JP2018172285A - Therapeutic agent of disease followed by abnormal material accumulation in cell, biomarker, diagnostic agent and screening method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a series of techniques in which a control factor of an autophagy is identified newly and the factor is used.SOLUTION: There is provided a therapeutic agent of a disease followed by an abnormal material accumulation in a cell, including as an active ingredient, a substance for suppressing expression of ERdj8 or a substance for suppressing an autophagy activity suppression function which the ERdj8 has. There are also provided a biomarker for detection of a disease followed by abnormal substance accumulation in a cell formed of the ERdj8, and a diagnostic agent used for detection of a disease followed by abnormal substance accumulation in a cell including a substance which binds to the ERdj8 specifically. There is also provided a method for screening a candidate substance of a therapeutic agent of a disease followed by abnormal substance accumulation in a cell with (a)activity for suppressing an autophagy activity suppression function which the ERdj8 has or (b) activity for suppressing an expression level of the ERDj8 as an index.SELECTED DRAWING: Figure 17

Description

  The present invention relates to therapeutic agents, biomarkers, diagnostic agents, and screening methods for diseases associated with abnormal substance accumulation in cells.

  Autophagy is a system that degrades bad proteins and organelles in cells. This degradation is thought to maintain intracellular homeostasis and supply amino acids during starvation.

  Autophagy is roughly classified into three types: “macro autophagy”, “microautophagy”, and “chaperone-mediated autophagy”. In macro autophagy, a membrane called an isolating membrane extends at the endoplasmic reticulum membrane, wraps up defective proteins and organelles, and forms a double membrane autophagosome. When this autophagosome is fused with lysosome, it becomes autolysosome and degrades protein. In general, the term “autophagy” indicates macro autophagy. Microautophagy, on the other hand, degrades by incorporating defective proteins directly into lysosomes. In addition, chaperone-mediated autophagy is degraded by incorporating defective proteins into lysosomes by molecular chaperones.

  The degradation process by autophagy can be broadly divided into three: “isolation membrane formation”, “isolation membrane extension and autophagosome formation”, and “autophagosome-lysosome fusion”. These are controlled by various autophagy-related factors (Atg factors) related to autophagy.

  Autophagy can be classified into “guided autophagy” and “basic autophagy”. Induced autophagy occurs when starvation is induced and is used to provide a temporary nutrient supply. On the other hand, basal-type autophagy is an autophagy that is always generated in order to perform steady clearance of abnormal proteins and organelles in cells.

  Of these, basal-type autophagy is particularly important for long-lived neurons. In the previous reports, in mice in which autophagy was suppressed in the nervous system, accumulation of structurally abnormal proteins occurred in neurons, and as a result, neuronal cell death was observed (Non-patent Document 1). From this, it is expected that neuronal cell death caused by their accumulation is prevented by degrading and removing defective proteins and abnormal intracellular organelles by basal autophagy in neurons. .

  By the way, for neurodegenerative diseases associated with dementia such as Alzheimer's disease, there is no fundamental treatment, and there is currently only coping therapy that delays the progression of the disease. There is an urgent need to develop pharmaceuticals for the treatment and prevention of such neurodegenerative diseases.

  As described above, it has been clarified that intracellular protein aggregates that cause neurodegenerative diseases accumulate due to degradation delay due to autophagy (Non-patent Document 1). That is, autophagy activity in nerve cells decreases, proteolysis is delayed, and intracellular protein aggregates accumulate. Therefore, if autophagy activity in nerve cells can be controlled (enhanced), intracellular protein aggregates can be reduced and accumulation of intracellular protein aggregates can be prevented. It is expected to lead to the development of therapeutic methods. For example, it is conceivable to increase autophagy activity by specifying a factor that regulates autophagy activity and controlling the factor.

  Furthermore, the decrease in autophagy activity is caused by Crohn's disease (Non-patent document 2), atrophic age-related macular degeneration, myotonic dystrophy, amyotrophic lateral sclerosis (Non-patent document 3), type 1 and type 2 diabetes ( Non-patent document 4) and hepatitis (non-patent document 5) are suggested to be involved in the onset or exacerbation of hepatitis.

  Examples of methods for inducing or inhibiting autophagy in cells include those described in Patent Documents 1 and 2.

  In recent years, it has been reported that a membrane component necessary for autophagy degradation is generated from a contact site (MAM) between the endoplasmic reticulum and mitochondria (Non-patent Document 6). Thus, it has become clear that MAM has an important role in autophagy.

Special table 2013-506686 gazette Special table 2013-506687 gazette

Hara, T et al., Nature, 441, 885-889 2006 Adolph T et al., Nature, 503, 272-276, 2013 Fujiwara Y et al., Autophagy 9: 3, 403-409, 2013 Zhang S et al., FASEB J (12): 5083-96, 2014 Rautou P et al., Journal of Hepatology, 53, 6, 1123-1134, 2010 Hamasaki M et al., Nature, 495, 389-93, 2013

  An object of the present invention is to newly specify a control factor for autophagy and to provide a series of techniques using the factor.

  The present inventors searched for a new autophagy regulator and cloned DNAJC16 (DnaJ homolog subfamily C member 16), which is an endoplasmic reticulum membrane-localized DnaJ protein. Since the protein was confirmed to have a J domain in the endoplasmic reticulum lumen, it was newly named ERdj8. As a result of research on ERdj8, it was found that ERdj8 has a function of strongly negatively controlling autophagy activity, particularly basal autophagy.

  One aspect of the present invention provided on the basis of the above findings is a therapeutic agent for diseases associated with abnormal substance accumulation in cells, containing as an active ingredient a substance that suppresses the expression of ERdj8.

  Another aspect of the present invention is a therapeutic agent for diseases associated with abnormal substance accumulation in cells, containing as an active ingredient a substance that suppresses the autophagy activity suppressing function of ERdj8.

  Preferably, the autophagy is a basal type autophagy.

  Preferably, the disease accompanied by intracellular abnormal substance accumulation is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease is there.

