines IFN-γ and TNG-α obtained from CD4 + T cell-mature DC co-culture supernatants were previously confirmed using ELISA. Both experimental approaches were able to partially rescue SK-BR-3 senescence and apoptosis by neutralizing antibodies that block IFN-γ and TNF-α (FIG. 14).

  In SK-BR-3 cells, this effect was dose-dependent because an increase in the number of immune system cells induced higher levels of SA-β-gal staining, p15INK4b and cleaved caspase 3 expression by both approaches. We also observed that.

The Th1 cytokines TNF-α and IFN-γ sensitize trastuzumab and pertuzumab-resistant breast cancer cells to senescence and apoptosis induction. It is believed that α and IFN-γ were able to restore sensitivity to trastuzumab and pertuzumab in breast cancer resistant cells. Treatment with trastuzumab and pertuzumab, as opposed to T-47D sensitive cells, resulted in two resistant cell lines, HCC-1419 (O'Brien et al., 2010, Mol Cancer Ther. 6: 1489-502) and JIMT- 1 (O'Brien et al., 2010, Mol Cancer Ther. 6: 1489-502; Tnner et al., 2004, Mol Cancer Ther. 12: 1585-92) cannot prevent activation of AKT. (FIG. 16).

  Treatment with TNF-α and IFN-γ induced senescence and apoptosis in a dose-dependent manner in HCC-1419 and JIMT-1 cells. When cells were treated with trastuzumab and pertuzumab, aging and apoptosis could not be demonstrated even at high doses (FIG. 11) (data not shown). However, dual treatment with cytokines and antibodies induced senescence by SA-β-gal assay in HCC-1419 and JIMT-1 cells (FIGS. 11A, 11C) and increased expression of p15INK4b (FIG. 11B, 11D). Furthermore, the combination of cytokine and antibody effectively induced cell death in HCC-1419 and JIMT-1 cells (FIGS. 11B, 11D). This result demonstrates that the Th1 cytokines TNF-α and IFN-γ were able to restore resistance to therapeutic agents, which broadly affect cancer patients.

DISCUSSION It has been demonstrated herein that TNF-α and IFN-γ induce senescence and apoptosis in breast cancer cells in a dose-dependent manner. It has also been shown that there is an inverse correlation between HER2 expression levels in breast cancer cells and the doses of TNF-α and IFN- required to induce senescence in those cells. Cytokine receptors are expressed at similar levels in all breast cell lines tested, suggesting that this is not responsible for the differential response. Furthermore, high doses of Th1 cytokines could induce senescence and apoptosis only when MDA-MB-231 cells (low HER2 levels) were stably transfected with wild type HER2 plasmid. Thus, HER2 signaling is necessary to induce asthma and apoptosis in cells lacking HER2 or expressing very low levels, even with high doses of cytokines cannot induce senescence or apoptosis. There seems to be. However, in cells that express high or medium levels of HER2, knocking down the gene induces senescence and apoptosis by a phenomenon called oncogene poisoning. Furthermore, the combination of HER2 and HER3 siRNAs further enhanced TNF-α and IFN-induced senescence and apoptosis in breast cancer cells, indicating a step forward over HER3 due to the lack of HER2 signaling. Has been.

(Example 5)
Anti-estrogen therapy and anti-HER2 dendritic cell vaccination improve pathological complete response in ERpos / HER2pos DCIS The ability of dendritic cells ("DC") to present antigen is enthusiasm for their use in anti-tumor vaccination Brought about. The current group has designed a HER2 peptide pulse autologous DC vaccine uniquely designed to promote anti-HER2 Th1 sensitization and attraction. Reference, USA. U.S. Patent Application No. 14 / 658,095 filed on March 13, 2015, U.S. Patent Application No. 14 / 985,303 filed on Dec. 30, 2015 (the disclosures of which are hereby incorporated by reference) (Incorporated herein in its entirety) Datta, J. Et al., OncoImmunology 4: 8 e1022301 (2015) DOI: 10. 1080 / 2216402X. 2015. 1022301 and Datta, J. Et al., Breast Cancer Res. 17 (1): 71 (2015). Feasibility, safety and preliminary clinical results of neoanti-adjuvant use of anti-HER2 vaccine in HER2pos DCIS (in situ HER2pos ductal carcinoma) patients have been reported. Complete tumor regression (pathological complete response (“pCR”)) was induced in 19% of patients. However, these results are concentrated in patients with hormone-independent (Erneg) DCIS, and patients with ERpos DCIS are more responsive to anti-HER2 DC vaccine than patients with hormone-independent DCIS. Was low (Sharma, A. Cancer 118 (17): 4354-62 (2012)). Extensive bi-directional crosstalk between HER2 and the ER signaling pathway results in enhanced cancer cell proliferation and survival (Arpino, G. et al., Endocrine Reviews 29 (2): 217-233 (2008) and Prat , A., Nat.Clin.Prac Oncol.5 (9): 531-542 (2008)). Targeting both of these two receptors in combination may prevent them from continuing to activate each other. Adding anti-estrogen ("AE") therapy to anti-HER2 DC vaccination therapy is postulated to improve response in HER2pos / ERpos DCIS patients. In the studies reported herein, ERneg DCIS vaccinated with HER2 DC ("ERneg"), clinical response in patients receiving ERpos DCIS vaccinated with ERpos DCIS alone ("No ERP") And ERpos DCIS patients who received both anti-estrogenic therapy ("ERpos with AE") in conjunction with anti-HER2 DC vaccine and comparison with immune response.

  The results presented herein demonstrate that concurrent neoadjuvant anti-estrogen therapy and anti-HER2 DC1 vaccination increase the proportion of immune and pathological complete responses in local sentinel lymph nodes in HER2pos / ERpos DCIS To do. These results further support personalized, targeted combination therapy.

Methods Method summary: 81 patients with HER2pos DCIS were administered neoadjuvant anti-HER2 DC vaccine. Clinical responses were measured on excised surgical specimens. Immune response-anti-HER2 CD4 + Th1 response-was measured in peripheral blood before and after vaccination and in sentinel lymph nodes after vaccination. Compare clinical and immune responses between ERneg patients who received only anti-HER2 vaccination, ERpos patients who received anti-HER2 vaccination alone, and ERpos patients who received anti-estrogen therapy simultaneously with anti-HER2 vaccination did.

  The method implemented is detailed below.

Preclinical Experiments Breast cancer cell lines SKBR3 (HER2pos 3 + / ERneg) and MCF7 (HER2neg2 + / ERpos) were Th1 cytokines (IFN and TNFα), tamoxifen metabolites (4-hydroxy tamoxifen, “4HT”) 72 hours. Metabolic activity was measured via the Alamar Blue assay.

Trial design After obtaining the approval of the institutional review board at the University of Pennsylvania, two neoadjuvant clinical trials of the HER2 peptide pulsed DC1 vaccine (NCT001070211 and NCT02061332) were conducted. The main objective was to evaluate the feasibility, safety and efficacy of DC1 vaccination. The second objective was to assess clinical and immune responses. Preliminary results of these studies showed that the vaccine was safe, well tolerated, and induced a reduction or eradication of HER-2 expression (Sharma, A. et al., Cancer 118 (17): 4354-62). (2012) (“Sharma, et al.)) Further review of preliminary results showed that vaccination was more effective in hormone independent (ERneg) patients [20, 21]. Preclinical data And based on preliminary results of clinical trials, an addendum to treat subsequent ERpos patients with hormone-dependent (ERpos) DCIS with concurrent AE therapy was approved.

Patient Selection Female patients over 18 years of age with a HER2pos DCIS and ECOG Performance Status Score of 0 or 1 demonstrated by biopsy were eligible for the study. All tissue specimens were reviewed by a single pathologist for eligibility. HER-2 positivity was defined as> 5% of HER-2 protein expression 2+ or 3+ strength cells. Women of childbearing age required a negative serum pregnancy test and had to use medically acceptable forms of contraceptives. Women with cardiac dysfunction, HIV, HepC, coagulation disorders, or existing medical illnesses or drugs that could interfere with the study were excluded from the study. Women who received definitive treatment or whose DCIS was excluded by excision biopsy at the time of diagnosis were not eligible for this study. 81 women were enrolled in the trial and completed the vaccination treatment. All 81 patients underwent surgical resection with pathological examination of the resected specimen. The immune response was measured in patients from the second study (NCT02061332)-53 out of 54 patients with pre- and post-vaccination CD4 + immune responses measured in peripheral blood. Forty patients had post-vaccination CD4 + immune responses measured in sentinel lymph nodes; 22 HLA-A2 pos patients had pre- and post-vaccination CD8 + immune responses measured in peripheral blood. Had.

Vaccination Procedures Vaccine preparation and delivery has been previously described in detail. For example, Sharma et al., Czerniecki, B. et al. J. et al. Et al., Cancer Res. 67 (4): 1842-52 (2007) (Czerniecki et al.), And Koski, G .; K. Et al. Immunother. 35 (1) 54-56 (2012). The vaccination procedure is shown in FIG. Briefly, monocytic dendritic cell precursors were obtained from patients by tandem leukapheresis / countercurrent centrifugal elution. Monocytes were cultured at 37 ° C. in serum-free medium (SFM) (Invitrogen, Carlsbad, Calif.) Containing granulocyte macrophage colony stimulating factor (GM-CSF) (Amgen, Newbury Park, Calif.) And IL-4. The next day, six HER2-derived major histocompatibility complex (MHC) class II binding peptides (American Peptide Corporation, Sunnyvale), including three extracellular domain (ECD) peptides (peptide 42-56: HLDMLRHLYQGCQVV (SEQ ID NO: 2)). CA) three intracellular domain (ICD) peptides (peptides 776-790: GVGSPYVSRLLGICL (SEQ ID NO: 3)), peptides 98-114: RLRIVRGTQLFEDNYAL (SEQ ID NO: 2), and peptides 328-345: TQRCEKCSKPCARVCYGL SEQ ID NO: 4); peptide 927-941: PAREIPDLLEKGERL (SEQ ID NO: 5); and peptide 1166-1180 TLERPKTLSPGKNG (SEQ ID NO: 6)). 8-12 hours later, 1000 U / mL IFN-γ (Intermune, Brisbane, CA) was added and clinical grade LPS (presented by Dr. Anthony Suffredini, National Institutes of Health (NIH)) 6 hours prior to collection ) Was added to complete rapid maturation into type I dendritic cells (DC1). For HLA-A2pos patients, the monocyte pool was pulsed with MHC class I binding peptides 369-377 and 689-697.

  Four to six week injections of 100,000-20 million HER-2 peptide-pulsating DC1 were administered to the breast, groin lymph nodes, or both thoracic and inguinal lymph nodes.

  Patients were monitored for adverse effects for a minimum of 1-2 hours after weekly vaccination. All adverse events were classified according to the National Cancer Institute Common Toxicity Criteria (NCI-CTC version 3.0), assessed at least weekly during vaccination and monitored until resolution.

Clinical monitoring Pathological responses were examined at the time of surgical resection (n = 48) or mastectomy (n = 33). A complete pathological response to immunization was defined as no residual DCIS or invasive breast cancer at the time of surgical resection. Patients were monitored after surgical resection for the occurrence of subsequent breast events. Subsequent breast events were defined as lesions identified in the ipsilateral or contralateral breast (DCIS or invasive breast cancer).

Anti-estrogen therapy ER-positive patients were treated with anti-estrogen therapy at the same time as anti-HER2 DC1 vaccination 4-6 times a week. Physician researchers have determined which of the following anti-estrogen therapies is most appropriate for each patient: tamoxifen (4-hydroxy tamoxifen (“4HT”) (NOLVADEX ™); letrozole (FEMARA ™) ); Anastrozole (ARMIDE ™); exemestane (AROMASIN ™); raloxifene (EVISTA ™); or other suitable anti-estrogenic agents that block or modify the action of estrogen.

Immune monitoring CD4 + T cells Systemic anti-HER2 CD4 + T cell responses were generated from autologous peripheral blood mononuclear cells (PBMC) pulsed with six HER2-derived major histocompatibility complex (MHC) class II binding peptide peptides. Local anti-HER2 CD4 + T cell responses were measured in sentinel lymph nodes (SLN) of 40 patients who underwent SLN biopsy. IFN-product was quantified via an enzyme-linked immunosorbent spot (ELISPOT) assay. (Fracol, M. et al., Ann. Surg. Oncol. 20 (10): 3233-9 (2013)) Briefly, PVDF membrane plates (Mabtech, Cincinnati, OH) were anti-IFN-antibodies (1D1K). The next day, the plates were washed with PBS (Mediatech, Manassas, VA) and blocked with 10% human serum / DMEM, then 2 × 10 ⁵ PBMCs on SLN cells were pulsed with HER2-derived class II peptides. Pulsed with unstimulated or anti-human CD3 and CD28 antibodies (0.5 μg / mL) (positive control, BD Pharmingen®) (4 μg) (42-56, 98-114, 328-345, 776- 790, 927-941, 116-1180), San Diego, CA) and incubated at 37 ° C. + 5% CO 2 for 24-36 hours. After the plate was washed with PBS, 100 μL of detection antibody (1 mg / mL; 7 B6-1-biotin) was added to each well and the plate was incubated for 2 hours. After the plate was washed again with PBS, 100 μL of 1: 1000 diluted streptavidin-HRP was added to each well and the plate was incubated for an additional hour. TMB substrate solution was added to reveal spot formation. Spot-forming cells (SFC) were counted using an automated reader (ImmunoSpot CTL).

A positive response to an individual HER2 class II peptide is defined as a minimum of 20 SFC / 2 × 10 ⁵ cells after subtracting the unstimulated background, with at least a 2-fold increase over the unstimulated background. Defined. Quantification of CD4 + Th1 responses included overall response rate (percentage of patients responding to ≧ 1 peptide), (2) response repertoire (number of peptides responded by patient), and (3) cumulative response (total of 6 Sum of SFC across peptides).

CD8 + T cells Systemic anti-HER2 CD8 + T cell responses were measured in 22 HLA-A2pos (HLA 2.1) patients. Briefly, CD8 + T cells were selected from a cryopreserved 120-140 lymphocyte cell fraction via negative selection (StemCell Technologies®). Vancouver, BC). Serum-free dendritic cells containing GM-CSF (10 ng / ml) pulsed with class I HER2 peptide (10 ug / ml) (369-377) were treated with serum-free medium (SFM) (Invitrogen, Carlsbad, CA) CD8 + T cells and The culture was performed at a ratio of 10: 1. On day 10, T cells were harvested and tested against T2 target cells pulsed with either class I HER2 peptides or irrelevant controls (p53 and colon cancer peptides). After 24 hours, supernatants were collected and analyzed by enzyme linked immunosorbent assay (ELISA). A positive response to HER2 class I peptides was defined as a 2-fold increase in CD8 + T cell IFNamic production compared to an irrelevant peptide control.

Statistical methods Demographic and clinical data were evaluated using descriptive statistics and univariate logistic regression. P values <0.05 were considered statistically significant. Kaplan Meier analysis was used to compare the onset of subsequent breast events. All analyzes were performed with STATA 12.0 / IC statistical software (STATA Corp, College Station, TX).

Results Results: The pathological complete response rate for ERneg DCIS and ERpos DCIS patients treated with estrogen was 31.4% vs. 28.6% (p = 1.00). Both rates were significantly higher than the rate of complete pathological response seen in ERpos DCIS patients (4.0%, p = 0.035) who had not received anti-estrogen therapy. The anti-HER2 Th1 immune response measured in peripheral blood was significantly increased after vaccination, but was similar in all three groups. However, in the sentinel lymph node, the anti-HER2 Th1 immune response is only HER2 vaccinated in ERpos DCIS patients treated with anti-HER2 vaccination and anti-estrogen therapy.

  The results are detailed below

Preclinical experiments The SKBR3 breast cancer cell line (ERneg) increased anti-tumor activity in response to Th1 cytokine treatment but did not respond to anti-estrogen treatment. Furthermore, adding anti-estrogen treatment to Th1 cytokine treatment did not affect metabolic activity, as shown in FIG. 17A.

  Conversely, the MCF7 breast cancer cell line (ERpos) did not increase anti-tumor activity in response to either Th1 cytokine treatment or anti-estrogen treatment. However, the combination of Th1 cytokine treatment and anti-estrogen treatment resulted in increased metabolic activity, as shown in FIG. 17B.

Trial: Patient Selection and Demographics The median value of 81 patients who participated in the clinical trial was 55 (interquartile range (IQR) 47-60) and the median BMI was 25.9 (IQR 22.4 31.0) and most patients are postmenopausal (n = 68; 84.0%) and white (n = 65,80.2%). All subject patients were diagnosed with DCIS at the time of biopsy. However, a small number of patients were found to have early invasive breast cancer (Stage I) at the final surgical resection (n = 16, 19.8%). All patients of interest were diagnosed with 2+ (n = 28, 34.6%) or 3+ (n = 53, 65.4%) HER2pos DCIS. Vaccination was administered to 47 patients' inguinal lymph nodes (58%), 18 patients (22.2%) breasts, 16 patients (20%) to both inguinal lymph nodes and breasts. . Surgical resection was completed by tumorectomy in 48 patients (59.3%) and 33 patients mastectomy (40.7%). Of the patients who underwent tumor removal, 37.5% received postoperative radiation therapy.

  This vaccine was well tolerated with only grade 1-2 adverse events. The most commonly reported vaccination adverse events were fatigue (n = 41,50.6%), injection site reaction (n = 34,42.0%), cold / severity (n = 26,32). 0.1%). None of the patients were unable to complete the trial due to side effects.

  Figure 18 shows 35 patients with ERneg disease (43.2%) and 46 patients with ERpos disease (56.8%) in all cohorts. Of the patients with ERpos disease, 25 (54.3%) received only the DC1 vaccine and 21 patients (45.7%) received the DC1 vaccine and AE combination therapy. The demographic and clinical characteristics of these treatment groups are summarized in Table 1 below and showed no significant differences between the groups.

ER (estrogen receptor), AE (antiestrogen), IQR (interquartile range), HER2 (human epidermal growth factor receptor 2)
¹ Bold indicates statistical significance
^a following tumor resection

Clinical response rate to HER2 vaccination Clinical response was available to all 81 patients. Overall, 18 of 81 immunized patients (22.2%) were found to have no residual disease identified in resected surgical specimens. These patients were considered to have a pathological complete response (pCR). As shown in FIG. 19, the complete pathological response of the ERneg group was higher than that of the ERpos group. More specifically, the pCR in the ERneg group (n = 11, 31.4%) and the ERpos group (n = 6, 28.6%) treated with AE were similar (p = 1.00) . However, p = 0.04 which was significantly lower than the ERpos group not receiving AE treatment (p = 0.01) and the ERpos group receiving AE treatment (p = 0.01) (FIG. 19).

  A pathological complete response correlates with a reduced risk of recurrence. For example, Tanioka, M .; Et al. , Br. All patients who experienced subsequent chest lesions occurred in 6 vaccinated patients (7.4%). Residual disease identified at surgical resection <pCR (FIG. 20A) 2 patients with ERneg DCIS and 4 patients with ERpos DCIS did not receive AE therapy Patients with ERIS DCIS and received AE Since the late enrolled ERP patients were treated with co-vaccination and AE therapy, the median follow-up period for these patients was shorter (Table 20B). Be monitored.

  As shown in Table 1, tumor removal rates were similar in all three groups. However, the ERP DCIS patients who received AE therapy (18.75%) had lower tumor shrinkage rates than the ERP DCIS patients who did not receive AE therapy (53.8%, p = 0.06). It was. ERpos DCIS patients who received AE therapy have a lower rate of subsequent breast events, despite lower radiation rates.

Immune response rate to HER2 vaccination CD4 + Th1 response: systemic-peripheral blood Pre-vaccination and post-vaccination immune responses were measured in 53 patients. Overall, there was a significant increase in responsiveness from 36.25% before vaccination to 56.25% (p = <0.001) after vaccination. The median response repertoire also increased significantly from pre-vaccination 1 (IQR 0-2) to 2.9 (IQR 2-4) after vaccination (p = <0.001). Finally, the median cumulative response ranged from 56.1 pre-vaccination (IQR 23.3-111.7) to post-vaccination 133.1 (IQR 75.6-240.3) (p = 0.002) Significantly increased.

  Response rate: After vaccination, response rate increased significantly in each group (ERneg 58.3% -87.5%, p <0.01; ERpos 50.0% -75.0% without AE treatment, p <0.01; AE treatment 57.1% -90.5%, p <0.01). Response rates before vaccination were similar in all three groups (ERneg 58.3%, ERpos 50.0% without AE treatment, ERpos 57.1% with AE treatment, p = 0.9) . Response rates after vaccination were similar in all three groups (ERneg 87.5%, ERpos 75.0% without AE treatment, AEpos 90.5% ERpos, p = 0.5, FIG. 21A). there were.

  Response repertoire: After vaccination, the response repertoire increased in each group (ERneg 1-3, p = 0.05; ERpos0-1.5 without AE treatment, p = 0.1; ERpos of AE treatment 1-3, p = 0.01). The pre-vaccination median response repertoire was AE treatment 0 (IQR 0-1.5), AE treatment 1 (IQR 0-2), P = 0.5 ERpos, ERpos1 (IQR 0-2). The median response repertoire after vaccination was ERpos 1.5 (IQR 0.5-3.5) without AE treatment, ERpos with AE treatment 3 (IQR 2-5), 3 groups of p = 0.4 ( ERneg 3 (IQR 2-4.5) FIG. 21B).

  Cumulative response: After vaccination, the cumulative response increased in each group (ERneg 56.3-149.7, p <0.01; ERpos 41.1-178.7 without AE treatment, p <0.01; ERpos with AE treatment 58.6-100.9, p <0.01). The median cumulative response before vaccination was ERpos 41.1 without AE treatment (IQR 9.6-168.6), ERpos 58.6 with AE treatment (IQR 24.2-87.9), p = 0 886) (ERneg 56.3 (IQR 26.1-116.2)) The median cumulative response after vaccination was also observed in ERpos 178.7 (IQR 64.7 without AE treatment). -278.3), ERpos with AE treatment 100.9 (IQR 67.5-174.4), 3 groups of p = 0.5 (ERneg 149.7 (IQR 97.7-246.7) FIG. 21C) .

CD4 + Th1 response: local-sentinel lymph node The immune response after vaccination was measured in 40 patients. Overall, the responsiveness was 80%, the median response repertoire was 2 (IQR1-5), and the median cumulative response was 76.5 (IQR23-197).

  Response rate: response in HER2pos / ERpos DCIS patients treated with AE compared to HER2pos / ERpos DCIS patients not treated with AER (92.3% vs 43%, p = 0.03, FIG. 22A) The rate was significantly higher.

  Response repertoire: HER2pos / ERpos DCIS (4 (IQR 2-6) vs0 (IQR 0-5); p = 0.05, FIG. 22B) not receiving AE treatment in HER2pos / ERpos DCIS patients treated with AE .

  Cumulative response: HER2pos / ERpos DCIS patients who received AE treatment, HER2pos / ERpos DCIS patients who did not receive AER treatment (102 (IQR 69-354) vs. 23 (IQR 1-100); p = 0.05, FIG. 22C).

CD8 + response: systemic-peripheral blood Pre-vaccination and post-vaccination CD8 + immune responses were measured in 22 HLA-A2 + patients. Overall, there was a significant increase in reactivity from 13.3% before vaccination to 72.7% (p = <0.0002) after vaccination.

  (ERneg 12.5% -75%, p = 0.04; ERpos without AE treatment 0% -100%, p <0.03; ERpos with AE treatment 20% -60%, p = 0.17) . Response rates before vaccination were similar across the three groups (ERneg 12.5%, ERpos 0% without AE treatment, AE treatment 20%; p =). Response rates after vaccination were also in 3 groups (ERneg 75%, ERpos 100% without AE treatment, AEpos 60% ERpos; p =.

  Conclusion: The studies described herein clearly show that the anti-HER2 DC1 vaccine is clinically effective in ERneg / HERpos DCIS patients. Anti-HER2 DC1 vaccines have also been shown to be safe when used in combination with anti-estrogen therapy. Concurrent neoadjuvant anti-estrogen therapy and anti-HER2 DC1 vaccination have been shown to increase the proportion of immune responses in local sentinel lymph nodes and pathological complete responses in HER2pos / ERpos DCIS patients. Combination therapy with antiestrogens is a milk event. These results may provide a personalized approach in DCIS therapy. These results further support a personalized, targeted combination of anti-HER2 DC1 vaccine and anti-estrogen therapy. One skilled in the art can appreciate that other anti-proliferative combinations of anti-HER2 treatments such as trastuzumab and pertuzumab are possible. These approaches can limit the need for extensive surgery, eliminate radiation therapy, and reduce long-term hormonal therapy.

(Example 6)
A novel dendritic cell vaccine targeting mutant BRAF overcomes bemelafenib resistance and synergistically improves survival in BRAF mutant mouse melanoma BRAF inhibitor Vemurafenib (PLX) is a BRAF mutation (BRAFV600E) melanoma Improves survival, but resistance is common. BRAFV600E pulsed type 1 polar dendritic cell vaccine (BRAFV600E-DC1) induces antigen-specific CD8 + T cells that affect murine BRAFV600E melanoma. We investigated whether the combination of BRAFV600E-DC1 and PLX elicited a synergistic clinical response.

