JP2018131391A - Micro rna formation inhibitor and method for producing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel micro RNA formation inhibitor.SOLUTION: A micro RNA formation inhibitor contains, for example, the following compound [where R3 and R4 are independently selected from a primary amine residue, a secondary amine residue and a tertiary amine residue].SELECTED DRAWING: None

Description

  The present invention relates to a microRNA formation inhibitor. The present invention also relates to a method for producing a microRNA formation inhibitor.

  A microRNA (microRNA; miRNA) is a single-stranded RNA consisting of about 20 nucleotides, and has a function of binding to mRNA having a complementary sequence and inhibiting translation of the mRNA into a polypeptide. Yes. This function plays an important role in various life phenomena such as canceration, differentiation and development. Therefore, by regulating the function of miRNA, it becomes possible to regulate the life phenomenon related to miRNA as described above.

  As a conventional technique for regulating the function of miRNA, there is a method using an oligonucleotide that binds to a target miRNA. For example, Non-Patent Document 1 synthesizes an oligonucleotide called antagomir and reports that the oligonucleotide inhibits the function of mouse endogenous miRNA.

  As another method for regulating the function of miRNA, there is a method of targeting a miRNA precursor in the maturation process. This method inhibits the formation of miRNA by inhibiting an enzyme that acts on pri-miRNA or pre-miRNA (both are microRNA precursors) (see Non-Patent Document 2).

Krutzfeldt J et. Al. (2005) "Silencing of microRNAs in vivo with 'antagomirs'" Nature, vol.438 (issue 7068), pp.685-689 Schoniger C et. Al. (2013) "Perspectives in targeting miRNA function" Bioorganic & Medicinal Chemistry, vol.21 (No.20), pp.6115-6118

  However, a lot of room for development remains in the conventional technology for regulating the function of miRNA, and the development of a new technology for regulating the function of miRNA has been desired.

  In view of the above-described prior art, an object of one embodiment of the present invention is to provide a novel microRNA formation inhibitor.

  As a result of intensive studies to achieve the above object, the present inventors have found that a compound having a specific basic skeleton inhibits the formation of microRNA, and have completed the present invention. That is, the present invention has the following configuration.

  <1> A microRNA formation inhibitor containing at least one of the compounds represented by the following chemical formulas 1 to 6.

[Wherein, R ¹ and R ² in Chemical Formula 1 are each independently selected from a primary amine residue, a secondary amine residue, and a tertiary amine residue, and X in Chemical Formula 3 is the number of carbon atoms. The linker may have an aryl moiety, R ^{5 in} Chemical Formula 4 is a hydrogen atom or an amino group, A is a methylene group or an acyl group, and m is 0 R ^{6 in} Chemical Formula 5 is a hydrogen atom or an amino group, n is a natural number in 0 to 10, and “*” and “*” in Chemical Formula 6 are those having 1 to 10 carbon atoms. 10 linkers may be connected to each other, and the linker may have a double bond or a triple bond. ].

  <2> The precursor of the microRNA has a bulge structure, a UGG / UGG mismatch structure, a GGGUGGGAGGU sequence (SEQ ID NO: 22) located in the loop portion and / or a UGG sequence located in the loop portion, <1 > The microRNA formation inhibitor described in>.

  <3> The microRNA formation inhibitor according to <1> or <2>, wherein the microRNA precursor has a cytosine bulge structure.

  <4> The microRNA formation inhibitor according to any one of <1> to <3>, wherein the compound is represented by the following chemical formula 7.

  [Wherein R3 and R4 are each independently selected from primary amine residues, secondary amine residues and tertiary amine residues. ].

  <5> A method for producing a microRNA formation inhibitor comprising a step of preparing a microRNA formation inhibitor using at least one compound among the compounds represented by the following chemical formulas 1 to 6.

[Wherein, R ¹ and R ² in Chemical Formula 1 are each independently selected from a primary amine residue, a secondary amine residue, and a tertiary amine residue, and X in Chemical Formula 3 is the number of carbon atoms. The linker may have an aryl moiety, R ^{5 in} Chemical Formula 4 is a hydrogen atom or an amino group, A is a methylene group or an acyl group, and m is 0 R ^{6 in} Chemical Formula 5 is a hydrogen atom or an amino group, n is a natural number in 0 to 10, and “*” and “*” in Chemical Formula 6 are those having 1 to 10 carbon atoms. 10 linkers may be connected to each other, and the linker may have a double bond or a triple bond. ].

  According to one embodiment of the present invention, a novel microRNA formation inhibitor is provided.