  Preferably, the substance that suppresses the expression of ERdj8 or the substance that suppresses the autophagy activity suppressing function of ERdj8 is a nucleic acid.

  Preferably, the nucleic acid is an siRNA, shRNA, nucleic acid aptamer, or antisense nucleic acid.

  Another aspect of the present invention is a biomarker for detecting a disease associated with abnormal substance accumulation in cells, comprising ERdj8.

  Preferably, the disease accompanied by intracellular abnormal substance accumulation is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease is there.

  Another aspect of the present invention is a diagnostic agent for use in detecting a disease associated with abnormal substance accumulation in a cell, including a substance that specifically binds to ERdj8.

  Preferably, the substance that specifically binds to ERdj8 is an anti-ERdj8 antibody.

  Preferably, the disease accompanied by intracellular abnormal substance accumulation is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease is there.

Another aspect of the present invention has a test substance,
(A) the activity of suppressing the autophagy activity suppressing function of ERdj8, or
(B) the activity of suppressing the expression level of ERdj8,
The screening method is characterized by screening a candidate substance for a therapeutic drug for a disease associated with abnormal substance accumulation in a cell using as an index.

  Preferably, the disease accompanied by intracellular abnormal substance accumulation is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease is there.

  INDUSTRIAL APPLICABILITY The present invention is useful for the treatment and diagnosis of diseases involving abnormal substance accumulation in cells and diseases involving autophagy abnormalities. Moreover, according to the present invention, candidate substances for therapeutic agents for diseases associated with intracellular abnormal substance accumulation can be efficiently screened.

It is a photograph showing the result of the Western blot which investigated the expression of LC3 in the HeLa cell which introduce | transduced human ERdj8 specific siRNA. It is a photograph showing accumulation of intracellular LC3 in HeLa cells introduced with human ERdj8-specific siRNA. It is a photograph showing accumulation of intracellular LC3 in a tfLC3 stable expression HeLa cell introduced with human ERdj8-specific siRNA. It is a graph showing the ratio for which the cell containing an autolysosome accounts among all the cells observed in FIG. It is the photograph showing the result of the Western blot which investigated the accumulation | storage amount of the PolyQ protein in the EYFP fluorescent protein fusion Poly143Q protein stable expression HeLa cell which introduce | transduced human ERdj8 specific siRNA, and investigated the accumulation amount of PolyQ protein. It is a photograph showing the accumulation of intracellular PolyQ protein aggregates in HeLa cells stably expressing Poly143Q protein fused with EYFP fluorescent protein introduced with human ERdj8-specific siRNA. It is a graph showing the number of PolyQ protein aggregates in the cells observed in FIG. It is the photograph showing the result of the western blotting which investigated the accumulation amount of the PolyQ protein in the EYFP fluorescent protein fusion Poly143Q protein stable expression HeLa cell which overexpressed ERdj8, and the accumulation amount of LC3. It is a photograph showing accumulation of PolyQ protein aggregates in EYFP fluorescent protein-fused Poly143Q protein stably expressing HeLa cells in which ERdj8 is overexpressed. 10 is a graph showing the number of PolyQ protein aggregates in the cells observed in FIG. 9. It is a photograph showing accumulation of endogenous ubiquitin protein in SK-N-SH cells in which ERdj8 is overexpressed. It is a photograph showing the co-localization of a PolyQ protein aggregate and a lysosome in an EYFP fluorescent protein-fused Poly143Q protein stable expression HeLa cell in which ERdj8 is overexpressed. It is a graph showing the ratio of the PolyQ protein aggregate co-localized with a lysosome in the cell observed in FIG. It is a photograph showing accumulation of GFP :: LGG1 in a neurodegenerative disease model nematode having knocked down dnj8. It is a graph showing the number of dots of LGG1 in the nematode of FIG. It is a graph showing the number of PolyQ protein aggregates in the neurodegenerative disease model nematode having knocked down dnj8. It is a graph showing the recovery | restoration of a motor function in the neurodegenerative disease model nematode which knocked down dnj8.

First, ERdj8 will be described. ERdj8 is the same protein as DNAJC16 (DnaJ homolog subfamily member 16), which is an endoplasmic reticulum membrane-localized DnaJ protein. The nucleotide sequence of DNA containing the gene (cDNA) encoding ERdj8 is shown in SEQ ID NO: 1. In the nucleotide sequence represented by SEQ ID NO: 1, the region from No. 165 to 2510 encodes ERdj8. The nucleotide sequence of the region and the corresponding amino acid sequence are shown in SEQ ID NO: 2, and only the amino acid sequence is shown in SEQ ID NO: 3.
ERdj8 is a membrane protein consisting of 782 amino acids and has a DnaJ domain, a thioredoxin-like domain, and a transmembrane domain.

  The present invention includes a therapeutic agent for a disease associated with accumulation of abnormal substances in cells, containing a substance that suppresses the expression of ERdj8 as an active ingredient. In addition, the present invention includes a therapeutic agent for diseases associated with abnormal substance accumulation in cells, which contains, as an active ingredient, a substance that suppresses the autophagy activity suppressing function of ERdj8.

  “Expression of ERdj8” includes both expression at the transcription level (mRNA amount) and expression at the translation level (protein amount). That is, both the amount of the transcript of the ERdj8 gene and the amount of the translation product can be the expression level of ERdj8.

  In one embodiment, the “substance that suppresses the expression of ERdj8” or the “substance that suppresses the autophagy activity suppressing function of ERdj8” is a nucleic acid. That is, the therapeutic agent of the present invention can be a nucleic acid drug.

  Examples of the substance that suppresses the expression of ERdj8 and the substance that suppresses the autophagy activity suppression function include siRNA and shRNA specific to ERdj8. As a specific example, siRNA containing the sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5 as an ERdj8-specific sequence used in Examples described later can be mentioned.

  The length (number of bases) of the sense strand and the antisense strand of the siRNA may be the same or different. The number of bases is usually 30 bases or less, preferably 19 to 25 bases, more preferably 19 to 23 bases, and even more preferably 21 bases.