Methods An implantable BRAFV600EPTEN-/-melanoma model was developed in the C57B1 / 6 background. DC1 was generated from bone marrow precursors using Flt3, IL-6, GM-CSF, IL-4, CpG and LPS and pulsed with class I BRAFV600E peptide. In addition to untreated and ovalbumin-DC1 controls, BRAFV600E-DC1 (twice weekly injection) and PLX were administered alone or in tumor-bearing mice (n = 10 each) in the designated combination. Tumor growth and survival were determined. Induction of BRAFV600E-specific CD8 + T cell response from splenocytes was assessed by IFN-γ ELISA. Quantification of cytokine mRNA in the tumor microenvironment (TME) was performed by RT-qPCR.

Results FIG. 24 shows that the BRAFV600E-DC1 + PLX combination (started after BRAFV600E-DC1 induction) compared to BRAFV600E-DC1 significantly delayed compared to BRAFV600E-DC1 (42d) (P <0.001). )), PLX (43.5d), ovalbumin-DC1 (28d), or untreated (24d) cohort (P <0.001); 35% became disease-free after BRAFV600E-DC1 + PLX therapy; Maintained immunity. We induced synergistically improved systemic CD8 + T cell recognition of BRAFV600E pulse antigen presenting cells and BRAFV600E tumor cells (p <0.001) as measured by in vitro IFN-γ release. In TME, BRAFV600E-DC1 + PLX produced higher mRNA levels of Th1 (IFN-γ / TNF-α) and T cell homing (CXCL9 / CCL5) cytokines, and PD-L1 expression was attenuated. The buying and selling of CD8 + TIL was strengthened by BRAFV600E-DC1 + PLX.

  In conclusion, the BRAFV600E-DC1 vaccine overcomes vemurafenib resistance in BRAFV600E melanoma and synergistically improves immune and clinical responses. Such combinations will be used by those skilled in the art.

  Each patent, patent application, and publication cited herein is hereby incorporated by reference in its entirety. While the invention has been disclosed in terms of particular embodiments, it is obvious that other embodiments and variations of the invention can be devised by other persons skilled in the art without departing from the true spirit and scope of the invention. is there. It is intended that the appended claims be construed to include all such embodiments and equivalent variations.

CROSS REFERENCE TO RELATED APPLICATIONS This application is a US Provisional Patent Application No. 62 / 025,673 filed July 17, 2014, May 22, 2015, each of which is hereby incorporated by reference in its entirety. US Provisional Patent Application No. 62 / 165,445 filed on the same day, US Provisional Patent Application No. 62 / 025,685 filed on July 17, 2014, US filed on July 24, 2014 Claims priority of provisional patent application 62 / 029,774.

DESCRIPTION OF FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT This invention was made with Federal support under contract number R01 CA096997 awarded by the National Institutes of Health. The federal government has certain rights to the invention.

  Dendritic cells (DCs) are white blood cells that acquire protein antigens from even microbial or cancerous cells and present or “present” these antigens to T cells. T cells are thus activated by DC and then initiate a systemic immune response that challenges the threat. Conventional vaccines against microorganisms contain additives known as “adjuvants” that enhance DC activity and amplify vaccine-induced immune responses by many possible means within the vaccinated individual. However, vaccine requirements for cancer present many unique problems. For example, conventional adjuvants do not provide the DC with an appropriate signal that allows the DC to initiate optimal immunity against the cancer. The tumor itself also creates an environment that can affect the proper activation of DCs.

A common solution to this problem is to remove DCs from cancer patients, have them take up tumor antigens in vitro, and then provide a specific activation signal to the cells before re-administering them to the body That is. This ensures proper DC activation that has been eliminated by the influence of the tumor environment. When returned to the body, DCs interact with T cells to initiate strong antitumor immunity. Extra-corporalized DC has solved many effectiveness problems, but historically this has been a price constraint. For example, because DC vaccines consist of living cells, special cell processing and vaccine production facilities were required at the actual location of the medical center that administers the treatment. This is an expensive and inefficient way to deliver therapy, because each institution that administers such treatment must build and maintain its own facilities for special applications Because.

Currently, the management of breast cancer, depending on the combination of early diagnosis and aggressive treatment, which may include surgery, radiation therapy, one or more of treatments such as chemotherapy and hormonal therapy. Herceptin (trastuzumab) was developed as a targeted therapy for HER2 / ErbB2-positive breast cancer cells and is often used with other therapies including the mitotic inhibitor paclitaxel (sold under the trade name Taxol).

Herceptin's effectiveness as monotherapy is estimated to be less than 30%; combinatorial treatment with microtubule stabilizing drugs such as paclitaxel increases efficacy to about 60% (Burris et al., 2000, Semin Oncol, 27: 19-23). Treatment with Herceptin results in the accumulation of the Cdk inhibitor p27 and subsequent G1 / S cell cycle arrest, paclitaxel stops the transition to mitosis, which can lead to cell death. However, despite great expectations, high doses of Herceptin or paclitaxel result in undesirable side effects. In addition, cancer often can be resistant to Herceptin and / or paclitaxel.

Burris et al., 2000, Semin Oncol, 27: 19-23.

Thus, there is an unmet need for compositions and effective methods for producing maximal therapeutic DC vaccines and new methods of treating cancer using Herceptin. Thus, there is a need in the art to have additional immunotherapeutic approaches for treating or preventing breast cancer and other malignancies. The present invention satisfies this need .

  The following detailed description of preferred embodiments of the invention is better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. However, it is to be understood that the invention is not limited to the arrangement and instrumentality of the embodiments shown in the drawings.

It is a chart which shows the survival rate and yield after thawing | decompression of DC1 cryopreserved. When cells were directly thawed and counted, cell recovery was an average of 89% and viability was 95%. It is a chart which showed that there was no significant difference in a cell survival rate (p = .4807) and recovery rate (p = .1220). FIG. 6 is a chart showing that both populations had similar initial (7 hours after LPS addition) IL-12p70 secretion (p = 0.768). The population continued to show comparable IL-12p70 secretion levels over the 30 hour observation period and there was no significant difference between the populations. Between populations and IL-1β (p = 0.7960), IL-1α (p = 0.0841), Rantes (p = 0.902), MDC (p = 0.1514), IL-8 (p = 0) 7844) , MIP-1α (p = 0.2673), IP-10 (p = 0.7366), IL-6 (p = 0.24), TNF-α (p = 0.8972), IL-5 (P = 0.0735) , IL-15 (p = 0.8878), IL-10 (p = .1937) , and MIP-1β (p = 0.9217 ) produced no significant difference. It is a chart to show . Is a chart showing the production of IFN-gamma from cryopreserved DC and cryopreserved were not DC. FIG. 3 shows that Th1 cytokines TNF-α and IFN-γ synergistically induce senescence in breast cancer cells, and the required dose is inversely correlated with HER2 expression. FIG. 6A shows that the SK-BR-3 breast cancer line was incubated with 10 ng / ml TNF-α and 100 U / ml IFN-γ for 5 days and subcultured two more times in the absence of cytokines, then Figure 8 shows the results of a study stained for SA-β-galactosidase (SA-β-gal) expression (senescence marker) and compared to untreated control cells. Only paired cytokines induced senescence. The upper panel shows three separate photos from one representative data of the experiment. The lower panel shows a histogram of densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^* P <0.05. FIG. 6B shows a photograph of Western blotting analysis in which cell lysates of the cells described in FIG. 6A were analyzed for p15INKb and p16INK4a expression . Vinculin was used as a loading control. FIG. 6C shows that T-47D breast cancer cells were untreated (1) or at the following concentrations of TNF-α and INF-γ: 10 ng / ml and 100 U / mL (2), 50 ng / ml and 500 U / mL (3 ), 75 ng / ml and 750 U / mL (4), 100 ng / ml and 1000 U / mL (5), and subcultured two more times in the absence of cytokines , then the cells were SA- (6) Shows the results of the study stained for β-gal and compared to control untreated cells or treated with 8 μM etoposide as a positive control. The upper panel shows from one photograph of representative data of three independent experiments. The lower panel shows a histogram of the six densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^* P <0.05, ^** P <0.01, ^*** P <0.001. FIG. 6D shows that combined treatment with the Th1 cytokines IFN-γ and TNF-α resulted in greater aging compared to untreated controls with SK-BR-3 (10 ng / ml TNF-α + 100 U / ml). IFN-γ) and T-47D (100 ng / ml TNF-α + 1000 U / ml IFN-γ) cells; MDA-MB-231 cells (200 ng / ml TNF-α + 2000 U / ml IFN-γ) FIG . 6 is a histogram showing the results of a study that remained largely unaffected by double IFN-γ + TNF-α treatment. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^** P <0.01, ^*** P <0.001. Figure 2 shows that HER2 induces senescence and apoptosis in MDA-MB-231 breast cancer cells. The left panel of FIG. 7A shows wtHER2 (pcDNAHER2) or empty vector (pcDNAHER2) treated with the listed concentrations of TNF-α and IFN-γ for 5 days and then subcultured twice in the absence of cytokines ( in MDA-MB-231 cells transfected with pcDNA3), it is a histogram showing the results of concentration measurement analysis conducted SA-β-gal staining. The inset at the top of the histogram is a photograph of Western blot analysis where MDA-MB-231 cells transfected with pcDNAHER2 or pcDNA3 and probed with a HER2 specific antibody were analyzed to determine the presence or absence of HER2 expression. Vinculin was used as a loading control. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^*** P <0.001. The right panel of FIG. 7A shows a photograph of representative data from one of three independent experiments. FIG. 7B shows a photograph of Western blotting analysis for p15INKb expression and cleaved caspase 3 expression on the cell lysate of the cells described in FIG. 7A. Vinculin was used as a loading control. A diagram showing expression while blocking together HER2 and HER3 are Oite the SK-BR-3 breast cancer cells, a Th1 cytokine, to enhance senescence and apoptosis by TNF-alpha and IFN-gamma is there. FIG. 8A shows non-targeted siRNA ( siRNA NT), HER2 siRNA , HER3 siRNA or HER2 siRNA and HER3. In SK-BR-3 cells transfected with siRNA combinations, then treated with the listed concentrations of TNF-α and IFN-γ for 5 days and subcultured two more times in the absence of cytokines, The result of the research which performed SA- (beta) -gal dyeing | staining is shown. The left panel shows a histogram of the densitometric analysis . Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^*** P <0.001. The inset shows a photograph of a Western blot analysis of SK-BR-3 cells transfected with NT siRNA, HER2 siRNA or HER3 siRNA probed with HER2 and HER3 specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. The right panel shows a photograph of representative data from one of three independent experiments. FIG. 8B shows the results of a study of Western blot analysis of cell lysates of the cells described in FIG. 8A for p15INKb expression and cleaved caspase 3 expression. FIG. 4 shows that the combination of HER2 inhibition and HER2-HER3 dimerization inhibition enhances senescence induction and apoptosis in SK-BR-3 breast cancer cells by Th1 cytokines, TNF-α and IFN-γ. Figure 9A (1) untreated, or, (2) 10 ng / ml of TNF-alpha and 100 U / ml of IFN- γ, (3) 10μg / ml of trastuzumab (TZM) + pertuzumab (Per) or (4 ) are treated for 5 days in the combination of both treatments, and shows the results of the SA-β-gal staining was performed on SK-BR-3 cells were further subcultured twice in the absence of antibodies and cytokines. The left panel is a histogram of the densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^*** P <0.001. The right panel is a photograph showing representative data from one of three independent experiments. FIG. 9B shows a photograph of Western blotting analysis of cell lysates of the cells described in FIG. 9A for p15INKb expression or cleaved caspase 3 expression. Vinculin was used as a loading control. Similar results were observed in three independent experiments. FIG. 9C shows the results of a study of the induction of apoptosis in untreated or treated SK-BR-3 cells, stained for Annexin V and PI, and then analyzed by flow cytometry. The upper panel shows a plot of representative data from one of three independent experiments. The lower panel shows a histogram of the densitometric analysis. Data are expressed as the mean ± SEM of annexin V ⁺ PI ⁺ cells from three independent experiments. P values were calculated using a paired student t test. Statistical significance was determined at ^** P <0.01. FIG. 4 shows that combined treatment with trastuzumab and pertuzumab enhances CD4 ⁺ Th1-mediated aging and apoptosis of HER2-overexpressing human breast cancer cells. FIG. 10A is FIG. 10A. Using a transwell system, 0.5 × 10 ⁵ SK-BR-3 cells were added with or without 10 μg / ml trastuzumab (Tzm) and pertuzumab (Per) 1) 5 × 10 ⁵ CD4 ⁺ T cells alone (CD4 ⁺ only), 2) CD4 ⁺ T cells + 0.5 × 10 ⁵ HER2 class II peptides (DC H) or irrelevant class II BRAP or survivin peptides (DC B or DC S) Results of studies co-cultured for 5 days with type 1 polarized mature DC pulsed with each, and immature DC pulsed with 3) CD4 ⁺ T cells + HER2 (iDC H) are shown. The cells were then subcultured two more times in the absence of blocking antibodies and immune system cells, then stained for SA-β-gal expression and compared to untreated control cells. The upper panel is a histogram of the densitometric analysis. Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^*** P <0.0001. The lower panel shows from one photograph of representative data of three independent experiments. FIG. 10B shows a photograph of Western blotting analysis of p15INKb expression or cleaved caspase 3 expression of cell lysates of SK-BR-3 cells co-cultured as described above. Increased expression of p15INK4b and cleaved caspase-3 was observed, which induced senescence and apoptosis in SK-BR-3 cells when cocultured with DC H / CD4 ⁺ T cells in the presence of trastuzumab and pertuzumab However, it is suggested that it was not derived from DC B group , DC S group and iDC H group. Vinculin was used as a loading control. Results are representative of 3 independent experiments. The photograph is a Western blotting analysis of p15INKb expression or cleaved caspase 3 expression of the cell lysate of the cells described in FIG. 9A. FIG. 3 shows that Th1 cytokines TNF-α and IFN-γ sensitize trastuzumab and pertuzumab resistant breast cancer cells to senescence and apoptosis induction. FIG. 11A shows (1) untreated or (2) 50 ng / ml TNF-α and 500 U / ml IFN-γ , (3) 10 μg / ml trastuzumab (Tzm), pertuzumab (Per) or (4) the same concentration of trastuzumab, pertuzumab and TNF-alpha, and treated for 5 days with a combination of IFN-gamma, then HCC-1419 cells and JIMT-1 cells were further subcultured twice in the absence of antibodies and cytokines Shows the results of SA-β-gal staining in FIG. The upper panel is a histogram of the densitometric analysis . Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^** P <0.01. The upper layer of the lower panel shows a photograph of representative data from one of three independent experiments on HCC-1419 cells . The lower layer of the lower panel shows a photograph of representative data from one of three independent experiments in JIMT-1 cells . Figure 11B shows the results of cell lysates of cells described were analyzed by Western blotting for p15INKb or switching Danka Supaze 3 expression in HCC-1419 cells (left panel) and JIMT-1 cells (right panel) in FIG. 11A . Vinculin was used as a loading control. Similar results were observed in three independent experiments. IFN -Ganmaaruarufa and TNF -R1, in breast cancer cell lines, independent of their HER2 levels, shows that it is expressed at the same level. IFN − determined by Western blot in immobilized MCF-10A mammalian epithelial cells and breast cancer cell lines (SK-BR-3, BT-474, MCF-7, T-47D and MDA-MB-231) Ganmaaruarufa, shows the expression of TNF -R1 and HER2. Vinculin was used as a loading control. Similar results were observed in three independent experiments. It is a figure which shows that the expression in the state which blocked | interrupted HER2 and HER3 together enhances the senescence induction by TNF-α and IFN-γ, which are Th1 cytokines, in MCF-7 breast cancer cells. FIG. 13A is transfected with non-targeted siRNA ( siRNA NT), HER2 siRNA , HER3 siRNA, or a combination of HER2 siRNA and HER3 siRNA and then treated with the listed concentrations of TNF-α and IFN-γ for 5 days. The results of a study in which SA-β-gal staining was performed on MCF-7 cells subcultured two more times in the absence of cytokines are shown. The left panel shows a histogram of densitometric analysis . Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. Statistical significance was determined at ^*** P <0.001. Inset is a photograph of Western blot analysis of MCF-7 cells transfected with NT siRNA, HER2 siRNA, HER3 siRNA, or a combination of HER2 siRNA and HER3 siRNA probed with HER2 and HER3-specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. Right panel shows from one photograph of representative data of three independent experiments. FIG. 13B shows the results of a Western blot analysis of cell lysates of the cells described in FIG. 13A for p15INKb expression or cleaved caspase 3 expression ( ^*** P <0.001). The inset shows a photograph of Western blot analysis of SK-BR-3 cells transfected with NT siRNA, HER2 siRNA or HER3 3 siRNA probed with HER2 and HER3 specific antibodies. Vinculin was used as a loading control. Similar results were observed in three independent experiments. It is a figure which shows the effect with respect to aging of SK-BR-3 and apoptosis of the cytokine produced by Th1. Figure 14 A, using a transwell system, the 0.5 × 10 ⁵ cells of the SK-BR-3 cells, 1) ⁵ × 10 5 cells of CD4 ⁺ T cells alone (CD4 ⁺ only), 2) CD4 ⁺ T cells + 0.5 x 10 type 1 polarized mature DC pulsed with ⁵ HER2 class II peptides (DC H) or irrelevant class II BRAF peptide (DC B), respectively, and 3) CD4 ⁺ T cells + HER2 (iDC) H) Results of studies co-cultured for 5 days with immature DC pulsed with BRAF (iDC B) are shown. The cells were then subcultured two more times in the absence of immune system cells, then stained for SA-β-gal expression and compared to untreated control cells. Compared to the IgG isotype control, senescence induced in SK-BR-3 treated with CD4 ⁺ / DC H was partially due to neutralizing IFN-γ and TNF-α with specific antibodies. Rescued (75.27% rescue). The upper panel is a histogram of the densitometric analysis . Data are expressed as% of SA-β-gal positive cells and mean ± SEM D. (N = 3). P values were calculated using a paired student t test. The lower panel shows a corresponding photograph of representative data from one of three independent experiments. FIG. 14B shows a photograph of a Western blot showing increased expression of p15INK4b and cleaved caspase-3, and when co-cultured with DC H / CD4 ⁺ T cells, the DC B, iDC H, and iDC B groups In comparison, it is suggested that senescence and apoptosis of SK-BR-3 cells are induced. Compared to IgG isotype control, ^CD4 + / DC senescence and apoptosis induced H in the SK-BR-3 treated, by neutralization with specific antibodies IFN-gamma and TNF-alpha, partially Was rescued. Vinculin was used as a loading control. Results are representative of three experiments. It is a figure which shows the effect of trastuzumab and pertuzumab with respect to AKT activation by heregulin in a breast cancer cell line. T-47D cells lack serum, the HCC-1419 cells and JIMT-1 cells were treated with trastuzumab (TZM) and pertuzumab (Per 10μg / ml, 90 minutes), and, (HRG, 20ng / ml, 5 minutes) Stimulated with. The upper panel shows representative data from one of three independent experiments. Data are expressed as% of HRG response in the absence of trastuzumab and pertuzumab, mean ± SEM D. (N = 3). FIG. 16 shows the vaccination procedure. Patients with biopsy was diagnosed with H ^ER2-positive DCIS has been enrolled in the study. Monocytes patients were collected by leukapheresis and elutriation method. Monocytes were rapidly matured into type 1 DC and the anti-HER2 CD4 Th1 immune response before vaccination was measured. Patients were vaccinated 4-6 times a week (+/- anti-estrogen therapy). Patient monocytes were collected again by a second leukopheresis and elutriation method and the anti-HER2 CD4 Th1 immune response after vaccination was measured. After vaccination, the patient underwent surgical resection and cured the remaining disease. Clinical response was measured in surgical specimens, and immune response was measured in sentinel lymph nodes when sentinel lymph nodes (SLN) were obtained . Figure 17A ~ 17B are, Th1 cytokines (IFN gamma and TNF [alpha]), tamoxifen metabolite - shows the results of (4-hydroxy tamoxifen, "4HT"), or SKBR3 and MCF7 breast cancer cell lines treated with both. SKBR3 (ER ^negative ) (FIG. 17A) increased anti-tumor activity in response to Th1 cytokine treatment, but not in response to anti-estrogen treatment or combination treatment. MCF7 (ER ^positive ) (FIG. 17B) did not increase anti-tumor activity in response to either Th1 cytokine treatment or anti-estrogen treatment, but the combination resulted in increased metabolic activity. Figure 18 shows the anti-estrogen ( "AE") therapy and anti-HER2 DC1 vaccination patient distribution of combination studies. HER-2 positive expression intensity of HER-2 protein by immunohistochemical staining was defined 2+ or 3+ cells> 5% and. AE therapy (tamoxifen, letrozole, or anastrozole) was given at the same time as DC vaccination. 19, ER status and AE treatment is a histogram showing the pathological complete response rate to compare more patients ^{(ER-negative;} there ^ER-positive AE; No ^ER-positive AE). FIGS. 20A - 20B show the study patient's subsequent breast events comparing the patients with complete pathological response (“pCR”) (FIG. 20A) and ER status and AE treatment (FIG. 20B). 21A - 21C show the CD4 + systemic immune response measured in peripheral blood. Th1 response; at each evaluation index (responsiveness (Fig. 21A) in response repertoire (Fig. 21B) and cumulative responses (Figure 21C)), immune response after anti-HER2 DC1 vaccination was significantly increased. However, the immune response before and after vaccination was similar in all three groups. 22A - 22C show the CD4 + local immune response measured in the patient's sentinel lymph node. The immune response after vaccination is AE compared with ER- ^positive patients who did not receive AE treatment at each endpoint (responsiveness (Figure 22A), response repertoire (Figure 22B) or cumulative response (Figure 22C)). It was higher in ER ^positive patients who received treatment . FIG. 23 shows the CD8 ⁺ systemic immune response measured in peripheral blood. ER ^negative condition of the patient and the anti-estrogen involving treatment and ^ER-positive state without patient (no ^ER-positive AE; there ^ER-positive AE) response of is shown. Figure 24 shows the ^BRAFV 600E -DC1 vaccine which overcomes the Oite Beramefenibu resistant to BRAF- mutant mouse melanoma.

The present invention provides compositions and methods for producing an FDA approved injectable multi-dose antigen pulsed dendritic cell vaccine for personalized treatment and prevention of cancer or other disorders. In one embodiment, the present invention provides compositions and methods for producing an FDA approved multi-dose antigen pulse type 1 polarized dendritic cell vaccine (DC1).

In one embodiment, the antigen is taken up and pre-activated, ie “syringe ready”, ie any additional cell processing that requires additional facilities and quality control / assurance steps (eg, according to FDA instructions). A method for cryopreserving dendritic cells as a multi-dose aliquot suitable for immediate injection into a patient is also provided .

In one embodiment, injectable multidose antigen-pulsed dendritic cell vaccine, preferably, a method of producing injectable multidose antigen-pulsed type 1 polarized DC vaccine showing a maximal effect efficiently is provided.

In one embodiment, an FDA approved injectable multi-dose antigen pulsed dendritic cell vaccine is produced by collecting DCs in a single patient leukapheresis . Preferably, leukapheresis and production of dendritic cell vaccine is a centralized vaccine in which the DC is engineered to create an activated antigen- incorporating DC vaccine consisting of its initial immunization dose and multiple “booster” doses Performed at a first location, which may be a production facility. The benefit of the present invention is that all quality control / quality assurance steps according to FDA orders are performed at a central facility, and after completion and release , all vaccine doses are stored frozen for continuous administration to patients. To be sent to a remote medical center. In one embodiment, the FDA approved injectable multi-dose antigen-dendritic cell vaccine of the present invention does not require any mandated quality control / quality assurance steps at the site of administration.

In another aspect, the invention includes altering the immune response in a tumor such that a treatment effective to treat cancer is such that immune cells in the tumor site are more effective at attacking tumor cells. Based on the discovery. In some cases, effective treatment includes improving immune cell migration and activity in the tumor site. Thus, the present invention uses a dendritic cell vaccine with a composition that inhibits one or more of HER-2 and HER-3 (eg, trastuzumab, pertuzumab, etc.) as a therapeutic regimen for treating cancer Compositions and methods are provided. In one embodiment, the treatment regimen includes the use of dendritic cell vaccines, HER-2 inhibitors, and chemokine modulating agents.

In one embodiment, the present invention provides compositions and methods for using a dendritic cell vaccine with blockade of one or more of HER-2 and HER-3 as a therapeutic regimen for treating cancer. provide. In another embodiment, the present invention provides compositions and methods using dendritic cell vaccines with HER-2 and HER-3 blockade by addition of TNF-α and IFN-γ. In another embodiment, the invention provides a composition that blocks one or more of HER-2 and HER-3 by the addition of TNF-α and IFN-γ as a therapeutic regimen for treating cancer, and Provide a method.