(A) is a figure which shows the structure of pre-miRNA-29a (sequence number 1). (B) is an electrophoresis image showing the inhibitory effect of pre-miRNA-29a cleavage reaction by BzDANP (no labeling with radioactive element). (C) is an electrophoretic image showing the inhibitory effect of pre-miRNA-29a cleavage reaction by BzDANP (labeled with a radioactive element). (D) is an electrophoretic image showing the inhibitory effect of the pre-miRNA-29a cleavage reaction by the BzDANP aminoalkyl linker derivative (not labeled with a radioactive element). (E) is an electrophoretic image showing the inhibitory effect of pre-miRNA-29a cleavage reaction by the BzDANP aminoalkyl linker derivative (labeled with a radioactive element). (A) is a figure which shows the structure of pre-miRNA-136 (sequence number 2). (B) is an electrophoretic image showing changes over time in the cleavage reaction of pre-miRNA-136 in the absence of BzDANP. (C) is an electrophoretic image showing changes over time in the cleavage reaction of pre-miRNA-136 in the presence of BzDANP. (D) is a graph plotting the initial concentration of the substrate concentration and the reaction rate. (A) is the figure which shows the structure of the adenine bulge variant (sequence number 3) of pre-miRNA-29a, and the electrophoresis image which shows the inhibitory effect of the cutting | disconnection reaction of the said variant by BzDANP. (B) is a figure which shows the structure of the guanine bulge mutant (sequence number 4) of pre-miRNA-29a, and the electrophoresis image which shows the inhibitory effect of the cutting | disconnection reaction of the said mutant by BzDANP. (C) is a figure which shows the structure of the uracil bulge mutant (sequence number 5) of pre-miRNA-29a, and the electrophoresis image which shows the inhibitory effect of the cutting reaction of the said mutant by BzDANP. (D) is a graph which shows the inhibitory effect of cleavage reaction by BzDANP in pre-miRNA-29a which has various bulge structures, or its variant. (A) is the figure which shows the structure of pre-miRNA-21 (sequence number 6), and the electrophoresis image which shows the inhibitory effect of the cleavage reaction of said miRNA by BzDANP. (B) is a diagram showing the structure of pre-miRNA-760 (SEQ ID NO: 7) and an electrophoretic image showing the inhibitory effect of the cleavage reaction of the miRNA by BzDANP. (A) is a figure which shows three types of hairpin type | mold artificial RNA (sequence number 8-10). (B) is a diagram showing three types of hairpin artificial RNAs (SEQ ID NOs: 11 to 13) in which the sequence of the hairpin artificial RNA shown in (a) is partially changed and UGG / UGG mismatch structures are introduced. It is. (A) is an electrophoretic image which shows the inhibitory effect of the cleavage reaction by NCD about six types of hairpin type | mold artificial RNA shown by FIG. (B) is an electrophoretic image showing the inhibitory effect of (Z) -NCTS on the cleavage reaction for the six types of hairpin artificial RNA shown in FIG. (A) is an electrophoretic image showing the inhibitory effect of the cleavage reaction depending on the concentration of NCD for the three types of hairpin artificial RNAs having the UGG / UGG mismatch structure shown in (b) of FIG. (B) is an electrophoretic image showing the inhibitory effect of the cleavage reaction depending on the concentration of (Z) -NCTS for the three types of hairpin artificial RNAs having the UGG / UGG mismatch structure shown in (b) of FIG. It is. (A) is a figure which shows the structure of pre-miRNA-432g (left, sequence number 14) and pre-miRNA-1587gu (right, sequence number 15) which are endogenous pre-miRNA which has a UGG / UGG mismatch structure. It is. (B) is an electrophoresis image showing the inhibitory effect of (Z) -NCTS and (E) -NCTS on the pre-miRNA-432g cleavage reaction and the pre-miRNA-1587gu cleavage reaction. (A) is a figure which shows the structure of pre-miRNA-143 (sequence number 16). (B) is an electrophoretic image showing the inhibitory effect of pre-miRNA-143 cleavage reaction by ND-link. (C) is an electrophoretic image showing the inhibitory effect of pre-miRNA-143 cleavage reaction by ND. (A) is a figure which shows the general structure of a pre-miRNA-29a loop variant. The sequence and structure of the stem part are almost the same as that of pre-miRNA-29a, whereas the base sequence of the loop part is different from that of pre-miRNA-29a. (B) is a diagram showing the structure of various loop variants (upper, SEQ ID NOs: 17 to 20), and an electrophoretic image (lower) showing the inhibitory effect of the cleavage reaction of the loop variant by RND-link. . (A) is a figure which shows the structure of the pre-miRNA-29a loop variant (sequence number 21) used in Example 10. FIG. (B) is an electrophoretic image showing the inhibitory effect of the above-mentioned loop mutant cleavage reaction by various CMBL3.

  An embodiment of the present invention will be described as follows, but the present invention is not limited to this. The present invention is not limited to each configuration described below, and various modifications can be made within the scope shown in the claims, and technical means disclosed in different embodiments and examples respectively. Embodiments and examples obtained by appropriately combining them are also included in the technical scope of the present invention. Moreover, all the literatures described in this specification are used as a reference in this specification.

  In the present specification, when “A to B” is described with respect to a numerical range, the description intends “A or more and B or less”.

[1. Background and technical idea of the present invention]
Before describing the configuration of the present invention, the discovery and technical idea behind the present invention will be described.

  In the method using an oligonucleotide disclosed in Non-Patent Document 1 described above, it is difficult to transport the oligonucleotide into a cell and an off-target effect occurs (for example, Krutzfeldt J et. Al. (2007 ) "Specificity, duplex degradation and subcellular localization of antagomirs" Nucleic Acids Research, vol.35 (No.9), pp.2885-2892).

  In the method of inhibiting microRNA in the maturation process disclosed in Non-Patent Document 2 described above, in many cases, a compound that binds to a precursor of a target microRNA is selected from known substances that bind to RNA. Obtained by screening.

  On the other hand, in one embodiment of the present invention, unlike the above-described method, a low molecular weight compound smaller than an oligonucleotide is selected as a microRNA formation inhibitor. This makes it easy to synthesize and modify as well as transport into the cell. Further, the low molecular weight compound is designed or selected from the molecular structure so that the binding affinity to the precursor of microRNA is high. In one embodiment, the low molecular weight compound has a structure such as a bulge structure, a UGG / UGG mismatch structure, a GGGUGGGAGGU (SEQ ID NO: 22) sequence located in the loop portion, a UGG sequence located in the loop portion, which the microRNA precursor has. In view of the above characteristics, the compound is selected as a compound that becomes a microRNA formation inhibitor.

[2. Compound〕
The microRNA formation inhibitor which concerns on one Embodiment of this invention contains at least 1 sort (s) among the compounds represented by Chemical formula 1-6.

  In one embodiment, the compound is represented by Formula 1.

In Chemical Formula 1, R ¹ and R ² are each independently selected from a primary amine residue, a secondary amine residue, and a tertiary amine residue.

Examples of the primary amine residue include —NH ₂ . Examples of the secondary amine residue include —NH (CH ₂ ) NH ₂ , —NH (CH ₂ ) ₂ NH ₂ , —NH (CH ₂ ) ₃ NH ₂ , —NH (CH) ₂ NH (CH _{3), - NH (CH)} 3 NH (CH 3) , and the like. Examples of the tertiary amine residue include —N (CH ₃ ) (CH ₂ ) ₂ NH ₂ .

Among the above-described structure, of R ₁ and R _2, it is preferable that at least one of which is a secondary amine residue, and more preferably both R ₁ and R ₂ is a secondary amine residue. If it is the said structure, the coupling | bonding of the compound represented by Chemical formula 1 and the bulge structure in RNA precursor will become strong, and the increase in the microRNA formation inhibitory effect can be anticipated.

  As an example of the preferable compound mentioned above, the compound represented by following Chemical formula 7 is mentioned.

In Chemical Formula 7, R ³ and R ⁴ are each independently selected from a primary amine residue, a secondary amine residue, and a tertiary amine residue.

Examples of the primary amine residue include —NH ₂ . Examples of the secondary amine residue include —NH (CH ₃ ), —NH (C ₂ H ₅ ) and the like. Examples of the tertiary amine residue, for _{example, -N (CH 3) 2,} -N (CH 3) (C 2 H 5) , and the like.