  Further, the end shape of the sense strand and the antisense strand of the siRNA may be a blunt end or a protruding end with an overhang on the 3 'side. In the case of a protruding end, the number of bases of the protruding portion is usually 1 to 10 bases, preferably 1 to 4 bases, more preferably 1 to 2 bases. The lengths of the protruding portions of the sense strand and the antisense strand may be the same or different. Moreover, the nucleotide of the protruding portion may be converted to DNA. Furthermore, the nucleotide in the protruding portion preferably has a base complementary to the mRNA of the target gene, but may have a non-complementary base as long as RNA interference can be induced.

  The ERdj8-specific sequence of the siRNA is preferably the same as the target sequence, but may not be completely identical as long as RNA interference can be induced. For example, as long as an ERdj8-specific sequence (antisense sequence) of siRNA and a target sequence can be hybridized, a mismatch of about several bases is allowed. That is, the siRNA includes those in which 1 to several (for example, about 2 to 4) bases are substituted, added, or deleted with respect to the target sequence and can induce RNA interference. Further, the siRNA includes those having sequence identity of 85% or more, preferably 90% or more, more preferably 95% or more, and still more preferably 98% or more, and can induce RNA interference with the target sequence. .

  Furthermore, the siRNA may be of a type in which RNA and DNA are mixed as long as RNA interference can be induced. For example, a hybrid siRNA in which one of the sense strand and the antisense strand is an RNA strand and the other is a DNA strand may be used. Alternatively, a chimeric siRNA in which a part of the nucleotides of the sense strand and / or antisense strand is converted to DNA may be used.

  The hybrid siRNA preferably has a sense strand of DNA and an antisense strand of RNA.

  Examples of the chimeric siRNA include those obtained by converting a part of the nucleotides on the downstream side (3 ′ end side of the sense strand, 5 ′ end side of the antisense strand) into DNA. Specific examples include those in which nucleotides on both the 3 'end side of the sense strand and the 5' end side of the antisense strand are converted to DNA. In addition, one in which either one of the nucleotide on the 3 'end side of the sense strand and the 5' end side of the antisense strand is converted to DNA can be mentioned. In addition, it is preferable that the length of the nucleotide converted into DNA is not more than the number of nucleotides corresponding to 1/2 of the RNA molecule. The region to be converted into DNA can be selected, for example, from the range of 1 to 13 nucleotides, preferably 1 to 10 nucleotides from the end.

  As an example of a chimeric siRNA, each strand has a nucleotide length of 19 to 21, and a part or all of about 1 to 10 nucleotides excluding the overhang portion from the 3 ′ end side of the sense strand are continuously DNA And a part or all of about 1 to 10 nucleotides from the 5 ′ end of the antisense strand are continuously converted to DNA. In this example, the region to be converted into DNA is usually about 1 to 10, preferably 1 to 8, more preferably 1 to 6, on the 3 ′ end side of the sense strand. is there. On the 5 'end side of the antisense strand, the number is usually about 1 to 10 from the end, preferably 1 to 8, more preferably 1 to 6. In this example, the number of DNAs in the sense strand (excluding the overhang portion) and the antisense strand is preferably the same. This siRNA is considered to be particularly preferable in terms of RNA interference effect, stability of RNA molecules, safety to living bodies, and the like.

In addition, as long as RNA interference can be induced, the nucleotide constituting the siRNA may be a nucleotide analog in which the sugar part or base part of the nucleotide or the binding part between nucleotides is chemically modified.
Base modified nucleotide analogs include 5-propynyluridine, 5-propynylcytidine, 5-methylcytidine, 5-methyluridine, 5- (2-amino) propyluridine, 5-halocytidine, 5-halouridine, 5 5-position modified uridine or cytidine such as methyloxyuridine; 8-position modified adenosine or guanosine such as 8-bromognosin; deazanucleotide such as 7-deaza-adenosine; O- and N-alkylated nucleotides such as N6-methyladenosine , Etc.
Sugar-modified nucleotide analogs include ribonucleotides 2′-OH are H, OR, R, halogen atoms, SH, SR, NH ₂ , NHR, NR ₂ , or CN (where R is carbon 2′-position sugar modified products substituted with an alkyl group, an alkenyl group or an alkynyl group represented by Formula 1-6, etc., and 5′-terminal phosphorylated modified products in which the 5 ′ end is monophosphorylated.
Nucleotide analogs in which the internucleotide linkage moiety is modified include those in which the phosphoester group between adjacent ribonucleotides is replaced with a phosphothioate group.

Similar to the siRNA, the nucleic acid in the present invention may be a double-stranded RNA formed by a single strand having a stem-loop structure, that is, shRNA. For example, the nucleic acid may be shRNA in which a loop of 2 to 4 nucleotides is formed at the 5 ′ end of the sense strand and the 3 ′ end of the antisense strand. The nucleic acid may be shRNA in which a loop of 2 to 4 nucleotides is formed at the 3 ′ end of the sense strand and the 5 ′ end of the antisense strand. Further, the nucleic acid has loops of 2 to 4 nucleotides formed at both the 5 ′ end of the sense strand and the 3 ′ end of the antisense strand, and at both the 3 ′ end of the sense strand and the 5 ′ end of the antisense strand. ShRNA may also be used.
As for shRNA, a hybrid type or chimeric type configuration can be adopted. Furthermore, the nucleotide constituting the shRNA may be a nucleotide analogue in which the sugar moiety, base moiety, or internucleotide linkage moiety is chemically modified.

  Examples of nucleic acids other than siRNA / shRNA include antisense nucleic acids. That is, an antisense nucleic acid having a sequence complementary to the mRNA of ERdj8 can be designed and used as a nucleic acid drug that suppresses the expression of ERdj8.

  Other examples include nucleic acid aptamers. For example, a nucleic acid aptamer that specifically binds to and acts on ERdj8 can be designed and used as a nucleic acid drug that suppresses the autophagy activity suppression function of ERdj8.