In one embodiment, the treatment regimen of the present invention comprises an oncogenic Th1 immune response (eg, TNF-α and IFN-γ) and one or more oncogenic drivers of HER-2 and HER-3. Includes combination therapy to induce blockade.

In one embodiment, the treatment regimen of the present invention can be used to treat cancer, thus, considered to be anti-cancer therapy of certain. In another embodiment, the treatment regimen of the present invention comprises surgery, chemotherapy, radiation therapy (eg, x-ray), gene therapy, immunotherapy, hormone therapy, viral therapy, DNA therapy, RNA therapy, protein therapy, cell therapy. Can be used in combination with another anti-cancer therapy, including but not limited to nanotherapy.

In one embodiment, the treatment regimen of the present invention is used prior to receiving other anti-cancer therapies. In another embodiment, the treatment regimen of the invention is used contemporaneously with receiving other anti-cancer therapies. In another embodiment, the treatment regimen of the present invention is used after receiving other anti-cancer therapies.

In another embodiment, simultaneous neoadjuvant estrogen therapy and anti-HER2 DC1 vaccination, increase the proportion of pathological complete response in the immune response and ^{HER2-positive} / ^ER-positive DCIS patients in the local sentinel lymph node.

Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.

  In general, the terminology used herein and laboratory procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and hybridization are well known in the art and commonly employed.

  Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures generally involve conventional methods in the art and various general references (eg, Sambrook and Russell, 2012, Molecular Cloning, A Laboratory Approach, Cold Spring Harbor Press, Cold Spring Harbold, Cold Spring Harbold, Cold Spring Harbold, Et al., 2012, Current Protocols in Molecular Biology, John Wiley & Sons, NY), which are provided throughout this document.

  The terminology used herein and the laboratory procedures used in analytical chemistry and organic synthesis described below are well known in the art and commonly employed. Standard techniques and modifications thereof are used for chemical synthesis and chemical analysis.

  Each of the following terms used herein has the meaning associated with it in this section.

  The articles “a” and “an” are used herein to refer to one or more (ie, at least one) of the grammatical objects of the article. For example, “an element” means one element or more than one element.

  As used herein, “about” refers to a measurable value, such as amount, duration, etc., where the specified value is such that such variation is appropriate to perform the disclosed method. Is intended to encompass ± 20%, or ± 10%, or ± 5%, or ± 1%, or ± 0.1% variation from

The term “abnormal” when used in relation to an organism, tissue, cell or component thereof is “normal” in at least one observable or detectable characteristic (eg, age, treatment , time, etc.). Refers to an organism, tissue, cell or component thereof that is different from the organism, tissue, cell or component thereof presenting each (expected) feature. Normal or expected characteristics for one cell or tissue type may be abnormal for different cell or tissue types.

The term “antigen” or “ag” as used herein is defined as a molecule that elicits an immune response. This immune response can include either antibody production or activation of specific immunocompetent cells, or both. One skilled in the art understands that any macromolecule, including virtually any protein or peptide, serves as an antigen. Furthermore, the antigen can be derived from recombinant or genomic DNA. One skilled in the art understands that when this term is used herein, any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response encodes an “ antigen”. . Furthermore, those skilled in the art will appreciate that the antigen need not be encoded solely by the full-length nucleotide sequence of the gene. It is clear that the present invention includes, but is not limited to, the use of partial nucleotide sequences of two or more genes and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Furthermore, those skilled in the art understand that the antigen need not be encoded by a “gene” at all. It is clear that the antigen can be produced synthetically or derived from a biological sample. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells or biological fluids.

  An “antigen presenting cell” (APC) is a cell that can activate T cells and includes, but is not limited to, monocytes / macrophages, B cells and dendritic cells (DC).

“APC incorporating antigen” or “antigen pulsed APC” includes APC that has been exposed to and activated by an antigen. For example, APC can take up antigens in vitro, for example during culture in the presence of antigen . APC can also take up antigens in vivo upon exposure to the antigen. “APC incorporating antigen” is conventionally one of two methods: (1) a small peptide fragment, known as an antigenic peptide, is “pulsed” directly outside the APC; or (2) It is prepared by incubating with whole protein or protein particles, which is then digested with APC. These proteins are digested by APC into small peptide fragments that are ultimately transported and presented on the APC surface. Furthermore, APCs incorporating antigens can also be created by introducing a polynucleotide encoding the antigen into a cell.

  An “anti-HER2 response” is an immune response specific for HER2 protein.

“Apoptosis” is a process of programmed cell death. Caspase-3 is a frequently activated cell death protease.

  The term “autoimmune disease” as used herein is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of inappropriate and excessive responses to self-antigens. Examples of autoimmune diseases include, among others, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (type I), dystrophic epidermolysis bullosa, Epididymis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, Examples include, but are not limited to, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis.

  As used herein, the term “self” is meant to refer to any material derived from the same individual as it is later reintroduced.

  The term “B cell” as used herein is defined as a cell derived from bone marrow and / or spleen. B cells develop into plasma cells that produce antibodies.

  As used herein, the term “cancer” is an excess of cells whose unique trait—loss of normal control—results in uncontrolled proliferation, loss of differentiation, invasion of local tissue, and / or metastasis. Defined as proliferation. Examples include but are not limited to breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer and lung cancer.

“Surface CD4 ⁺ Th1 cells”, “Th1 cells”, “CD4 + T helper type 1 cells”, “CD4 + T cells”, etc. express the surface protein CD4 and produce IFN-γ, a cytokine, at a high level. It is defined as a subtype of T helper cells. See also “T helper cells”.

"Cumulative response", the sum of the reactive spots from all six all MHC class II binding peptides from a given group of patients (IFN-gamma ELISPOT cells 10 per ⁶ spot-forming cells from the analysis "SFC") represented as being, that means the total immune response of one patient group.

  The term “cryopreserved” or “cryopreservation” as used herein refers to cells that have been resuspended in cryopreservation media and frozen at a temperature of about −70 ° C. or lower.

  “DC vaccination”, “DC immunization”, “DC1 immunization”, etc. utilize autologous dendritic cells to recognize specific molecules using the immune system and acquire specific responses to them. Refers to strategy.

  The term “dendritic cell” (DC) is an antigen presenting cell that can be present in vivo, in vitro, ex vivo or in a host or subject, or derived from hematopoietic stem cells or monocytes. Dendritic cells and their progenitor cells can be isolated from a variety of lymphoid organs such as the spleen, lymph nodes, and bone marrow and peripheral blood. DC has a characteristic form having a thin sheet (foliate foot) extending from a dendritic cell body in a plurality of directions. Typically, dendritic cells express high levels of MHC and costimulatory (eg, B7-1 and B7-2) molecules. Dendritic cells can induce antigen-specific differentiation of T cells in vitro and can elicit primary T cell responses in vitro and in vivo.

As used herein, “activated DC” is DC that has been exposed to a Toll-like receptor agonist. The activated DC may or may not have taken up the antigen.

  The term “mature DC” as used herein is defined as dendritic cells that express molecules including high levels of MHC class II, CD80 (B7.1) and CD86 (B7.2). In contrast, immature dendritic cells express low levels of MHC class II, CD80 (B7.1) and CD86 (B7.2) molecules and can still take up antigen. “Mature DC” also refers to antigen presenting cells present in a host or subject that are in vivo, in vitro, ex vivo, or DC1-polarized (ie, can fully promote cellular immunity).

  A “disease” is a health condition of an animal, where the animal cannot maintain homeostasis and if the disease is not ameliorated, the animal's health continues to deteriorate.

A “disorder” in an animal is a health condition in which the animal can maintain homeostasis, but is less favorable than the absence of the disorder. If left untreated, the disorder does not cause necessarily further decrease in the animal's state of health.

  A disease or disorder is “ameliorated” if the severity or frequency of at least one sign or symptom of the disease or disorder experienced by the patient is reduced.

  As used herein, an “effective amount” or “therapeutically effective amount” is used interchangeably and is a compound, formulation, material or composition effective to achieve a particular biological result as described herein. Refers to the amount of a thing. Such results can include, but are not limited to, prevention of viral infection as determined by any means suitable in the art.

  “Endogenous” as used herein refers to any material derived from or produced within an organism, cell, tissue or system.

  As used herein, the term “exogenous” refers to any material that is introduced or produced externally from an organism, cell, tissue or system.

  An “estrogen receptor (ER) positive” cancer is a cancer that yields a positive result in a test for expression of ER. Conversely, “ER negative” cancers give a negative result when tested for such expression. The analysis of the state of the ER can be performed by any method known in the art.

  The term “cryopreservation medium” as used herein refers to a cell sample in preparation for freezing so that at least some of the cells in the cell sample can be recovered and remain viable after thawing. Refers to any medium mixed with.

“HER2” is a member of the human epidermal growth factor receptor (“EGFR”) family. HER2 is overexpressed in about 20-25% of human breast cancers and is expressed in many other cancers .

  A “HER receptor” is a receptor protein tyrosine kinase that belongs to the HER receptor family and includes EGFR (ErbB1, HER1), HER2 (ErbB2), HER3 (ErbB3) and HER4 (ErbB4) receptors. In general, the HER receptor contains an extracellular domain that binds a HER ligand and / or another HER receptor molecule; a lipophilic transmembrane domain; a conserved intracellular tyrosine kinase domain; and several Can be dimerized with a carboxyl-terminal signaling domain with a tyrosine residue that can be phosphorylated. The HER receptor may be a “native sequence” HER receptor or an “amino acid sequence variant” thereof. Preferably, the HER receptor is a native sequence human HER receptor.

  “HER pathway” refers to a signaling network mediated by the HER receptor family.

  “HER activation” refers to activation or phosphorylation of any one or more HER receptors. In general, HER activation results in signal transduction (eg, caused by the intracellular kinase domain of a HER receptor phosphorylated tyrosine residue in a HER receptor or substrate polypeptide). HER activation can be mediated by a HER ligand that is bound to a HER dimer containing the HER receptor of interest. A HER ligand bound to a HER dimer activates the kinase domain of one or more HER receptors in the dimer, thereby phosphorylating and / or tyrosine residues in one or more HER receptors. Alternatively, phosphorylation of tyrosine residues in additional substrate polypeptide (s) such as Akt or MAPK intracellular kinase can result.

“HER2 binding peptide”, “HER2 MHC class II binding peptide”, “binding peptide”, “HER2 peptide”, “immunogenic MHC class II binding peptide”, “antigen binding peptide”, “HER2 epitope”, “reactivity” "Peptides" and the like as used herein are derived from or based on sequences of HER2 / neu proteins that are targets found in about 20-25% of all human breast cancers , and , Its equivalent . The HER2 extracellular domain "ECD", extracellularly, or are anchored to the cell membrane, or you are circulating, means a HER2 domain comprising fragments thereof. The HER2 intracellular domain “ICD” refers to the domain of the HER2 / neu protein in the cytoplasm of the cell. According to a preferred embodiment, the HER2 epitope or otherwise binding peptide comprises 6 HER2 binding peptides including 3 HER2 ECD peptides and 3 HER2 ICD peptides.
Preferred HER2 ECD peptides are
Peptide 42-56: HLDMLRHLYQGCQVV (SEQ ID NO: 1) ,
Peptide 98-114: RLRIVRGGTQLFEDNYAL (SEQ ID NO: 2) , and Peptide 328-345: TQRCEKCSKPCARVCYGL (SEQ ID NO: 3) .
Preferred HER2 ICD peptides are
Peptide 776-790: GVGSPYVSRLLGICL (SEQ ID NO: 4) ,
Peptide 927-941: PAREIPDLLEKGERL (SEQ ID NO: 5) , and Peptide 1166-1180: TLERPKTLSPGKNGV (SEQ ID NO: 6) .
In embodiments where the patient has an HLA-A2 ^{positive /} A2.1 blood group , the MHC class I peptide or epitope is
Peptide 369-377: KIFGSLAFL (SEQ ID NO: 7) , and peptide 689-697: RLLQETELV (SEQ ID NO: 8) .

“HER2 ^positive ” is a classification or molecular subtype of certain types of breast cancer as well as many other types of cancer. HER2 positivity is currently defined by 2+ or 3+ in intensity of gene amplification and pathological staining by FISH (fluorescence in situ hybridization) assay.

“HER2 ^negative ” is defined by the lack of gene amplification by FISH and can in most cases encompass pathological staining in the range of 0 to 2+.

  The term “hyperproliferative disorder” is defined as a disorder resulting from the hyperproliferation of cells. Exemplary hyperproliferative diseases include, but are not limited to, cancer or autoimmune diseases. Other hyperproliferative diseases can include, for example, vascular occlusion, restenosis, atherosclerosis, or inflammatory bowel disease.

  The term “inhibit” as used herein means, for example, suppressing or blocking activity or function by about 10 percent compared to a control value. Preferably, the activity is inhibited or blocked by 50%, more preferably 75%, even more preferably 95% compared to the control value. As used herein, “inhibit” reduces or completely reduces the expression, stability, function or activity of a molecule, reaction, interaction, gene, mRNA and / or protein by a measurable amount. It also means preventing. Inhibitors, for example, bind to proteins, genes and mRNA, partially or completely block stimulation, reduce activation, prevent, delay, inactivate, desensitize, or Compounds that down-regulate stability, expression, function and activity, eg, antagonists.

  “Instructional material” as used herein includes publications, records, diagrams or any other medium of expression used to convey the usefulness of the compositions and methods of the present invention. The instructional material of the kit of the present invention can be attached to a container containing the nucleic acid, peptide and / or composition of the present invention or shipped together with a container containing the nucleic acid, peptide and / or composition of the present invention. it can. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.

  “Isolated” means altered or removed from the natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not “isolated”, but the same nucleic acid or peptide that is partially or completely separated from coexisting materials in its natural state is “Isolated”. An isolated nucleic acid or protein can exist in substantially pure form or can exist in a non-natural environment such as, for example, a host cell.

For each group of subjects analyzed for anti-HER2 CD4 ⁺ Th1 immune response, the following “ assessment indicators ” of CD4 ⁺ Th1 response (or Th1 response) are defined: (a) overall anti-HER2 responsiveness ( one the proportion of subjects responding to more reactive peptide (%) represented as a); (b) expressed as the response repertoire (average number of reactive peptides are recognized by each subject group); and, (c ) Cumulative response ( expressed as the sum of reactive spots from 6 MHC class II binding peptides from each subject group (spot-forming cells “SFC” per 10 ⁶ cells from IFN-γ ELISPOT analysis )) .

By the term "modulating" as used herein, although the treatment or level of response in a subject in the absence of the compound and / or others are the same as compared to the level of response in untreated subject, It is meant to mediate a detectable increase or decrease in the level of response in the subject. The term encompasses perturbing and / or affecting a natural signal or response, thereby mediating a beneficial therapeutic response in a subject, preferably a human.

As used herein, “neoadjuvant therapy” for breast cancer refers to treatment given prior to primary therapy (ie, surgery). "Adjuvant therapy" for increasing the probability of long-term survival, the treatment of post-primary therapy.

  As used herein, a “population” includes a reference to an isolated culture, including a culture of uniform, substantially homogeneous, or heterogeneous cells. In general, a “population” can also be regarded as a culture of “isolated” cells.

  As used herein, a “recombinant cell” is a host cell that contains a recombinant polynucleotide.

  “Responsiveness” or “anti-HER2 responsiveness” is used interchangeably herein and means the percentage of subjects that respond to at least one of the six binding peptides.

  The “response repertoire” is defined as the average number of reactive peptides (“n”) recognized by each subject group.

  As used herein, a “sample” or “biological sample” refers to biological material from a subject, including but not limited to organs, tissues, exosomes, blood, plasma, saliva, urine and other body fluids. means. A sample can be any source of material obtained from a subject.

“Aging” refers to a cell that can no longer divide, but is still alive and metabolically active. Senescent cell characteristics include essentially irreversible growth arrest and expression of SA-β-gal, P15IN K4B and p16INK4a.

  “Signal 1” as used herein generally refers to the first biochemical signal transmitted from activated DCs to T cells. Signal 1 is provided by an antigen expressed on the surface of the DC and is sensed by the T cell through the T cell receptor.

  As used herein, “signal 2” refers to a second signal provided from DC to T cells. Signal 2 is provided by “costimulatory” molecules in activated DCs, which are usually CD80 and / or CD86 (although other costimulatory molecules are known), and by T cells through the surface receptor CD28. Perceived.

  “Signal 3” as used herein generally refers to a signal generated from a soluble protein (usually a cytokine) provided by activated DC. These are sensed through receptors on T lymphocytes. The third signal instructs the T cell which trait or functional characteristics should be acquired to best deal with the current threat.

  As used herein, the term “specifically binds” recognizes and binds to another molecule or feature, such as an antibody, but does not substantially recognize another molecule or feature in the sample. A molecule that does not bind to it.

  The terms “subject”, “patient”, “individual” and the like are used interchangeably herein and refer to any animal or cell thereof, either in vitro or in situ, that is amenable to the invention described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.

“T / C” is defined as trastuzumab and chemotherapy. Which refers to a patient that Ru undergoing both trastuzumab and chemotherapy after breast cancer surgery before /.

  The term “T cell” as used herein is defined as a thymus-derived cell that participates in various cellular immune responses.

The terms “T helper cell”, “helper T cell”, “Th cell” and the like as used herein with respect to cells refer to lymphocytes ( a type of white blood cell ) comprising various cell types that can be identified by those skilled in the art. Indicates the subgroup. In particular, T helper cells are effector T cells (such as Th1, Th2 and Th17) whose primary function is to promote the activation and function of other B lymphocytes and T lymphocytes and / or macrophages. Helper T cells differentiate into two major subtypes of cells known as “Th1” or “type 1” and “Th2” or “type 2” phenotypes. These Th cells secrete cytokines, proteins or peptides that stimulate or interact with other leukocytes. As used herein, “Th1 cell”, “CD4 ⁺ Th1 cell”, “CD4 ⁺ T helper type 1 cell”, “CD4 ⁺ T cell” and the like refer to a mature T cell that expresses the surface glycoprotein CD4. CD4 ⁺ T helper cells are activated when peptide antigens are presented by MHC class II molecules expressed on the surface of antigen presenting peptides (“APC”) such as dendritic cells. CD4 ⁺ T helper cells secrete cytokines such as interferon γ (“IFN-γ”) at high levels when activated by the MHC antigen complex. Such cells are very effective against microorganisms that cause a given disease present inside the host cell, and are considered to be very important in the antitumor response of human cancer.

  As used herein, a “Th1 T cell” is a T cell that produces high levels of the cytokine IFN-γ and is considered to be highly effective against host cells and certain pathogenic microorganisms that live inside cancer. Point to.

  As used herein, “Th17T cells” produce high levels of cytokines IL-17 and IL-22 and are considered to be highly effective against certain pathogenic microorganisms that live on the mucosal surface. Point to.

A “therapeutically effective amount” is an amount of a compound of the invention that, when administered to a patient, ameliorates a symptom of the disease. The amount of a compound of the invention which constitutes a "therapeutically effective amount" will vary depending on the compound, the condition and its severity of the disease, it will vary depending of age of the patient to be treated. Therapeutically effective amount, in view of the knowledge and the disclosure of those skilled in the art itself, can be determined routinely by one of ordinary skill in the art.

The terms “ treat ”, “ treating ” and “ treatment ” refer to a therapeutic or prophylactic measure as described herein. A method of “ treatment ” is to prevent, heal, delay, reduce severity, or ameliorate one or more symptoms of a disease or relapsed disease, or in the absence of such treatment . To a subject in need of such treatment , such as a subject suffering from a disease or disorder, or ultimately potentially having such a disease or disorder to prolong the survival of the subject beyond prediction Of administration of the composition of the present invention.

  The term “Toll-like receptor” or “TLR” as used herein is defined as a class of proteins that play a role in the innate immune system. TLRs are single transmembrane non-catalytic receptors that recognize structurally conserved molecules from microorganisms. TLRs activate immune cell responses when bound to ligands.

  The term “Toll-like receptor agonist” or “TLR agonist” as used herein is defined as a ligand that binds to the TLR to activate an immune cell response.

  The term “vaccine” as used herein is defined as the material used to elicit an immune response after its administration to an animal, preferably a mammal, more preferably a human. Upon introduction into a subject, a vaccine can elicit an immune response including, but not limited to, antibodies, cytokine production and / or other cellular responses.

  Scope: Throughout this disclosure, various aspects of this invention can be expressed in a range format. The description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, descriptions of ranges such as 1 to 6 include subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and so on. It should be considered as specifically disclosing individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3 and 6. This is true regardless of the width of the range.

DESCRIPTION The present invention involves the preparation of DCs. In one embodiment, the purity of the DC preparation is greater than 90 % . In another embodiment, the DC preparation is fully activated. For example, DCs are activated by cytokines and / or Toll-like receptor ligands, and this state is fully maintained by the cryopreservation technique of the present invention. The benefits of the DC preparations of the present invention are that thawing as needed at a remote treatment location from a single leukapheresis (patient collection) without requiring any specialized cell processing facility or further quality control testing. Can be efficiently cryopreserved in the initial vaccine + multiple (eg, 10 or more) “booster” doses.

As contemplated herein, the present invention is to produce a stronger signal than for T cells, to produce a DC having also After be superior functionality as a result vaccines based on more powerful DC, frozen Provide a way to save. By effectively cryopreserving such cells, the sample can be stored and thawed for later use, thereby reducing the need for repeated component removal and elutriation processes during vaccine production. be able to. It is beneficial to be able to freeze the DCs and then later to thaw them . One round of vaccine production is divided into small portions, frozen, and then given to patients one at a time to give a “booster” inoculation that enhances immunity over weeks, months or years It means that it can be administered.

In one embodiment, the invention includes an FDA-approved injectable multi-dose antigen pulsed dendritic cell vaccine produced by collecting DCs by leukapheresis of a single patient. The FDA approved multi-dose antigen-pulsed dendritic cell vaccine for injection includes an initial immunization dose and multiple “booster” doses. FDA-approved multi-dose antigen pulse dendritic cell vaccine for injection is cryopreserved and separated for series administration to patients without special requirements at the site of administration (eg, QC / QA steps according to FDA orders) Can be sent to a medical center.

The present invention relates to antigen presentation and production of various cytokines and chemokines such that cryopreserved and subsequently thawed activated DCs are clinically effective as freshly harvested and activated DCs. their efficacy and functionality in a manner that retained after thawing also relates to the cryopreserved these activated DC.

The invention also relates to inducing tumor senescence and apoptosis in cells by blocking one or more of HER-2 and HER-3 and activating anti-HER-2 CD4 Th1 cells. Thus, the present invention includes combinations and methods for promoting an anti- carcinogenic driver Th1 immune response by oncogenic driver blockade for HER-2 to promote tumor aging in HER-2-expressing breast cancer. In one embodiment, promoting anti- carcinogenic driver Th1 immune response comprises TNF-α and IFN-γ. In one embodiment, oncogenic driver blockade for HER-2 includes any composition that blocks HER-2, including but not limited to trastuzumab and pertuzumab.

In one embodiment, H for inducing senescence of ER-2 expressing breast cancer, the order combining the addition of one or more blocking and TNF-alpha and IFN-gamma of HER-2 and HER-3 Compositions and methods are provided . In one embodiment, TNF-α and IFN-γ are secreted from CD4 Th1 cells.

  In one embodiment, HER2 is required in the TNF-α and IFN-γ mechanisms that induce breast cancer cell senescence and apoptosis.

  In one embodiment, TNF-α and IFN-γ restore sensitivity to trastuzumab and pertuzumab to breast cancer resistant cells. In one embodiment, the Th1 cytokines IFN-γ and IFN-α reverse resistance to therapeutic agents that broadly affect cancer patients.

DC-based immunotherapy DCs are derived from pluripotent monocytes that serve as antigen presenting cells (APCs). DCs are universal in peripheral tissues where they are ready to capture antigen. Upon capture of the antigen, the DC processes the antigen into small peptides and moves towards secondary lymphoid organs. Within the lymphoid organ, DCs present antigenic peptides to naive T cells, thereby initiating a cascade of signals that polarize T cell differentiation. Upon exposure, DCs present antigen molecules bound to either MHC class I or class II binding peptides and activate CD8 ⁺ or CD4 ⁺ T cells, respectively (Steinman, 1991, Annu. Rev. Immunol. 9: 271-296; Bancherau et al., 1998, Nature 392, 245-252; Steinman et al., 2007, Nature 449: 419-426; Ginhoux et al., 2007, J. Exp. 3133-3146; Banerjec et al., 2006, Blood 108: 2655-2661; Sallusto et al., 1999, J. Exp. Med. 189: 611-614; Reid et al., 2000, Curr. Opin. unol.12: 114~121 pages; Bykovskaia et al., 1999, J.Leukoc.Biol 66:.. 659~666 pages; Clark et al., 2000, Microbes Infect 2: 257~272 pages).

