JP2018191561A - Multiplex gene introduction techniques - Google Patents

Abstract

To provide useful gene introduction methods that can insert plural or a number of foreign DNAs into a genomic DNA by one step gene transfer operation.SOLUTION: The invention provides a method for inserting a foreign DNA into two or more sites on a genomic DNA, the method comprising: contacting a genomic double-stranded DNA and a donor DNA and a nuclease in a host cell containing the genomic double-stranded DNA, where the genomic double-stranded DNA comprises discretely existing two or more copies of a nucleotide sequence of not less than 200 bp, the donor DNA comprises a nucleotide sequence homologous to the nucleotide sequence of not less than 200 bp or partial sequence thereof and a foreign DNA sequence, the nuclease specifically binds to a target nucleotide sequence selected from the nucleotide sequence of not less than 200 bp and cleaves the DNA within the target nucleotide sequence; causing homologous recombination between the nucleotide sequence of not less than 200 bp in the genomic double-stranded DNA and the nucleotide sequence homologous to the nucleotide sequence of not less than 200 bp or partial sequence thereof in the donor sequence, thereby inserting the foreign DNA sequence into the nucleotide sequence of not less than 200 bp existing in two copies or more in the genomic double-stranded DNA, where the homologous nucleotide sequence comprises the target nucleotide sequence, and has a sequence identity to the genomic DNA comprising the nucleotide sequence of not less than 200 bp and length sufficient enough to cause homologous recombination when the DNA is cleaved within the target nucleotide sequence.SELECTED DRAWING: None

Description

  The present invention relates to a method for inserting foreign DNA into a plurality of sites in genomic DNA.

  A group of genes (functional modules) that constitute various cell functions such as signal transduction pathway, metabolic pathway (eg, amino acid synthesis pathway, nucleic acid synthesis pathway, pentose phosphate pathway), gene replication mechanism, DNA damage repair mechanism, and nuclear function Is present. Introducing an excellent functional module of another organism into a host cell makes it possible to produce a chimeric organism having an excellent cell function. However, many genes are involved in functional modules, some of which exceed tens of genes. Even when such a large number of genes are introduced into a host cell as, for example, a plasmid, it is very difficult to maintain stably. Therefore, it is necessary to establish a gene modification technique for easily introducing a large number of genes into a chromosome.

  For example, a technique for producing lectilin from glucose in yeast was separately published in Nature Chemical Biology (Non-patent Document 1), and a method for synthesizing codeine from lectilin was separately published in ProsOne (Non-patent Document 2). If this can be done with a single yeast, it will be possible to synthesize codeine from glucose.

  In addition, it has been reported that a budding yeast strain that synthesizes heroin is created through many genetic engineering processes (Non-patent Document 3). If it can be introduced, such a strain can be easily prepared.

  There are many methods for gene transfer, but since the advent of genome editing technology using the CRISPR / Cas9 system, various applications have been developed due to its simplicity and accuracy.

  However, in the conventional gene transfer method using homologous recombination, the circular DNA (plasmid) that can be introduced into the host chromosome is basically one by one gene transfer operation, and other organism species in the host cell chromosome. It is costly and time consuming to introduce dozens of genes, etc. In addition, there is a low probability of introduction to a target position on a chromosome, and the number of selectable markers for gene introduction is limited. It was difficult because of the problem. In addition, the gene transfer method using a self-replicating plasmid does not require the insertion of a gene on a chromosome, so that a desired gene can be easily introduced, but only in a specific host species such as E. coli and budding yeast. It is necessary to continue to apply selective pressure using a marker gene so that it is applicable and the plasmid is not lost.

DeLoache, W. C. et al., Nature Chemical Biology (2015) 11, 7, 465-71 Fossati, E., et al., ProsOne (2015) 10, e0124459) Ehrenberg R, Nature 521, 267-268 (2015)

  An object of the present invention is to provide a useful gene transfer method capable of collectively inserting a large number of genes or a large number of copies of genes into genomic DNA.

  The present inventor has intensively studied to solve the above problems, and if a transposon having a common sequence necessary for homologous recombination that is scattered in a non-gene region on a chromosome is used as a gene insertion site, the survival of the host It was found that a large number of genes can be collectively inserted into the host chromosome while minimizing the effects on the host. Then, using genome editing technology, a technique of inserting a plurality of plasmids obtained by cloning genes of other species into transposon sites scattered on the host cell chromosome by genetic manipulation such as one-time transformation ( Clustered Regularly Interspaced Short Palindromic Repeat / Transposon gene integration (CRITGI) has been developed, and the present invention has been completed.

[1] A method for inserting foreign DNA into two or more sites on genomic DNA,
In a host cell having genomic double-stranded DNA containing a nucleotide sequence of 200 bp or more, interspersed with 2 copies or more,
A donor DNA comprising the genomic double-stranded DNA and a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more or a partial sequence thereof, and a foreign DNA sequence;
Contacting with a nuclease that specifically binds to a selected target nucleotide sequence in the nucleotide sequence of 200 bp or more and cleaves DNA within the target nucleotide sequence;
By causing homologous recombination between the nucleotide sequence of 200 bp or more on the genomic double-stranded DNA and the nucleotide sequence of 200 bp or more contained in the donor DNA or a nucleotide sequence homologous to a partial sequence thereof, Inserting a foreign DNA sequence into two or more copies of the 200 bp or more nucleotide sequence contained in the genomic double-stranded DNA;
The homologous nucleotide sequence includes the target nucleotide sequence, and when DNA is cleaved within the target nucleotide sequence, a degree sufficient to cause homologous recombination with respect to genomic DNA including the nucleotide sequence of 200 bp or more. Having a sequence identity and length of
[2] The method according to [1], wherein the nucleotide sequence of 200 bp or more is a transposon sequence.
[3] The method according to [1] or [2], wherein the nuclease preferentially cleaves a target sequence in a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more contained in the donor DNA or a partial sequence thereof.
[4] The method according to any one of [1] to [3], wherein the donor DNA is a cloned donor DNA.
[5] The method according to any one of [1] to [4], wherein the donor DNA is a mixture of two or more types of donor DNA each containing different foreign DNA sequences.
[6] The method according to any one of [1] to [5], wherein the foreign DNA sequence encodes a structural gene.
[7] The method according to any one of [1] to [6], wherein the donor DNA is circular double-stranded DNA.
[8] The nuclease comprises a nucleic acid sequence recognition module and a DNA cleavage domain, and the nucleic acid sequence recognition module is selected from the group consisting of a zinc finger motif, a TAL effector and a PPR motif. [1] to [7] The method in any one of.
[9] The method according to any one of [1] to [7], wherein the nuclease is a complex of guide RNA and Cas protein in the CRISPR-Cas system.
[10] The method according to [9], wherein the nuclease is a complex of guide RNA and Cas9 protein.
[11] The method according to any one of [2] to [10], wherein the transposon is a retrotransposon.
[12] The method according to [11], wherein the retrotransposon is a Ty1-copia group retrotransposon.
[13] The method according to any one of [1] to [12], wherein the host cell is a prokaryotic cell, yeast, vertebrate cell, insect cell or plant cell.
[14] The method according to [13], wherein the host cell is yeast.
[15] The method according to [14], wherein the yeast is a budding yeast.
[16] The method according to any one of [1] to [15], wherein the target nucleotide sequence comprises the sequence represented by SEQ ID NO: 3.
[17] A guide RNA for the CRISPR / Cas9 system, comprising the nucleotide sequence represented by SEQ ID NO: 5.

  In the conventional gene insertion method using homologous recombination, the number of exogenous DNA that can be introduced into a chromosome by one gene introduction operation is about one, but according to the method of the present invention, one gene introduction operation is performed. Dozens of exogenous DNA can be inserted into the chromosome at once. By the method of the present invention, a large number of genes constituting cell functions / metabolic pathways of various species can be inserted into the host cell chromosome, and the cell functions / metabolic pathways can be reconfigured in the host cells. In addition, by inserting a gene with a large number of copies into a chromosome, the expression level of the gene can be significantly increased. Furthermore, although the recombination method used in the method of the present invention is not particularly limited, genome editing techniques such as CRISPR can be used in various biological species from microorganisms to mammals. The method of the present invention can be carried out in many biological species by using a genome editing technique such as CRISP and a plasmid having a DNA fragment for insertion into a nucleotide sequence of 200 bp or more interspersed in the genome, such as transposon. can do.