  About the usage method of the therapeutic agent of this invention, it selects suitably by the kind, dosage form, etc. of an active ingredient.

  The therapeutic agents of the present invention can be used either systemically or locally. When abnormal substance accumulation in cells occurs locally, it can be administered directly to the site by injection or the like (local administration). On the other hand, systemic administration by intravenous injection or the like is preferably employed when the accumulation of abnormal substances in cells extends over a plurality of locations or when the location cannot be specified.

  As an administration route of the therapeutic agent of the present invention, both oral administration and parenteral administration can be applied. Examples of parenteral administration include administration methods such as intravenous, subcutaneous, muscle, topical, intraperitoneal, transdermal, nasal, and pulmonary.

  About the dosage of the therapeutic agent of this invention, it can set suitably according to the kind of active ingredient, an administration route, the progression degree and seriousness of a disease, age, weight, etc. of an administration subject.

  The therapeutic agent of the present invention comprises an active ingredient “substance that suppresses the expression of ERdj8” or “substance that suppresses the autophagy activity suppression function of ERdj8” and a pharmaceutically acceptable carrier. It can be. Examples of the carrier include excipients, binders, disintegrants, stabilizers, lubricants, suspending agents, dispersing agents, diluents, and the like. As these carriers, known ones can be applied as they are. In addition, the therapeutic agent of the present invention may be in a liquid, semi-solid, or solid dosage form.

  When the therapeutic agent of the present invention is a nucleic acid drug, it can be administered in the form of a non-viral vector or a viral vector.

  When administering in the form of a non-viral vector, for example, a method of introducing a nucleic acid molecule using a liposome, such as liposome method, HVJ-liposome method, cationic liposome method, lipofection method, lipofectamine method, etc .; microinjection Method: A method of transferring a nucleic acid molecule into a cell together with a carrier with a gene gun can be used.

  When siRNA / shRNA is administered using a viral vector, for example, a viral vector such as a recombinant adenovirus or a retrovirus can be used. For example, siRNA or shRNA is expressed in DNA virus or RNA virus such as detoxified retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, pox virus, poliovirus, Sindbis virus, Sendai virus, SV40 Introduce DNA. Cells or tissues are then infected with this recombinant virus. Thereby, a transgene is expressed in a cell or a tissue, and siRNA / shRNA can act.

  In one embodiment, the “substance that suppresses the autophagy activity suppressing function of ERdj8” is a low molecular compound, a peptide, or an antibody.

  Examples of the peptide include a peptide that can bind to ERdj8, a peptide that is a partial peptide and / or analog peptide of ERdj8 and has a function of suppressing autophagy activity lower than that of ERdj8 (a peptide having a dominant negative action of ERdj8). .

Examples of the antibody include an antibody against ERdj8. The antibody may be a polyclonal antibody or a monoclonal antibody. In addition to a complete antibody molecule, an antibody fragment that can specifically bind to an antigen (for example, Fab, F (ab ′) ₂ , Fab ′, Fv, scFv, etc.) may be used. Further, the antibody is preferably a human chimeric antibody or a humanized antibody.

  Both of the above peptides and antibodies can be produced by known methods. When the active ingredient of the pharmaceutical composition of the present invention is a peptide or an antibody, as an injection or infusion formulated with a pharmaceutically acceptable carrier, a parenteral route of administration, for example, intravenous, intramuscular, intradermal Can be administered intraperitoneally, subcutaneously or locally.

  The present invention includes a biomarker for detecting a disease accompanied by abnormal substance accumulation in cells, comprising ERdj8. For example, a disease associated with abnormal substance accumulation in cells can be detected using a biomarker composed of ERdj8 as an index. For example, when the expression level of the biomarker is large in a local area of the living body, autophagy is suppressed, and it can be determined that abnormal substance accumulation in the cell is occurring.

  The present invention includes a diagnostic agent for use in detecting a disease associated with abnormal substance accumulation in a cell, including a substance that specifically binds to ERdj8. An example of a substance that specifically binds to ERdj8 is an anti-ERdj8 antibody. For example, the expression level of ERdj8 in tissues or body fluids can be measured using an anti-ERdj8 antibody, and the presence or absence of abnormal substance accumulation in cells due to abnormal autophagy can be detected.

  The present invention relates to the accumulation of abnormal substances in cells using as an index the (a) the activity of suppressing the autophagy activity suppression function of ERdj8, or the (b) the activity of suppressing the expression level of ERdj8. A screening method for screening a candidate substance for a therapeutic agent for a disease associated with

  One aspect of the screening method of the present invention uses “the activity of suppressing the expression level of ERdj8” possessed by the test substance as an index. That is, a substance having the activity is expected to have an action of promoting autophagy or an action of recovering (releasing the suppression) of suppressed autophagy, and a therapeutic agent for diseases accompanied by abnormal substance accumulation in cells. Can be a candidate substance.

  Also in this embodiment, “expression level of ERdj8” includes both the expression level at the transcription level (mRNA amount) and the expression level at the translation level (protein amount). That is, both the amount of transcription product and the amount of translation product of ERdj8 gene or its alternative gene (reporter gene etc.) can be the expression level of ERdj8.

  The method for measuring the amount of mRNA is not particularly limited as long as it is a method capable of measuring the amount of mRNA of the corresponding gene. For example, the RT-PCR method, quantitative PCR method, Northern blot method, DNA microarray method, etc. are used. be able to.

  The method for measuring the amount of protein is not particularly limited as long as it can specifically measure the protein encoded by the corresponding gene. For example, an immunoassay method such as ELISA, a Western blot method, or the like can be used. it can.

  When using the expression level of ERdj8 as an indicator, a reporter gene can be used. That is, the expression level of ERdj8 can be grasped from the expression level of the reporter gene operably linked downstream of the promoter of the ERdj8 gene.

  The ERdj8 gene promoter is a region on the DNA that regulates the expression of the ERdj8 gene in the cell, and refers to a region in which the expression of the ERdj8 gene is induced by binding of a transcription factor.