  DCs are involved in the induction, coordination and regulation of the adaptive immune response and also serve to integrate communication between the natural and adaptive arm effectors of the immune system. These features made DC a strong candidate for immunotherapy. DC has the unique ability to sample the environment by macropinocytosis and receptor-dependent endocytosis (Geroer et al., 2008, J. Immunol. 181: 155-164; Stoitzner et al., 2008, Cancer. Immunol.Immunother 57: 1665-1673; Lanzevecchia A., 1996, Curr.Opin.Immunol.8: 348-354; Delamarre et al.

  DC also requires a maturation signal to enhance its antigen presentation ability. DCs up-regulate the expression of surface molecules such as CD80 and CD86 (also known as second signal molecules) by providing additional maturation signals such as TNF-α, CD40L or calcium signaling agents ( Czernieki et al., 1997, J. Immunol. 159: 3823-3837; Bedrosian et al., 2000, J. Immunother. 23: 311-320; Maryliard et al., 2004, Cancer Res. Brossart et al., 1998, Blood 92: 4238-4247; Jin et al., 2004, Hum. Immunol. 65: 93-103). It has been established that a mixture of cytokines including TNF-α, IL-1β, IL-6 and prostaglandin E2 (PGE2) has the ability to mature DC (Jonuleit et al., 2000, Arch. Derm. Res. 292: 325-332). DCs can also be matured by calcium ionophores before being pulsed with antigen.

  In addition to pathogen recognition receptors such as PKR and MDA-5 (Kalali et al., 2008, J. Immunol. 181: 2694-2704; Nallagatla et al., 2008, RNA Biol. 5 (3): 140-144) Thus, DC also contains a series of receptors known as Toll-like receptors (TLRs) that can also sense risks from pathogens. When these TLRs are induced, a series of activity changes are induced in DC, which leads to T cell maturation and signal transduction (Boulart et al., 2008, Cancer Immunol. Immunother. 57 (11): 1589-1597. Kaisho et al., 2003, Curr.Mol.Med.3 (4): 373-385; Pulendran et al., 2001, Science 293 (5528): 253-256; Napoitiani et al., 2005, Nat. 6 (8): 769-776). DCs can activate and expand diverse arms of cell-mediated responses such as natural killer γ-δT cells and α-βT cells, and once activated, DCs retain their immunizing capacity. (Steinman, 1991, Annu. Rev. Immunol. 9: 271-296; Bancherau et al., 1998, Nature 392: 245-252; Reid et al., 2000, Curr. Opin. Immunol. 12: 114-121. (Bykovskskaia et al., 1999, J. Leukoc. Biol. 66: 659-666; Clark et al., 2000, Microbes Infect. 2: 257-272).

The present invention includes mature, antigen-uptake DCs activated by Toll-like receptor agonists that are capable of eliciting a clinically effective immune response , preferably when used early in the disease process. The DCs of the present invention have the ability to produce desirable levels of cytokines and chemokines and to induce apoptosis of tumor cells.

In one embodiment, a method for large-scale production of antigen-pulsed dendritic cell vaccine is provided. In one embodiment, the method comprises rapidly maturating dendritic cells, cryopreserving the dendritic cells, and thawing the cryopreserved cells, wherein the thawed dendritic cells The cells produce an amount of at least one cytokine effective to generate a T cell response.

  In one embodiment, maturation of dendritic cells comprises contacting the cells with IFN-γ and LPS.

  In one embodiment, the thawed cells maintain a DC1 phenotype and drive a Th1 polarized immune response.

  In one embodiment, the thawed cells maintain the ability to primarily sensitize T cells.

Generation of Antigen Uptake (Antigen Pulse ) Immune Cells The present invention includes cells that have been exposed to or “pulsed” with an antigen. For example, an APC, such as DC, can take up an antibody in vitro, for example, by ex vivo culture in the presence of the antigen, or in vivo by exposure to the antigen.

  One skilled in the art will also readily appreciate that APC can be “pulsed” in a manner that exposes the APC to the antigen for a time sufficient to facilitate presentation of the antigen on the surface of the APC. For example, APC can be exposed to an antigen in the form of a small peptide fragment known as an antigenic peptide and directly “pulsed” outside of the APC (Melita-Damani et al., 1994), or APC is It can be incubated with whole protein or protein particles, which are then digested by APC. All these proteins are digested into small peptide fragments by APC and finally transported to the APC surface for presentation (Cohen et al., 1994). Antigens in the form of peptides can be exposed to cells by the standard “pulse” technique described herein.

While not wishing to be bound by any particular theory, foreign or autoantigen forms of the antigen are processed by the APC of the present invention to retain the immunogenic form of the antigen. An immunogenic form of an antigen refers to the processing of the antigen by fragmentation to produce a form of the antigen that can be recognized and stimulated by immune cells, eg, T cells. Preferably, such foreign antigens or autoantigens are proteins that are processed into peptides by APC. Related peptides produced by APC can be extracted and purified for use as immunogenic compositions. Peptides processed by APC can also be used to induce tolerance to proteins processed by APC.

Antigen- incorporated APC, also known as “pulse APC” of the present invention, is generated by exposing APC to an antigen in vitro or in vivo. If the APC is pulsed in vitro, APC were seeded in culture dishes, sufficient time in an amount sufficient to antigen binds to the APC, it can be exposed to the antigen. The amount and time required to achieve binding of the antigen to APC can be determined by using methods known in the art or disclosed herein. Other methods known to those skilled in the art, such as immunoassays or binding assays, can be used to detect the presence of an antigen on APC after exposure to the antigen.

In a further embodiment of the invention, APC can be transfected with a vector that allows expression of a particular protein by APC. Protein expressed by the APC is then processed, it can be presented on the cell surface. The transfected APC can then be used as an immunogenic composition to generate an immune response against the protein encoded by the vector.

  As discussed elsewhere herein, vectors are prepared to contain specific polynucleotides that encode and express proteins for which an immunogenic response is desired. Preferably, retroviral vectors are used to infect cells. More preferably, an adenoviral vector is used to infect cells.

  In another embodiment, the vector modifies the viral vector to encode a protein or portion thereof that is recognized by a receptor on APC, whereby occupation of the APC receptor by the vector reduces vector endocytosis. APC can be targeted by initiating and allowing processing and presentation of the antigen encoded by the nucleic acid of the viral vector. The nucleic acid delivered by the virus may be natural for the virus, which when expressed on APC is then processed and presented on the AHC MHC receptor.

  As contemplated herein, a variety of methods can be used to transfect a polynucleotide into a host cell. The methods include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, colloidal dispersion (ie macromolecular complexes, nanocapsules, microspheres, beads and oil-in-water emulsions, micelles, mixed micelles) And lipid based systems, including but not limited to liposomes). These methods are understood in the art and are described in the published literature so that those skilled in the art can perform these methods.

In another embodiment, in order to produce APCs that have incorporated antigen in another manner, a polynucleotide encoding the antigen can be cloned into an expression vector and the vector introduced into the APC. Various types of vectors and methods for introducing nucleic acids into cells are discussed in the available published literature. For example, an expression vector can be transfected into a host cell by physical, chemical or biological means. For example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Mol. It will be readily appreciated that the introduction of an expression vector comprising a polynucleotide encoding an antigen results in a pulsed cell.

The present invention includes a variety of methods for pulsing APC including, but not limited to, incorporating a whole antigen in the form of protein, cDNA or mRNA into APC. However, it should not be understood that the present invention is limited to the particular form of antigen used to pulse APC. Rather, the present invention encompasses other methods known in the art for generating antigen- incorporated APCs. Preferably, APCs are transfected with mRNA encoding a defined antigen. MRNA corresponding to a gene product whose sequence is known can be readily generated in vitro using reverse transcriptase-polymerase (RT-PCR) combined with appropriate primers and transcription reaction. Transfection of APC with mRNA is advantageous over other antigen uptake techniques to generate pulsed APC. For example, the ability to amplify RNA from microscopic amounts of tissue, ie tumor tissue, opens up the use of APC for vaccination of a large number of patients.

  In order for an antigen composition to be useful as a vaccine, the antigen composition must induce an immune response to the antigen in a cell, tissue or mammal (eg, a human). As used herein, an “immunological composition” expresses or presents an antigen (eg, a peptide or polypeptide), a nucleic acid encoding the antigen (eg, an antigen expression vector), or an antigen or cellular component. Cells may be included. In a specific embodiment, the antigen composition comprises or encodes all or a portion of any antigen described herein, or an immunofunctional equivalent thereof. In other embodiments, the antigen composition is in a mixture comprising additional immunostimulatory agents or nucleic acids encoding such agents. Immunostimulatory agents include, but are not limited to, additional antigens, immunomodulators, antigen presenting cells or adjuvants. In other embodiments, one or more additional agent (s) are covalently bound to the antigen or immunostimulatory agent in any combination. In certain embodiments, the antigen composition is conjugated to or comprises an anchor motif amino acid of HLA.

A vaccine contemplated herein may vary in its nucleic acid composition and / or cellular components. In a non-limiting example, nucleic acid encoding the antigen may also be formulated with an adjuvant. Of course, it is understood that the various compositions described herein may further include additional components. For example, one or more vaccine components can be included in a lipid or liposome. In another non-limiting example, the vaccine can include one or more adjuvants. The vaccine of the present invention and its various components can be prepared and / or administered by any method disclosed herein or known to those of skill in the art in light of this disclosure.

The antigen composition of the present invention is chemically synthesized by solid phase synthesis and purified by HPLC from other products of chemical reaction, or a nucleic acid sequence (eg, DNA sequence) encoding a peptide or polypeptide containing the antigen of the present invention It is understood that can be made by methods well known in the art, including, but not limited to, in vitro translation systems or production by expression in living cells. In addition, the antigen composition can include cellular components isolated from a biological sample. The antigen composition is isolated, dialyzed on a large scale to remove one or more undesirable low molecular weight molecules and / or lyophilized for easier incorporation into the desired vehicle. . Additional amino acids at vaccine component, if the mutation, and chemical modification is present, be said that it is preferred that they do not substantially interfere with the antigen recognition of an epitope sequence is further understood.

Peptides or polypeptides corresponding to one or more antigenic determinants of the invention generally must be at least 5 amino acid residues or 6 amino acid residues in length, with a maximum of about 10, about 15, It may comprise about 20, about 25, about 30, about 35, about 40, about 45 or about 50 residues. Peptide sequences are described, for example, in Applied Biosystems , Inc. , Foster City, CA (Foster City, CA) and can be synthesized by methods known to those skilled in the art such as peptide synthesis using an automated peptide synthesizer.

  Longer peptides or polypeptides can also be prepared, for example, by recombinant means. In certain embodiments, for example, encoding the antigen compositions and / or components described herein to generate antigen compositions for the various compositions and methods of the invention in vitro or in vivo. Nucleic acids can be used. For example, in certain embodiments, the nucleic acid encoding the antigen is contained, for example, in a vector in a recombinant cell. The nucleic acid can be expressed to produce a peptide or polypeptide that includes an antigenic sequence. The peptide or polypeptide can be secreted from the cell or contained as part of or within the cell.

  In certain embodiments, an immune response can be enhanced by transforming or inoculating a mammal with a nucleic acid encoding an antigen. One or more cells contained within the target mammal then express the sequence encoded by the nucleic acid after administration of the nucleic acid to the mammal. A vaccine can also be in the form of a nucleic acid (eg, cDNA or RNA) encoding, for example, all or part of the peptide or polypeptide sequence of the antigen. In vivo expression by nucleic acids can be, for example, by a plasmid type vector, a viral vector or a virus / plasmid construct vector.

  In another embodiment, the nucleic acid comprises a coding region that encodes all or part of a sequence encoding a suitable antigen or immunological functional equivalent thereof. Of course, the nucleic acid may include and / or encode additional sequences, including but not limited to those including one or more immunomodulatory agents or adjuvants.

As considered in an antigen herein, the present invention may include the use of any suitable antigen for Ru incorporated in APC to elicit an immune response. In one embodiment, tumor antigens can be used. Tumor antigens common tumor antigens, and can be classified two broad categories of unique tumor antigens. While common antigens are expressed by many tumors, unique tumor antigens can be attributed to mutations induced by physical or chemical carcinogens and are therefore expressed only by individual tumors. In certain embodiments, common tumor antigens are incorporated into the DCs of the present invention. In other embodiments, unique tumor antigens are incorporated into the DCs of the invention.

In the context of the present invention, “tumor antigen” refers to an antigen common to a particular hyperproliferative disorder. In some embodiments, the hyperproliferative disorder antigen of the invention comprises primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia, uterine cancer, cervical cancer, Derived from cancers including but not limited to bladder cancer, kidney cancer and breast cancer, prostate cancer, ovarian cancer, pancreatic cancer and the like.

  Malignant tumors express a number of proteins that can serve as target antigens for immune attack. These molecules include, but are not limited to, tissue specific antigens such as MART-1, tyrosinase and GP100 in melanoma and prostate acid phosphatase (PAP) and prostate specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 / Neu / ErbB-2. Yet another group of target antigens are oncofetal antigens such as carcinoembryonic antigen (CEA). In B-cell lymphomas, tumor-specific idiotype immunoglobulins constitute truly tumor-specific immunoglobulin antigens that are unique to individual tumors. B cell differentiation antigens such as CD19, CD20 and CD37 are other candidates for target antigens in B cell lymphomas. Some of these antigens (CEA, HER-2, CD19.CD20, idiotype) have been used as targets for passive immunotherapy with monoclonal antibodies without great success.

  Tumor antigens and their antigenic cancer epitopes can be purified and isolated from natural sources such as primary clinical isolates, cell lines. Cancer peptides and their antigenic epitopes can also be obtained by chemical synthesis or by recombinant DNA techniques known in the art. Techniques for chemical synthesis are described in Steward et al. (1969); Bodansky et al. (1976); Meienhofer (1983); and Schroder et al. (1965). Furthermore, as described in Renkvist et al. (2001), many antigens are known in the art. Although analog or artificially modified epitopes are not specifically described, those skilled in the art will recognize how to obtain or generate them by standard means in the art. Other antigens identified by antibodies and detected by the Serex method (see Sahin et al. (1997) and Chen et al. (2000)) are confirmed in the Ludwig Institute for Cancer Research database.

  In yet another embodiment, the present invention may include a microbial antigen for presentation by APC. The microbial antigens considered herein can be of viral, bacterial or fungal origin. Examples of infectious viruses include: Retroviridae (eg, human immunodeficiency viruses such as HIV-1 or HIV-III (also referred to as HTLV-III, LAV or HTLV-III / LAV); and other such as HIV-IP Isolated strain); Picoraviridae (eg, poliovirus, hepatitis A virus; enterovirus, human coxsackie virus, rhinovirus, echovirus); Calciviridae (eg, strain causing gastroenteritis); Togaviridae (eg, equine encephalitis virus, rubella) Flavividae (eg, dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (eg, coronavirus); Rhabdoviridae For example, vesicular stomatitis virus, rabivirus); Filoviridae (eg, Ebola virus); Paramyxoviridae (eg, parainfluenza virus, mumps virus, measles virus, respiratory polynuclear virus); Orthomyxobiridae (eg, influenza virus); Bungavirid For example, Hunter virus, bunyavirus, flavovirus and nairovirus); Arena viridae (hemorrhagic fever virus); Reoviridae (eg reovirus, orbivirus and rotavirus); Birnaviridae; Hepadnaviridae (hepatitis B virus); Parvovirvovirus ; Papovaviridae ( Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) types 1 and 2, varicellazoster virus, cytomegalovirus (CMV), herpesvirus); Poxviridae Auravirus, vaccinia virus, poxvirus); and Iridoviridae (eg, African swine fever virus); and unclassified virus (eg, causative agent of spongiform encephalopathy, considered a defective satellite of hepatitis B virus) Pathogen, non-A, non-B hepatitis (class 1 = internally infected; class 2 = parenterally infected (ie, hepatitis C)); Norwalk and related viruses, and ast Virus), and the like.

  Examples of infectious bacteria: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (..... For example, M tuberculosis, M avium, M intracellulare, M kansasii, M gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus)), Streptococcus agalactiae (Group B Str. ptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp. Enterococcus sp. Haemophilus influenzae, Bacillus anthracis, corynebacterium diphtheriae, corynebacterium sp. , Erysiperothrix rhusiopathiae, Clostridium perfiringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multoclet. , Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema Treponema pertenue, Leptospira and Actinomyces israeliii.

  Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitis, Chlamydia trachomatis, Candida albicans. Other infectious organisms (ie, protists), including Plasmodium falciparum and Toxoplasma gondii.

DC activation
Conventional DC-based vaccines (which have previously prevailed in clinical trials) use cytokine cocktail mixtures containing a combination of TNF, IL-6, PGE2 and IL-1β that ultimately stimulate aseptic inflammation In order to mature DCs and stimulate signal generation, the present invention instead utilizes TLR agonists.

According to one aspect of the present invention, stimulation of DC with a combination of TLR ligands leads to an increase in IL-12 production. Furthermore, DC activation by a combination of TLR agonists results in a more pronounced CD4 and CD8 T cell response (Warger et al., 2006, Blood, 108: 544-550). Thus, DCs of the invention can secrete Th1-driven cytokines such as IL-12 upon exposure to these ligands that induce TLRs. For example, the addition of poly (I: C), a TLR3 agonist to IL-1β, TNF-α and IFN-γ, produces a strong type 1 polarized DC characterized by stable levels of IL-12 production (Heifler et al., 1996, Eur. J. Immunol. 26: 659-668) In certain embodiments, the antigen is incorporated into the DC prior to exposure to the TLR agonist. In other embodiments, the antigen can be incorporated into the DC following exposure to the TLR agonist.

According to one aspect of the present invention, by collecting DCs from leukapheresis of a single patient, a multi-dose antigen-pulsed dendritic cell vaccine for injection is produced, which DCs biomolecules that stimulate bacterial infection (eg, LPS ) is activated by the. This unique activation method confers qualities to DCs that are not found in DCs matured by cytokine cocktails of TNF, IL-6, PGE2 and IL-1β (“conventional maturation”), which is aseptic. It also stimulates sexual inflammation (Lombardi et al., 2009, J. Immunol., 182: 3372-3379).

In one embodiment, the DCs of the invention can be activated by a combination of a TLR4 agonist, a bacterial lipopolysaccharide (LPS), a TLR7 / 8 agonist, resimiquad (R848) and / or IFN-γ. (Amati et al, 2006, Curr. Pharm. Des 12: 4247-4254). Activation of DCs with a TLR4 agonist and bacterial LPS generates DCs that are at least substantially (phenotypically) identical to DC1 generated via conventional maturation methods. These DCs highly express surface molecules including CD83, CD80, CD86 and HLA-DR. In other embodiments, a TLR2 agonist such as lipoteichoic acid (LTA), a TLR3 agonist such as poly (I: C) and / or a TLR4 agonist such as MPL may be used. As contemplated herein, any TLR agonist or combination of TLR agonists can activate DCs, provided that such ligands stimulate the generation of cytokines and chemokine signals by activated DCs. Can be used. Many other TLR agonists are known in the art for use according to the present invention and can be found in the published literature.

  Even though there are phenotypic similarities between DCs and DCs matured in a conventional manner, the DCs of the present invention exhibit many significant advantages.

Cryopreservation After initiation and activation of the cells, the cells are harvested and the vaccine is cryopreserved. For example, peripheral blood monocytes are obtained by leukocyte removal. The cells are cultured for a period of time in serum free medium containing GM-CSF and IL-4, followed by a pulse of cells with the desired antigen. After pulsing the cells with the desired antigen, the antigen-pulsed dendritic cells are incubated with IFN-γ followed by a TLR agonist (eg, LPS). Activated antigen-pulsed dendritic cells are collected, cryopreserved in cryopreservation medium, and stored in liquid nitrogen. In one embodiment, the cryopreservation medium comprises 55% plasma light, 40% human serum albumin and 5% DMSO.

The cryopreservation aspect of the present invention allows the generation of FDA approved multi-dose antigen pulsed dendritic cell vaccines for injection. An advantage of the present invention is that multi-dose antigen-pulsed dendritic cells retain their ability to generate a signal critical to T cell function after thawing. As contemplated herein, the present invention includes a variety of cryopreservation techniques and cryopreservation media that will be understood by those skilled in the art. For example, in certain embodiments, the cryopreservation medium comprises 55% plasma light, 40% human serum albumin and 5% DMSO. Accordingly, the present invention includes a first immunization dose and multiple "booster" dose, the ability to produce multiple doses of antigen pulsed dendritic cell vaccine in a centralized area of the present invention to provide. Thus, multi-dose antigen pulsed dendritic cell vaccines can be shipped to remote medical centers for continuous administration to patients at the point of administration without requiring special FDA quality control / quality assurance requirements. it can.

In one embodiment, the dendritic cell vaccine of the invention is cryopreserved in aliquots for multiple administrations. For example, the cells are stored frozen at a concentration of 30 × 10 ⁶ cells / mL. For example, a cryopreservation medium bag having a volume equal to the cell volume is prepared. While working quickly, a cryopreservation medium is added to the cell bag and the cells are transferred to a labeled cryovial. In one embodiment, the vial is frozen using a rate controlled freezer. For example, frozen vials are frozen at 1 ° C./min using an automatic speed control freezer and stored in gas phase nitrogen.

  In one embodiment, the vial is frozen using a rate controlled freezer. The vial is placed in a cryochamber and liquid nitrogen enters the chamber through an electronic solenoid valve. Since evaporation is almost instantaneous, controlling the rate at which liquid nitrogen enters the chamber directly controls the rate at which heat is absorbed and removed from the cryochamber and its contents.

As contemplated herein, the present invention includes a variety of cryopreservation techniques and cryopreservation media that will be understood by those skilled in the art. For example, in certain embodiments, a cryopreservation medium for cultured cells can include about 55% plasma light, about 40% human serum albumin, and about 5% DMSO. In other embodiments, the cryopreservation medium can be serum free. In certain embodiments, rate-controlled freezing can be used, while other embodiments are cryopreservation media placed in a freezer at a temperature ranging, for example, from about -70 ° C to -80 ° C. The use of a shielded container containing a vial of cells mixed with. The present invention further facilitate the clinical application of such cells, to provide a method of storing activated DC in a manner that reduces the need to repeat large component removal and elutriation step. As contemplated herein, cryopreservation techniques can be used for both small and large batches.

When considering the widespread use of activated DCs, the ability to provide a stable supply of cryopreserved activated DC represents a significant benefit that can facilitate a variety of therapeutic uses for such cells. For example, a large-scale culture of activated DC can be used in accordance with the method of the present invention for an initial immunization dose and multiple “boosters” so that individual doses of cells can later be used in any particular immunotherapy protocol. It can be cryopreserved in aliquots of appropriate size containing a dose. In certain embodiments, the activated DC can be stored frozen at a temperature of about −70 ° C. or lower for 2 to 24 weeks. At lower temperatures, such as about −120 ° C. or less, activated DC can be stored frozen for at least one year or more.

  In one exemplary embodiment, DC are suspended in human serum and about 5% DMSO (v / v). Alternatively, other serum types such as fetal calf serum can be used. Suspended cells can be aliquoted into smaller samples such as 1.8 ml vials and stored at about −70 ° C. or lower. In other embodiments, the cryopreservation medium can include about 20% serum and about 10% DMSO, and the suspended cells can be stored at about -180 ° C. Still further embodiments can include a medium containing about 55% plasma light and about 5% DMSO. Other exemplary cryopreservation media can include about 12% DMSO and about 25-40% serum.

Although the invention described herein can include specific concentrations of serum, those skilled in the art may vary the exact amount of serum in the cryopreservation medium, and in some embodiments, may be totally different. Although not necessarily present, it should generally be understood to be in the range of about 1% to 30%. Of course, any serum concentration that results in about 50% cell viability and / or about 50% cell recovery rate can be used in any DC composition of the invention, as well as any of those described herein Can be used together with the cryopreservation method. When recovering cryopreserved cells in a selected cryopreservation medium, a cell viability and cell recovery rate of preferably at least about 60%, more preferably at least about 70%, or even at least 80% is desired.

  Similarly, although the invention described herein may include a specific concentration of DMSO, those skilled in the art may not have DMSO at all in some embodiments, but in other embodiments, It should be appreciated that concentrations as high as about 5% to about 20% may be used in cryopreservation media and included in the cryopreservation methods described herein. In general, low concentrations of DMSO, such as between about 5% and about 10%, are preferred. However, after thawing, at least 50% cell viability and at least 50% cell recovery, preferably at least 60%, more preferably about 70%, more preferably about 80% and even more preferably about 90% or more cells. Any concentration of DMSO that results in viability and recovery can be used.

While the invention described herein may include reference to rate controlled freezing, it will be appreciated by those skilled in the art that freezing methods in a rate controlled or non-rate controlled manner can be routinely used. Should be understood.

  It should also be understood by those skilled in the art that the various cryopreservation media described herein may contain serum or may be serum free. Examples of serum free media include XVIVO 10, XVIVO 15, XVIVO 20, StemPro and any commercially available serum free media. When utilizing serum-free freezing media, the cryopreservation methods of the present invention generally involve infectious agents, antibodies and foreign proteins that may be antigenic, and typically in serum-based freezing media. Does not contain any other foreign molecules found in

The cryopreservation of the active DC incorporating the antigen can be performed at any time after the activation of the DC by the TLR agonist. In one embodiment, activated DC are stored frozen about 6-8 hours after exposure to the TLR agonist. Preferably, the time point chosen for cryopreserving activated cells should be based on maximization of cellular signal generation, particularly IL-12 production.