  Among the substances represented by Chemical Formula 7, as a preferable substance having a high ability to inhibit the formation of microRNA, BzDANP (IUPAC name: N, N′-Bis (3-aminopropyl) benzo [c ] [1,8] naphthyridine-3,6-diamine) and BzDANP aminoalkyl linker derivatives (IUPAC name: N, N'-Bis (3-dimethylaminopropyl) benzo [c] [1,8] naphthyridine-3,6- diamine).

  In one embodiment, the compound is NCD (IUPAC name: 2,2 ′-[Iminobis (trimethyleneoxycarbonylimino)] bis (7-methyl-1,8-naphthyridine)) represented by Chemical Formula 2.

  In one embodiment, the compound is represented by Formula 3.

  In Chemical Formula 3, X is a linker having 1 to 40 carbon atoms, and the linker may have an aryl moiety.

Among the compounds represented by Chemical Formula 3 described above, a substance having a high ability of inhibiting the formation of microRNA and a preferable substance includes a substance in which the structure of X is X ¹ or X ² shown below.

When X is ^{X 1,} substance represented by the chemical formula 3 (Z) -NCTS (IUPAC name: (Z) -4,4'-Bis [ bis [3 - [(7-methyl-1,8- naphthyridine-2-yl) carbamoyloxy] propyl] aminomethyl] stilbene). When X is ^{X 2,} material of Formula 3 (E) -NCTS (IUPAC name: (E) -4,4'-Bis [ bis [3 - [(7-methyl-1,8- naphthyridine-2-yl) carbamoyloxy] propyl] aminomethyl] stilbene).

  In one embodiment, the compound is represented by Formula 4.

R ^{5 in} Chemical Formula 4 is a hydrogen atom or an amino group. A is a methylene group (—CH ₂ —) or an acyl group (—C (═O) —). m is a natural number of 0-10.

  Among the compounds represented by the above-mentioned chemical formula 4, ND (naphthyridine dimer; IUPAC name: 3,3′-Iminobis [N- () represented by the following chemical formula is preferable as a preferable substance having a high ability to inhibit the formation of microRNA. 7-methyl-1,8-naphthyridine-2-yl) propionamide]) and ND-link (IUPAC name: 4-amino-N, N-bis (3-((7-methyl-1,8-naphthyridin-2 -yl) amino) -3-oxopropyl) butanamide).

  In one embodiment, the compound is represented by Formula 5.

In Chemical Formula 5, R ⁶ is a hydrogen atom or an amino group. Moreover, n is a natural number of 0-10.

  Among the compounds represented by the chemical formula 5 described above, RND-link (IUPAC name: 2,3-bis (7-amino-1) represented by the following chemical formula is preferable as a substance having a high ability to inhibit the formation of microRNA. , 8-naphthyridin-2-yl) -N- (3-aminopropyl) propanamide).

  In one embodiment, the compound is represented by Formula 6.

  In Chemical Formula 6, “*” and “*” are connected via a linker having 1 to 10 carbon atoms. The linker may have a double bond or a triple bond.

Among the compounds represented by Chemical Formula 4 described above, as a preferable substance having a high ability to inhibit the formation of microRNA, a connecting portion of “*” and “*” is represented by the following Chemical Formula Y ¹ , Y ² or Y ³ . The compound which is made is mentioned.

The compound in which the connecting part between “*” and “*” is Y ¹ is CMBL3aL. The compound in which the connecting part between “*” and “*” is Y ² is CMBL3bL. The compound in which the connecting part between “*” and “*” is Y ³ is CMBL3cL. The above CMBL3aL, CMBL3bL, and CMBL3cL are collectively referred to as CMBL3L.

  The aforementioned compounds can be synthesized by known techniques. For example, the compound represented by Formula 1 is [Murata A et. Al. (2016) "BzDANP, a Small-Molecule Modulator of Pre-miR-29a Maturation by Dicer" ACS Chemical Biology, vol.11 (issue 10), pp.2790-2796], the compound represented by Chemical Formula 2 is [Peng T et. al. (2005) "A new ligand binding to GG mismatch having improved thermal and alkaline stability" Bioorganic & Medicinal Chemistry Letters, vol.15 ( issue 2), pp.259-262], and the compound represented by Formula 3 is [Dohno C et. al. (2012) "Naphthyridine tetramer with a pre-organized structure for 1: 1 binding to a CGG / CGG sequence" Nucleic Acids Research, vol.40 (issue 6), pp.2771-2781], the compound represented by Chemical Formula 4 is [Nakatani K et. Al. (2001) "Recognition of Guanine-Guanine Mismatches by the Dimeric Form of 2 -Amino-1,8-naphthyridine "Journal of the American Chemical Society, vol. 123 (issue 50), pp. 12650-12657].

  Moreover, as a compound mentioned above, a commercially available compound may be used, and you may synthesize | combine by adding a modification with respect to a commercially available compound suitably.

  On the other hand, the compounds represented by Chemical Formulas 5 and 6 are compounds newly developed by the inventors. As an example of a method for synthesizing the compounds represented by Chemical Formulas 5 and 6, the methods used in [Synthesis Example 1] and [Synthesis Example 2] described later in this specification can be given.

[3. MicroRNA and MicroRNA Precursor]
The microRNA formation inhibitor according to one embodiment of the present invention inhibits microRNA formation.

  In the present specification, “microRNA (abbreviated as miRNA or miR)” means a short RNA (for example, 25 or less, preferably, having a function of binding to mRNA and inhibiting translation of the mRNA into a polypeptide). 23 or less, more preferably 22 or less nucleotide RNA). The microRNA formation inhibitor according to one embodiment of the present invention only needs to have a function of inhibiting the formation of microRNA as defined above, and is a multi-step process in which microRNA is formed from a microRNA precursor. Any of the steps may be inhibited.

  The precursor of microRNA has a stem-loop structure (stem hairpin) composed of a stem part in which hydrogen bonds are often seen between complementary base pairs and a loop part in which such hydrogen bonds are not seen. (See, for example, FIG. 1A. The loop from the 25th U to the 35th U). In addition, not all bases included in the stem part form hydrogen bonds with complementary base pairs, “Bulge” where there is no opposite base, “No opposite base pair” There may also be structures such as “mismatch”.

  In one embodiment, the precursor of the microRNA has a bulge structure, a UGG / UGG mismatch structure, a GGGUGGGAGGU sequence (SEQ ID NO: 22) located in the loop portion, and / or a UGG sequence located in the loop portion. The effect of the microRNA formation inhibitor according to one embodiment of the present invention tends to appear in the precursor of microRNA containing the above structure.