  “Functionally linked” refers to a linkage mode in which a gene linked downstream of a promoter can be expressed under the control of the promoter. That is, the reporter gene operably linked downstream of the promoter of the ERdj8 gene is transcribed under the control of the promoter and then translated.

  As the reporter gene, those generally used in the field of biotechnology can be employed. For example, a gene encoding luciferase, green fluorescent protein (GFP), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT) can be employed.

Preferred embodiments include the following (i) and (ii):
(I) contacting a test substance with a cell having a reporter gene operably linked downstream of the promoter of the ERdj8 gene or an extract of the cell;
(Ii) measuring the expression level of the reporter gene in the cell contacted with the test substance in step (i) or the extract of the cell,
And the above screening method.

  As a specific example of the step (i) in this embodiment, a reporter gene is operably linked downstream of the promoter of the ERdj8 gene, incorporated into an appropriate vector, and further introduced into an appropriate cell. Then, a test substance is brought into contact with these cells (recombinant cells). Examples of the method of bringing a test substance into contact with cells include culturing the cells in a medium containing the test substance. Other examples include adding a test substance to a cell suspension or cell extract.

  In step (ii), the expression level of the reporter gene is measured. For example, if the reporter gene is a luciferase gene, the activity of the expression product luciferase can be detected with fluorescence. If the reporter gene is a GFP gene, the expression product GFP can be detected with fluorescence. If the reporter gene is a GUS gene, the activity of the expression product GUS can be detected with color development such as glucuron. If the reporter gene is a CAT gene, the activity of the expression product CAT can be detected by acetylation of chloramphenicol.

  Separately, in step (i), a control is set so that the test substance is not brought into contact with cells or the like, and the expression level in that case is set as a reference value. And the measured value when a test substance is made to contact a cell etc. is compared with the said reference value.

  The gene linked downstream of the promoter of ERdj8 may be a fusion gene of a part or full length of ERdj8 gene and a reporter gene.

It is also possible to use the ERdj8 gene as it is without using the reporter gene. That is, the expression level of ERdj8 can be grasped by measuring the amount of the transcription product (mRNA amount) or translation product (ERdj8 protein) of the ERdj8 gene linked downstream of the promoter.
In addition, the ERdj8 gene in this case may be a gene encoding a functional fragment of ERdj8 in addition to the gene encoding the full length of ERdj8. The functional fragment of ERdj8 will be described later.

  Another aspect of the screening method of the present invention is based on “suppressing the autophagy activity suppression function of ERdj8” possessed by the test substance. In other words, a substance having the activity is expected to have an action of restoring suppressed autophagy (releasing the suppression), and can be a candidate substance for a therapeutic drug for a disease accompanied by intracellular abnormal substance accumulation.

  For example, the screening method of the present invention can be performed by measuring the activity of the ERdj8 when the test substance is brought into contact with the isolated ERdj8. “Activity of ERdj8” is, for example, an autophagy activity suppression function. As an alternative to the autophagy activity suppression function, there is a possibility of inhibiting the dissociation of the autophagosome from the endoplasmic reticulum membrane.

  Isolated ERdj8 can be prepared using, for example, the ERdj8 gene shown in SEQ ID NO: 2.

  Isolated ERdj8 includes a functional fragment of ERdj8 in addition to the full length of ERdj8. Here, the “functional fragment of ERdj8” refers to a polypeptide having a partial sequence of ERdj8, which retains activity as ERdj8 (for example, autophagy activity suppression function).

The isolated ERdj8 includes mutants and modifications of ERdj8 that can be regarded as substantially equivalent to natural ERdj8.
For example, it is encoded by DNA that hybridizes under stringent conditions with DNA comprising a nucleotide sequence complementary to DNA having the nucleotide sequence represented by SEQ ID NO: 2 (cDNA of human ERdj8) and has activity as ERdj8 The isolated protein is included in the isolated ERdj8 in this embodiment. Here, the stringent conditions are the conditions of “0.1 × SSC solution (composition of 1 × concentration SSC solution is 150 mM sodium chloride, 15 mM sodium citrate), 1% SDS, 65 ° C., 24 hours”. Say.
As another example, in the amino acid sequence represented by SEQ ID NO: 3 (human ERdj8), a protein comprising an amino acid sequence in which 1 to 10 amino acids are deleted, substituted or added, and having activity as ERdj8, Included in the isolated ERdj8 in this embodiment.
As yet another example, an amino acid sequence having a homology of 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more with the amino acid sequence represented by SEQ ID NO: 3 (human ERdj8) A protein having an activity as ERdj8 is also included in the isolated ERdj8 in this embodiment.

  An example of a disease associated with abnormal substance accumulation in cells is a neurodegenerative disease. Specific examples include Alzheimer's disease, Parkinson's disease, Lewy body dementia, frontotemporal lobar degeneration, spinocerebellar degeneration. Other examples of diseases with abnormal substance accumulation in cells include type 1 diabetes and type 2 diabetes. Other examples include age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, Crohn's disease, and the like.

  This invention includes the autophagy activity promoter which contains the substance which suppresses the autophagy activity suppression function which ERdj8 has as an active ingredient. For example, the present autophagy activity promoter can be used to promote autophagy activity in eukaryotic organisms and cells derived therefrom. Moreover, this autophagy activity promoter can also be used for purposes other than human treatment. The present autophagy activity promoter can also have the same embodiment as the therapeutic agent of the present invention described above. For example, the active ingredient of the present autophagy activity promoter may be a low molecular compound, a peptide or an antibody.

  Furthermore, this invention includes the autophagy activity inhibitor which contains the nucleic acid which codes ERdj8 or ERdj8 as an active ingredient. The autophagy activity inhibitor containing the nucleic acid as an active ingredient can be, for example, a vector in which the nucleic acid is incorporated.

  The present invention includes a method for treating a disease associated with intracellular abnormal substance accumulation, which comprises administering a substance that suppresses the expression of ERdj8. The present invention also includes a method for treating a disease associated with abnormal substance accumulation in cells, which comprises administering a substance that suppresses the autophagy activity suppressing function of ERdj8.