The present invention provides compositions and methods for producing large-scale dendritic cell vaccines. In one embodiment, large-scale production of dendritic cell vaccines will produce FDA approved injectable multi-dose antigen pulsed dendritic cell vaccines for personalized treatment and prevention of cancer or other disorders. Make it possible. In one embodiment, compositions and methods for the production of large antigen-pulsed type 1 polarized dendritic cell vaccine (DC1) is provided.

In one embodiment, the present invention provides that the antigen has been taken up and pre-activated, ie “syringe ready”, ie any facility requiring additional facility and quality control / assurance steps (eg, according to FDA instructions). Provided is a method for cryopreserving large dendritic cells suitable for immediate injection into a patient that does not require additional cell processing.

  In one embodiment, the present invention provides a method for efficiently producing an injectable multi-dose antigen pulse dendritic cell vaccine, preferably an injectable multi-dose antigen pulse type 1 polarized dendritic cell vaccine that exhibits maximum efficacy. I will provide a.

Packaging of Compositions or Kit Components Suitable containers for the compositions (or kit components) of the present invention include vials, syringes (eg, disposable syringes) and the like. These containers should be sterile.

  Where the composition / component is placed in a vial, the vial is preferably made of a glass or plastic material. The vial is preferably sterilized before the composition is added. In order to avoid problems with latex sensitive patients, the vial is preferably sealed with a latex-free stopper and preferably no latex is present in all packaging materials. A vial may contain a single dose of vaccine or may contain more than one dose (a “multi-dose” vial), eg, 10 doses. Preferred vials are made of colorless glass.

  The vial is fitted with a cap (eg, luer lock) so that a pre-filled syringe can be inserted into the cap and the syringe contents can be drained into the vial and the vial contents returned to the syringe. Can have. After removal of the syringe from the vial, a needle is then attached and the composition can be administered to the patient. The cap is preferably placed inside the seal or cover so that the seal or cover must be removed before the cap is available. The vial may have a cap that allows aseptic removal of its contents, particularly for multi-dose vials.

  When the composition / component is packed into a syringe, the syringe can have a needle attached to it. If the needle is not attached, another needle can be supplied to the syringe for assembly and use. Such a needle can be stored in the sheath. A safety needle is preferred. 1 inch 23 gauge, 1 inch 25 gauge and 5/8 inch 25 gauge needles are typical. The syringe can be provided with a peelable label that can be printed with lot number, season season and expiration date of contents to facilitate record keeping. The plunger in the syringe preferably has a stopper to prevent the plunger from being inadvertently removed during inhalation. The syringe may have a latex rubber cap and / or plunger. The disposable syringe contains a single dose of vaccine. The syringe generally has a tip cap for peeling off the tip before attaching the needle, and the tip cap is preferably made of butyl rubber. Where the syringe and needle are packaged separately, the needle is preferably provided with a butyl rubber sheath.

  The container can be marked to indicate a half dose volume, for example, to facilitate delivery to a child. For example, a syringe containing a 0.5 ml dose may have a mark indicating a volume of 0.25 ml.

  When glass containers (eg, syringes or vials) are used, it is preferable to use containers made of borosilicate glass rather than soda lime glass.

  The kit or composition can be packaged (eg, in the same box) with a leaflet containing details of the vaccine, eg, instructions for administration, details of antigens within the vaccine, and the like. The instructions may also include warnings such as, for example, keeping a ready-to-use solution of adrenaline in the case of an anaphylactic reaction following vaccination.

Methods for treating diseases The present invention also encompasses methods of treatment and / or prevention of pathogenic microorganisms, diseases caused by autoimmune disorders and / or hyperproliferative diseases.

Diseases that can be treated or prevented by use of the present invention include those caused by viruses, bacteria, yeast, parasites, protozoa, cancer cells, and the like. The pharmaceutical composition of the present invention can be used as a general-purpose immunostimulant (DC activation composition or system) and thus has use in the treatment of diseases. Representative diseases that can be treated and / or prevented using the pharmaceutical composition of the present invention include HIV, influenza, herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chickenpox Infectious diseases of viral origin such as papillomavirus; Infectious diseases of bacterial origin such as pneumonia, tuberculosis, syphilis; or infectious diseases of parasitic origin such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amebiasis However, it is not limited to that.

Pre-neoplastic or hyperproliferative conditions that can be treated or prevented using the pharmaceutical compositions of the present invention (transduced DCs, expression vectors, expression constructs, etc.) include colon polyps, Crohn's disease, ulcerative colitis, breast lesions, etc. Including, but not limited to.

Cancers that can be treated using the compositions of the present invention include primary or metastatic melanoma, adenocarcinoma, squamous cell carcinoma, adenosquamous cell carcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Including but not limited to Hodgkin lymphoma, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer, multiple myeloma, neuroblastoma, NPC, bladder cancer, cervical cancer and the like.

  Other hyperproliferative diseases that can be treated using the DC activation system of the present invention are rheumatoid arthritis, inflammatory bowel disease, osteoarthritis, leiomyoma, adenoma, lipoma, hemangioma, fibroma, vascular occlusion, revascularization Includes, but is not limited to, stenosis, atherosclerosis, pre-neoplastic lesions (such as adenomatous hyperplasia, prostate intraepithelial neoplasia), in situ carcinoma, oral hairy leukoplakia or psoriasis.

Autoimmune disorders that can be treated using the composition of the present invention include AIDS, Addison's disease, adult respiratory distress syndrome, allergy, anemia, asthma, atherosclerosis, tracheitis, cholecystitis, Crohn's disease, ulcerative colitis , Atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, erythema nodosum, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, multiple sclerosis, Myasthenia gravis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, polymyositis, rheumatoid arthritis, scleroderma, Sjogren's syndrome and autoimmune thyroiditis; cancer, hemodialysis and extracorporeal circulation Including but not limited to: viruses, bacteria, fungi, parasites, protozoa and parasite-like infections; and trauma.

In therapeutic methods, administration of the compositions of the invention can be for either “prevention” or “treatment” purposes. When given prophylactically, in certain embodiments, a vaccine is given after the onset of one or more symptoms to prevent further symptoms from occurring or to prevent current symptoms from worsening. Despite being given, the compositions of the invention are given prior to any symptoms. Prophylactic administration of the composition serves to prevent or ameliorate any subsequent infection or disease. When given therapeutically, the pharmaceutical composition is given at or after the onset of symptoms of infection or disease. Thus, the present invention may be given before any anticipated exposure to a pathogen or disease state or after the onset of an infection or disease.

An effective amount of the composition is that amount that achieves this selected result of an enhanced immune response, and such amount can be routinely determined by one of ordinary skill in the art. For example, an amount effective to treat a failure of the immune system against a cancer or pathogen is that amount necessary to cause activation of the immune system and result in the generation of an antigen-specific immune response upon exposure to the antigen. sell. The term is also a synonym for “sufficient amount”.

The effective amount for any particular application, the disease or condition being treated, the specific composition to be administered can vary depending on factors such as the size and / or disease or condition severity of the subject . One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.

Therapeutic applications The present invention includes the generation of activated APCs incorporating antigens that , when thawed from cryopreservation, produce significant levels of cytokines and chemokines, wherein the incorporated antigens and activated APCs are Used in the immunotherapy of mammals, preferably humans. The response to the antigen presented by the APC can be measured by monitoring the cytolytic T cell response, helper T cell response, and / or antigen response to the antigen using methods known in the art. .

The present invention relates to a method of enhancing an immune response in a mammal, comprising generating immature DC from monocytes obtained from a mammal (eg, a patient); immature DC is converted into an antigenic composition. Activating the antigen- incorporated DC with at least one TLR agonist; thawing the activated, antigen- incorporated DC and then activating, the antigen- incorporated Administering a DC to a mammal in need thereof. The composition comprises at least one antigen and may further be a vaccine for ex vivo immunization and / or in vivo treatment in a mammal. Preferably the mammal is a human.

  Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, the cells are isolated from a mammal (preferably a human). The cells are administered to the mammalian recipient to provide a therapeutic effect. The mammalian recipient can be a human and the cell can be autologous with respect to the recipient. Alternatively, the cells can be allogeneic, syngeneic or xenogeneic with respect to the recipient.

  In one embodiment, peripheral blood monocytes are obtained from the patient by a combination of leukocyte removal and elutriation. Monocytes can be cultured overnight in SFM containing GM-CSF and IL-4. The next day, immature DCs are pulsed with the antigen, which can then be contacted with IFN-γ and LPS. Activated DC are then suspended in cryopreservation medium and frozen until ready for use in immunotherapy.

  Cryopreserved DC can be cultured ex vivo under conditions effective to produce percent cell recovery and survival comparable to newly activated DCs. DCs generated from cryopreserved samples can show the same stability as freshly prepared DCs. Furthermore, comparison of cryopreserved mature DC with freshly prepared DC can show substantially identical phenotype as well as signal generation profile. As considered herein, DCs are about 2 in both the small and large scales at various temperatures of about −70 ° C. to −80 ° C. in the various cryopreservation media described herein. Can be stored for ~ 24 weeks. At temperatures below about −120 ° C., the storage time can be extended indefinitely or beyond at least 24 weeks without affecting DC cell recovery, viability and functionality. For example, in certain embodiments, activated cells can be stored for at least one year and still retain their ability to generate a signal after thawing. As described throughout this specification, the present invention provides an effective recovery and survival profile upon cell thawing, and further, the cryopreservation conditions described herein allow DCs to retain their signal profile. Does not affect the ability to do.

  In an exemplary embodiment, cryopreservation resuspends cells in cryopreservation medium containing about 55% plasma light, about 40% human serum albumin and about 5% DMSO after DC activation. Can be implemented. The mixture is then aliquoted into 1.8 ml vials and frozen at about −80 ° C. overnight in a freezing chamber. The next day, the vial can then be transferred to a liquid nitrogen tank. After about 2-24 weeks of cryopreservation, frozen DCs can be thawed and examined for their recovery and viability. The recovery rate of such DC can be about 70% or more and the survival rate can be about 70% or more. In other embodiments, even DCs or monocytes can be cryopreserved prior to cell activation.

  Alternatively, a procedure for ex vivo expansion of hematopoietic stem cells and progenitor cells is described in US Pat. No. 5,199,942, which is hereby incorporated by reference in its entirety. Can be applied to any cell. In addition to the cell growth factors described in US Pat. No. 5,199,942, other factors such as flt3-L, IL-1, IL-3 and c-kit ligands are used for cell culture and proliferation. It can be used.

  A variety of cell selection techniques are known for identifying and isolating cells from a cell population. For example, monoclonal antibodies (or other specific cell binding proteins) can be used to bind to marker proteins or surface antigen proteins found on cells. Several such markers or cell surface antigens are known in the art.

Vaccine formulation The present invention further comprises a vaccine formulation suitable for use in immunotherapy. In certain embodiments, the vaccine formulation is used for the prevention and / or treatment of diseases such as cancer and infectious diseases. In one embodiment, administration of a vaccine according to the invention for the prevention and / or treatment of cancer to a patient is performed before or after surgery to remove the cancer, before chemotherapy for the treatment of cancer or After and before or after radiation therapy for the treatment of cancer, and any combination thereof. In other embodiments, the vaccine formulation may be administered in combination with or in combination with another composition or pharmaceutical product. It should be understood that the present invention can also be used to prevent cancer in individuals who do not have cancer but may be at risk of developing cancer.

Administration of cancer vaccines prepared according to the present invention is broadly applicable to cancer prevention or treatment , which is determined in part by the selection of antigens that form part of the cancer vaccine. Cancers that can be suitably treated according to the practice procedure of the present invention include, but are not limited to, lung, breast, ovary, cervix, colon, head and neck, pancreas, prostate, stomach, bladder, kidney, bone, Includes cancers of the liver, esophagus, gastroesophagus , brain, testis, uterus and various leukemias and lymphomas.

In one embodiment, vaccine may be derived from tumor or cancer cells being treated. For example, in the treatment of lung cancer, lung cancer cells are treated as described above to produce a lung cancer vaccine. Similarly, breast cancer vaccines, colon cancer vaccines, pancreatic cancer vaccines, gastric cancer vaccines, bladder cancer vaccines, kidney cancer vaccines, etc. follow the implementation procedures for the prevention and / or treatment of tumors or cancer cells from which the vaccines were generated. Produced and adopted as an immunotherapeutic agent.

In another embodiment, the vaccine can also be prepared by collecting relevant antigens excreted by the pathogen into the medium to treat a variety of infectious diseases affecting mammals, as described above. . Due to heterogeneity in the types of immunogenic and protective antigens expressed by different organisms that cause the same disease, by preparing a vaccine from a pool of organisms that express different important antigens, A vaccine can be prepared.

In another embodiment of the invention, the vaccine can be administered by intralymphatic injection into the groin lymph node. Alternatively, the vaccine can be administered intradermally or subcutaneously to the limb, upper limb and lower limb of the patient being treated , depending on the vaccine target. In general, this approach is satisfactory for melanoma and other cancers, including prevention or treatment of infectious diseases, but other routes of administration such as intramuscular or in the bloodstream can also be used. .

  Further, the vaccine can be given with adjuvants and / or immunomodulators to enhance vaccine activity and patient response. Such adjuvants and / or immunomodulators are understood by those skilled in the art and are readily described in the available published literature.

  As contemplated herein, depending on the type of vaccine being produced, the production of the vaccine may optionally be suitable for growing cells in a bioreactor or fermentor or in bulk. It can be scaled up by culturing the cells in a container or device. In such a device, the medium is collected regularly, frequently or continuously in order to recover such material or antigen before any material or antigen is degraded in the medium.

  If desired, devices or compositions containing vaccines or antigens produced and recovered by the present invention and suitable for sustained or intermittent release are actually relatively slow into the body of such materials. Or it may be implanted in the body or administered locally for timed release.

  Other steps in vaccine preparation can be individualized to meet specific vaccine requirements. Such additional steps will be understood by those skilled in the art. For example, some collected antigenic material can be concentrated, in some cases treated with detergent, and ultracentrifuged to remove alloantigens in the transplant.

Combination therapy The present invention provides an effective treatment for treating cancer, wherein the treatment alters the immune response in the tumor, such that immune cells at the tumor site are more effective at attacking tumor cells. Including. In some cases, effective therapies include improving immune cell migration and activity at the tumor site. In one embodiment, the dendritic cell vaccines in combination with one or more inhibitors of HER2 and HER3, compositions and methods for use as therapeutic regimen for treating a cancer. In another embodiment, the treatment regimen includes the use of dendritic cell vaccines, one or more inhibitors of HER2 and HER3, and chemokine modulating agents. In one embodiment, the chemokine modulating agent is a chemokine activator. An example of a chemokine activator is a TLR8 agonist.

In one embodiment, a therapeutic regimen for treating cancer, compositions and methods using a combination of dendritic cell vaccine and blocking of HER-2 and HER-3 is provided. In another embodiment, the dendritic cell vaccines, compositions and methods for use in combination with blocking of HER-2 and HER-3 by TNF-alpha and IFN-gamma are provided. In another embodiment, the present invention provides compositions and methods that add both TNF-α and IFN-γ to block both HER-2 and HER-3 as a therapeutic regimen for treating cancer. .

In one embodiment, the treatment regimen can be used to treat cancer and thus can be considered a type of anti-cancer therapy. In another embodiment, the treatment regimen is surgery, chemotherapy, radiation therapy (eg, X-ray), gene therapy, immunotherapy, hormone therapy, viral therapy, DNA therapy, RNA therapy, protein therapy, cell therapy and nanotherapy. Can be used in the context of combination therapy with another anti-cancer or anti-tumor therapy, including but not limited to.

In one embodiment, a therapeutic regimen in combination with another cancer drug for the treatment or prevention of cancer in a subject is provided . Other cancer medicaments are administered in synergistic amounts or with varying doses or with varying time schedules with the treatment regimen of the present invention. The invention also relates to kits and compositions relating to the combination of only the therapeutic regimen of the invention or the combination with the desired cancer medicament.

In one embodiment, the treatment regimen is used before receiving another anti-cancer therapy. In another embodiment, the treatment regimen is used concurrently with receiving another anti-cancer therapy. In another embodiment, the treatment regimen is used after receiving another anti-cancer therapy.

In some embodiments, the present invention provides a method of treating ER negative breast cancer in a subject. In some embodiments, the present invention provides a method of treating breast cancer that is ER negative and HER2 positive in a subject. In some embodiments, the breast cancer is metastatic breast cancer. In some embodiments, the breast cancer is in stage I, stage II or stage III.

In another embodiment, the treatment regimen can be used in combination with existing therapeutic agents used to treat cancer. In order to evaluate the potential therapeutic efficacy of the treatment regimens of the present invention in combination with antitumor therapeutic agents as otherwise described herein, these combinations were tested for antitumor activity according to methods known in the art. Can be done.

In one aspect, the present invention provides therapeutic regimen, chemotherapeutic agents, including anti-cell proliferation agent, or any combination thereof, but not limited to, may be used in combination with therapeutic agents such as anti-tumor agents.

The present invention should not be limited to any specific chemotherapeutic agent. Rather, any chemotherapeutic agent can be used with the treatment regimen of the present invention. For example, the following non-limiting representative classes: alkylating agents; nitrosourea; antimetabolites; antitumor antibiotics; plant alkaloids; taxanes; any conventional chemotherapy of hormonal agents and miscellaneous agents Agents are included in the present invention.

Alkylating agents do so because of their ability to load alkyl groups into many electronegative groups under the conditions present in the cells, thereby preventing DNA replication and preventing cancer cells from growing. Named. Most alkylating agents are nonspecific for the cell cycle. In certain embodiments, they stop tumor growth by cross-linking guanine bases in the DNA duplex strand. Non-limiting examples include busulfan, carboplatin, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, ifosfamide, mechlorethamine, hydrochloride, melphalan, procarbazine, thiotapere and uracil mustard.

  Antimetabolites prevent the incorporation of bases into DNA during the synthetic (S) phase of the cell cycle and inhibit normal development and division. Non-limiting examples of antimetabolite drugs include drugs such as 5-fluorouracil, 6-mercaptopurine, capecitabine, cytosine arabinoside, floxuridine, fludarabine, gemcitabine, methotrexate and thioguanine.

  In general, there are a variety of antitumor antibiotics that prevent cell division by interfering with enzymes required for cell division or by changing the membrane surrounding the cell. Included in this class are anthracyclines such as doxorubicin that prevent cell division by disrupting the structure of DNA and terminating its function. These agents are nonspecific for the cell cycle. Non-limiting examples of anti-tumor antibiotics include dactinomycin, daunorubicin, doxorubicin, idarubicin, mitomycin-C and mitoxantrone.

  Plant alkaloids inhibit enzymes that prevent or stop mitosis or prevent cells from making proteins necessary for cell growth. Often used plant alkaloids include vinblastine, vincristine, vindesine and vinorelbine. However, the present invention should not be construed as limited to only these plant alkaloids.

  Taxanes affect cell structures called microtubules that are important in cell function. In normal cell growth, microtubules are formed when cells begin to divide, but once the cells stop dividing, the microtubules are disassembled or destroyed. Taxanes prohibit disassembly of microtubules so that cancer cells become too clogged with microtubules and cannot grow and divide. Non-limiting representative taxanes include paclitaxel and docetaxel.

  Hormonal agents and hormone-like drugs are utilized for certain types of cancer including, for example, leukemia, lymphoma and multiple myeloma. They are often employed with other types of chemotherapeutic agents to increase their effectiveness. Sex hormones are used to alter the action or production of female or male hormones and are used to slow the growth of breast, prostate and endometrial cancers. Inhibiting the production of these hormones (aromatase inhibitors) or inhibiting the action (tamoxifen) can often be used as a therapeutic aid. Some other tumors are also hormone dependent. Tamoxifen is a non-limiting example of a hormonal agent that interferes with the activity of estrogens that promote the growth of breast cancer cells.

  The miscellaneous agents include chemotherapeutic agents such as bleomycin, hydroxyurea, L-asparaginase and procarbazine, which are also useful in the present invention.

  Anti-cell proliferating agents can be further defined as apoptosis-inducing agents or cytotoxic agents. The apoptosis-inducing agent can be granzyme, a member of the Bcl-2 family, cytochrome C, caspase or a combination thereof. Typical granzymes include Granzyme A, Granzyme B, Granzyme C, Granzyme D, Granzyme E, Granzyme F, Granzyme G, Granzyme H, Granzyme I, Granzyme J, Granzyme K, Granzyme L, Granzyme M, Granzyme N or those The combination of is mentioned. In other specific embodiments, a member of the Bcl-2 family is, for example, Bax, Bak, Bcl-Xs, Bad, Bid, Bik, Hrk, Bok or combinations thereof.

  In a further aspect, the caspase is caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13, caspase 14 or them It is a combination. In certain embodiments, the cytotoxic agent is TNF-α, gelonin, prodigiosin, ribosome inhibitory protein (RIP), Pseudomonas exotoxin, Clostridium difficile toxin B, Helicobacter pylori pentylamine, V. Irofulvene, Diptheria toxin, mitogillin, ricin, botulinum toxin, cholera toxin, saporin 6 or combinations thereof.

In one embodiment, the therapeutic regimen is used with an anti-tumor agent, wherein the anti-tumor agent is an anti-tumor alkylating agent, an anti-tumor antimetabolite, an anti-tumor antibiotic, a plant-derived anti-tumor agent, Antitumor platinum complex, antitumor camptothecin derivative, antitumor tyrosine kinase inhibitor, monoclonal antibody, interferon, biological response modifier, hormonal antitumor agent, antitumor virus agent, angiogenesis inhibitor, differentiation inducer PI3K / mTOR / AKT inhibitor, cell cycle inhibitor, apoptosis inhibitor, hsp90 inhibitor, tubulin inhibitor, DNA repair inhibitor, anti-angiogenic agent, receptor tyrosine kinase inhibitor, topoisomerase inhibitor, taxane, Agents targeting Her-2, hormone antagonists, agents targeting growth factor receptors or pharmacy It is acceptable salts. In some embodiments, the anti-tumor agent is cytabine, capecitabine, valopicitabine or gemcitabine. In some embodiments, the anti-tumor agent is Avastin, Sutent, Nexavar, Recentin, ABT-869, Axitinib, Irinotecan, topotecan, paclitaxel, docetaxel, lapatinib, Herceptin, lapatinib, steroid steroid Selected from the group consisting of a systemic aromatase inhibitor, Fluvestrant, an inhibitor of epidermal growth factor receptor (EGFR), Cetuximab, Panitimab, an inhibitor of insulin-like growth factor 1 receptor (IGF1R), and CP-751871.