FIG. 1 shows the structure of the budding yeast Ty1 retrotransposon and the base sequence of the guide RNA (gTy1) used. FIG. 2 is a diagram showing the position of the Ty1 sequence (Ty1 HR sequence) in the Ty1 retrotransposon. FIG. 3 is a schematic diagram of plasmid pTy1 and a graph showing the efficiency of integration of pTy1 into the chromosome. FIG. 4 is a diagram showing a base sequence analysis of a chromosome Ty1 site into which pTy1 has been introduced by CRISPR / Cas9. FIG. 5 shows that pTy1 is accurately introduced into Ty1 on the budding yeast chromosome in the presence of gTy1. FIG. 6 is a diagram showing an electrophoresis pattern of chromosomal DNA of a transformant. FIG. 7 is a graph showing the copy number of pTy1 introduced into a chromosome. FIG. 8 is a schematic diagram of homologous recombination in Ty1 in the chromosome that occurs when CRITGI is performed twice in succession, and a diagram showing the copy number of Ty1 in the chromosome and introduced pTy1. FIG. 9 is a diagram showing that a strain into which both LEU2 and URA + were introduced was established by introducing LEU2 in the first CRITGI and URA + in the second CRITGI. Two Ty1 newly generated by the first introduction of pTy1 (LEU2) are used as the introduction site of pTy1 (URA3) in the second CRITGI. FIG. 10 is a schematic diagram of a plasmid used in an experiment for introducing a plurality of genes constituting the E. coli lysine synthesis pathway. FIG. 11 is a schematic diagram showing the procedure of an experiment for collectively introducing seven types of genes constituting the E. coli lysine synthesis pathway. FIG. 12 is a table showing genes introduced into each established transformant strain. FIG. 13 is a graph showing the number of transformant strains in which the number of genes indicated on the horizontal axis has been introduced into the chromosome. FIG. 14 is a diagram comparing the DNA sequences of Ty1 sequences (Ty1 HR sequence) and 31 types of Ty1 retrotransposons.

  Hereinafter, the present invention will be described in detail.

The present invention is a method for inserting foreign DNA into two or more sites on genomic DNA,
In a host cell having genomic double-stranded DNA containing a nucleotide sequence of 200 bp or more, interspersed with 2 copies or more,
A donor DNA comprising the genomic double-stranded DNA and a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more or a partial sequence thereof, and a foreign DNA sequence;
Contacting with a nuclease that specifically binds to a selected target nucleotide sequence in the nucleotide sequence of 200 bp or more and cleaves DNA within the target nucleotide sequence;
By causing homologous recombination between the nucleotide sequence of 200 bp or more on the genomic double-stranded DNA and the nucleotide sequence of 200 bp or more contained in the donor DNA or a nucleotide sequence homologous to a partial sequence thereof, Inserting a foreign DNA sequence into two or more copies of the 200 bp or more nucleotide sequence contained in the genomic double-stranded DNA;
The homologous nucleotide sequence includes the target nucleotide sequence, and when DNA is cleaved within the target nucleotide sequence, a degree sufficient to cause homologous recombination with respect to genomic DNA including the nucleotide sequence of 200 bp or more. A method having the sequence identity and length of

  The copy number of the nucleotide sequence of 200 bp or more contained in the genomic double-stranded DNA contained in the host cell used in the method of the present invention is preferably 10 or more, more preferably 20 or more, and even more preferably 30. That's it.

  The length of the nucleotide sequence of 200 bp or more contained in the genomic double-stranded DNA contained in the host cell used in the method of the present invention can be, for example, 200 bp-100 kbp, preferably 200 bp-10 kb.

  The homologous sequence of the nucleotide sequence of 200 bp or more includes a selected target nucleotide sequence (described later) in the nucleotide sequence of 200 bp or more, and in the method of the present invention, DNA (donor DNA (eg, Sequence identity and length sufficient to cause homologous recombination with genomic DNA containing the nucleotide sequence of 200 bp or more when cleaved circular double-stranded DNA) and / or genomic double-stranded DNA) It is the arrangement | sequence which has thickness.

  The degree of identity of the homologous sequence to the nucleotide sequence of 200 bp or more is not particularly limited as long as homologous recombination is possible. The degree of identity that enables homologous recombination varies depending on the length of the polynucleotide, but for example at least about 80% or more, preferably at least about 85% or more, more preferably at least about 90% or more, most preferably It can be about 95-100%. The percent identity can be determined by a method known per se, for example, by using BLASTN available on the NCBI homepage with default settings. % Identity also uses the Smith-Waterman algorithm to affine gap search with a gap open penalty of 12 and a gap extension penalty of 1. ) May be determined.

  The length of the homologous sequence of the nucleotide sequence of 200 bp or more is not particularly limited as long as homologous recombination with genomic DNA occurs. However, in general, a longer homologous region is better for efficient homologous recombination with genomic DNA. On the other hand, the length of DNA that can be inserted is limited by the efficiency of introduction of donor DNA (eg, circular double-stranded DNA) into cells. Therefore, considering these, the length of the homologous sequence can be, for example, 0.15 kb-20 kb, preferably 0.18 kb-10 kb.

  In one embodiment, the homologous sequence includes a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more present in the genome or a partial sequence thereof.

  The homologous sequence is synthesized based on, for example, an oligo DNA primer so as to cover a region encoding a desired portion (a portion including a target nucleotide sequence described later) based on DNA sequence information of a nucleotide sequence of 200 bp or more. Cloning can be performed by amplification by PCR using the prepared genomic DNA as a template. As long as the degree of identity that enables homologous recombination is maintained, a nucleotide sequence of 200 bp or more cloned from a biological species other than the host cell can also be used.

  The nucleotide sequence of 200 bp or more is not particularly limited as long as it is a sequence interspersed in two or more copies in the genome, but it exists in a form inserted between genes, and even if the sequence is changed, cell survival is not affected. Is preferably a sequence that does not affect. Examples of the nucleotide sequence of 200 bp or more include transposon (narrowly defined DNA-type transposon), retrotransposon, retrovirus, pararetrovirus, retrointron, retrophage, and retroplasmid (retrotransposon, retrovirus, pararetrovirus, Retrointrons, retrophages, and retroplasmids may be collectively referred to as retroelements). Transposons (DNA transposons in the narrow sense) and retrotransposons are preferred.

  In the present specification, the nucleotide sequence of 200 bp or more will be described mainly by exemplifying a transposon sequence as a representative example, but the description is similarly applied to other nucleotide sequences of 200 bp or more other than the transposon sequence. Applicability can be easily understood by those skilled in the art.

  As used herein, “transposon” refers to a nucleotide or a sequence thereof that can transfer a position on a genome in a cell. Transposons are classified into DNA-type transposons (in a narrow sense) and RNA-type transposons (retrotransposons). A transposase (transferase) is encoded in the sequence of the DNA-type transposon. When expressed, this enzyme recognizes inverted repeats at both ends of the transposon sequence, cuts out the transposon sequence at the boundary, and inserts it at another position on the genome. On the other hand, a reverse transcriptase is encoded in the sequence of the RNA-type transposon. When this reverse transcriptase is transcribed and translated by an internal promoter, it synthesizes cDNA using its transcript as a template and inserts it at another position on the genome. A transposon exists in an evolutionary manner inserted between genes on a chromosome, and changes in its sequence do not affect cell survival. Generally, a plurality of transposon sequences are scattered on a chromosome in a non-gene region and have a common sequence necessary for homologous recombination. Therefore, the transposon sequence is suitable as an insertion site for foreign DNA on the genome in the method of the present invention. It is.

  In the present specification, the “transposon sequence” includes a plus-strand nucleotide sequence and a minus-strand nucleotide sequence of the transposon.