  In microRNA, pri-RNA (primary RNA), which is a primary transcript of DNA, is cleaved by RNA cleaving enzyme Drosha to become pre-RNA (precursor RNA), and pre-RNA is cleaved by RNA cleaving enzyme Dicer. Thus, it is synthesized in vivo. As used herein, “microRNA precursor” means the pri-RNA and the pre-RNA.

  In one embodiment, the microRNA precursor has a bulge structure. Here, the “bulge structure” is a bulge that occurs due to the presence of extra nucleotides in one strand of polynucleotide in a region where the polynucleotide (eg, RNA and DNA) has a double-stranded structure. (Bulge) is intended.

  For example, when “UCU” and “AA” face each other to form a double strand, two “U” in “UCU” and two “A” in “AA” pair with each other. To form a double strand. At this time, since “C” existing between two “U” has no nucleotide to be paired, the “C” is expanded. This swollen structure is a bulge structure.

  As in the above example, a bulge structure formed when the excess base is C (cytosine) is referred to as “cytosine bulge structure (C bulge structure)” in this specification. Similarly, when the surplus base is A (adenine), G (guanine) or U (uracil), “adenine bulge structure (A bulge structure)”, “guanine bulge structure (G bulge structure)”, “uracil bulge structure ( U bulge structure) ”.

  In one embodiment, the bulge structure is preferably a cytosine bulge structure. In particular, when the microRNA formation inhibitor according to one embodiment of the present invention contains a compound represented by Chemical Formula 1, the microRNA precursor preferably has a bulge structure, More preferably, it has a cytosine bulge structure. The compound represented by Chemical Formula 1 is considered to bind to a bulge structure, particularly a cytosine bulge structure, and inhibit the formation of microRNA.

  The position of the bulge structure is not particularly limited in the structure of the microRNA precursor.

  In one embodiment, the microRNA precursor has a UGG / UGG mismatch structure. Here, “UGG / UGG mismatch structure” refers to sequences “5′-UGG-3 ′” and “3′-GGU-5 ′” in a double-stranded polynucleotide (eg, RNA). "Means a structure in which hydrogen bonds between the central Gs are weakened. More specifically, see FIG.

  When the precursor of microRNA has the above UGG / UGG mismatch structure, the microRNA formation inhibitory effect of the compounds represented by Chemical Formula 2 and Chemical Formula 3 is particularly increased.

  The position of the UGG / UGG mismatch structure is not particularly limited in the structure of the microRNA precursor.

  In one embodiment, the microRNA precursor has a GGGUGGGAGGU (SEQ ID NO: 22) sequence located in the loop. Here, the GGGUGGGAGGU sequence is only required to be included in the loop portion, and the position in the loop portion is not particularly limited.

  When the precursor of microRNA has a GGGUGGGAGGU sequence located in the loop part, the microRNA formation inhibitory effect of the compound represented by the chemical formula 5 is particularly increased.

  In one embodiment, the microRNA precursor has a UGG sequence located in the loop region. Here, the UGG array located in the loop part only needs to be included in the loop part, and the position in the loop part is not particularly limited.

  When the precursor of microRNA has a UGG sequence located in the loop part, the microRNA formation inhibitory effect of the compound represented by Chemical Formula 6 is particularly increased.

[4. MicroRNA formation inhibitor and method for producing the same]
Using the compound described in [2] as an active ingredient, a microRNA formation inhibitor can be prepared (manufactured). That is, the present invention includes a microRNA formation inhibitor containing the compound described in [2] as an active ingredient and a method for producing the same.

  The amount of the compound contained in the microRNA formation inhibitor is appropriately determined depending on the purpose of use of the microRNA formation inhibitor and the intended use. In determining the compounding amount of the above compound, in addition to ordinary experiments, the description of the following examples may be useful.

  The microRNA formation inhibitor may contain other known active ingredients and known additives in addition to the compounds described above. Which active ingredients and additives are selected is appropriately selected according to the purpose of use, the target of use, etc. of the microRNA formation inhibitor. For example, when the above microRNA formation inhibitor is a drug used for humans, other standards are established in accordance with standards established by the US Food and Drug Administration (FDA), the European Medicines Agency (EMA), the Japanese Ministry of Health and Welfare, etc. The active ingredients and additives are preferably selected. When the microRNA formation inhibitor is a drug used for animals other than humans, a drug used for agricultural purposes, a drug used for experimental purposes, etc. It is preferred that other active ingredients and additives are selected according to the corresponding criteria.

  The microRNA formation inhibitor can be prepared by a conventional method using at least one of the above-mentioned compounds, and optionally other known active ingredients and known additives. In addition, the dosage form, administration route, and prescription amount of the microRNA formation inhibitor are appropriately selected depending on the purpose of use of the microRNA formation inhibitor, the intended use, and the like. For selection, the following examples will be helpful.

[General experimental methods]
Unless otherwise mentioned, experiments in which the pre-miRNA cleavage reaction by Dicer was inhibited by a compound were carried out by the following procedure.

  1. The substances shown in Table 1 or 2 below were mixed, and the pre-miRNA cleavage reaction by Dicer was allowed to proceed at 37 ° C. for 3 to 6 hours.

  In the table, Turbo Dicer Reaction Buffer (manufactured by Genlantis) was used as the buffer. Recombinant Turbo Dicer (manufactured by Genlantis) was used as the recombinant human Dicer. The compound was dissolved in water or water containing DMSO. Milli-Q water was used as the water.

  Using a 15% modified acrylamide gel (acrylamide: bis = 19: 1) (manufactured by Nacalai Tesque) with 2.6M urea, The reaction solution obtained in (1) was electrophoresed to separate the cleavage products. The electrophoresis was performed at room temperature at 200 to 300 V for 1 hour.

    3-1. (When there is no labeling with a radioactive element) The gel was stained with 3 μL of SYBR (registered trademark) Gold (manufactured by ThermoFisher SCIENTIFIC). The staining was performed at room temperature for 5 to 10 minutes.

  4-1. The stained gel was photographed with a camera (PENTAX MX-1, manufactured by RICOH).

  3-2. (When there is a label with a radioactive element) The gel was placed on an imaging plate (BAS IP MS 2025 E, manufactured by GE Healthcare) and exposed. The exposure was performed overnight at -20 ° C.

  4-2. Bands were detected by an imager (Typhoon FLA 7000, manufactured by GE Healthcare).