In one embodiment, the anti-tumor agent is a chemotherapeutic agent. A chemotherapeutic agent as used herein is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotaper and cyclophosphamide (CYTOXAN); alkyl sulfonates such as busulfan, improsulfan and piperosulfan; aziridines such as benzodopa, carbocon, methredopa and ureodopa; , Ethyleneimine and methylamylamine including triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethyllolomelamine; acetogenin (especially bratacin and bratacinone); delta-9-tetrahydrocannabinol (dronabinol) , MARINOL); beta-lapachone; lapachol; Ruchtin; betulinic acid; (synthetic analog topotecan (HYCAMTIN), CPT-11 (including irinotecan, CAMTOSAR), acetylcamptothecin, scopolectin and 9-aminocamptothecin) camptothecin; bryostatin; calistatin; CC-1065; podophyllotoxin; podophyllic acid; teniposide; cryptophycin (especially cryptophycin 1 and cryptophycin 8); dolastatin (including synthetic analogs, KW-2189 and CB1-TM1) duocarmycin Eluterobin; pancratistatin; sarcodictin; sponge statin; chlorambucil, chlornafadin, Nitrogen mustards such as lolophosphamide, estramustine, ifosfamide, mechloretamine, mechloretamine oxide hydrochloride, melphalan, novembicin, phenesterin, predonimustine, trophosphamide, uracil mustard; Nitrosourea, such as; enediyne antibiotics (see, for example, calicheamicin, especially calicheamicin γII and calicheamicin omega II (see, eg, Agnew, Chem Intl. Ed. Engl, 33: 183-186 (1994)) Dynemicin including dynemicin A; esperamicin; and neocardinostatin (classic Antibiotics such as mophor and related chromoprotein enediyne antibiotics chromophore), aclacinomycin, actinomycin, anthramycin, azaserine, bleomycin, kactinomycin, carabicin, carminomycin, cardinophyllin, chromomycin, dactino Mycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, (ADRIAMYCIN, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HCl liposome injection (DOXIL), liposomal doxorubicin TLC D- 99 (MYOCET), including pegylated liposomal doxorubicin (CAELYX) and deoxyxorubicin ) Mitomycin such as doxorubicin, epirubicin, esorubicin, idarubicin, marcelomycin, mitomycin C, mycophenolic acid, nogaramycin, olivomycin, peplomycin, podophylomycin, puromycin, keramycin, rhodorubicin, streptonigrin, streptozocin, tubercidine, , Dinostatin, zorubicin; antimetabolites such as methotrexate, gemcitabine (GEMZAR), tegafur (UFTORAL), capecitabine (XELODA), epothilone and 5-fluorouracil (5-FU); Fludarabine, 6-mercaptopurine, thiampurine, thioguanine Which purine analogs; pyrimidine analogs such as amcitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxyfluridine, enocitabine, floxuridine; antiadrenals such as aminoglutethimide, mitotane, trilostane; folic acid supplements such as folinic acid Acegraton; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; vestlabcil; bisantrene, edatraxate; defifamine; demecorsin; diazicon; erfornium acetate; Ethogluside; gallium nitrate; hydroxyurea; lentinan; lonidinine; maytansine and Nsamitoshin (ansamitocins) such maytansinoid; mitoguazone; mitoxantrone; mopidamole; Nitorakurin; pentostatin; Fenametto; pirarubicin; losoxantrone; 2-ethyl-hydrazide; procarbazine, PSK polysaccharide complex (JHS National Products, Eugene, Oreg. Razoxan; Rhizoxin; Schizophyllan; Spirogermanium; Tenuazonic acid, Triadicon; 2,2 ', 2 "-Trichlorotriethylamine; Trichothecene (especially T-2 toxin, Veraculin A, Loridin A and Anguidine); Urethane; Dacarbazine; Mannomustine Mitoblonitol; mitactol; pipobroman; gacytosine; arabinoside ("Ara-C");thiotaper; taxoids such as paclitaxel (TAXOL), paclitaxel albumin-modified nanoparticle E (ABRA) Docetaxel (TAXOTERE); chlorambucil; 6-thioguanine; mercaptopurine; methotrexate; cisplatin, oxy Platinum agents such as saliplatin and carboplatin; Vincas, including vinblastine (VELBAN), vincristine (ONCOVIN), vindesine (ELDISINE, FILDESIN) and vinorelbine (NAVELBINE), which prevents polymerization of tubulin from forming microtubules Etoposide (VP-16); Ifosfamide; Mitoxantrone; Leucovovin; Novantrone; Edatrexate; Daunomycin; Aminopterin; Ibandronate; Topoisomerase inhibitor RFS2000; Retinoids such as retinoic acid; clodronate (eg BONEFOSO or OS AC), etidronate (DIDROCAL), NE-58095, zoledronic acid / zoledronate (ZOMETA), alendronate (FOSAMAX), pamidronate (AREDIIA), bisphosphonates such as tiludronate (SKELID) or risedronate (ACTONEL); troxacitabine (1,3 -Dioxolane nucleoside cytosine analogues); antisense oligonucleotides, in particular genes in signaling pathways involved in abnormal cell proliferation such as, for example, PKC-α, Raf, H-Ras and epidermal growth factor receptor (EGF-R) That inhibit the expression of THERTOPE. RTM. Vaccines such as vaccines and gene therapy vaccines, such as ALLOVECTIN vaccines, LEUVECTIN vaccines and VAXID vaccines; topoisomerase I inhibitors (eg LULTOTCAN); rmRH (eg ABARELIX); BAY-439006 (Sorafenib; Bayer); SU-11248 ( Perifosine; COX-2 inhibitors (eg celecoxib or etoroxib), proteosome inhibitors (eg PS341); bortezomib (VELCADE); CCL-779; tipifanib (R11577); orafenib, ABT510; oblimersen sodium (GENASENSE) Bcl-2 inhibitors such as; Pixanthrone; EGFR inhibitors; Tyrosine kinases And any of the pharmaceutically acceptable salts, acids or derivatives described above; and CHOP, which is an abbreviation for cyclophosphamide, doxorubicin, vincristine and prednisolone combination therapy, and oxali in combination with 5-FU and leucobobin Combination therapy of two or more of the above, such as FOLFOX, which is an abbreviation for a treatment regimen with platin (ELOXATIN).

In another embodiment, using a combination of immunotherapy, estrogen receptor-positive / HER2-positive ^(ER-positive / ^{HER-positive)} treating DCIS breast cancer patients. For example, anti-estrogen therapy such as tamoxifen is combined with an amti-HER2 dendritic cell vaccine to improve complete pathological response .

  These methods described herein are by no means exhaustive and methods for specific applications will be apparent to those skilled in the art. Furthermore, the effective amount of the composition can be further estimated by analogy with compounds known to have the desired effect.

Experimental example

  The invention is explained in more detail in connection with the following experimental examples. These examples are provided for illustrative purposes only, and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should not be construed as limited to the following examples, but should be construed as including any and all variations that become apparent as a result of the teaching provided herein. .

  Without further explanation, one of ordinary skill in the art, using the foregoing description and the following examples, can make and use the invention and practice the claimed methods. Accordingly, the following examples specifically point out preferred embodiments of the invention and should not be construed as limiting the remainder of the disclosure in any way.

Example 1
Cryopreserved pre-activated multi-dose dendritic cell vaccines In order to be able to produce these large scale vaccines, fully activated DC1 vaccines pulsed with tumor antigens are produced, thereby producing fully activated DC1 vaccines. A process of cryopreserving as a multi-dose syringe ready 6-pack DC1 vaccine was developed. DC1 is cryopreserved and activated as DC1, as described elsewhere herein. For example, they are stored frozen in 55% plasma light medium containing 40% human serum albumin and 5% DMSO. These vaccines are produced in the laboratory, extensively tested, and consistently meet quality standards set by the FDA for patient administration.

  The materials and methods employed in the experiments and examples disclosed herein are now described.

Preparation of fully activated DCs for cryopreservation Freshly elicited bone marrow monocytes were cultured in 6-well microplates (12 × 10 ⁶ cells / well). The medium consisted of Serum Free Medium (SFM Invitrogen Carlsbad CA). The final concentration of GMCSF added was 50 ng / ml and IL4 was 1000 U / ml. Cells were cultured overnight in 5% CO ₂ at 37 ° C. In some batches, after 16-20 hours, cells were pulsed with the appropriate peptide and cultured for an additional 6-8 hours, after which 1000 U / ml IFN-γ was added. Dendritic cells were matured with TLR agonists, LPS (TLR4, 10 ng / ml) or R848 (TLR8, 1 μg / ml). The maturation time was at least about 6 hours. Thereafter, DCs activated with TLR agonists were either cryopreserved or ready for immediate use.

  To induce the production of the Th1 polarized cytokine IL-12, DCs are activated with the cytokine IFN-γ, or a combination of the TLR agonist bacterial LPS and / or R848. This should induce T cells that produce IFN-γ. Alternatively, DC can be activated with a combination of ATP, bacterial LTA, LPS and prostaglandin E2 (PGE2). This can cause amplification of IL-23, IL-6 and IL-1β, resulting in an immune response dominated by IL-17 and IL-22 secreting Th17 cells.

Cryopreservation of DCs DC were collected by gently rubbing. All media and cells were kept on wet ice each time. Cells were gently washed by centrifuging at approximately 800 RPM for 10 minutes. Cells (eg, 10 × 10 ⁶ cells) were cryopreserved in freezing medium of 55% plasma light, 40% human serum albumin containing 5% DMSO and stored in liquid nitrogen.

  The results of the experiments presented here are described here.

Multi-dose DC1 vaccine Experiments were performed to assess cell recovery, viability and sterility. Briefly, peripheral blood monocytes were obtained by a combination of leukocyte depletion and counter current elimination, and cultured overnight in serum free medium containing GM-CSF and IL-4. The next day they were pulsed with HER-2 peptide, then with IFN-γ followed by LPS. DC1 was collected at 40 hours, cryopreserved in a freezing medium of 55% plasma light containing 5% DMSO, 40% human serum albumin and stored in liquid nitrogen. After one week, they were thawed to obtain shipping standards including viability, yield, endotoxin testing and aseptic culture. All 12 cultures had no bacterial growth and were less than 0.1 EU endotoxin. FIG. 1 shows the survival rate of cryopreserved DC1. As seen in FIG. 1, when cells were directly thawed and counted, the cell recovery rate averaged 89% and the survival rate was 95%. These data demonstrate that the cryopreservation and viability of the DC1 vaccine is maintained in media containing less than 7.5% DMSO acceptable to the FDA.

  It was observed that cell function was maintained after cryopreservation. IL-12 and Th1 chemokines were produced 36 hours after thawing of the multiple dose DC1 vaccine. Thawed cells produced high levels of IL-12 from 6 to 36 hours after thawing. These levels of IL-12 are comparable to prepared DC1 vaccines made from cryopreserved monocytes.

  The results presented herein demonstrate that a cryopreserved, pre-activated, multi-dose dendritic cell vaccine sensitized to the HER-2 tumor target antigen of breast cancer is therapeutically effective. However, the present invention is further applicable to various pathophysiological conditions.

  The multi-dose syringe readypack DC1 vaccine can be used in HER-2 non-expressing breast cancer. HER-2 is expressed in approximately 25% of all breast cancers. Breast cancer that does not produce detectable levels of HER-2 may be less susceptible to vaccination. To address this limitation, additional target proteins can be added to the vaccine. For example, many breast cancers that do not produce high levels of HER-2 instead produce other related proteins, including HER-1 and HER-3. While not wishing to be bound by any particular theory, it is believed that adding these other proteins to the vaccine will allow targeting of these other breast cancer phenotypes.

  The multi-dose syringe ready pack DC1 vaccine can be used for other cancer types besides breast cancer. Possible target proteins such as HER-1, HER-2 and HER-3 are ovarian, prostate, pancreas, colorectal, stomach, head and neck, and non-small cell lung cancer, and other common cancers May also be present in other types of cancer, including

The multi-dose syringe readypack DC1 vaccine can be used to treat chronic infectious diseases including but not limited to chronic infections such as HIV or hepatitis C virus. Here, proteins specific for these viruses will replace HER-2 or other oncoproteins and mobilize the patient's immune response to these persistent infections. Enhanced immunity can greatly reduce the viral load and associated disease symptoms and progression, or help completely eliminate the infection.

The multi-dose syringe ready pack DC1 vaccine can be used to treat autoimmune diseases. Diseases such as rheumatoid arthritis and lupus develop when the immune system mistakenly attacks the normal tissues of the body. Although current vaccine / immunotherapy formulations are designed to initiate and enhance immune responses, we do not wish to be bound by any particular theory, It is believed that in vitro signals can be provided to DCs during the production of vaccines that induce DCs to switch off.

(Example 2)
Cryopreservation of activated DC1 creates large-scale dendritic cell vaccines suitable for cancer treatment Dendritic cell-based vaccine therapy is a promising directed therapy for various cancers. Various strategies have been adopted to optimize DCs for CD4 + and CD8 + T cell sensitization to recognize tumor epitopes and mature DCs into a phenotype that elicits anti-tumor immunity, but interferon gamma (IFN- Experiments were designed to utilize methods that employ rapid maturation of monocytes in serum-free medium (SFM) using γ) and lipopolysaccharide (LPS), Toll-like receptor (TLR) 4 agonist As such, the immune response was polarized into a Th1-type response, resulting in mature DCs that could induce sensitization by an IL-12-dependent mechanism. The results demonstrate the ability of this vaccine strategy to be used as an adjunct therapy in early breast cancer. Lyophilization of dendritic cells (DC) in the mature state allows easier creation and reachability of individualized treatments.

Rapid maturation of dendritic cells Freshly matured DC (DC1) and matured lyophilized (cryoDC), then thawed DCs were analyzed for viability and recovery, as well as cell surface markers by flow cytometry. The phenotype maturity determined by expression was compared. Dendritic cell function was determined by measuring the production of various cytokines, particularly interleukin 12p70 (IL-12p70). The ability of these cells to stimulate naive CD4 + and CD8 + cells was also evaluated.

  There was no significant difference in survival rate (p = 0.4807) and recovery rate (p = 10.120) (FIG. 2).

  Both populations had similar initial (7 hours after LPS addition) IL-12p70 secretion (p = 0.768). The population showed comparable IL-12p70 secretion levels over a 30 hour observation period with no significant differences between the populations (FIG. 3).

  Population and IL-1β (p = 0.7690), IL-1α (p = 0.0841), Rantes (p = 0.902), MDC (p = 0.1514), IL-10 (p = 0.1937) ), MLP-1α (p = 0.2673), IP-10 (p = 0,7366), IL-6 (p = 0.24), IL-5 (p = 0.0735), TNF-β (p = 0.9422), IL-15 (p = 0.8878), MIP-1β (p = 0.9217), TNF-α (p = 0.8972), IL-8 (p = 0.7844) production There was no significant difference between. (FIG. 4).

  Cell surface markers, meaning DC maturity, show no significant difference in expression between DC1 and cryoDC. Both populations elicited non-specific alloantigen CD4 + T cell responses as well as antigen-specific CD8 + T cell recognition and Th1 polarization responses. CD80, 83 and 86 showed DC maturation and there was no significant difference in expression. Functional ability was induced by CD4 + T cells from different donors co-cultured with each population, resulting in non-specific alloantigen response and CD4 + T cells secreting INF-γ (DC1 107.40 ng / mL and cryoDC1 129.23 ng / mL). Antigen-specific sensitization elicited by co-culturing the two populations with tumor antigen-specific CD8 + T cells induces equivalent IFN-γ secretion for both groups, resulting in a TH1 polarization response (FIG. 5). .

  The results presented herein show that the rapid maturation method of DC1 can be cryopreserved in a functionally mature state, maintaining phenotype and function, and thus for global use in cancer therapy Demonstrate that it can be used to produce Syringe Ready DC1.

  While maintaining the DC1 phenotype to drive a Th1 polarized immune response, the results presented herein demonstrate that cryoDC maintained primarily the ability to sensitize T cells. This may also be related to the maturation strategy, as DC1 matured by IFN-γ and LPS exhibits an increased ability to sensitize CD4 + T cells primarily compared to DCs matured by cytokines.

  The present protocol for the preparation of cryopreserved mature DCs can be easily adapted to current good manufacturing practice guidelines, thereby increasing the availability of new therapies.

(Example 3)
CD4 T cell-derived cytokines and Herceptin sensitize HER-2 highly expressing breast cancer cells to CD8 T cell killing HER-2 highly expressing breast cancer cells are visible to CD8 T cells And have been demonstrated to down-regulate molecules on the cell surface that can be killed by these immune cells. In breast cancer cells that moderately and highly express HER-2 when interferon gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α), cytokines produced by CD4 cells, are combined with Herceptin, It has been shown to cause an increase in their class I molecule expression. As a result of this, CD8 T cells can better see breast cancer cells and kill them or produce cytokines to kill them.

  A trial was designed to evaluate the therapeutic effect of using Herceptin in combination with a dendritic cell vaccine (eg, DC1 vaccine).

A Phase I DC1S vaccine trial was designed that used Herceptin in combination with the DC1 vaccine. For example, for patients with HER-2 highly expressing DC1S, a Phase I study was designed to receive DC1 vaccine in combination with two doses of Herceptin in weeks 1 and 4. Without wishing to be bound by any particular theory, in patients with HER-2-expressing DC1S, this combination is considered to increase the complete response rate from 30% to over 50%.

In addition, a Phase III DC1S vaccine trial was designed. For example, a vaccine trial was developed to prevent breast cancer recurrence in patients with estrogen independent (ER negative), HER-2 positive DC1S. The study has three treatment groups: 1) standard treatment (surgery and radiation), 2) receive DC1 vaccine before surgery, and 3) receive DC1 vaccine + Herceptin before surgery. While not wishing to be bound by any particular theory, patients who respond completely to treatment can avoid radiation after surgery. It is also believed that this study serves to demonstrate the prevention of recurrence with vaccines in patients with DC1S.

In addition, a Phase I neoadjuvant DC1 vaccine was designed for use with Herceptin in patients with early invasive HER-2 ^positive breast cancer. For example, whether a combination of a vaccine with Herception and a chemokine modulator (eg, a chemokine activator) removes HER-2 expressing small invasive breast cancer prior to surgery and avoids the need for chemotherapy A Phase I study was designed to test. While not wishing to be bound by any particular theory, this neoadjuvant strategy (pre-surgery) with the potential to add immune antibodies that breaks the immune response is toxic for the treatment of breast cancer It is believed that the need for certain chemotherapy is eliminated and therefore immunotherapy can be the standard of care for this disease. That is, the treatment regimens disclosed herein take the quest to eradicate breast cancer one step further using a natural immune response that can be repaired by the vaccine regimens of the invention. The regimens discussed herein can drive immune cells into the tumor by altering the immune response within the tumor and allow the immune cells to work longer by releasing the brakes on the immune cells. Combining the DC1 vaccine with Herceptin and adding a chemokine modulator would also improve immune cell migration and activity within the tumor in the breast.

  Without wishing to be bound by any particular theory, in many cancers, if there are a large number of excellent immune-fighting cells, the patient will perform better in any type of treatment. Conceivable. This means that if immune cells enter the tumor to fight the tumor before it is removed, the patient may perform better in other treatments, including surgery, chemotherapy and radiation, and respond better Means there is.

While not wishing to be bound by any particular theory, effective therapies to treat cancer can change breast cancer and other types of cancer by rapidly changing the immune response within the tumor prior to surgery. An agent that improves the outcome of patients with This strategy is applicable to a variety of cancers including but not limited to colon cancer, melanoma, lung, brain, pancreas, prostate, esophagus and the like.

  Experiments to develop immunofluorescence assays to measure and quantify immune cells of the type that migrate into the breast after vaccination, types of chemokines that attract cells, and molecules they express to help remove cancer cells Designed. These assays allow multiple cell types to be visualized simultaneously and indicate where they are located within the tumor microtubule thorax. In at least some of the vaccinated patients, it has been observed that the tumor produces chemokines that mobilize cells into the environment and kill the tumor cells.

Example 4
Combinations of HER-2 and HER-3 blockade The results presented herein show that the combination of HER-2 and HER-3 blockade with an effective anti-HER-2CD4 + Th1 response indicates HER-2 expression. Demonstrates that it is highly effective in causing tumor aging and apoptosis in breast cancer.

It blocked HER-2 and HER-3 together, and the addition of a combination of TNF-alpha and IFN-gamma, a Th1 cytokine derived CD4Th1 cells, causing a significant aging and apoptosis of HER-2 expressing breast cancer Was observed. This was confirmed in various cell lines of both breast cancer cells expressing high and moderate HER-2. This result demonstrates that this combination can be powerful for prevention and prevention of recurrence.

The method is a cell culture and treated human breast cancer cell line SK-BR-3, BT- 474, MCF-7, T-47D, the HCC-1419 and MDA-MB-231, from American Type Culture Collection (Manassas, VA ) Obtained and grown in RPMI-1640 (Life technologies, Grand Island, NY) supplemented with 10% FBS (Cellgro, Herndon, VA). JIMT-1 cells were obtained from Dr. Ohio State University (Columbus, OH) . Presented by Pravin Kaumaya and grown in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen, Walham, Mass.) Supplemented with 10% FBS . Normal immortalized MCF-10 cells were obtained from Karmanos Cancer Institute (Detroit, MI) and 10 mM HEPES, 10 μg / ml insulin, 20 ng / ml EGF, 100 ng / ml cholera toxin, 30 mM sodium bicarbonate, Growing in DMEM / F12 (Invitrogen) supplemented with 0.5 μg / ml hydrocortisone and 5% horse fetal serum. All cells were grown at 37 ° C. in a humidified 5% CO ₂ incubator.

300,000 breast cancer cells were treated with the indicated concentrations of human recombinant TNF-α (R & D Systems, Minneapolis, Minn.) And human recombinant IFN-γ (R & D Systems) for 5 days, then in the absence of cytokines And subcultured twice more. Cells were subjected to senescence-related β-galactosidase enzyme (SA-β-gal) detection or lysed and subjected to Western blot analysis for p15INK4b , p16INK4a and cleaved caspase-3 .

In some cases, cells were treated with 10 μg / ml trastuzumab (HERCEPTIN ™) and pertuzumab (PERJETA ™) (both Genetech, San Francisco, Calif.) As indicated. This treatment was combined with cytokines or human recombinant heregulin (R & D Systems).

Also 50000 cancer cells were co-cultured with 10 × 10 ⁵ human CD4 ⁺ T cells in the chamber under the transwell system (BD Biosciences, San Jose, Calif.) And in the upper chamber. in 10 ^five mature (i.e., I-type polarization) were co-cultured with or immature human DC. DC and CD4 ⁺ T cells were obtained from selected test subjects (Sharma et al., 2012, Cancer 118: 4354-4362). Mature and immature DCs were pulsed for 5 days at 37 ° C. with class II-derived HER2 or control unrelated (BRAF and survivin) peptides (20 μg / ml). Control wells contained only CD4 ⁺ T cells. In addition, 0.5 × 10 ⁵ cells were incubated for 5 days at 37 ° C. in the presence of DC / CD4 ⁺ T cell co-culture supernatant. In both approaches, the cells were then subcultured twice in the absence of cytokines and subjected to aging tests (SA-β-gal activity at pH 6 and Western blots of p15INK4b and p16INK4a) or apoptosis tests (of cleaved caspase-3). Western blot). DC and DC4 + T cells by the addition of the following antibodies in 60 minutes before the incubation with the co-cultures was neutralized Th1 produce cytokines: polyclonal goat IgG anti-human TNF-α (0.75mg / ml per TNF-alpha of 0.06 μg / ml) and IFN-γ (0.3 μg / ml per 5 ng / ml IFN-γ) and the corresponding goat IgG isotype as a negative control (all from R & D Systems ).

Plasmid Transfection MDA-MB-231 cells were transiently transfected with 2 μg of wtHER2 expression vector (pcDNAHER2) for 48 hours. As a control, cells were transfected with 2 μg of empty vector (pcDNA3). Both vectors are described in Dr. Courtesy of Mark Greene (University of Pennsylvania, Philadelphia, PA). Cells were transfected with Turbofect (Thermo Scientific, Waltham, Mass.) In complete medium without antibody. Transduction efficiency was assessed by Western blot 48 hours after transfection. After 48 hours, the transfected cells were transferred to complete medium containing 0.4 mg / ml G418 (Life Technologies). After 15 days in culture, colonies resistant to G418 were selected by limiting dilution. Transfection efficiency was evaluated by Western blot.

RNA interference (RNAi) transfection Small interfering RNA (siRNA) SMART Pool: ON TARGET Plus HER2 siRNA, HER3 siRNA and SMART Pool: ON-TARGETplus Non-targeting Pool was purchased from GE Dharmacon -te ( Lafay). The following target sequences were used: HER2: UGGAAGAGAUUCACAGGUUA (SEQ ID NO: 9), GAGACCCGCUGAACAAUAC (SEQ ID NO: 10), GGAGGAAUGCCGAGUACAUUG (SEQ ID NO: 11), GCUCAUCGCUCCACAACCCAA (SEQ ID NO: 13) UG; ), AGAUUGUGCUCACGGGGACA (SEQ ID NO: 14), GCAGUGGAUUCGAGAAGUG (SEQ ID NO: 15), UCGUUCAUGUUGUAGAUAUUA (SEQ ID NO: 16); A (SEQ ID NO: 19), UGGUUUACAUGUUUUCCUA (SEQ ID NO: 20). 300,000 cells were transfected with siRNA sequence (25 nM) using RNAi Max Lipofectamine (Life Technologies) in serum-free medium and 1 hour later, 10% FBS was added to the medium. After 16 hours, cells were subjected to 48 hours of serum starvation followed by various designated treatments and Western blots to check expression levels.

SA-β-gal activity at pH 6 Cells were washed twice with PBS, fixed with 3% formaldehyde and washed again with PBS. Incubate with freshly prepared aging-related acid β-galactosidase (SA-β-gal) stain from Millipore (Billerica, MA) at 37 ° C. overnight (without CO ₂ ) as per manufacturer's instructions. . 300 cells using a bright field microscope (Evos CoreXL, Bothel, WA / 40X / 2048 × 1536, 3.2 μm / pixel; 3.1 Mp color / capture image: color TIFF, PNG, JPG or BMP- 2048 × 1536 pixels ) After scoring, the ratio (%) of SA-b-gal positive (blue) cells in each sample was measured.

Western blot analysis Lysates were prepared from MCF-10A, SK-BR-3, and MCF-7, T-47D or MDA-MB-231 cells. 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 70% Tergitol, 0.1% SDS, 1 mM Mg ₂ Cl and protease inhibitor cocktail Sigma- Cells were lysed in a buffer containing Aldrich (St. Louis, MO). The lysate was centrifuged at 12,000 xg for 15 minutes at 4 ° C. Protein was solubilized in sample buffer (Life Technologies) and subjected to SDS-PAGE. Protein was electroblotted into PVDF. The following antibodies are all: p15INK4b (K-18), p16INK4a (50.1), IFN-γRα (C-20), HER3 (C-17) from Santa Cruz Biotechnology (Santa Cruz, CA) ; Sigma-Aldrich ; Membranes were immunoblotted with vinculin (V9131) from HER2 (29D8), cleaved caspase 3 (8G10) and TNF-R1 (C25C1) from Cell Signaling Technologies (Danvers, Mass.). After washing, the membrane was incubated with a secondary antibody (Bio-Rad, Hercules, CA) conjugated to HRP. Bands were visualized and quantified using an enhanced chemiluminescence (ECL) Western blotting detection system and Image Reader LAS-1000 Lite version 1.0 software (Fuji). Western blot quantification was performed using ImageJ software.