  In the method of the present invention, the transposon is preferably a retrotransposon. Examples of the retrotransposon include an LTR (long terminal repeat) type retrotransposon in which a long repeating sequence is formed at the terminal and other non-LTR type retrotransposons. Examples of the LTR type retrotransposon include the Ty1-copia group and the Ty3-gypsy group. Both are distinguished based on both sequence similarity and gene product code order. Non-LTR-type retrotransposons include those having “long interspersed nuclear elements” (“long interspersed nuclear element” LINE) and those having “short interspersed nuclear elements” (SINE) . The retrotransposon is preferably a Ty1-copia group of retrotransposons (eg, Ty1 retrotransposon in yeast and copia retrotransposon in Drosophila).

  In the method of the present invention, cells of a host organism containing 2 or more copies of the nucleotide sequence of 200 bp or more (eg, transposon sequence) in genomic double-stranded DNA are targeted. Since most organisms with genomic double-stranded DNA have more than one copy of the transposon sequence, the methods of the invention are applicable to cells of almost any host organism that has genomic double-stranded DNA. Examples of the host organism include prokaryotes such as Escherichia and Bacillus; eukaryotes such as yeast (budding yeast, fission yeast, etc.), insects, plants, vertebrates (fishes, birds, mammals), and the like. However, it is not limited to these.

  Examples of the genus Escherichia include, for example, Escherichia coli K12 / DH1 [Proc. Natl. Acad. Sci. USA, 60, 160 (1968)], Escherichia coli JM103 [Nucleic Acids Research, 9, 309 ( 1981)], Escherichia coli JA221 [Journal of Molecular Biology, 120, 517 (1978)], Escherichia coli HB101 [Journal of Molecular Biology, 41, 459 (1969)], Escherichia coli C600 [Genetics, 39, 440 (1954)] is used.

  Examples of Bacillus bacteria include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)] and the like.

Examples of the yeast include Saccharomyces cerevisiae AH22, AH22R ⁻ , NA87-11A, DKD-5D, 20B-12, BY-4742, Schizosaccharomyces pombe NCYC1913, NCYC2036, Pichia (Pichia pastoris) KM71 is used.

Insect cells include, for example, larvae-derived cell lines (Spodoptera frugiperda cells; Sf cells); Trichoplusia ni midgut-derived MG1 cells; Trichoplusia ni egg-derived High Five ^TM cells; Mamestra brassicae-derived cells Estigmena acrea-derived cells; cocoon-derived cell lines (Bombyx mori N cells; BmN cells); Drosophila-derived cells and the like are used.

  Vertebrate cells include, for example, monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, dhfr gene-deficient CHO cells, mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, Cell lines such as human FL cells, pluripotent stem cells such as human and other mammalian iPS cells and ES cells, and primary cultured cells prepared from various tissues are used. Furthermore, zebrafish embryos, Xenopus oocytes, and the like can also be used.

  Plant cells were prepared from various plants (for example, grains such as rice, wheat and corn, commercial crops such as tomato, cucumber and eggplant, garden plants such as carnation and eustoma, experimental plants such as tobacco and Arabidopsis thaliana). Suspension culture cells, callus, protoplasts, leaf sections, root sections and the like are used.

  The host organism is preferably yeast, more preferably budding yeast. There are about 30 copies of Ty1 retrotransposon in the budding yeast genomic double-stranded DNA, and its sequence is also highly conserved among the retrotransposons.

  The copy number of the transposon sequence contained in the genomic double-stranded DNA contained in the host cell used in the method of the present invention is preferably 10 or more, more preferably 20 or more, and even more preferably 30 or more.

  As donor DNA used in the method of the present invention, double-stranded DNA, single-stranded DNA (circular double-stranded DNA, linear double-stranded DNA, circular single-stranded DNA, linear single-stranded DNA) And circular double-stranded DNA including single-stranded DNA. When the donor DNA is single-stranded DNA, “bp” such as “nucleotide sequence of 200 bp or more” is read as “b”.

  The donor DNA will be described mainly using a circular double-stranded DNA as a representative example, but the description is applicable to other donor DNAs other than the circular double-stranded DNA as well. Can be easily understood by those skilled in the art.

  The circular double-stranded DNA used in the method of the present invention is preferably a circular double-stranded DNA plasmid. As circular double-stranded DNA plasmids, plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13); plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC194); yeast-derived plasmids (eg, YCplac33, pRS403, YIplac128); insect cell expression plasmids (eg pFast-Bac); animal cell expression plasmids (eg pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo), etc. .

  The circular double-stranded DNA is a nucleotide sequence homologous to a transposon sequence or a partial sequence thereof contained in two or more copies in the genome double-stranded DNA of a host cell (hereinafter sometimes referred to as “transposon homologous sequence”), and Contains foreign DNA sequences.

  The transposon homologous sequence includes a selected target nucleotide sequence (described later) in the transposon sequence, and DNA (donor DNA (eg, circular double-stranded DNA) and / or genome) in the target nucleotide sequence in the method of the present invention. When the double-stranded DNA) is cleaved, the sequence has sufficient sequence identity and length to cause homologous recombination with the genomic DNA containing the transposon sequence. In one aspect, the transposon homologous sequence is a region conserved among Ty1t retrotransposons interspersed on the budding yeast chromosome and about 840 between about 1680 bp and about 2520 bp within the Ty1 retrotransposon sequence. The nucleotide sequence of bp (SEQ ID NO: 1). The Ty1 sequence (840 bp) corresponds to the region between about 1680 bp and about 2520 bp in the Ty1 retrotransposon sequence (about 5930 bp) (FIG. 14).

  The degree of identity of the transposon homologous sequence to the transposon sequence is not particularly limited as long as homologous recombination is possible. The degree of identity that enables homologous recombination varies depending on the length of the polynucleotide, but for example at least about 80% or more, preferably at least about 85% or more, more preferably at least about 90% or more, most preferably It can be about 95-100%. The percent identity can be determined by a method known per se, for example, by using BLASTN available on the NCBI homepage with default settings. % Identity also uses the Smith-Waterman algorithm to affine gap search with a gap open penalty of 12 and a gap extension penalty of 1. ) May be determined.

  The length of the transposon homologous sequence is not particularly limited as long as homologous recombination with genomic DNA occurs. However, in general, a longer homologous region is better for efficient homologous recombination with genomic DNA. On the other hand, the length of DNA that can be inserted is limited by the efficiency of introduction of donor DNA (eg, circular double-stranded DNA) into cells. Therefore, considering these, the length of the transposon homologous sequence can be, for example, 0.5 kb-20 kb, preferably 0.75 kb-10 kb.

  In one embodiment, the transposon homologous sequence includes a nucleotide sequence homologous to a structural gene sequence within a transposon sequence present in the genome or a partial sequence thereof.

  A transposon homologous sequence is, for example, a genome prepared from a host cell by synthesizing an oligo DNA primer so as to cover a region encoding a desired portion (a portion containing a target nucleotide sequence described later) based on the DNA sequence information of the transposon. Cloning can be performed by using DNA as a template and amplifying by PCR. A transposon sequence cloned from a biological species other than the host cell can be used as long as the degree of identity that enables homologous recombination is maintained.

  The foreign DNA refers to a portion of DNA in the genome that the cell having the genome into which the foreign DNA has been inserted by the method of the present invention did not have before the foreign DNA was inserted. For example, in the method of the present invention, the sequence of the foreign DNA can include a transposon sequence present in the genome into which the foreign DNA is inserted or a partial sequence thereof, and this sequence is also inserted into the cell by the cell. This is a DNA sequence that had not previously been present. Therefore, in the present specification, the sequence is also treated as a foreign DNA sequence.

  The foreign DNA sequence preferably encodes a structural gene. That is, the foreign DNA sequence preferably encodes a polypeptide having a specific function. The type of the structural gene is not particularly limited. For example, genes encoding enzymes involved in various cellular functions such as synthesis pathways of useful metabolites, gene replication mechanisms, DNA damage repair mechanisms, signal transduction pathways, and nuclear functions Can be mentioned. Based on the cDNA sequence information, the structural gene synthesizes an oligo DNA primer so as to cover a region encoding the desired portion (preferably, the full length region of the gene, ORF region), and expresses the gene. Cloning can be performed by amplifying by RT-PCR using a total RNA or mRNA fraction prepared from cells as a template.