[Example 1]
Inhibition experiment of cleavage reaction of pre-miRNA-29a (SEQ ID NO: 1: acugauuucuuuugguguucagagucaauauaauuuucuagcaccaucugaaaucgguua) by BzDANP or BzDANP aminoalkyl linker derivative was conducted. The structure of pre-miRNA-29a is shown in FIG.

[Example 1-1]
In the cleavage reaction inhibition experiment using RNA that was not labeled with a radioactive element, the final concentration of pre-miRNA-29a was 4 μM, and the final concentration of BzDANP was 0 μM, 3.1 μM, 6 based on the composition of Table 1, respectively. Reaction solutions were prepared to be 3 μM, 12.5 μM, 25 μM, 50 μM, 10 μM, 200 μM, and 400 μM. The reaction was carried out at 37 ° C. for 3 hours. The results are shown in FIG.

In the cleavage reaction inhibition experiment using RNA labeled with a radioactive element, based on the composition of Table 2, the final concentration of pre-miRNA-29a was 11 nM, and the final concentration of BzDANP was 0 μM, 20 μM, 60 μM, 120 μM, Reaction solutions were prepared so as to be 180 μM and 200 μM. The reaction was carried out at 37 ° C. for 3 hours. In this experiment, the 5 ′ end of pre-miRNA-29a was labeled with ³² P. The results are shown in FIG.

[Example 1-2]
In the cleavage reaction inhibition experiment using RNA not labeled with a radioactive element, based on the composition of Table 1, the final concentration of pre-miRNA-29a was 4 μM, and the final concentration of BzDANP aminoalkyl linker derivative was 0 μM, 25 μM, respectively. Reaction solutions were prepared so as to be 50 μM, 100 μM, and 200 μM. The reaction was carried out at 37 ° C. for 3 hours. As a control, an experiment was also conducted on a reaction solution prepared so that the final concentration of DANP was 200 μM and a reaction solution prepared so that the final concentration of BzDANP was 200 μM. The results are shown in FIG.

In the cleavage reaction inhibition experiment using RNA labeled with a radioactive element, the final concentration of pre-miRNA-29a was 71.4 nM and the final concentration of BzDANP was 0 μM, 20 μM, 60 μM, respectively, based on the composition of Table 2. Reaction solutions were prepared so as to be 120 μM, 180 μM, and 200 μM. The reaction was carried out at 37 ° C. for 3 hours. In this experiment, the 5 ′ end of pre-miRNA-29a was labeled with ³² P. The results are shown in FIG.

  The structure of DANP used as a control is as follows.

(result)
1 (b) to (e), S represents a substrate, I represents an intermediate product (a pre-miRNA is cleaved at only one position), and P represents a cleaved product (the same applies to the following examples). ). From (b) and (c) of FIG. 1, when the BzDANP concentration was 200 μM or more, the generation of cleavage products was inhibited, and when it was 400 μM or more, the production of cleavage products was particularly inhibited. From (d) and (e) of FIG. 1, when the concentration of the BzDANP aminoalkyl linker derivative was 200 μM or more, the generation of cleavage products was inhibited. On the other hand, from FIG. 1 (d), 200 μM DANP did not inhibit the generation of cleavage products.

[Example 2]
[Example 2-1]
The inhibitory effect of pre-miRNA-136 (SEQ ID NO: 2: acuccauuuguuuugaugauggauucuuaugcuccaucaucgucucaaaugagucu) cleavage reaction due to the presence of BzDANP was observed over time. The structure of pre-miRNA-136 is shown in FIG.

  Based on the composition in Table 1, the substances were mixed so that the final concentration of pre-miRNA was 50 nM (total 50 μL). The final concentration of BzDANP in the mixed solution to which BzDANP was added was 100 μM. Dicer was added to the mixed solution at the end, and Dicer was added as a reaction solution.

  Before adding Dicer to the above mixture (after 0 minutes), 0.5 minutes, 1.0 minutes, 2.5 minutes, 5 minutes, 10 minutes, 20 minutes after adding Dicer, After 80 minutes, 180 minutes later, 5 μL of the mixed solution or reaction solution was collected, and 1 μL of Turbo Dicer Stop Solution (Genlantis) and 14 μL of formamide were added to stop the cleavage reaction. Thereafter, electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in (b) and (c) of FIG.

(result)
As shown in FIG. 2B, in the absence of BzDANP, the substrate decreased with the reaction time, and the cleavage product increased. On the other hand, in the presence of BzDANP, the decrease amount of the substrate and the increase amount of the cleaved product were suppressed over time. In particular, the results after 20 minutes from the start of the reaction were greatly different in the presence of BzDANP and in the absence of BzDANP.

[Example 2-2]
Changes in the maximum reaction rate and Dicer's dissociation constant in the pre-miRNA-136 (SEQ ID NO: 2) cleavage reaction due to the presence of BzDANP were examined.

  The final concentration of pre-miRNA-136 was adjusted to 25 nM, 50 nM, 75 nM, 100 nM, 150 nM, 225 nM, and 375 nM by changing the concentration of the pre-miRNA solution to be added. . The final concentration of BzDANP in the reaction solution to which BzDANP was added was 100 μM.

  0.5 min, 1.0 min, 2.5 min, 5 min, 10 min, 20 min, 40 min, 80 min, and 180 min after adding Dicer. Each was collected, and the band after electrophoresis was detected by the above method 2-4-2. The volume of each band was quantified by image analysis software (ImageQuant TL, manufactured by GE Healthcare), and the initial reaction rate was calculated based on the amount of the quantified cleavage product.

The reaction initial velocity was calculated for each substrate concentration described above, and plotted on a plane with the vertical axis representing the reaction initial velocity and the horizontal axis representing the substrate concentration ((d) of FIG. 2). Further, based on the equation of Michaelis = Menten was calculated the maximum reaction rate _{V max} and the dissociation constant _{K m.}

(result)
In the presence of BzDANP, the maximum reaction rate V _max of the cleavage reaction of pre-miRNA-136 by Dicer decreased from 25.4 ± 1.26 pM / sec to 6.21 ± 0.56 pM / sec. Further, the dissociation constant _{K m} also, to 30.1 ± 11.4 nm from 52.9 ± 8.54nM, showed a tendency of decrease.

Example 3
Pre-miRNA-29a mutant in which C-bulge structure of pre-miRNA-29a is changed to A-bulge structure, G-bulge structure or U-bulge structure ) To inhibit the mutant cleavage reaction with BzDANP.

  The structures of the pre-miRNA-29a mutants used in the experiments are shown in the upper part of FIGS. 3 (a) to (c), respectively. The structure of the mutant is obtained by changing the 20th base which is C in pre-miRNA-29a to A, G and U, respectively.