  The present invention also includes a substance that suppresses the expression of ERdj8, which is used for treatment of a disease associated with abnormal substance accumulation in cells. Moreover, this invention includes the substance which suppresses the autophagy activity suppression function which ERdj8 has used for the treatment of the disease which accompanies abnormal substance accumulation | storage in a cell.

  The present invention also includes the use of a substance that suppresses the expression of ERdj8 for the manufacture of a therapeutic drug for diseases associated with abnormal substance accumulation in cells. The present invention also includes the use of a substance that suppresses the autophagy activity-suppressing function of ERdj8 for the manufacture of a therapeutic drug for diseases associated with intracellular abnormal substance accumulation.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

(1) Production of human ERdj8-specific siRNA
Two human ERdj8-specific siRNAs were generated using Lifetechnologies Stealth RNAi ^™ siRNA. As sequences (sense) specific to human ERdj8, GAUUGGUGCUUUAGCUGCAUUCAUA (SEQ ID NO: 4) and GAUUGGGAGUGAGAGUGACAAAUUU (SEQ ID NO: 5) were employed. Hereinafter, siRNA employing SEQ ID NO: 4 is referred to as “siRNA # 2”, and siRNA employing SEQ ID NO: 5 is referred to as “siRNA # 3”.

(2) Knockdown of ERdj8 in HeLa cells <1>
Using LipofectamineRNAiMAX (Invitrogen), the human ERdj8-specific siRNA (siRNA # 2 or siRNA # 3) prepared in (1) above was introduced into HeLa cells simultaneously with seeding. After culturing for 72 hours, the cells were collected and solubilized with Lysis Buffer containing 1% NP40. After centrifugation at 15000 rpm at 4 ° C., the soluble fraction was solubilized by adding Laemmli Sample buffer and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE).
The gel after SDS-PAGE was transferred to a PVDF membrane, blocked for 1 hour at room temperature using BlockingOne (Nacalai Tesque), and then Western blotted. For detection of ERdj8, an anti-DNAJC16 antibody (Cosmo Bio) was used. For detection of LC3 type 1, an anti-LC3 type 1 antibody (MBL) was used. For detection of LC3 type 2, an anti-LC3 type 2 antibody (MBL) was used. Detection was performed with LAS4000 (Fuji Film) using ECL (GE Healthcare) as a detection reagent.
As a control, the same experiment was performed using HeLa cells into which Stealth RNAi siRNA negative control lo GC (ThermoFisher) was introduced.

The results are shown in FIG. That is, significant accumulation of LC3, an autophagosome marker, was observed in HeLa cells into which human ERdj8-specific siRNA was introduced and the expression level of ERdj8 was suppressed.
From the above, it was strongly suggested that autophagy is promoted by suppressing the expression level of ERdj8. Moreover, it was strongly suggested that ERdj8 is a factor that negatively controls autophagy.

(3) Knockdown of ERdj8 in HeLa cells <2>
In the same manner as in (2) above, human ERdj8-specific siRNA was introduced into HeLa cells. After 72 hours of culture, the cells were fixed with 4% paraformaldehyde. Membrane permeabilization was performed with 50 μg / mL digitonin, blocking was performed for 1 hour at room temperature using BlockingOne (Nacalai Tesque), and then intracellular LC3 was stained using anti-LC3 antibody (MBL). For observation, an LSM700 confocal laser microscope (Carl Zeiss) was used. ZEISS microscope software ZEN (Carl Zeiss) was used for analysis of the acquired image.
As a control, the same experiment was performed using HeLa cells into which Stealth RNAi siRNA negative control lo GC (ThermoFisher) was introduced.

The results are shown in FIG. That is, in HeLa cells into which human ERdj8-specific siRNA was introduced, significant accumulation of LC3 was observed in the cells.
From the above, it was strongly suggested that autophagy is promoted by suppressing the expression level of ERdj8. Moreover, it was strongly suggested that ERdj8 is a factor that negatively controls autophagy.

(4) Knockdown of ERdj8 in HeLa cells stably expressing tfLC3
Using LipofectamineRNAiMAX (Invitrogen), human ERdj8-specific siRNA # 2 prepared in (1) above was introduced into tfLC3 stably expressing HeLa cells simultaneously with seeding. After culturing for 72 hours, the cells were fixed with 4% paraformaldehyde, and then the cells were solidified using a mounting agent. Observation was performed using a DeltaVision fluorescence microscope (GE Healthcare). Image J was used for the acquired image analysis.
As a control, a similar experiment was performed using tLaC3 stably expressing HeLa cells into which no siRNA was introduced.
TfLC3 is a fusion protein (mCherry-GFP-LC3) in which mCherry and GFP are tandemly linked to LC3. tfLC3 emits red and green fluorescence in autophagosomes that are not fused with lysosomes, whereas it emits only red fluorescence in autolysosomes after being fused with lysosomes.

The results are shown in FIGS. In other words, in the tfLC3 stably expressing HeLa cells into which siRNA was introduced, many red-only fluorescence was observed (photo on the right side of FIG. 3). This indicates that a large amount of LC3 is accumulated in the lysosome, and autophagy was thought to be significantly promoted.
The proportion of cells observed that contained autolysosomes in all the observed cells was 24% in the control without siRNA introduction, but reached 89% with siRNA introduction (FIG. 4).
From the above, it was strongly suggested that ERdj8 negatively controls autophagy.

(5) Knockdown of ERdj8 in HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein <1>
Using LipofectamineRNAiMAX (Invitrogen), human ERdj8-specific siRNA # 3 prepared in (1) above was introduced into EYFP fluorescent protein-fused Poly143Q protein stably expressing HeLa cells simultaneously with seeding. After culturing for 72 hours, the cells were collected and sampled by directly adding Laemmli Sample buffer. A dot blot was performed on the PVDF membrane, and the accumulation of PolyQ protein was quantified with an anti-GFP antibody (MBL).