The structural gene is preferably operably linked to a promoter capable of exhibiting promoter activity in the host cell. That is, when the structural gene is inserted into the genomic DNA of a host cell by the method of the present invention, the structural gene is expressed under the control of the promoter. A person skilled in the art can select an appropriate promoter corresponding to the type of host cell.
For example, where the host cell is a bacterium of the genus Escherichia, trp promoter, lac promoter, recA promoters, .lambda.P _L promoters, lpp promoter, T7 promoter and the like are used, but are not limited to.
When the host cell is a bacterium belonging to the genus Bacillus, SPO1 promoter, SPO2 promoter, penP promoter and the like are used, but not limited thereto.
When the host cell is yeast, a Gal1 promoter, a Gal1 / 10 promoter, a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH promoter, and the like are used, but not limited thereto.
When the host cell is an insect cell, polyhedrin promoter, P10 promoter and the like are used, but not limited thereto.
When the host cell is a plant cell, CaMV35S promoter, CaMV19S promoter, NOS promoter, etc. are used, but not limited thereto.
When the host cell is a vertebrate cell, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex) Viral thymidine kinase) promoter and the like are used, but not limited thereto.

  The structural gene is preferably operably linked to an enhancer, a splicing signal, a terminator, a poly A addition signal or the like that can exhibit activity in the host cell. By having such a configuration, when the structural gene is inserted into the genomic DNA of the host cell by the method of the present invention, the structural gene is more stably transcribed and translated in the host cell.

  The donor DNA (eg, circular double-stranded DNA) can further contain a selection marker gene for selecting a transformant having foreign DNA inserted into the genome. Examples of selectable marker genes include, but are not limited to, genes that confer resistance to drugs such as tetracycline, ampicillin, and kanamycin, and genes that complement auxotrophic mutations. Examples of genes that complement auxotrophic mutations include LEU2, URA3, URA4, LYS2, MET15, HIS3, TRP1, and ADE2. A gene that complements an auxotrophic mutation is used in combination with a host cell having the corresponding auxotrophic mutation.

  In the method of the present invention, the genomic double-stranded DNA and the donor DNA (eg, circular double-stranded DNA) are combined with a selected target nucleotide sequence in a transposon sequence contained in two or more copies of the genomic double-stranded DNA. Contact with a nuclease that specifically binds and cleaves DNA within the target nucleotide sequence.

  The “nuclease” used in the present invention is a molecular complex having a DNA cleavage activity imparted with a specific nucleotide sequence recognition ability. The complex comprises a nucleic acid sequence recognition module having DNA cleavage activity, or comprises a nucleic acid sequence recognition module having no DNA cleavage activity and a DNA cleavage domain. Here, the “complex” includes not only a complex composed of a plurality of molecules, but also a complex having a nucleic acid sequence recognition module and a DNA cleavage domain in a single molecule, such as a fusion protein. In one embodiment, the nuclease of the present invention comprises or consists of a protein as a constituent factor. In another embodiment, the nuclease of the present invention contains a component (eg, nucleic acid) other than a protein.

  In the present invention, the “nucleic acid sequence recognition module” means a molecule or molecular complex having the ability to specifically recognize and bind to a specific nucleotide sequence (ie, target nucleotide sequence) on a DNA strand. Binding of the nucleic acid sequence recognition module to the target nucleotide sequence allows the module or the DNA cleavage domain linked to the module to specifically act on the targeted site of DNA. In one embodiment, the “nucleic acid sequence recognition module” itself has DNA cleavage activity. In other embodiments, the “nucleic acid sequence recognition module” does not itself have DNA cleavage activity.

  In the present invention, the “DNA cleavage domain” means a polypeptide that catalyzes a reaction that cleaves one or both strands of a double helix constituting DNA. Examples of the polypeptide include a restriction enzyme FokI polypeptide and the like.

  The target nucleotide sequence in DNA recognized by the nucleic acid sequence recognition module is not particularly limited as long as the module can specifically bind, and may be any sequence in DNA. The length of the target nucleotide sequence only needs to be sufficient for the nucleic acid sequence recognition module to specifically bind. For example, when a mutation is introduced into a specific site in yeast genomic DNA, the length depends on the genome size. , 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 17 nucleotides or more. The upper limit of the length is not particularly limited, but is preferably 25 nucleotides or less, more preferably 22 nucleotides or less.

  In one embodiment of the present invention, the nucleic acid sequence recognition module includes a CRISPR-Cas system. In this embodiment, since the nucleic acid sequence recognition module itself has DNA cleavage activity, it is not always necessary to form a complex of the nucleic acid sequence recognition module and the DNA cleavage domain for the method of the present invention.

The above CRISPR-Cas system recognizes the sequence of the target donor DNA (double-stranded DNA or single-stranded DNA) by the guide RNA having the target nucleotide sequence (but RNA sequence). Any sequence can be targeted simply by synthesizing an oligo-DNA that can be hybridized.
The CRISPR / Cas system recognizes single-stranded DNA as a substrate and has the activity of cleaving (Ma, E., Mol. Cell, (2015) 60 (3), 398-407). In one embodiment, the donor DNA can be double stranded DNA including single stranded DNA. In homologous recombination, the cut end of the donor DNA is trimmed to expose the single-stranded DNA, and the single strand binds to the homologous sequence site on the chromosome, so the donor DNA is integrated into the chromosome by homologous recombination more efficiently. There is a possibility.

  A nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of a Cas protein with an RNA molecule (guide RNA) composed of a target nucleotide sequence (however, an RNA sequence) and tracrRNA necessary for the recruitment of Cas protein. As another embodiment, a nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of crRNA containing RNA having the same sequence as the target nucleotide sequence, tracrRNA, and Cas.

  The Cas protein used in the present invention is not particularly limited as long as it belongs to the CRISPR system, but is preferably Cas9. Examples of Cas9 include, but are not limited to, Cas9 (SpCas9) derived from Streptococcus pyogenes, Cas9 (StCas9) derived from Streptococcus thermophilus, and the like. SpCas9 is preferable.

When CRISPR-Cas is used as a nucleic acid sequence recognition module, it is desirable to introduce the nucleic acid sequence recognition module into a host cell in the form of a nucleic acid (expression vector) encoding them. That is, an expression vector encoding guide RNA and Cas protein is introduced into a host cell, and the guide RNA and Cas protein are expressed to form a complex of guide RNA and Cas protein in the host cell. The guide RNA and Cas protein may be encoded on the same expression vector, or may be encoded on different expression vectors.
The DNA encoding Cas can be cloned from cells producing Cas by methods well known in the art.
The obtained Cas-encoding DNA can be inserted downstream of the promoter of the expression vector according to the host.
On the other hand, the DNA encoding the guide RNA is designed as an oligo DNA sequence in which a target nucleotide sequence (but RNA sequence) and a known tracrRNA sequence (for example, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; SEQ ID NO: 2) are used, and a DNA / RNA synthesizer is used. Can be chemically synthesized. A DNA encoding a guide RNA can also be inserted into an expression vector appropriate for the host. The guide RNA and Cas may be encoded on the same expression vector, or may be encoded on different expression vectors. Preferably, DNA encoding Cas and DNA encoding guide RNA and tracrRNA are inserted downstream of separate promoters in the same expression vector.

As the target nucleotide sequence in the present invention, a sequence immediately adjacent to the 5 ′ side of the PAM sequence (5′-NGG) in the transposon sequence contained in two or more copies in the host cell genome is selected.
When the budding yeast Saccharomyces cerevisiae is used as the host cell and Ty1 retrotransposon is used as the transposon, the target nucleotide sequence is, for example, the nucleotide sequence represented by SEQ ID NO: 3. In this case, the expression vector is designed so that a guide RNA in which a tracrRNA sequence (for example, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; SEQ ID NO: 2) is linked to the 3 ′ side of the nucleotide sequence represented by SEQ ID NO: 3 is expressed in the host cell. .