Based on the composition shown in Table 2, a reaction solution was prepared in which the final concentration of pre-miRNA was 50 nM and the final concentration of BzDANP was 200 μM. As a control, a reaction solution containing DANP with a final concentration of 200 μM was also prepared. The reaction was carried out at 37 ° C. for 3 hours. In this experiment, the 5 ′ end of pre-miRNA-29a was labeled with ³² P.

  Electrophoresis, exposure, and band detection were performed on the reaction solution by the above-described methods 2-4-2. The results are shown in the lower part of (a) to (c) of FIG.

  Furthermore, by quantifying the volume of the band with image analysis software (ImageQuant TL, manufactured by GE Healthcare), the ratio (%) of the generated cleavage product to the pre-miRNA (mol) initially contained in the reaction solution. Was calculated and shown in FIG. In addition, the numerical value on a bar graph is a relative value when the ratio of the cleavage product when no compound is added is 1.

(result)
As shown in FIG. 4 (d), BzDANP showed an inhibitory effect on the cleavage reaction of all pre-miRNA-29a mutants by Dicer. The inhibitory effect was particularly large in pre-miRNAs having a C bulge structure, an A bulge structure, and a G bulge structure. From the viewpoint of reducing the generation rate of the cleavage product, the inhibitory effect on pre-miRNA having a C bulge structure was the largest.

Example 4
Pre-miRNA-21 (SEQ ID NO: 6: uagcuuaucagacugauguugacuguugaaucucauggcaacaccagucgaugggcugu) cleavage reaction and pre-miRNA-760 (SEQ ID NO: 7: cccucaguccaccagagcccggauaccucagaaauucggcucugggugu inhibition reaction reaction by BzDANP).

  As shown in the upper part of FIG. 4A, pre-miRNA-21 has an A bulge structure in the structure. Further, as shown in the upper part of FIG. 4B, pre-miRNA-760 has a C bulge structure and a CA bulge structure in the structure.

  Based on the composition of Table 1, the reaction solution was prepared so that the final concentration of pre-miRNA was 4 μM and the final concentration of BzDANP was 200 μM. As a control, a reaction solution was prepared so that the final concentration of DANP was 200 μM. The reaction was carried out at 37 ° C. for 3 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in the lower part of (a) and (b) of FIG.

(result)
BzDANP showed an inhibitory effect on the cleavage reaction of pre-miRNA-21 and pre-miRNA-760 by Dicer. On the other hand, DANP did not show an inhibitory effect on the cleavage reaction of pre-miRNA-21 and pre-miRNA-760 by Dicer. The inhibitory effect by BzDANP was greater in the pre-miRNA-21 cleavage reaction than in pre-miRNA-760.

  When the results of Examples 1 to 4 are combined, it is presumed that BzDANP binds to the bulge structure of pre-miRNA, reduces the cleavage reaction rate by Dicer, and finally inhibits the cleavage reaction. The bulge structure tends to be a C bulge structure. In addition, a similar inhibitory effect can be expected for the BzDANP aminoalkyl linker derivative, while DANP appears to have no inhibitory effect.

Example 5
The inhibition experiment of the hairpin type artificial RNA cleaving reaction having UGG / UGG mismatch structure by NCD or (Z) -NCTS was conducted.

  The hairpin-type artificial RNA used in the experiment has the sequences (shRNA1_full (SEQ ID NO: 8: gacucaugucacacuaccaauucaagagauugguagugugacaugagucugug)), shRNA2_full (SEQ ID NO: 9: gaccaacaugugauccacacacacacacacacacacacacacacacacacacacacaca) And shRNA3_full (SEQ ID NO: 10: gacuguaccaacacucacaauucaagagauugugaguguugguacagugagugaucugagucugaguucugagugaugugagugagugaugugagugagugagugagugagugaugugaguugagugagugaugugagugagugagugaguugagugaguucugagugagugagugagugagugagugagugagugaugu And shRNA3_miss (SEQ ID NO: 13: gacuguauggacacucacaauucaagagauugugaguguugguacagucag)). shRNA1_miss is obtained by partially changing the sequence of shRNA_full and introducing a UGG / UGG mismatch structure. The same applies to other hairpin artificial RNAs.

[Example 5-1]
Based on the composition shown in Table 1, a reaction solution was prepared so that the final concentration of the hairpin artificial RNA was 2 μM and the final concentration of NCD was 200 μM. The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

[Example 5-2]
Based on the composition of Table 1, the reaction solution was prepared so that the final concentration of the hairpin artificial RNA was 2 μM and the final concentration of (Z) -NCTS was 200 μM. The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

(result)
In the sequence without the UGG / UGG mismatch structure, neither NCD nor (Z) -NCTS showed an inhibitory effect on the hairpin-type artificial RNA cleavage reaction by Dicer. On the other hand, in the sequence in which the UGG / UGG mismatch structure exists, both NCD and (Z) -NCTS showed an inhibitory effect on the hairpin-type artificial RNA cleavage reaction by Dicer. Therefore, it is considered that NCD and (Z) -NCTS bind to the UGG / UGG mismatch structure in the hairpin RNA structure and inhibit the cleavage reaction by Dicer. Further, the position of the UGG / UGG mismatch structure in the hairpin RNA did not affect any of the inhibitory effects by NCD and (Z) -NCTS.

Example 6
While changing the concentration of NCD or the concentration of (Z) -NCTS, an inhibition experiment of the hairpin artificial RNA (SEQ ID NO: 11 to 13) having a UGG / UGG mismatch structure was carried out.

  As the hairpin artificial RNA having the UGG / UGG mismatch structure, shRNA1_miss, shRNA2_miss or shRNA3_miss shown in FIG. 5B was used.

[Example 6-1]
Based on the composition of Table 1, reaction solutions were prepared so that the final concentration of the hairpin artificial RNA was 2 μM and the final concentration of NCD was 0 μM, 3.1 μM, 12.5 μM, 50 μM, and 200 μM, respectively. The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

[Example 6-2]
Based on the composition of Table 1, reaction solutions were prepared so that the final concentration of the hairpin artificial RNA was 2 μM and the final concentration of (Z) -NCTS was 0 μM, 3.1 μM, 12.5 μM, 50 μM, and 200 μM, respectively. . The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

(result)
In the case of NCD, the inhibitory effect on the cleavage reaction of hairpin-type artificial RNA by Dicer was observed when the concentration of NCD was 12.5 μM or more, and particularly remarkable when the concentration was 200 μM. In the case of (Z) -NCTS, an inhibitory effect on the cleavage reaction of hairpin-type artificial RNA by Dicer was observed when the concentration of (Z) -NCTS was 12.5 μM or more.