Analysis of cell death by flow cytometry SK-BR-3 cells were untreated, treated with IFN-γ (100 U / ml) and TNF-α (10 ng / ml), trastuzumab (10 μg / ml) and pertuzumab ( 10 μg / ml) or a combination of IFN-γ, TNF-α, trastuzumab and pertuzumab for 24 hours. After incubation, apoptosis induction was detected using FITC-Annexin V apoptosis detection kit (BD Biosciences) according to the manufacturer's instructions. Briefly, untreated and treated SKBR-3 cells were collected, washed with PBS, and resuspended in Annexin V binding buffer at a concentration of 1 × 10 ⁶ cells / ml. 100 μl of cell suspension was incubated with 5 μl PI and 5 μl FITC-annexin V for 15 minutes at room temperature in the dark. After incubation, 150 μl of annexin V binding buffer was added, apoptosis induction was analyzed using BD Accuri C6 flow cytometry (BD Biosciences), and data analysis was performed using CFlow Plus software. Cells irradiated with UV were used as a positive control.

Tumor development studies For xenograft experiments, SK-BR-3 cells (2 × 10 ⁶ cells in 200 μl of PBS) were transformed into 6 week old female athymic (nude) mice (Foxnu, Harlam Laboratories, 5 mice). Injection into the flank of / group). If the tumor is palpable, animals are s.c. with trastuzumab and pertuzumab (30 μg / kg). c. Treatment and then hrTNF-α and hrIFN-γ (10 ng / kg) s. c. Injected. Tumor formation was monitored by tactile sensation and tumor volume in mm ³ was measured twice a week with calipers: width 2 × length / 2. All animal experiments were performed in compliance with institutional guidelines.

Statistical Analysis GraphPad Prism (GraphPad Software, La Jolla , CA, USA) was performed using the unpaired Student's t-test (both sides). A P value of 0.05 or less was considered significant. ^* P <0.05, ^** P <0.01, ^*** P <0.001.

Results Cytokines TNF-α and IFN-γ synergistically induce senescence in breast cancer cells When cytokines produced by immune system cells were able to induce specific senescence responses in tumor cells SK-BR-3 cells were incubated with human recombinant tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) alone or in combination at 37 ° C. for 5 days. The cells were then subcultured two more times and subjected to an aging test. The combination of both cytokines resulted in increased senescence-related acidic β-galactosidase (SA-β-gal) staining (FIG. 6A) and high senescence-related markers p15INK4b and p16INK4a compared to control untreated cells detected by Western blot or each cytokine alone. It resulted in senescence induction of SK-BR-3 cells, as observed by expression (FIG. 6B). Similar results were obtained in BT-474, MCF-7 and T-47D breast cancer cell lines (data not shown). Therefore, T-47D cells were treated with several concentrations of TNF-α, 10-100 ng / ml, and 100-1000 U / ml IFN-γ, or combinations thereof. We observed that the induction of the aging phenotype was dose dependent (FIG. 6C). Similar results were observed in SK-BR-3, BT-474 and MCF-7 cells.

Inverse correlation between HER2 expression level in breast cancer cells and doses of TNF-α and IFN-γ, Th1 cytokines required to induce senescence HER2 expression level is 5 days with TNF-α and IFN-γ Induced in SK-BR-3, BT-474, MCF-7, T-47D and MDA-MB-231 breast cancer cells by treatment at 37 ° C., followed by two additional passages without cytokines An experiment was designed to determine whether or not to play a role in aging. Indeed, compared to moderate HER2 expressing cell lines with high cytokine concentrations (T-47D, FIG. 6D and MCF-7, data not shown), low doses of TNF-α and IFN-γ caused HER2 The amount of SA-β-gal positive cells was increased in the high expression cell line (SK-BR-3, FIG. 6D and BT-474, data not shown). However, even the highest concentrations of TNF-α and IFN-γ were unable to induce senescence in the HER2 low expressing cell line MDA-MB-231 (FIG. 6D). These results clearly demonstrate a correlation between TNF-α and IFN-γ and HER2 expression levels that induce senescence.

HER2 is required for Th1 cytokines TNF-α and IFN-γ-mediated senescence and apoptosis in MDA-MB-231 breast cancer cells. Stably transfected and treated with high concentrations of TNF-α (200 ng / ml) and IFN-γ (2000 U / ml) for 5 days at 37 ° C., followed by two additional passages in the absence of cytokines. Only in cases, SA-β-gal positive cells (FIG. 7A) and p15INK4b expression (FIG. 7B) were strongly increased. In particular, when HER2-MDA-MB-231 cells were cultured with high concentrations of TNF-α and IFN-γ, not only were there relatively many blue senescent cells, but the amount of cells was remarkably low. As a result, the experiment was repeated and the cells were subjected to Western blot in order to detect active caspase 3 and investigate apoptosis (FIG. 7B). Treatment of cells transfected with the control empty vector (pcDNA3) with increasing concentrations of TNF-α, 75-200 ng / ml and IFN-γ, 750-2000 U / ml in the same conditions as described above, had no effect on aging-induced assessed by beta-gal staining (Fig. 7A) or p15INK4b and switching Danka Supaze 3 expression (Figure 7B). This finding reinforces that HER2 is required for the mechanism of TNF-α and IFN-γ induced senescence and apoptosis in breast cancer cells .

Cytokine receptors are expressed at similar levels in breast cancer cells HER-2 high expressing cell lines SK-BR-3 and BT-474, moderate MCF-7 and T-47D, and low HER2 normal A HER-2 low expressing MDA-MB-231 breast cancer cell line, such as an immortalized MCF-10 breast cancer cell line, showed similar IFN-γ and TNF-α receptor expression by Western blot analysis (FIG. 12). . This result demonstrates that the expression level of these two cytokine receptors is independent of the HER2 expression level. This is consistent with reports explaining the effects of these cytokines in various phases in normal breasts. TNF-alpha is the growth of normal breast, it is involved in the development and branching morphogenesis (Lee et al., 2000, Endocrinology 141: 3,764 to 3,773 pages). Expression of the receptor TNFR1 mediates breast epithelial cell proliferation induced by TNF-α, and activation of TNFR2 induces casein accumulation (Varela et al., 1996, Endocrinology 137: 4915-4924). Similarly, the active form of IFN-γ interacts with its receptor expressed on the surface of almost all normal cells (Ealick et al., 1991, Science 252; 698-702; Frrar et al., 1993). Annu. Rev. Immunol. 11: 571-611).

The combination of HER2 and HER3 expression blockade in T h1 cytokine is a TNF-alpha and IFN-gamma HER2 high expressing and moderately expressing cell lines treated with the combination of cytokines that enhance senescence induction by the breast cancer cells Previous results showing senescence and an enhanced apoptotic phenotype led to the study of the effects of HER2 and HER3 knockdown by siRNA. The therapeutic effect of blocking HER2 / HER3 signaling in breast cancer has been demonstrated in several studies (Lee-Hoefrich et al., 2008, Cancer Res. 14: 5878-87; Berghoff et al., 2014, Breast 14: S0960-9776). The combined treatment of TNF-α and IFN-γ in HER3-deficient cells did not increase the number of senescent or apoptotic cells, but double knockdown by HER2 and HER3 siRNAs was not affected by SA-β- in SK-BR-3 cells. Gal staining (FIG. 8A) and p15INK4b expression and active caspase 3 expression levels (FIG. 8B) were strongly increased. At the same time, a high level of apoptosis in cells treated with double knockdown and cytokines was observed by Western blot of active caspase 3 (FIG. 8A). Similar results were observed in MCF-7 cells (FIG. 13), BT474 and T47D cells.

Combination of HER2 inhibition and HER2-HER3 dimerization inhibition enhances senescence induction and apoptosis of Th1 cytokines TNF-α and IFN-γ in SK-BR-3 breast cancer cells Trastuzumab and pertuzumab are HER2-positive breast cancer An antibody that has been widely used in clinics to treat . To study Th1 cytokine-induced senescence and apoptosis in a translational approach, experiments were designed to pretreat SK-BR-3 cells with trastuzumab and pertuzumab, and then cells were treated with TNF-α and IFN-γ. For 5 days at 37 ° C., followed by two additional subcultures in the absence of cytokines and antibodies. Compared to cells treated with only cytokines, the amount of blue cells measured by SA-β-gal staining was greatly increased in cells that had undergone complete treatment (FIG. 9A), and p15INK4b measured by Western blot Increased expression was observed (FIG. 9B). Interestingly, this double treatment was directed against the induction of apoptosis by both increasing the active caspase 3 expression by Western blot (FIG. 9B) and increasing the amount of Annexin v and propidium iodide positive cells by flow cytometric analysis. Even had a significant effect (FIG. 9C).

Senescence and apoptosis of HER2-overexpressing human breast cancer cells via CD4 ⁺ Th1 To confirm that cytokines produced by immune system cells in vivo could also induce specific senescence and apoptosis in tumor cells Designed and co-cultured CD4 ⁺ T cells and SK-BR-3 breast cancer cells stimulated with HER2 class II peptides using a transwell culture system. The cells were co-cultured at 37 ° C. for 5 days and then subcultured two more times in complete medium without immune system cells. This co-culture showed SK-BR-3 cells as evidenced by an increased amount of SA-β-gal staining (FIG. 10A) and increased expression of p15INK4b and cleaved caspase 3 detected by Western blot (FIG. 10B). Caused aging and apoptosis. CD4 ⁺ T cells stimulated with either immature dendritic cells (DC) or mature DC plus unrelated class II (BRAF or survivin) peptides can induce senescence and apoptosis of SK-BR-3 cells. It was not possible (FIG. 10).

Observed aging and apoptosis, SK-BR-3 cells in the presence of trastuzumab and pertuzumab in transwell, when co-cultured with CD4 ⁺ T cells stimulated with HER2 Class II peptide, was significantly enhanced. This result was clearly demonstrated by SA-β-gal staining (FIG. 10A) and increased expression levels of p15INK4b and cleaved caspase 3 (FIG. 10B).

Another approach, SK-BR-3 cells, CD4 + T cells - cultured with supernatants from the co-culture of mature DC, was observed similar specific aging response. Th1 secreted cytokines IFN-γ and TNG-α obtained from CD4 + T cell-mature DC co-culture supernatants were previously confirmed using ELISA. Both experimental approaches were able to partially rescue SK-BR-3 senescence and apoptosis by neutralizing antibodies that block IFN-γ and TNF-α (FIG. 14).

  In SK-BR-3 cells, this effect was dose-dependent because an increase in the number of immune system cells induced higher levels of SA-β-gal staining, p15INK4b and cleaved caspase 3 expression by both approaches. We also observed that.

The Th1 cytokines TNF-α and IFN-γ sensitize trastuzumab and pertuzumab-resistant breast cancer cells to senescence and apoptosis induction. It is believed that α and IFN-γ were able to restore sensitivity to trastuzumab and pertuzumab in breast cancer resistant cells. Treatment with trastuzumab and pertuzumab, as opposed to T-47D sensitive cells, resulted in two resistant cell lines, HCC-1419 (O'Brien et al., 2010, Mol Cancer Ther. 6: 1489-502) and JIMT- 1 (O'Brien et al., 2010, Mol Cancer Ther. 6: 1489-502; Tnner et al., 2004, Mol Cancer Ther. 12: 1585-92) cannot prevent activation of AKT. (FIG. 16).

Treatment with TNF-α and IFN-γ induced senescence and apoptosis in a dose-dependent manner in HCC-1419 and JIMT-1 cells. When cells were treated with trastuzumab and pertuzumab, no senescence and apoptosis were observed even at high doses (FIG. 11) (data not shown). However, dual treatment with cytokines and antibodies induced senescence by SA-β-gal assay in HCC-1419 and JIMT-1 cells (FIGS. 11A, 11C) and increased expression of p15INK4b (FIG. 11B, 11D). Furthermore, the combination of cytokine and antibody effectively induced cell death in HCC-1419 and JIMT-1 cells (FIGS. 11B, 11D). This result demonstrates that the Th1 cytokines TNF-α and IFN-γ were able to restore resistance to therapeutic agents, which broadly affect cancer patients.

DISCUSSION It has been demonstrated herein that TNF-α and IFN-γ induce senescence and apoptosis in breast cancer cells in a dose-dependent manner. It has also been shown that there is an inverse correlation between HER2 expression levels in breast cancer cells and the doses of TNF-α and IFN- required to induce senescence in those cells. Cytokine receptors are expressed at similar levels in all breast cell lines tested, suggesting that this is not responsible for the different responses. Furthermore, high doses of Th1 cytokines could induce senescence and apoptosis only when MDA-MB-231 cells (low HER2 levels) were stably transfected with wild type HER2 plasmid. Thus, HER2 signaling induces senescence and apoptosis in cells lacking HER2 or expressing HER2 at very low levels , even with high dose cytokines cannot induce senescence or apoptosis. Seems to be necessary. However, in cells that express HER2 at high or medium levels , knocking down the gene induces senescence and apoptosis by a phenomenon called oncogene poisoning. Furthermore, the combination of HER2 and HER3 siRNAs further enhanced TNF-α and IFN-induced senescence and apoptosis in breast cancer cells, indicating a step forward over HER3 due to the lack of HER2 signaling. Has been.

(Example 5)
Anti-estrogen therapy and anti-HER2 dendritic cell vaccination improve pathological complete response in ER- ^positive / HER2- ^positive DCIS The ability of dendritic cells ("DC") to present antigen is their use in anti-tumor vaccination Brought enthusiasm for. The group designed a HER2 peptide pulsed self DC vaccine that was uniquely designed to promote anti-HER2 Th1 sensitization and attraction . Filed March 13, 2015 U.S. Patent Application Serial No. 14 / 658,095, 2015 Dec. U.S. Patent Application Serial No. 14 / 985,303 filed on 30 days (in its entirety by reference these disclosures Are incorporated herein) , Datta, J. et al . Et al., OncoImmunology 4: 8 e1022301 (2015) DOI: 10. 1080 / 2216402X. 2015. 1022301 and Datta, J. Et al., Breast Cancer Res. 17 (1): 71 (2015) . Feasibility, safety, and preliminary clinical results after neoadjuvant use of anti-HER2 vaccine in patients with HER2- ^positive DCIS ( HER2- ^positive noninvasive ductal carcinoma ) have been reported. Complete tumor regression (pathological complete response (“pCR”)) was induced in 19% of patients. However, these results are concentrated in patients with hormone-independent (Er- ^negative ) DCIS, and patients with ER- ^positive DCIS are more likely to have anti-HER2 DC vaccine than patients with hormone-independent DCIS. Also suggested that the reaction was low (Sharma, A. Cancer 118 (17): 4354-62 (2012)). Extensive bi-directional crosstalk between HER2 and the ER signaling pathway results in enhanced cancer cell proliferation and survival (Arpino, G. et al., Endocrine Reviews 29 (2): 217-233 (2008) and Prat , A, Nat.Clin.Prac Oncol 5 (9 ):.. 531-542 (2008)). Targeting both of these two receptors in combination may prevent them from continuing to activate each other. The addition of an anti-HER2 DC vaccination treatment antiestrogens ( "AE") therapy is assumed to improve the response in ^{HER2-positive} / ^ER-positive DCIS patients. The studies reported herein include ER ^negative DCIS patients who received anti-HER2 DC vaccination (“ER ^negative ”), ER ^positive DCIS patients who received only anti-HER2 DC vaccination ( no ER ^positive AE ”), And a comparison of clinical and immune responses in ER ^positive DCIS patients ("ER ^positive , with AE") who received both anti-HER2 DC vaccine and concurrent anti-estrogen therapy .

The results presented herein, neoadjuvant antiestrogen therapy and anti-HER2 DC1 vaccination simultaneous, increase the proportion of the immune response and pathologic complete response in the local sentinel lymph node in ^{HER2-positive} / ^ER-positive DCIS Prove that. These results further support personalized and targeted combination therapy.

Summary of Method: was administered neoadjuvant anti-HER2 DC vaccine on 81 patients with ^{HER2-positive} DCIS. Clinical responses were measured on excised surgical specimens. Immune response-anti-HER2 CD4 + Th1 response-was measured in peripheral blood before and after vaccination and in sentinel lymph nodes after vaccination. ER ^negative patients receiving only anti-HER2 vaccination, among ^ER-positive patients undergoing ER ^positive patients receiving anti-HER2 vaccination alone, and anti-HER2 vaccination and anti-estrogen therapy simultaneously, clinical and immunological Responses were compared.

  The method implemented is detailed below.

Preclinical experiments breast cancer cell line SKBR3 (HER2 ^positive 3 + / ^ER-negative) and MCF7 and ^{(HER2-negative} 2 + / ^{ER-positive),} Th1 cytokines (IFN gamma and TNF [alpha]), tamoxifen metabolite (4-hydroxy tamoxifen, "4HT"), Or both were treated for 72 hours. Metabolic activity was measured via the Alamar Blue assay.

Study Design After obtaining approval from the institutional review board at the University of Pennsylvania, two neoadjuvant clinical trials of the HER2 peptide pulsed DC1 vaccine (NCT001070211 and NCT02061332) were conducted. The main objective was to evaluate the feasibility, safety and efficacy of DC1 vaccination. The second objective was to assess clinical and immune responses. Preliminary results of these studies showed that the vaccine was safe, well tolerated and induced a decrease or eradication of HER-2 expression (Sharma, A. et al. Cancer 118 (17): 4354-62. (2012) (“Sharma et al .). Further review of preliminary results showed that vaccination was more effective in hormone-independent (ER- ^negative ) patients [20, 21] Preclinical data and clinical Based on the preliminary results of the study, an addendum was approved to treat subsequent ER ^positive patients with hormone-dependent (ER ^positive ) DCIS with concurrent AE therapy.

Patient selection
Female patients over the age of 18 who were found to have a HER2- ^positive DCIS and ECOG Performance Status Score of 0 or 1 on biopsy were eligible for the study. All tissue specimens were reviewed for eligibility by a single pathologist. HER-2 positivity was defined as> 5% of cells with HER-2 protein expression intensity of 2+ or 3+. Women of childbirth needed to be negative on serological pregnancy tests and had to use medically acceptable forms of contraceptives. Women with cardiac dysfunction, HIV, HepC, coagulopathy, or existing medical illness or taking medications that could interfere with the study were excluded from the study. Women who had undergone curative treatment or who had DCIS excluded by excision biopsy at the time of diagnosis were not eligible for this study. 81 women were enrolled in the trial and completed the vaccination treatment. All 81 patients underwent surgical resection, and the resected specimen and pathological examination. The immune response was measured in patients from the second study (NCT02061332) . 54 patients among 53 people showed CD4 + immune responses before and after vaccination was measured in peripheral blood and inoculated, 40 patients showed CD4 + immune response after vaccination was measured with the sentinel lymph node , 22 people HLA-A2 ^positive patients showed CD8 + immune responses before and after vaccination as measured in the peripheral blood.

Preparation and delivery procedures vaccine vaccination has been described in detail previously. For example, Sharma et al., Czerniecki, B. et al. J. et al. Et al., Cancer Res. 67 (4): 1842-52 (2007) (Czerniecki et al.), And Koski, G .; K. Et al. Immunother. 35 (1) 54-56 (2012). The vaccination procedure is shown in FIG. Briefly, monocytic dendritic cell precursors were obtained from patients by tandem leukapheresis / countercurrent centrifugal elution. Monocytes were cultured at 37 ° C. in serum-free medium (SFM) (Invitrogen, Carlsbad, Calif.) Containing granulocyte macrophage colony stimulating factor (GM-CSF) (Amgen, Newbury Park, Calif.) And IL-4. The next day, cells were pulsed with six HER2-derived major histocompatibility complex (MHC) class II binding peptides (American Peptide Corporation, Sunnyvale, Calif.):
Three extracellular domain (ECD) peptides (peptide 42-56: HLDMLRHLYQGCQVV (SEQ ID NO: 1); peptide 98-114: RLRIVRGTQLFEDNYAL (SEQ ID NO: 2); and peptide 328-345: TQRCEKCSKPCARVCYGL (SEQ ID NO: 3)), and
Three intracellular domain (ICD) peptides (peptides 776-790: GVGSPYVSRRLGLICL (SEQ ID NO: 4); peptide 927-941: PAREIPDLLEKGERL (SEQ ID NO: 5); and peptide 1166-1180: TLERPKTLSPGKNGV (SEQ ID NO: 6)). After 8 to 12 hours, 1000U / mL of IFN-γ (Intermune, Brisbane, CA) was added, and the 6 hours prior to harvesting, (gift from Dr. Anthony Suffredini of the National Institutes of Health (NIH)) of clinical grade LPS ) Was added to complete rapid maturation into type I dendritic cells (DC1). For HLA-A2 ^positive patients, the monocyte pool was pulsed with MHC class I binding peptides 369-377 and 689-697.

Four to six injections of weekly 1-2 million HER-2 peptide pulse DC1 were administered to the breast, groin lymph node, or both breast and groin lymph nodes.

After a week of vaccination, at least 1 to 2 hours, and monitored the patient for adverse effects. All adverse events were classified according to the National Cancer Institute Common Toxicity Criteria (NCI-CTC version 3.0), evaluated at least weekly during vaccination and monitored until they disappeared .

Clinical monitoring Pathological responses were examined at the time of surgical resection ( mastectomy ( n = 48) or mastectomy (n = 33) ) . Pathologic complete response for immunization was defined as the absence residual DCIS nor invasive breast cancer at the time of surgical resection. Patients were monitored after surgical resection for the occurrence of subsequent breast events. Subsequent breast events were defined as lesions identified in the ipsilateral or contralateral breast (DCIS or invasive breast cancer).

Anti-estrogen therapy ER positive patients were treated with anti-estrogen therapy at the same time as anti-HER2 DC1 vaccination 4-6 times a week. Physician researchers have determined which of the following anti-estrogen therapies is most appropriate for each patient: tamoxifen (4-hydroxy tamoxifen (“4HT”) (NOLVADEX ™); letrozole (FEMARA ™) ); Anastrozole (ARMIDE ™); exemestane (AROMASIN ™); raloxifene (EVISTA ™); or other suitable anti-estrogenic agent that blocks or modifies the action of estrogen .

Immunomonitoring CD4 + T cells Systemic anti-HER2 CD4 + T cell responses were generated from autologous peripheral blood mononuclear cells (PBMC) pulsed with six HER2-derived major histocompatibility complex (MHC) class II binding peptide peptides. Local anti-HER2 CD4 + T cell responses were measured in sentinel lymph nodes (SLN) of 40 patients who underwent SLN biopsy. IFN- γ production was quantified via an enzyme-linked immunosorbent spot (ELISPOT) assay as previously detailed . (Fracol, M. et al., Ann . Surg . Oncol . 20 (10): 3233-9 (2013)) Briefly, PVDF membrane plates (Mabtech, Cincinnati, OH) were treated with anti-IFN- γ supplementary antibodies (1D1K). And coated overnight. The next day, the plate was washed with PBS (Mediatech, Manassas, VA) and blocked with 10% human serum / DMEM, then 2 × 10 ⁵ PBMCs on SLN cells were unstimulated; HER2-derived class II peptide (42 -56,98-114,328-345,776-790,927-941,116-1180) (4 μg); anti-human CD3 and CD28 antibody (0.5 μg / mL) (positive control, BD Pharmingen, San diego, pulse CA); were seeded in each well with either, then incubated at _{37 ℃ + 5% CO 2 24} ~ 36 hours. After the plate was washed with PBS, 100 μL of detection antibody (1 mg / mL; 7 B6-1-biotin) was added to each well and the plate was incubated for 2 hours. After the plate was washed again with PBS, 100 μL of 1: 1000 diluted streptavidin-HRP was added to each well and the plate was incubated for an additional hour. TMB substrate solution was added to reveal spot formation. Spot-forming cells (SFC) were counted using an automated reader (ImmunoSpot CTL).

Positive response to individual HER2 class II peptide was defined as at least a 2-fold increase for at least 20 SFC / 2 × 10 ⁵ cells and unstimulated background after background subtraction of the unstimulated . The following three measures were used to quantify the CD4 + Th1 response : (1) overall response rate (percentage of patients responding to one or more 1 peptide), (2) response repertoire (patient responds) Number of peptides), and (3) Cumulative response (SFC sum across all 6 peptides).

The CD8 + T cell systemic anti-HER2 CD8 + T cell responses, 22 people of ^{HLA-A2-positive} (HLA.2.1) was measured in patients. The anti-HER2 CD8 + T cell response was generated by an in vitro sensitization assay as previously described in detail by Czerniecki et al. Briefly, the CD8 + T cells were selected by negative selection from 120-140 amino lymphocyte cell fraction cryopreserved (StemCell Technologies, Vancouver, BC). Autologous dendritic cells were suspended in serum-free medium (SFM) (Invitrogen, Carlsbad, CA) containing GM-CSF (10 ng / ml), pulsed with class I HER2 peptide (10 ug / ml) (369-377), It was then co-cultured with CD8 + T cells at a ratio of 10: 1. On the second day, IL-2 (30 IU / ml) was added. On day 10, T cells were harvested and tested against T2 target cells pulsed with either class I HER2 peptides or irrelevant controls (p53 and colon cancer peptides). After 24 hours, supernatants were collected and analyzed by enzyme linked immunosorbent assay (ELISA). Positive response to HER2 class I peptides, as compared to irrelevant peptide control was defined as 2-fold increase in CD8 + T cells IFN gamma production.