  The nucleotide sequence homologous to the transposon sequence or a partial sequence thereof in the donor DNA (eg, circular double-stranded DNA) used in the present invention includes the target nucleotide sequence.

The RNA encoding Cas can be prepared, for example, by transcribing to the mRNA using a known in vitro transcription system using the above-described DNA encoding Cas as a template.
The guide RNA can be chemically synthesized using a DNA / RNA synthesizer by designing an oligo RNA sequence in which a target nucleotide sequence (however, RNA sequence) is linked to a known tracrRNA sequence.

  In this specification, the nucleotide sequence is described as a DNA sequence unless otherwise specified. However, when the polynucleotide is RNA, thymine (T) is appropriately replaced with uracil (U).

  In another aspect of the present invention, the nucleic acid sequence recognition module includes a zinc finger motif, a TAL effector, a PPR motif, etc., as well as DNA of a protein that can specifically bind to DNA such as a restriction enzyme, transcription factor, RNA polymerase, etc. A fragment that contains a binding domain and does not have the ability to cleave DNA double strands can be used.

  The zinc finger motif is formed by connecting 3 to 6 different zinc finger units of different Cys2His2 type (one finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9 to 18 bases. Zinc finger motifs include Modular assembly method (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69) , And can be prepared by a known technique such as the E. coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701). Japanese Patent No. 4968498 can be referred to for details of the production of the zinc finger motif.

  The TAL effector has a repeating structure of modules of about 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVD) of one module. The Since each module is highly independent, it is possible to create a TAL effector specific to the target nucleotide sequence simply by connecting the modules. TAL effectors are produced using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), Golden Gate method (Nucleic Acids Res (2011) 39: e82) etc. have been established, and a TAL effector for a target nucleotide sequence can be designed relatively easily. The details of the production of the TAL effector can be referred to JP-T-2013-513389.

  The PPR motif consists of 35 amino acids, and is constructed to recognize a specific nucleotide sequence by a series of PPR motifs that recognize one nucleobase. The 1st, 4th, and ii (-2) th amino acids of each motif Only recognize the target base. Since there is no dependence on the motif structure and there is no interference from the motifs on both sides, it is possible to produce a PPR protein specific to the target nucleotide sequence by linking the PPR motifs just like the TAL effector. JP, 2013-128413, A can be referred to for details of preparation of a PPR motif.

  In addition, when using fragments such as restriction enzymes, transcription factors, RNA polymerase, etc., the DNA-binding domain of these proteins is well known, so it is easy to design a fragment that contains this domain and does not have the ability to cleave DNA double strands. And can be built.

  Any one of the nucleic acid sequence recognition modules can be provided as a fusion protein with the DNA cleavage domain, or a protein binding domain such as SH3 domain, PDZ domain, GK domain, GB domain, and their binding partners. The nucleic acid sequence recognition module and the DNA cleavage domain may be fused to each other and provided as a protein complex through the interaction between the protein binding domain and its binding partner. Alternatively, intein can be fused to the nucleic acid sequence recognition module and the DNA cleavage domain, respectively, and both can be linked by ligation after synthesis of each protein.

Contact of the nuclease with genomic double-stranded DNA and the donor DNA (eg, circular double-stranded DNA) encodes the nuclease together with the donor DNA (eg, circular double-stranded DNA) in the host cell. It can be carried out by introducing a nucleic acid.
Accordingly, the nucleic acid sequence recognition module, or the nucleic acid sequence recognition module and the DNA cleavage domain, can be used as a nucleic acid encoding the fusion protein or in a form that can be complexed in the host cell after being translated into the protein. It is preferable to prepare it as a nucleic acid encoding a constitutive factor. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably a double-stranded DNA, and is provided in the form of an expression vector capable of expressing each component under the control of a promoter functional in the host cell. In the case of RNA, it is preferably a single-stranded RNA.

A DNA encoding a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, and a PPR motif can be obtained by any of the methods described above for each module. For example, DNA encoding sequence recognition modules such as restriction enzymes, transcription factors, RNA polymerase, etc. covers the region encoding the desired part of the protein (part containing the DNA binding domain) based on the cDNA sequence information. Thus, oligo DNA primers can be synthesized and cloned by amplifying by RT-PCR using total RNA or mRNA fraction prepared from cells producing the protein as a template.
Similarly, for DNA encoding a DNA cleavage domain, an oligo DNA primer is synthesized based on the cDNA sequence information of the domain to be used, and the total RNA or mRNA fraction prepared from the cell producing the domain is used as a template. It can be cloned by amplification by RT-PCR. For example, DNA encoding FokI can be cloned from mRNA derived from Flavobacterium okeanokoites (IFO 12536) by RT-PCR by designing appropriate primers upstream and downstream of CDS based on the cDNA sequence.
The cloned DNA can be digested as is, or if desired, with restriction enzymes, or an appropriate linker and / or nuclear translocation signal (if the target double-stranded DNA is mitochondrial or chloroplast DNA, each organelle translocation signal ), And then ligated with DNA encoding the nucleic acid sequence recognition module to prepare DNA encoding the fusion protein. Alternatively, a DNA encoding a nucleic acid sequence recognition module and a DNA encoding a DNA cleavage domain are each fused with a DNA encoding a binding domain or a binding partner thereof, or both DNAs are fused with a DNA encoding a separate intein. Thus, a complex may be formed after the nucleic acid sequence recognition module and the DNA cleavage domain are translated in the host cell. In these cases, a linker and / or a nuclear translocation signal can be linked to an appropriate position of one or both of DNAs as desired.

  For DNA encoding nucleic acid sequence recognition modules and DNA encoding DNA cleavage domains, use the PCR method or Gibson Assembly method to chemically synthesize DNA strands or to synthesize partially overlapping oligo DNA short strands. Thus, it is possible to construct a DNA that encodes the full length of the DNA. The advantage of constructing full-length DNA by chemical synthesis or in combination with PCR or Gibson Assembly is that the codons used can be designed over the entire CDS according to the host into which the DNA is introduced. In the expression of heterologous DNA, an increase in protein expression level can be expected by converting the DNA sequence into a codon frequently used in the host organism. Data on the frequency of codon usage in the host to be used is, for example, the genetic code usage frequency database (http://www.kazusa.or.jp/codon/index.html) published on the Kazusa DNA Research Institute website. ) May be used, or references describing the frequency of codon usage in each host may be consulted. By referring to the obtained data and the DNA sequence to be introduced and converting the codon used in the DNA sequence that is not frequently used in the host into a codon that encodes the same amino acid and is frequently used Good.

  An expression vector containing DNA encoding a nucleic acid sequence recognition module and / or a DNA cleavage domain can be produced, for example, by ligating the DNA downstream of a promoter in an appropriate expression vector. When the CRISPR-Cas system is used as a nucleic acid sequence recognition module, an expression vector encoding a guide RNA and a Cas protein is introduced into the host cell, and the guide RNA and the Cas protein are expressed, whereby the guide RNA and the Cas protein are expressed in the host cell. Forms a complex with Cas protein. The guide RNA and Cas protein may be encoded on the same expression vector, or may be encoded on different expression vectors.

Expression vectors include plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13); plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, pC194); yeast-derived plasmids (eg, pSH19, pSH15); insect cell expression Plasmid (eg, pFast-Bac); animal cell expression plasmid (eg, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophage such as λ phage; insect virus vector such as baculovirus ( Examples: BmNPV, AcNPV); animal virus vectors such as retrovirus, vaccinia virus, adenovirus, etc. are used.
As the promoter, an appropriate promoter that can function in the host cell can be selected according to the type of the host cell.
For example, when the host cell is a bacterium of the genus Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter, lpp promoter, T7 promoter and the like are used, but are not limited to.
When the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter and the like are used, but not limited thereto.
When the host is yeast (eg, fission yeast, budding yeast), Gal1 / 10 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, etc. are used, but not limited thereto.
When the host is an insect cell, polyhedrin promoter, P10 promoter and the like are used, but not limited thereto.
When the host is a plant cell, CaMV35S promoter, CaMV19S promoter, NOS promoter and the like are used, but not limited thereto.
When the host is a vertebrate cell, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus) Thymidine kinase) promoter and the like are used, but not limited thereto.