Further, the sample was subjected to SDS-PAGE, then transferred to a PVDF membrane, and Western blotting was performed. For detection of ERdj8, an anti-DNAJC16 antibody (Cosmo Bio) was used. For detection of LC3, an anti-LC3 antibody (MBL) was used. For detection of tubulin, an anti-tubulin antibody (using Millipore) was used.
Detection was performed with LAS4000 (Fuji Film) using ECL (GE Healthcare) as a detection reagent for dot plots and Western blots.
As a control, the same experiment was conducted using EYFP fluorescent protein-fused Poly143Q protein stably expressing HeLa cells into which no siRNA was introduced.

  The results are shown in FIG. That is, in the cells into which human ERdj8-specific siRNA was introduced, the PolyQ protein known as a substrate for autophagy was significantly reduced. From the above, it was strongly suggested that autophagy might be enhanced by knockdown of ERdj8.

(6) ERdj8 knockdown <2> in HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein
In the same manner as in (5) above, human ERdj8-specific siRNA # 3 was introduced into HeLa cells that stably expressed EYFP fluorescent protein-fused Poly143Q protein. After culturing for 72 hours, the cells were fixed with 4% paraformaldehyde, and then the cells were solidified using a mounting agent. For observation, an LSM700 confocal laser microscope (Carl Zeiss) was used. ZEISS microscope software ZEN (Carl Zeiss) was used for analysis of the acquired image.
As a control, Stealth RNAi siRNA negative control lo GC (ThermoFisher) was introduced as a control, and the same experiment was performed using EYFP fluorescent protein-fused Poly143Q protein stably expressing HeLa cells.

  The results are shown in FIGS. That is, in the cells into which human ERdj8-specific siRNA was introduced, the PolyQ protein (white point) known as an autophagy substrate was significantly reduced (FIG. 6). The number of PolyQ protein aggregates per cell was about 0.17 in the control, whereas it was about 0.05 in the cells into which human ERdj8-specific siRNA was introduced (FIG. 7). From the above, it was strongly suggested that autophagy might be enhanced by knockdown of ERdj8.

(7) Overexpression of ERdj8 in HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein <1>
Using Lipofectamine 2000 (Invitrogen), a plasmid (origene) for expressing a fusion protein (ERdj8-RFP) of human ERdj8 and RFP simultaneously with seeding into HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein did.
After culturing for 24 hours, the cells were collected and sampled by directly adding Laemmli Sample buffer. A dot blot was performed on a cellulose acetate membrane, and the accumulation of PolyQ protein was quantified with an anti-GFP antibody (MBL).
Further, the sample was subjected to SDS-PAGE, then transferred to a PVDF membrane, and Western blotting was performed. For detection of ERdj8, an anti-DNAJC16 antibody (Cosmo Bio) was used. For detection of tubulin, an anti-tubulin antibody (using Millipore) was used.
Detection was performed with LAS4000 (Fuji Film) using ECL (GE Healthcare) as a detection reagent for dot plots and Western blots.
As a control, a similar experiment was performed using a plasmid expressing only RFP.

The results are shown in FIG. That is, PolyQ protein was remarkably increased in cells into which a plasmid expressing ERdj8-RFP was introduced.
These results strongly suggested that ERdj8 overexpression inhibits basal level autophagy activity.

(8) Overexpression of ERdj8 in HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein <2>
In the same manner as in (7) above, a plasmid for expressing ERdj8-RFP was introduced into HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein.
After culturing for 24 hours, the cells were fixed with 4% paraformaldehyde, and then fluorescence of ERdj8 and PolyQ was observed. For observation, an LSM700 confocal laser microscope (Carl Zeiss) was used. ZEISS microscope software ZEN (Carl Zeiss) was used for analysis of the acquired image.
As a control, a similar experiment was performed using a plasmid expressing only RFP.

The results are shown in FIGS. That is, accumulation of PolyQ aggregates was observed in cells into which a plasmid expressing ERdj8-RFP was introduced (FIG. 9). The number of PolyQ protein aggregates per cell was about 0.29 in the control, and about 41.4 in the human ERdj8 overexpressing cells (FIG. 10).
These results strongly suggested that ERdj8 overexpression inhibits basal level autophagy activity.

(9) Overexpression of ERdj8 in neurocytoma SK-N-SH cells
Using Lipofectamine2000 (Invitrogen), SK-N-SH cells were introduced with a plasmid (Kazusa DNA Laboratory) for expressing a fusion protein (ERdj8-Flag) of human ERdj8 and Flag at the same time as seeding. .
After culturing for 48 hours, the cells were fixed with 4% paraformaldehyde, and then the cells were solidified using a mounting agent. For observation, an LSM700 confocal laser microscope (Carl Zeiss) was used. ZEISS microscope software ZEN (Carl Zeiss) was used for analysis of the acquired image.
As a control, the same experiment was performed using SK-N-SH cells into which a plasmid having no inserted gene was introduced.

  The results are shown in FIG. That is, accumulation of endogenous ubiquitin protein was observed in SK-N-SH cells into which the expression plasmid of ERdj8-Flag was introduced. This result shows that ubiquitinated proteins that are steadily degraded in the cell accumulated significantly due to overexpression of ERdj8, and that ERdj8 steadily controls autophagy negatively. It was suggested. Moreover, since it is said that inductive autophagy does not occur in nerve cells, it was considered that ERdj8 can negatively control stationary autophagy.

(10) Localization of lysosome and PolyQ during ERdj8 overexpression using HeLa cells with stable expression of EYFP fluorescent protein-fused Poly143Q protein
Using Lipofectamine 2000 (Invitrogen), a plasmid (origene) for expressing a fusion protein (ERdj8-RFP) of human ERdj8 and RFP simultaneously with seeding into HeLa cells stably expressing EYFP fluorescent protein-fused Poly143Q protein did.
After culturing for 24 hours, the cells were further treated with E64d and Pepstatin A, which are inhibitors of degrading enzymes in lysosomes, and then stained with Lysotraker (Molecular probes). After fixing the cells with 4% paraformaldehyde, the cells were solidified using a mounting agent. For observation, an LSM700 confocal laser microscope (Carl Zeiss) was used. ZEISS microscope software ZEN (Carl Zeiss) was used for analysis of the acquired image.
As a control, a similar experiment was performed using a plasmid expressing only RFP.