Example 7
Endogenous pre-miRNA having a UGG / UGG mismatch structure by (Z) -NCTS or (E) -NCTS (SEQ ID NO: 14: gcuuggaguaggucauuggguggauccucuauuuccuuacgugggccacuggauggcuccuccaugucu, SEQ ID NO: 15: guugggcugggcuggguugggaccgaccucguggaccugcaccugcugcuggaccgaccgaccgggaccgaccgaccgggaccgaccgaccgggaccgaccgaccgggaccgaccgaccggaccgaccgaccgggaccgaccgaccgggaccgaccgaccgggaccgaccgaccgggaccgcaccug

  As the endogenous pre-miRNA, pre-miRNA-432g or pre-miRNA-1587gu was used (see (a) of FIG. 5 for the structure).

  Based on the composition in Table 1, reaction solutions were prepared so that the final concentration of pre-miRNA was 2 μM and the final concentration of (Z) -NCTS or (E) -NCTS was 200 μM. The reaction was carried out at 37 ° C. for 3 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The result is shown in FIG.

(result)
Both (Z) -NCTS and (E) -NCTS showed an inhibitory effect on the cleavage reaction of pri-miRNA-432g and pre-miRNA-1587gu by Dicer. Moreover, the inhibitory effect of the cleavage reaction by (Z) -NCTS was larger than the inhibitory effect of the cleavage reaction by (E) -NCTS.

  When the results of Examples 5 to 8 are combined, NCD, (Z) -NCTS and (E) -NCTS can perform the pri-miRNA cleavage reaction by Dicer when UGG / UGG mismatch structure is present in pri-miRNA. Inhibit. It is considered that the inhibitory effect by these compounds is not affected by the position of the UGG / UGG mismatch structure in the pri-miRNA. In addition, since the structure of the hairpin artificial RNA is similar to that of a biological pre-miRNA, the inhibitory effect is considered to be effective for biological pre-miRNA.

Example 8
An inhibition experiment of pre-miRNA-143 (SEQ ID NO: 16: ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcuc) cleavage reaction by ND-link or ND was performed. The structure of pre-miRNA-143 is shown in FIG.

[Example 8-1]
Based on the composition in Table 1, reaction solutions were prepared so that the final concentration of pre-miRNA was 2 μM and the final concentration of ND-link was 0 μM, 1 μM, 3 μM, 10 μM, 30 μM, 100 μM, 300 μM, and 1000 μM, respectively. The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

[Example 8-2]
Based on the composition in Table 1, reaction solutions were prepared so that the final concentration of pre-miRNA was 2 μM and the final concentration of ND was 0 μM, 1 μM, 3 μM, 10 μM, 30 μM, 100 μM, 300 μM, and 1000 μM, respectively. The reaction was carried out at 37 ° C. for 6 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in FIG.

(result)
Both ND-link and ND showed an inhibitory effect on the cleavage reaction of pre-miRNA-143 by Dicer. The cleavage reaction inhibitory effect of ND-link appeared at a concentration of 100 μM or higher, and was particularly remarkable at a concentration of 300 μM or higher. The ND cleavage inhibitory effect appeared at a concentration of 300 μM or more.

Example 9
An experiment for inhibiting the cleavage reaction of the pre-miRNA-29a loop mutant with RND-link was performed.

  The general structure of the pre-miRNA-29a loop mutant is as shown in FIG. 10 (a), and the structure of the loop portion is as shown in the upper part of FIG. 10 (b). Each pre-miRNA-29a-loop mutants specific nucleotide sequence of, from left to right, SEQ ID NO: 17 (gcugauuucuuuugguguucagagagggugggagguauguuucuagcaccaucugaaaucgguua), SEQ ID NO: 18 (gcugauuucuuuugguguucaggagggugggagguguucuagcaccaucugaaaucgguua), SEQ ID NO: 19 (gcugauuucuuuugguguucaggagggugggagguuguucuagcaccaucugaaaucgguua), as SEQ ID NO: 20 (gcugauuucuuuugguguucagagagggugggagguuguuucuagcaccaucugaaaucgguua) It is shown. All of these sequences have the GGGUGGGAGGU sequence (SEQ ID NO: 22) in the loop portion.

  Based on the composition in Table 1, reaction solutions were prepared so that the final concentration of pre-miRNA was 4 μM and the final concentration of RND-link was 500 μM. The reaction was carried out at 37 ° C. for 3 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The results are shown in the lower part of FIG.

(result)
RND-link showed an inhibitory effect on any of the four types of pre-miRNA-29a loop mutants (N11 Rank2, N11 Rank3, Nmix Rank1, and Nmix Rank2) by Dicer. That is, it is suggested that the inhibitory effect of the pre-miRNA cleavage reaction by RND-link only needs to have a GGGUGGGAGUGU sequence in the loop and is not affected by the position of the sequence in the loop.

Example 10
A cleavage reaction inhibition experiment of the pre-miRNA-29a loop mutant (SEQ ID NO: 21: gcugauuucuuuugguguucagaguggggugagcuuucuagcaccaucugaaaucgguua) was performed with CMBL3aL, CMBL3bL, or CMBL3cL. The structure of the pre-miRNA-29a loop mutant is shown in FIG. The above array has a UGG array in the loop portion.

  Based on the composition in Table 1, the reaction solution was prepared so that the final concentration of pre-miRNA was 2 μM and the final concentration of CMBL3aL, CMBL3bL, or CMBL3cL was 300 μM. The reaction was carried out at 37 ° C. for 2 hours.

  Electrophoresis, staining, and photographing were performed by the above-described methods 2-4-1. The result is shown in FIG.

(result)
All of CMBL3aL, CMBL3bL and CMBL3cL showed a slight inhibitory effect on the cleavage reaction of the pre-miRNA-29a loop mutant by Dicer.

[Synthesis Example 1]
A method for synthesizing RND-link, which is an example of the compound represented by Chemical Formula 5, will be described based on the following chemical reaction formula.