  In addition to the above, the expression vector may contain an enhancer, a splicing signal, a terminator, a poly A addition signal, a drug resistance gene, a selection marker such as an auxotrophic complementary gene, an origin of replication, and the like as desired.

  The RNA encoding the nucleic acid sequence recognition module and / or the DNA cleavage domain can be obtained, for example, using a vector encoding the DNA encoding the nucleic acid sequence recognition module and / or the DNA cleavage domain as a template in an in vitro transcription system known per se. It can be prepared by transcription into mRNA.

  An expression vector encoding the donor DNA (eg, circular double-stranded DNA) and the nuclease component (nucleic acid sequence recognition module and / or DNA cleavage domain) is introduced into a host cell, and the host cell is cultured. Thus, the nuclease is formed in the host cell, and the nuclease can be brought into contact with the genomic double-stranded DNA and the donor DNA (eg, circular double-stranded DNA).

  The introduction of a nucleic acid such as donor DNA (eg, circular double-stranded DNA) into a host cell can be carried out according to a known method (for example, lysozyme method, competent method, PEG method, CaCl coprecipitation method, electrolysis method) (Poration method, microinjection method, particle gun method, lipofection method, Agrobacterium method, etc.). An expression vector encoding the donor DNA (eg, circular double-stranded DNA) and the nuclease component (nucleic acid sequence recognition module and / or DNA cleavage domain) is prepared by mixing them and performing a single introduction operation. It is preferable to introduce both.

The number of molecules of the donor DNA (eg, circular double-stranded DNA) used for the introduction operation is, for example, 1 x 10 ² molecules to 1 x 10 ⁸ molecules when converted as the copy number of a transposon homologous nucleotide sequence per host cell. It is preferably ⁴ × 10 ³ molecules to ⁴ × 10 ⁴ molecules.

The number of molecules of the expression vector used for the introduction operation encoding the nuclease constituent element (nucleic acid sequence recognition module and / or DNA cleavage domain) is, for example, 1 × 10 ² molecules to 1 × 10 ⁹ molecules, preferably 1 host cell 4x10 ⁴ molecules to 4x10 ⁵ molecules.

  When the CRISPR-Cas system is used as a nucleic acid sequence recognition module, and the expression vector of Cas protein and the expression vector of guide RNA are different, the ratio of the number of molecules of those expression vectors to be introduced is, for example, 1: 0.4 to 1: 1.6, preferably 1: 0.5 to 1: 1.5.

Escherichia can be transformed, for example, according to the method described in Proc. Natl. Acad. Sci. USA, 69, 2110 (1972), Gene, 17, 107 (1982).
Bacillus can be introduced into a vector according to the method described in, for example, Molecular & General Genetics, 168, 111 (1979).
Yeast can be introduced into a vector according to a method described in, for example, Methods in Enzymology, 194, 182-187 (1991), Proc. Natl. Acad. Sci. USA, 75, 1929 (1978).
Insect cells can be introduced into a vector according to the method described in, for example, Bio / Technology, 6, 47-55 (1988).
Vertebrate cells can be introduced into a vector according to the method described in, for example, Cell Engineering Supplement 8 New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973).

Culturing of cells into which foreign DNA and a vector have been introduced can be performed according to known methods depending on the type of host.
As described above, the nuclease (nucleic acid sequence recognition module or a complex of a nucleic acid sequence recognition module and a DNA cleavage domain) can be expressed in cells.

  Introduction of a nucleic acid sequence recognition module and / or RNA encoding a DNA cleavage domain into a host cell can be performed by a microinjection method, a lipofection method, or the like. RNA can be introduced once or repeatedly several times (for example, 2 to 5 times) at an appropriate interval.

  When a nucleic acid sequence recognition module or a complex of a nucleic acid sequence recognition module and a DNA cleavage domain (nuclease) is expressed from an expression vector or RNA molecule introduced into a cell, the nucleic acid sequence recognition module is converted into donor DNA (eg, circular double-stranded DNA). By specifically recognizing and binding the target nucleotide sequence in the double-stranded DNA) and / or genomic double-stranded DNA, and by the action of the nucleic acid sequence recognition module itself or the DNA cleavage domain linked to the nucleic acid sequence recognition module, The DNA is cleaved at the targeted site (adjustable within a range of several hundred bases including all or part of the target nucleotide sequence or the vicinity thereof). In one embodiment, the nuclease gives priority to a target sequence in a nucleotide sequence homologous to the nucleotide sequence (eg, transposon sequence) of 200 bp or more contained in the donor DNA (eg, circular double-stranded DNA) or a partial sequence thereof. Cut off. Subsequently, transposon sequences on genomic double-stranded DNA and donor DNA (eg, circular double-stranded DNA) are repaired by a repair mechanism known as homologous recombination (orientated) repair (HDR), which exists in almost all cell and biological species. Homologous recombination occurs with the transposon homologous nucleotide sequence contained in the single-stranded DNA), and the foreign DNA sequence contained in the donor DNA (eg, circular double-stranded DNA) becomes the transposon sequence on the genomic double-stranded DNA. Inserted at the targeted site.

  In one embodiment, when linear double-stranded DNA is used as donor DNA, the linear double-stranded DNA is obtained by cleaving the circular double-stranded DNA with a target sequence to obtain linear DNA. possible. The linear donor DNA is introduced into a host cell, and then present in almost all cell types and biological species by a repair mechanism known as homologous recombination (orientation) type repair (HDR). Homologous recombination occurs between the above transposon sequence and the transposon homologous nucleotide sequence contained in the linear double-stranded DNA donor DNA, and the foreign DNA contained in the donor DNA (eg, circular double-stranded DNA) The DNA sequence is inserted into the targeted site of the transposon sequence on the genomic double stranded DNA.

  In the method of the present invention, by using a host cell having a genomic double-stranded DNA containing two or more copies of a transposon sequence, foreign DNA can be inserted into two or more sites (transposon sequences) on the genomic DNA. . In the method of the present invention, the number of transposon sequences on genomic DNA into which foreign DNA is inserted is usually 2 or more, preferably 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more. Theoretically, desired foreign DNA can be inserted into a large number of sites on the genomic DNA, with the upper limit being the number of copies of the transposon sequence present in the genomic DNA of the host cell.

  In one embodiment, only one type of cloned donor DNA (eg, circular double-stranded DNA) is used as the donor DNA (eg, circular double-stranded DNA) containing a transposon homologous nucleotide sequence and a foreign DNA sequence. In this case, two or more copies of a specific foreign DNA sequence contained in the donor DNA (eg, circular double-stranded DNA) can be inserted into the host host genome double-stranded DNA. The number of copies of the foreign DNA inserted into the genomic double-stranded DNA is usually 2 or more, preferably 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more. 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 Above, it is 100 or more. Theoretically, multiple copies of a specific foreign DNA can be inserted into the genomic DNA, with the upper limit being the number of copies of the transposon sequence present in the genomic DNA of the host cell. When foreign DNA encoding a specific structural gene is used, it can be expected that the expression level of the structural gene in the host cell will be significantly increased.

  In one embodiment, two or more types of donor DNA (eg, circular double-stranded DNA) each containing a different foreign DNA sequence are used as donor DNA (eg, circular double-stranded DNA) containing a transposon homologous nucleotide sequence and a foreign DNA sequence. Use a mixture. In this case, two or more kinds of foreign DNA can be collectively inserted into the genome double-stranded DNA of the host cell. The mixture of the two or more kinds of circular double-stranded plasmid DNA is preferably 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 30 or more, 40 or more, 50 As described above, it is a mixture of 60 or more, 70 or more, 80 or more, 90 or more, 100 or more circular double-stranded plasmid DNA. Theoretically, a large number of foreign DNAs can be inserted into the genomic DNA at once, up to the number of copies of the transposon sequence present in the genomic DNA of the host cell. For example, by using a mixture of donor DNAs (eg, circular double-stranded DNAs) each containing each gene included in a large number of gene groups that constitute cell functions / metabolic pathways of various biological species, the gene groups are collectively collected. Then, it can be inserted into the genomic DNA of the host cell and the cell function / metabolic pathway can be reconstituted within the host cell.