The results are shown in FIGS. That is, the PolyQ protein aggregate produced by inhibiting the activity of degrading enzyme in the lysosome no longer co-localizes with the lysosome in ERdj8 overexpressing cells (FIG. 12). The ratio of PolyQ protein aggregates co-localized with lysosomes was about 85% in the control, but about 18% in the ERdj8 overexpressing cells (FIG. 13).
From the above, it was strongly suggested that ERdj8 inhibits the fusion of autophagosome and lysosome.

(11) Knockdown of dnj8 against nematode individuals stably expressing GFP :: LGG1 <1>
Nematodes that stably express GFP :: LGG1 (LC3 homolog in mammalian cells) in the gonad were fed with E. coli expressing dnj8 (ERdj8 homolog) -specific siRNA, and dnj8 was knocked down. Changes in GFP :: LGG1 in the gonads in the next generation were observed with a confocal laser microscope LSM700.
As a control, a similar experiment was performed using a nematode fed with E. coli that does not express siRNA as a bait.

The results are shown in FIGS. That is, the dots of LGG1 were remarkably accumulated in the nematode individuals in which dnj-8 was knocked down (FIG. 14). The number of LGG1 dots per nematode was about 15 for the control nematode, but about 30 for the nematode knocked down with dnj-8 (FIG. 15).
Thus, in the individual animal, LGG1 as an autophagy marker was markedly accumulated by knocking down ERdj8 in the same manner as in cultured cells, strongly suggesting that autophagy was promoted.

(12) Knockdown of dnj8 against nematode individuals stably expressing GFP :: poly40Q <2>
E. coli expressing dnj8-specific siRNA was fed to a nematode that stably expresses GFP :: poly40Q in a muscle (a neurodegenerative disease model nematode), and dnj8 was knocked down. Changes in GFP :: LGG1 in muscle in the next generation were observed with a confocal laser microscope LSM700.
As a control, a similar experiment was performed using a nematode fed with E. coli that does not express siRNA as a bait.

  The results are shown in FIG. That is, the number of PolyQ protein aggregates was significantly reduced in the nematode individuals in which dnj8 was knocked down. Specifically, the number of PolyQ protein aggregates per cell was about 42 in the control nematode but about 31 in the nematode knocked down with dnj8. This strongly suggested that autophagy was promoted by knockdown of ERdj8 in nematode individuals.

(13) Knockdown of dnj8 against nematode individuals stably expressing GFP :: poly79Q GFP :: poly79Q is a nematode (neurodegenerative disease model nematode) that stably expresses muscular E. coli expressing dnj8-specific siRNA. It was given as food and knocked down dnj8. Recovery of the movement of GFP :: poly79Q-expressing nematodes at the time of adults was observed with a fluorescence microscope SZX16 (Olympus), and analysis of changes in movement was performed with MetaMorph (Molecular Devices). Specifically, the movement distance of each nematode for 60 seconds after 24 hours, 48 hours, and 72 hours after the siRNA was given to the nematode was measured.
As a control, a similar experiment was performed using a nematode fed with E. coli that does not express siRNA as a bait.

The results are shown in FIG. That is, the motor function was still lost in the control nematode, whereas the motor function was restored in the nematode knocked down with dnj8. The recovery of motor function was particularly remarkable at 72 hours after siRNA was given to the nematode.
It was considered that autophagy was promoted by knocking down dnj8, so that degradation of the PolyQ protein by autophagy was promoted, and the motor function of the nematode was restored. This result means recovery of the neurodegenerative disease that develops in PolyQ-expressing nematodes.

Claims (13)

  A therapeutic agent for diseases associated with abnormal substance accumulation in cells, comprising as an active ingredient a substance that suppresses the expression of ERdj8.   A therapeutic agent for a disease associated with accumulation of abnormal substances in cells, comprising as an active ingredient a substance that suppresses the autophagy activity suppressing function of ERdj8.   The therapeutic agent according to claim 2, wherein the autophagy is basal type autophagy.   The disease accompanied by abnormal substance accumulation in the cell is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease The therapeutic agent according to any one of claims 1 to 3.   The therapeutic agent according to any one of claims 1 to 4, wherein the substance that suppresses the expression of ERdj8 or the substance that suppresses the autophagy activity suppressing function of ERdj8 is a nucleic acid.   The therapeutic agent according to claim 5, wherein the nucleic acid is siRNA, shRNA, nucleic acid aptamer, or antisense nucleic acid.   A biomarker for detecting a disease accompanied by accumulation of abnormal substances in cells, comprising ERdj8.   The disease accompanied by accumulation of abnormal substances in the cell is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease 8. The biomarker according to claim 7, wherein   A diagnostic agent for use in detection of a disease associated with abnormal substance accumulation in a cell, including a substance that specifically binds to ERdj8.   The diagnostic agent according to claim 9, wherein the substance that specifically binds to ERdj8 is an anti-ERdj8 antibody.   The disease accompanied by abnormal substance accumulation in the cell is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease The diagnostic agent according to claim 9 or 10, wherein: The test substance has,
(A) the activity of suppressing the autophagy activity suppressing function of ERdj8, or
(B) the activity of suppressing the expression level of ERdj8,
A screening method comprising screening a candidate substance for a therapeutic drug for a disease associated with abnormal substance accumulation in a cell, using as an index.   The disease accompanied by abnormal substance accumulation in the cell is neurodegenerative disease, type 1 diabetes, type 2 diabetes, age-related macular degeneration, hepatitis, myotonic dystrophy, amyotrophic lateral sclerosis, or Crohn's disease The screening method according to claim 12.