Statistical methods Demographic and clinical data were evaluated using descriptive statistics and univariate logistic regression. P values <0.05 were considered statistically significant. Kaplan Meier analysis was used to compare the onset of subsequent breast events. All analyzes were performed with STATA 12.0 / IC statistical software (STATA Corp, College Station, TX).

Results Summary of Results: pathologic complete response rate of ^ER-positive DCIS patients E underwent ^R-negative DCIS patients and estrogen treatment was 31.4% versus 28.6% (p = 1.00). Both pathologic complete response rate of the anti-estrogen therapy do not receive ^ER-positive DCIS patients to be seen pathologic complete response rate (4.0%, p = 0.035) was significantly higher than that. The anti-HER2 Th1 immune response measured in peripheral blood was significantly increased after vaccination, but was similar in all three groups. However, the sentinel lymph node, the anti-HER2 Th1 immune response, as compared to ^ER-positive DCIS patients treated with only anti-HER2 vaccination, ^ER-positive treated for a combination of anti-HER2 vaccination and anti-estrogen therapy Significantly higher in DCIS patients.

  The results are detailed below

Preclinical experiments The SKBR3 breast cancer cell line (ER ^negative ) increased anti-tumor activity in response to Th1 cytokine treatment but did not respond to anti-estrogen treatment. Furthermore, adding anti-estrogen treatment to Th1 cytokine treatment did not affect metabolic activity, as shown in FIG. 17A.

Conversely, the MCF7 breast cancer cell line (ER ^positive ) did not increase anti-tumor activity in response to either Th1 cytokine treatment or anti-estrogen treatment. However, the combination of Th1 cytokine treatment and anti-estrogen treatment resulted in increased metabolic activity, as shown in FIG. 17B.

Test: is the median age of the 81 patients who participated in the selection and population statistics clinical trials of patients 55 years of age (interquartile range (IQR) 47 ~ 60 years of age), BMI median 25.9 (IQR a 22.4 to 31.0), the majority of patients postmenopausal (n = 68; was 84.0%) and white (n = 65,80.2%). All subject patients were diagnosed with DCIS at the time of biopsy. However, a small number of patients (n = 16,19.8%), to have an early invasive breast cancer (stage I) was found during the final surgical resection. All patients of interest were diagnosed with 2+ (n = 28, 34.6%) or 3+ (n = 53, 65.4%) HER2- ^positive DCIS. Vaccination was administered to 47 patients' inguinal lymph nodes (58%), 18 patients (22.2%) breasts, 16 patients (20%) to both inguinal lymph nodes and breasts. . Surgical resection was completed by mastectomy ( 48 patients (59.3%) ) and mastectomy (33 patients (40.7%)) . Of the patients who underwent mammary massectomy , 37.5% received postoperative radiation therapy.

The vaccine showed only well tolerated adverse events grade 1-2. The most commonly reported vaccination adverse events were fatigue (n = 41,50.6%), injection site reaction (n = 34, 42.0%), chills / warriors (n = 26, 32. 1%). None of the patients were unable to complete the trial due to side effects.

FIG. 18 shows that in all cohorts, 35 patients (43.2%) were ER ^negative and 46 patients (56.8%) were ER ^positive . Of the ER ^positive patients, 25 (54.3%) received only the DC1 vaccine and 21 patients (45.7%) received the DC1 vaccine and AE combination therapy. The demographic and clinical characteristics of these treatment groups are summarized in Table 1 below and showed no significant differences between the groups.

Clinical response rate to HER2 vaccination Clinical response was obtained in all 81 patients. Overall, 18 of the patients immunized 81 patients (22.2%) of the turned out this disease in resected surgical specimen does not remain. These patients were considered to have a complete pathological response (pCR). As shown in FIG. 19, pathologic complete response of ^ER-negative group was higher than the ^ER-positive group. More specifically, the pCR in the ER ^negative group (n = 11, 31.4%) and the ER ^positive group (n = 6, 28.6%) treated with AE were similar (p = 1. 00). However, the pathological complete response rate of the ER ^positive group not receiving AE treatment (n = 1, 4.0%) is ER ^negative group (p = 0.01) and ER ^positive group receiving AE treatment (p. 0.01). p = 0.01) (FIG. 19).

Pathologic complete response is correlated with the risk of low recurrence. For example, Tanioka, M .; , Et al., Br. J. et al. Cancer 103 (30; 297-302 (2010)) Subsequent breast lesions (defined as DCIS or invasive breast cancer identified in one breast ) occurred in 6 vaccinated patients (7.4%) All patients who experienced subsequent breast events had residual disease identified at surgical resection (<pCR (FIG. 20A)). Two of the patients had ER ^negative DCIS. Although four out of patients had ^ER-positive DCIS, it is a .ER ^positive DCIS did not receive the AE therapy, and patients who received the AE treatment did not experience a subsequent breast events (Fig. 20B). ER ^positive patients enrolled in the second half of the test, because it was treated with vaccination and AE therapy simultaneous, median follow-up period of these patients was shorter. of course Monitoring of these patients will continue.

As shown in Table 1, the mammary mass removal rates were similar in all three groups. However, the radiotherapy rate after the removal of the mammary tumor was higher in the ER ^positive DCIS patient group (18 %) receiving AE therapy than in the ER ^positive DCIS patient group (53.8%, p = 0.06) not receiving AE treatment. .75%). Patients with ER ^positive DCIS who have received AE therapy have a lower rate of subsequent breast events, despite lower radiation rates.

Immune response rate to HER2 vaccination CD4 + Th1 response: systemic-peripheral blood Pre-vaccination and post-vaccination immune responses were measured in 53 patients. Overall , responsiveness increased significantly from 36.25% before vaccination to 56.25% after vaccination (p = <0.001). The median response repertoire also increased significantly from pre-vaccination 1 (IQR 0-2) to 2.9 (IQR 2-4) after vaccination (p = <0.001). Finally, the median cumulative response significantly increased from 56.1 (IQR 23.3-111.7) before vaccination to 133.1 (IQR 75.6-240.3 ) after vaccination (p = 0.002) .

Response rate: Response rate increased significantly in each group after vaccination (ER ^negative 58.3% to 87.5%, p <0.01; ER ^positive without AE treatment 50.0% to 75.0) %, P <0.01; ER ^{positive with} AE treatment 57.1% to 90.5%, p <0.01). Response rate before vaccination were similar in all three groups ^(ER-negative 58.3%, ^ER-positive 50.0% without AE treatment, 57.1% ^ER-positive there AE treatment, p = 0 9) . Response rate after vaccination was also similar in all three groups ^(ER-negative 87.5%, ^ER-positive 75.0% without AE treatment, 90.5% ^ER-positive there AE treatment, p = 0 .5, FIG. 21A ).

Response repertoire: After vaccination, the response repertoire increased in each group (ER ^negative) 1 to 3, p = 0.05; ER ^positive without AE treatment 0 to 1.5, p = 0.1; ER ^{positive with} AE treatment 1 to 3, p = 0.01). The median response repertoire before vaccination was similar in all three groups (ER ^negative 1 (IQR 0-2), ER ^positive 0 without AE treatment (IQR 0-1.5), with AE treatment ER ^positive 1 (IQR 0-2); p = 0.5). Median response repertoire after vaccination was similar in all three groups (ER ^negative 3 (IQR 2-4.5), ER ^positive 1.5 without AE treatment (IQR 0.5-3.5) ER ^positive 3 with AE treatment (IQR 2-5); p = 0.4 FIG. 21B).

Cumulative response: After vaccination, the cumulative response increased in each group (ER ^negative 56.3 to 149.7, p <0.01; ER ^positive 41.1 to 178.7 without AE treatment, p <0. 01; AE treatment there of ^ER-positive 58.6 from 100.9, p <0.01). The median cumulative response before vaccination was similar in all three groups (ER ^negative 56.3 (IQR 26.1-116.2), ER ^positive 41.1 without AE treatment (IQR 9.6-6). 168.6), ER ^positive 58.6 with AE treatment (IQR 24.2-87.9), p = 0.886). The median cumulative response after vaccination was similar in all 3 groups (ER ^negative 149.7 (IQR 97.7-246.7), ER ^positive 178.7 without IQ treatment (IQR 64.7- 278.3), ER ^positive with AE treatment 100.9 (IQR 67.5-174.4), p = 0.5 FIG. 21C).

CD4 + Th1 response: local-sentinel lymph node The immune response after vaccination was measured in 40 patients. Overall, the responsiveness was 80%, the median response repertoire was 2 (IQR1-5), and the median cumulative response was 76.5 (IQR23-197).

Response rate: in patients with ^{HER2-positive} / ^ER-positive DCIS who received AE therapy, compared with ^{HER2-positive} / ^ER-positive DCIS patients not receiving AER treatment, response rates were significantly higher (92.3% vs. 43%, p = 0.03, FIG. 22A).

Response repertoire: HER2- ^positive / ER- ^positive DCIS patients treated with AE also had a significantly higher median response repertoire compared to HER2- ^positive / ER- ^positive DCIS without AE treatment (4 (IQR 2-6 ) Vs. 0 (IQR 0-5); p = 0.05, FIG. 22B).

Cumulative response: HER2- ^positive / ER- ^positive DCIS patients treated with AE also had a significantly higher median cumulative response compared to HER2- ^positive / ER- ^positive DCIS patients not treated with AE (102 (IQR 69- 354) Pair 23 (IQR 1-100); p = 0.05, FIG. 22C) .

CD8 + response: systemic-peripheral blood Pre-vaccination and post-vaccination CD8 + immune responses were measured in 22 HLA-A2 + patients. Overall , reactivity increased significantly from 13.3% before vaccination to 72.7% (p = <0.0002) after vaccination.

Response rate: After vaccination, response rate increased significantly in each group (ER ^negative   12.5% to 75%, p <0.04; ER without AE treatment ^Positive   0% to 100%, p <0.03; ER with AE treatment ^Positive   20% to 60%, p <0.17). Response rates before vaccination were similar in all three groups (ER ^negative   12.5%, ER without AE treatment ^Positive   0%, ER with AE treatment ^Positive   20%, p =). Response rates after vaccination were similar in all three groups (ER ^negative   75%, ER without AE treatment ^Positive   100%, ER with AE treatment ^Positive   60%, p = FIG. 23).

Conclusion: The studies described herein clearly show that anti-HER2 DC1 vaccine is clinically effective in ER ^negative / HER ^positive DCIS patients. Anti-HER2 DC1 vaccines have also been shown to be safe when combined with anti-estrogen therapy. Neoadjuvant antiestrogen therapy and anti-HER2 DC1 vaccination simultaneous, increasing the proportion of pathologic complete response in the immune response and ^{HER2-positive} / ^ER-positive DCIS patients in the local sentinel lymph node showed. Combination therapy with antiestrogens can also reduce subsequent breast events . These results may provide a separate approach in DCIS therapy. These results further support the combination of individualized, targeting of anti-HER2 DC1 vaccine anti-estrogen therapy. Those skilled in the art can appreciate that it is possible combination of anti-HER2 therapy other antiproliferative agents such as trastuzumab and pertuzumab. These approaches can limit the need for extensive surgery, eliminate radiation therapy, and reduce long-term hormonal therapy.

(Example 6)
A novel dendritic cell vaccine targeting mutant BRAF overcomes bemelafenib resistance and synergistically improves survival in BRAF mutant mouse melanoma The BRAF inhibitor Vemurafenib (PLX) is a BRAF mutant (BRAF ^V600E ) black Improves tumor survival, but resistance is common. The BRAF ^V600E pulsed type 1 polar dendritic cell vaccine (BRAF ^V600E- DC1) induces antigen-specific CD8 + T cells that affect mouse BRAF ^V600E melanoma. We investigated whether the combination of BRAF ^V600E- DC1 and PLX elicited a synergistic clinical response.

Methods An implantable BRAF ^V600E PTEN ^{− / −} melanoma model was developed in the C57B1 / 6 background. DC1 was generated from bone marrow precursors using Flt3, IL-6, GM-CSF, IL-4, CpG and LPS and pulsed with class I BRAF ^V600E peptide. In addition to untreated and ovalbumin -DC1 ^{control, BRAF} V600E -DC1 (1 injections twice a week) and also alone PLX was administered to tumor bearing mice with a combination that has been specified (each n = 10) Tumor growth and survival were measured . Induction of BRAF ^V600E- specific CD8 + T cell response from splenocytes was assessed by IFN-γ ELISA. Quantification of cytokine mRNA in the tumor microenvironment (TME) was performed by RT-qPCR.

Results Figure 24 ^(after induction of ^BRAFV V600E induction -DC1 and or simultaneously ^{BRAFV V600E -DC1) BRAFV V600E -DC1 +} PLX combinations in mice administered dramatically tumor growth is delayed (P <0.001) ), BRAFV ^V600E- DC1 (42 days), PLX (43.5 days), ovalbumin-DC1 (28 days) or median survival improved compared to untreated (24 days) cohorts (86, respectively). Day and 73.5 days) (P <0.001) . 35% became disease-free after BRAFV ^V600E- DC1 + PLX therapy and maintained immunity against BRAF ^V600E tumor re-exposure. BRAFV ^V600E -DC1 + PLX, as compared to an individual treatment, as measured by IFN-gamma release in vitro, ^{BRAF V600E} pulse antigen presenting cells and ^{BRAF V600E} tumors fine synergistically improved systemic CD8 + T cell recognition of cells Was induced (p <0.001) . In ^TME, BRAF V600E -DC1 + PLX, while attenuates the PD-L1 expression, Th1 (IFN-γ / TNF -α) and T cell homing (CXCL9 / CCL5) generated greater mRNA levels of cytokines. CD8 + TIL of trafficking has been strengthened by the ^BRAF V600E -DC1 + PLX.

In conclusion, the BRAFV600E-DC1 vaccine overcomes vemurafenib resistance in BRAF ^V600E melanoma and synergistically improves immune and clinical response. Such combinations will be used by those skilled in the art.

  Each patent, patent application, and publication cited herein is hereby incorporated by reference in its entirety. While the invention has been disclosed in terms of particular embodiments, it is obvious that other embodiments and variations of the invention can be devised by other persons skilled in the art without departing from the true spirit and scope of the invention. is there. It is intended that the appended claims be construed to include all such embodiments and equivalent variations.

Claims (65)

A method of generating a multiple dose antigen pulsed dendritic cell vaccine for injection comprising:
Contacting at least one antigen with a dendritic cell (DC);
Activating said DC with at least one TLR agonist;
Cryopreserving the DC in a plurality of doses including an initial immunization dose and a plurality of booster doses, and when the DC is thawed, the DC produces an effective amount of at least one cytokine, and T A method of generating a cellular response.   The method of claim 1, further comprising thawing the DC, wherein the DC produces an effective amount of at least one cytokine to generate a T cell response.   The method of claim 1, wherein the antigen is a tumor antigen.   The method of claim 1, wherein the antigen is a viral antigen.   The method of claim 1, wherein the TLR agonist is LPS.   The method of claim 1, comprising activating the DC with IFN-γ.   The cryopreservation comprises freezing the DC in a freezing medium comprising about 55% plasma light, about 40% human serum albumin and about 5% DMSO. Method.   The method of claim 7, wherein the cryopreserving comprises freezing the DC at a temperature of about −70 ° C. or less.   The method of claim 1, wherein the DC recovery and viability after thawing is about 70% or greater.   The method of claim 1, wherein the DC recovery and viability after thawing is about 80% or more.   The method of claim 1, wherein the DC is stored frozen for at least about 1 week.   The method of claim 1, wherein the cytokine is IL-12.   The method of claim 1, wherein the DC exhibits killer function, thereby allowing the DC to lyse target cells. A cryopreserved injectable multiple dose antigen pulse dendritic cell vaccine for inducing an immune response in a mammal, wherein the injectable multiple dose antigen pulse dendritic cell vaccine comprises:
Comprising DC loaded with at least one antigen;
The DC is activated by exposure to at least one TLR agonist;
An injectable multi-dose antigen pulsed dendritic cell vaccine, wherein the DC produces an effective amount of at least one cytokine to generate a T cell response.   15. The multi-injection antigen-pulse dendritic cell vaccine for injection according to claim 14, wherein the antigen is a tumor antigen.   The multi-dose antigen pulse dendritic cell vaccine for injection according to claim 14, wherein the antigen is a viral antigen.   15. The multi-dose antigen pulse dendritic cell vaccine for injection according to claim 14, wherein the TLR agonist is LPS.   15. The injectable multi-dose antigen pulsed dendritic cell vaccine of claim 14, wherein the DC is activated by exposure to IFN-γ.   15. The vaccine of claim 14, wherein the vaccine is cryopreserved at a temperature of about -70 ° C or lower in a freezing medium comprising about 55% plasma light, about 40% human serum albumin and about 5% DMSO. Multi-dose antigen pulsed dendritic cell vaccine for injection.   The multi-dose antigen pulse dendritic cell vaccine for injection according to claim 14, wherein the recovery rate and survival rate of DC after thawing is about 70% or more.   15. The multi-injection antigen-pulse dendritic cell vaccine for injection according to claim 14, wherein the recovery rate and survival rate of DC after thawing is about 80% or more.   15. The injectable multiple dose antigen pulsed dendritic cell vaccine of claim 14, wherein the composition is stored frozen for at least about 1 week.   15. The multi-injection antigen-pulse dendritic cell vaccine for injection according to claim 14, wherein the cytokine is IL-12.   15. A method of inducing an immune response in a mammal, comprising administering a dose of said cryopreserved multi-dose antigen pulsed dendritic cell vaccine of claim 14 to a mammal in need thereof. Including.   A method for treating a subject having or at risk of developing cancer, effective for treating a cancer or reducing the risk of developing cancer in a subject in need of such treatment Administering an amount of a dendritic cell vaccine and an inhibitor of HER-2.   26. The method of claim 25, further comprising administering a chemokine modulating agent to the subject.   27. The method of claim 26, wherein the chemokine modulating agent is a TLR agonist.   27. The method of claim 26, wherein the chemokine modulating agent is a TLR8 agonist.   26. The method of claim 25, further comprising administering an amount of a cancer medicament effective to treat the cancer or reduce the risk of developing the cancer.   30. The method of claim 29, wherein the cancer medicament is selected from the group consisting of surgery, anticancer agents, chemotherapeutic agents, immunotherapeutic agents and hormonal therapies.   26. The method of claim 25, wherein the cancer is selected from the group consisting of breast cancer, ovarian cancer, lung cancer, prostate cancer, colon cancer, melanoma, pancreatic cancer, gastrointestinal cancer, brain cancer and any combination thereof.   26. The method of claim 25, wherein the dendritic cell vaccine comprises activated dendritic cells in contact with at least one antigen and at least one TLR agonist.   26. The method of claim 25, wherein the dendritic cell vaccine comprises activated dendritic cells in contact with agents and activators that increase intracellular calcium levels in the dendritic cells.   34. The method of claim 33, wherein the agent increases intracellular calcium levels by blocking calcium transport from the cytoplasm.   35. The method of claim 34, wherein the agent comprises a calcium ionophore.   36. The method of claim 35, wherein the calcium ionophore is selected from the group consisting of A23187 and ionomycin.   26. The method of claim 25, wherein the dendritic cell vaccine is in the form of an injectable multiple dose antigen pulsed dendritic cell vaccine.   A method of improving immune cell migration and activity in a tumor site of interest, wherein the immune response in the tumor is altered so that the immune cells in the tumor site are more effective in tumor cell attack. Administering to the subject an effective amount of a dendritic cell vaccine and an inhibitor of HER-2.   40. The method of claim 38, further comprising administering a chemokine modulating agent to the subject.   40. The method of claim 39, wherein the chemokine modulating agent is a TLR agonist.   41. The method of claim 40, wherein the chemokine modulating agent is a TLR8 agonist.   40. The method of claim 38, further comprising administering to the subject an amount of a cancer medicament effective to treat the cancer or reduce the risk of developing the cancer.   43. The method of claim 42, wherein the cancer medicament is selected from the group consisting of surgery, anticancer agents, chemotherapeutic agents, immunotherapeutic agents, and hormonal therapies.   43. The method of claim 42, wherein the cancer is selected from the group consisting of breast cancer, ovarian cancer, lung cancer, prostate cancer, colon cancer, melanoma, pancreatic cancer, gastrointestinal cancer, brain cancer and any combination thereof.   40. The method of claim 38, wherein the dendritic cell vaccine comprises activated dendritic cells in contact with at least one antigen and at least one TLR agonist.   40. The method of claim 38, wherein the dendritic cell vaccine comprises activated dendritic cells in contact with agents and activators that increase intracellular calcium levels in the dendritic cells.   48. The method of claim 46, wherein the agent increases intracellular calcium levels by blocking calcium transport from the cytoplasm.   48. The method of claim 47, wherein the agent comprises a calcium ionophore.   49. The method of claim 48, wherein the calcium ionophore is selected from the group consisting of A23187 and ionomycin.   39. The method of claim 38, wherein the dendritic cell vaccine is in the form of an injectable multiple dose antigen pulsed dendritic cell vaccine.   40. The method of claim 38, wherein the dendritic cell vaccine and an inhibitor of HER-2 are administered at the tumor site.   40. The method of claim 39, wherein the dendritic cell vaccine, the inhibitor of HER-2 and the chemokine modulator are administered at the tumor site.   A method for treating a subject having or at risk of developing cancer, wherein said subject inhibits one or more of HER-2 and HER-3 and thereby HER-2-expressing breast cancer Inducing tumor aging in.   Inhibiting one or more of HER-2 and HER-3 includes administering an inhibitor to the subject, wherein the inhibitor is an inhibitor of both HER-2 and HER-3. 54. The method of claim 53, wherein the method is a combination of a HER-2 inhibitor and a HER-3 inhibitor.   The inhibitor is selected from the group consisting of small interfering RNA (siRNA), microRNA, antisense nucleic acid, ribozyme, expression vector encoding transdominant negative mutant, antibody, peptide, chemical compound and small molecule. 55. The method according to item 54.   54. The method of claim 53, further comprising administering a dendritic cell vaccine to the subject.   54. The method of claim 53, further comprising administering TNF- [alpha] and IFN- [gamma] to the subject.   57. The method of claim 56, further comprising administering TNF- [alpha] and IFN- [gamma] to the subject. Neoadjuvant treatment of a subject having estrogen receptor positive / HER2 positive ductal carcinoma (“ERpos / HER2pos DCIS”), comprising:
Administering at least one dose of an antigen-pulsed DC1 vaccine derived from the subject monocytic dendritic cell (DC) precursor pulsed with 6 HER2-derived MHC class II binding peptides, wherein the HER2-pulsed DC precursor is 1 A combination of cells that mature into dendritic cells (DC1s) and anti-estrogen therapy.   60. The treatment of claim 59, wherein the six HER2-derived MHC class II binding peptides comprise peptide 42-56: HLDMLRHLYQGCQVV (SEQ ID NO: 1). Peptide 98-114: RLRIVRGGTQLFEDNYAL (SEQ ID NO: 2). Peptide 328-345: TQRCEKCSKPCARVCYGL (SEQ ID NO: 3). Peptide 776-790: GVGSPYVSRLLGICL (SEQ ID NO: 4). Peptide 927-941: PAREIPDLLEKGER (SEQ ID NO: 5). And peptide 1166-1180: TLERPKTLSPGKNGV (SEQ ID NO: 6).   60. The treatment of claim 59, wherein the anti-estrogen treatment comprises administration of an anti-estrogen agent selected from the group consisting of tamoxifen, letrozole, anastrozole, exemestane, raloxifene, and any combination thereof.   60. If the patient is HLA-A2 positive, the patient's monocytic DC precursor is pulsed with an MHC class I binding peptide comprising peptide 369-377: KIFGSLAFL (SEQ ID NO: 7). Treatment. And peptide 689-697: RLLQETELV (SEQ ID NO: 8).   Systemic anti-HER2 CD4 + T cell responses are generated from the subject's peripheral blood mononuclear cells (PBMC) pulsed with the six HER2-derived MHC class II binding peptides before and after vaccination, which are then plated 60. The treatment of claim 59. Spot formation of spot forming cells (SFC) is revealed and processed to cause measured IFN-γ production.   Systemic anti-HER2 CD8 + T cell responses were generated from peripheral blood mononuclear cells (PBMC) of the subject pulsed with HER2-derived MHC class II binding peptides 367-377 before and after vaccination, spot forming cells (SFC) Were processed to reveal spot formation and subsequent IFN-γ production.   60. The treatment of claim 59, wherein the anti-HER2 CD4 + T cell local local immune response is measured in a sentinel lymph node of the subject after vaccination.