  When using a mixture of two or more types of donor DNA (eg, circular double-stranded DNA) each containing a different foreign DNA sequence, the mixture of donor DNA (eg, circular double-stranded DNA) is introduced into the host cell. The ratio of the number of molecules of various donor DNAs (eg, circular double-stranded DNA) in the mixture is, for example, 1: 0.4 to 1: 1.6, preferably 1: 0.5 compared with any two types. ~ 1: 1.5. By setting such a mixing ratio, it can be expected that each foreign DNA is inserted into the genomic double-stranded DNA with the same frequency. In addition, in two or more types of donor DNA (eg, circular double-stranded DNA) each containing different foreign DNA sequences, the transposon homologous nucleotide sequences contained in each donor DNA (eg, circular double-stranded DNA) are the same. It is preferable. Thereby, it can be expected that each foreign DNA is inserted into the genomic double-stranded DNA with the same frequency.

  In one embodiment, the transformant obtained by the method of the present invention (host cell in which foreign DNA is inserted into two or more sites) is used as a host cell, and the method of the present invention is further applied to the genomic DNA. Foreign DNA can be inserted into a larger number of sites (the nucleotide sequence of 200 bp or more, eg, transposon sequence). In the method of the present invention, foreign DNA is inserted into the nucleotide sequence (eg, transposon sequence) of 200 bp or more by homologous recombination in the nucleotide sequence (eg, transposon sequence) of 200 bp or more. To one of the sequences derived from the nucleotide sequence (eg, transposon sequence) of 200 bp or more on the genomic double-stranded DNA (sequence on the 5 ′ side of the DSB site) and the donor DNA (eg, circular double-stranded DNA) One of sequences derived from a nucleotide sequence homologous to the nucleotide sequence (eg, transposon sequence) of 200 bp or more (sequence 3 ′ side of the DSB site), and further, the 200 bp on the genomic double-stranded DNA The other of the sequences derived from the above nucleotide sequence (eg, transposon sequence) (sequence 3 ′ side of DSB site) and the nucleotide of 200 bp or more on donor DNA (eg, circular double-stranded DNA). The nucleotide sequence (eg, transposon sequence) of 200 bp or more is newly obtained by linking to the other sequence (sequence on the 5 ′ side of the DSB site) derived from the nucleotide sequence homologous to the leotide sequence (eg, transposon sequence). (Ie, the copy number of the nucleotide sequence of 200 bp or more (eg, transposon sequence) is amplified). By applying the method of the present invention using the newly generated transformant containing the nucleotide sequence of 200 bp or more (eg, transposon sequence) as a host cell, a larger number of sites on the genomic DNA (200 bp or more of the sequence) Foreign DNA can be inserted into the nucleotide sequence (eg, transposon sequence). Thus, when the method of the present invention is repeated a plurality of times, nucleotides homologous to the nucleotide sequence (eg, transposon sequence) of 200 bp or more contained in the donor DNA (eg, circular double-stranded DNA) used in each round The sequence is identical. Moreover, it is preferable that the donor DNA (for example, circular double-stranded DNA) used in each round contains a different selection marker gene, respectively. Although the upper limit of the number of repetitions when the method of the present invention is repeatedly applied is not theoretically, it is usually within 10 times, preferably within 5 times, more preferably within 3 times, from the viewpoint of easy operation. .

The present invention is a method for producing a genetically modified cell,
In a host cell having genomic double-stranded DNA containing a nucleotide sequence (eg, transposon sequence) of 200 bp or more interspersed with 2 copies or more,
A donor DNA (eg, circular double-stranded DNA) comprising the genomic double-stranded DNA, and a nucleotide sequence (eg, transposon sequence) of 200 bp or more or a nucleotide sequence homologous to a partial sequence thereof, and a foreign DNA sequence;
Contacting with a nuclease that specifically binds to and cleaves DNA within the target nucleotide sequence selected from the 200 bp or more nucleotide sequence (eg, transposon sequence);
The nucleotide sequence (eg, transposon sequence) of 200 bp or more on the genomic double-stranded DNA and the nucleotide sequence (eg, transposon sequence) of 200 bp or more contained in the donor DNA (eg, circular double-stranded DNA) or its By causing homologous recombination between a partial sequence and a homologous nucleotide sequence, the foreign DNA sequence is converted into two or more copies of the 200 bp nucleotide sequence (eg, transposon sequence) contained in the genomic double-stranded DNA. Including inserting into
The homologous nucleotide sequence includes the target nucleotide sequence, and when DNA is cleaved within the target nucleotide sequence, homologous recombination is performed on genomic DNA including the nucleotide sequence of 200 bp or more (eg, transposon sequence). Methods are provided that have a sufficient degree of sequence identity and length to occur.

  Regarding the nucleotide sequence (eg, transposon sequence) of 200 bp or more, a sequence homologous to a nucleotide sequence of 200 bp or more (eg, transposon sequence), foreign DNA, target nucleotide sequence, nuclease, and targeted site in the above method, It is the same.

  The method may further comprise culturing the cell and selecting a genetically modified cell. The selection of a genetically modified cell includes, for example, a primer designed based on a nucleotide sequence adjacent to a locus of a nucleotide sequence of 200 bp or more on the genome (eg, transposon sequence), and a nucleotide sequence of 200 bp or more on a plasmid. (For example, transposon sequence) Using primers designed based on the base sequence adjacent to the homologous sequence, PCR is performed using the DNA of the transformant strain as a template, and a band appears at the expected molecular weight position during electrophoresis. It is determined by judging whether or not the foreign DNA has been correctly introduced depending on whether or not it appears, and selecting a transformant strain into which the foreign DNA has been correctly introduced.

  Hereinafter, the present invention will be described by way of examples. However, the present invention is not limited to these examples.

[Example 1]
By homologous recombination with CRISPR / Cas9 using a guide RNA containing the RNA sequence of the target sequence 5'-acgtcttagaacggtctga-3 '(SEQ ID NO: 3) (Fig. 1), 5'-acgucuuagaacggucuga-3' (SEQ ID NO: 5) The pTy1 plasmid was inserted into the transposon Ty1 present on the genome of the budding yeast Saccharomyces cerevisiae. Specifically, the Ty1 retrotransposon Ty1 sequence (Ty1 HR sequence) (SEQ ID NO: 1) is used as a transposon homologous sequence, and the homologous sequence and the gene to be introduced are cloned into a plasmid such as PHM661 (FIG. 2). Was prepared. Moreover, a plasmid containing DNA sequences encoding iCas9 and gTy1 (guide RNA) was prepared. These were introduced into budding yeast by transformation.

The composition of the medium used is as follows (Methods in Yeast Genetics, 1997 Edition (see Cold Spring Harbor Laboratory Press)).

1. YPD agar polypeptone 20 g
Yeast extract 10 g
Glucose 20 g
agar 20 g
Ion exchange water 1 L

After autoclaving, subdivide into 100 mm diameter dishes.

2. Reagent for transformation
4 M LiAc 5 μl
1 M DTT 10 μl
60% PEG (average MW. 4000) 67 μl
dH2O 18 μl
100 μl total

3. Amino acid requirement selective medium
Yeast Nitrogen Base 6.7 g
Glucose 20 g
Agar 20 g
x20 Amino acid drop (-Leu, -URA) 50 ml
10 mg / ml Leucine 4 ml
10 mg / ml Leucine 10 ml
add dH2O up to 1 L
Adjust the pH to near neutral with NaOH.

After autoclaving, subdivide into 100 mm diameter dishes.

* x20 Amino acid drop (-Leu, -URA)
Adenine sulfate 400 mg
L-Tryptophan 400 mg
L-Histidine HCl 400 mg
L-Arginine HCl 400 mg
L-Methionine 400 mg
L-Tyrosine 600 mg
L-Isoleucine 600 mg
L-Lysine HCl 600 mg
L-Phenylalanine 1 g
L-Glutamic acid 2 g
L-Aspartic acid 2 g
L-Valine 3 g
L-Threonine 4 g
L-Serine 8 g
Add dH2O up to 1 L

[Example 2]
Transformation was performed in the presence or absence of guide RNA gTy1, and the recombination efficiency of pTy1 into the chromosome was calculated. The recombination efficiency of pTy1 was not affected by the presence or absence of gTy1 as was the case with the control recombination efficiency of the vector not containing Ty1 into the chromosome (FIG. 3).

[Example 3]
The base sequence analysis of the chromosome Ty1 site into which pTy1 was introduced by CRISPR / Cas9 was performed (FIG. 4). Analysis of 10 transformants was carried out, but in all of them, there was no change in the nucleotide sequence. This showed that accurate introduction of pTy1 by homologous recombination into the Ty1 site on the chromosome was achieved with high reproducibility.

[Example 4]
Next, transformation was performed in the presence or absence of the guide RNA gTy1, and the frequency of the transformant strain in which pTy1 was accurately introduced into Ty1 on the chromosome was calculated. Using primers designed based on the nucleotide sequence adjacent to the Ty1 locus on the genome and primers designed based on the nucleotide sequence adjacent to pTy1 on the plasmid, PCR is performed using the DNA of the transformant strain as a template. Whether or not Ty1 was introduced correctly was determined by whether or not a band appeared at the position of the expected molecular weight during electrophoresis. As a negative control, a vector not containing Ty1 was used. It was shown that pTy1 was accurately introduced into Ty1 on the budding yeast chromosome in the presence of gTy1 (FIG. 5).

[Example 5]
Chromosomal DNA of the transformant strain was separated by pulse field electrophoresis, and compared with the migration pattern of the budding yeast chromosome as a marker and the chromosome of the parent strain before transformation. The DNA migration pattern of each transformant strain was the same as the DNA migration pattern of the parent strain. This confirmed that the CRITGI system did not cause genomic destabilization such as translocation of chromosome arms of the transformant strain (FIG. 6). In addition, this result indicates that CRISPR / Cas9 preferentially cleaves the Ty1 sequence on the plasmid, and that this cleaved plasmid is inserted into the Ty1 retrotransposon region on the chromosome via a homologous recombination reaction. Was suggested.

[Example 6]
The number of pTy1 introduced into the chromosome was examined (FIG. 7). In FIG. 7, “Integration” was transformed by cutting the Ty1 sequence in pTy1 with SalI. “CRISPR / Transposon” used CRITGI. RT-qPCR was used to measure the number of pTy1 in the chromosome. Using ACT1 as a reference, the number of LEU2 genes in pTy1 was measured. As a result, it was revealed that 1 copy of pTy1 was inserted in “Integration” and 1 to 11 copies in “CRISPR / Transposon”.

[Example 7]
By CRITGI, homologous recombination having the configuration shown in the upper left of FIG. 8 was performed, and the obtained transformant strain was further subjected to homologous recombination by the plasmid shown in the upper right of FIG. At each stage of the first and second homologous recombination, the copy numbers of the Ty1 and Amp loci in the obtained transformant strains were measured. The results are shown in the lower graph of FIG. It was found that the second homologous recombination can dramatically increase the copy number of the sequence inserted into the genome.

[Example 8]
The LEU2 marker was introduced by the first CRITGI, and the resulting transformant strain was further subjected to the second RITGI to introduce the URA3 marker. When the obtained transformant strain was analyzed, it was found that the first introduced pTy1 (LEU2) was used as a site for introducing pTy1 (URA3) in the second CRITGI (FIG. 9).

[Example 9]
A budding yeast strain BY4742 + DpaA gene integrated (Genotype: Matαtrp1Δhis3Δleu2Δura3ΔTy1 locus: DpaA (LEU2)) was used as a host strain, and the lysine synthesis pathway genes (DpaA, DpaB, Plasmids (PHM721, PHM712, PHM716, PHM703, PHM717, PHM704, PHM724) containing any one of DpaC, DpaD, DpaE, DpaF, LysA) and PHM663 were all introduced and transformed. PHM663 is a plasmid containing iCas9, gTy1 (guide RNA), and URA3.

  A transformant was identified in a medium from which histidine and uracil had been removed. For the 16 transformed yeast strains, the introduced gene was confirmed by PCR. As a result, the introduced gene was detected from each strain as shown in FIG. In many strains, multiple types of genes were introduced by a single transformation operation (FIG. 13).

  According to the method of the present invention, a large number of genes constituting cell functions / metabolic pathways of various species are introduced into host cell chromosomes, and cell functions / metabolic pathways are reconstructed in the host cell, By introducing about several tens of genes into the chromosome, the expression level of the gene in the plasmid can be significantly increased. Therefore, the method of the present invention is useful for inexpensive production of microorganisms that produce expensive rare metabolites and functional fusion organisms having excellent functions.

Claims (17)

A method for inserting foreign DNA into two or more sites on genomic DNA,
In a host cell having genomic double-stranded DNA containing a nucleotide sequence of 200 bp or more, interspersed with 2 copies or more,
A donor DNA comprising the genomic double-stranded DNA and a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more or a partial sequence thereof, and a foreign DNA sequence;
Contacting with a nuclease that specifically binds to a selected target nucleotide sequence in the nucleotide sequence of 200 bp or more and cleaves DNA within the target nucleotide sequence;
By causing homologous recombination between the nucleotide sequence of 200 bp or more on the genomic double-stranded DNA and the nucleotide sequence of 200 bp or more contained in the donor DNA or a nucleotide sequence homologous to a partial sequence thereof, Inserting a foreign DNA sequence into two or more copies of the 200 bp or more nucleotide sequence contained in the genomic double-stranded DNA;
The homologous nucleotide sequence includes the target nucleotide sequence, and when DNA is cleaved within the target nucleotide sequence, a degree sufficient to cause homologous recombination with respect to genomic DNA including the nucleotide sequence of 200 bp or more. Having a sequence identity and length of   The method according to claim 1, wherein the nucleotide sequence of 200 bp or more is a transposon sequence.   The method according to claim 1 or 2, wherein a nuclease preferentially cleaves a target sequence in a nucleotide sequence homologous to the nucleotide sequence of 200 bp or more contained in the donor DNA or a partial sequence thereof.   The method according to any one of claims 1 to 3, wherein the donor DNA is a cloned donor DNA.   The method according to any one of claims 1 to 4, wherein the donor DNA is a mixture of two or more types of donor DNA each containing different foreign DNA sequences.   6. The method according to any one of claims 1 to 5, wherein the foreign DNA sequence encodes a structural gene.   The method according to any one of claims 1 to 6, wherein the donor DNA is circular double-stranded DNA.   8. The nuclease comprises a nucleic acid sequence recognition module and a DNA cleavage domain, wherein the nucleic acid sequence recognition module is selected from the group consisting of a zinc finger motif, a TAL effector and a PPR motif. The method described.   The method according to any one of claims 1 to 7, wherein the nuclease is a complex of a guide RNA and a Cas protein in the CRISPR-Cas system.   The method according to claim 9, wherein the nuclease is a complex of guide RNA and Cas9 protein.   The method according to any one of claims 2 to 10, wherein the transposon is a retrotransposon.   12. The method of claim 11, wherein the retrotransposon is a Ty1-copia group retrotransposon.   The method according to any one of claims 1 to 12, wherein the host cell is a prokaryotic cell, yeast, vertebrate cell, insect cell or plant cell.   14. A method according to claim 13, wherein the host cell is yeast.   The method according to claim 14, wherein the yeast is budding yeast.   The method according to any one of claims 1 to 15, wherein the target nucleotide sequence comprises the sequence represented by SEQ ID NO: 3.   A CRISPR / Cas9 system guide RNA comprising the nucleotide sequence represented by SEQ ID NO: 5.