[Synthesis of Compound 1-2 and Compound 1-3]
The reaction of obtaining compound 1-2 from compound 1-1 and the reaction of obtaining compound 1-3 from compound 1-2 are described in [He H et. Al. (2009) "A Small Molecule Affecting the Replication of Trinucleotide Repeat d ( GAA) _n "Chemistry -A European Journal, vol.15 (issue 40), pp.10641-10648] was adopted. The outline is as follows. Compound 1-1 was dissolved in acetone and reacted with methyl chloroformate and potassium carbonate to obtain compound 1-2. Subsequently, compound 1-2 was dissolved in a chloroform-acetonitrile mixed solvent, and N-bromosuccinimide and benzoyl peroxide were reacted to obtain compound 1-3.

[Synthesis of Compound 1-4]
Compound 1-2 (302 mg, 1.39 mmol) was dissolved in 10 mL of anhydrous tetrahydrofuran and cooled to 0 ° C. Next, a solution of lithium bis (trimethylsilyl) amide in tetrahydrofuran (1M, 4.14 mL, 4.14 mmol) was added, and the mixture was stirred at 0 ° C. for 30 minutes under an argon atmosphere. Furthermore, diethyl carbonate (0.33 mL, 2.76 mmol) was added, and the mixture was stirred at 0 ° C. for 1 hour, then warmed to room temperature and stirred for 2.5 hours. The resulting reaction solution was concentrated with a rotary evaporator and extracted with an ethyl acetate / saturated ammonium chloride solution. The organic layer was washed 3 times with a saturated aqueous sodium chloride solution and then dried over anhydrous magnesium sulfate. After the solvent was distilled off under reduced pressure using a rotary evaporator, the synthesized product was separated and purified by silica gel column chromatography (ethyl acetate 100%) to obtain Compound 4 (331 mg, 1.14 mmol) as a pale orange solid (yield 83 %).

The physical property values related to NMR of Compound 1-4 measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (CDCl ₃ , 400 MHz): d = 8.46 (d, 1H, J = 9.2 Hz), 8.27 (d, 1H, J = 8.7 Hz), 8.19 (d, 1H, J = 8.2 Hz), 7.54 (d, 1H, J = 8.2 Hz), 4.20 (q, 2H, J = 7.0 Hz), 4.12 (s, 2H), 3.88 ppm (s, 3H), 1.27 ppm (t, 3H, J = 7.1 Hz) ESI-MS: m / z: 290 [M + H] ⁺ , 312 [M + Na] ⁺ .

[Synthesis of Compound 1-5]
Compound 1-4 (191 mg, 0.660 mmol) was dissolved in 6 mL of tetrahydrofuran and cooled to 0 ° C. Subsequently, a solution of lithium bis (trimethylsilyl) amide in tetrahydrofuran (1M, 1.31 mL, 1.31 mmol) was added, and the mixture was stirred at 0 ° C. for 1 hour under an argon atmosphere. Further, Compound 1-3 (202 mg, 0.698 mmol) dissolved in 6 mL of tetrahydrofuran was added, and the mixture was stirred at 0 ° C. for 40 minutes, then warmed to room temperature and stirred overnight. The resulting reaction solution was concentrated with a rotary evaporator and extracted with an ethyl acetate / saturated ammonium chloride solution. The organic layer was washed 3 times with a saturated aqueous sodium chloride solution and then dried over anhydrous magnesium sulfate. After the solvent was distilled off under reduced pressure using a rotary evaporator, the synthesized product was separated and purified by silica gel column chromatography (ethyl acetate 60% in chloroform) to obtain compound 1-5 (134 mg, 0.27 mmol) as a pale yellow solid. (53% yield).

The physical property values relating to NMR of Compound 1-5 measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (CDCl ₃ , 400 MHz): d = 8.31 (d, 1H, J = 9.2 Hz), 8.27 (d, 1H, J = 9.2 Hz), 8.13 (d, 1H, J = 8.7 Hz), 8.11 (d, 1H, J = 8.7 Hz), 8.05 (d, 1H, J = 8.2 Hz), 7.96 (d, 1H, J = 8.2 Hz), 7.54 (d, 1H, J = 8.2 Hz), 7.38 (d , 1H, J = 8.2 Hz), 5.09 (dd, 1H, J ₁ = 6.4, J ₂ = 8.5 Hz), 4.13-4.01 (m, 3H), 3.83 (s, 6H), 3.76 (dd, 1H, J ₁ = 6.4, J ₂ = 14.9 Hz), 1.08 ppm (t, 3H, J = 7.3 Hz); ESI-MS: m / z: 505 [M + H] ⁺ , 527 [M + Na] ⁺ .

[Synthesis of Compound 1-6 (RND-link)]
Compound 1-5 (26 mg, 0.052 mmol) and 1,3-diaminopropane (26 mg, 0.052 mmol) were mixed and stirred at 60 ° C. for 7.5 hours. Water was added to the resulting reaction solution, and 1,3-diaminopropane and water were removed by lyophilization. The synthesized product was separated and purified by reverse phase high performance liquid chromatography (9% acetonitrile in water, 0.1% acetic acid) to obtain the target compound 1-6 (RND-link, 12 mg, 0.029 mmol) as a white solid. (Yield 56%).

The physical property values of NMR of compound 1-6 (RND-link) measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (CD ₃ OD, 400 MHz): d = 8.02 (d, 1H, J = 7.8 Hz), 7.93 (d, 2H, J = 8.7 Hz), 7.90 (d, 1H, J = 8.7 Hz), 7.29 (d, 1H, J = 7.8 Hz), 7.11 (d, 1H, J = 7.8 Hz), 6.87 (d, 1H, J = 8.7 Hz), 6.84 (d, 1H, J = 8.7 Hz), 4.41 ( dd, 1H, J ₁ = 5.5, J ₂ = 10.1 Hz), 3.73 (dd, 1H, J ₁ = 10.1, J ₂ = 13.7 Hz), 3.51 (dd, 1H, J ₁ = 5.5, J ₂ = 14.2 Hz ), 3.43-3.37 (m, 1H), 3.27-3.21 ppm (m, 1H), 3.17-3.10 ppm (m, 1H), 3.08-3.01 ppm (m, 1H), 1.89-1.80 ppm (m, 2H) ; ESI-MS: m / z: 417 [M + H] ⁺ .

[Synthesis Example 2]
A method for synthesizing CMBL3aL, CMBL3bL, and CMBL3cL, which are examples of the compound represented by Chemical Formula 6, will be described based on the following chemical reaction formula.

[Synthesis of Compound 2-2]
Compound 2-1 (3-buten-1-ol, 0.72 g, 10 mmol) and 1,1′-carbonyldiimidazole (1.62 g, 10 mmol) were dissolved in 30 mL of anhydrous dichloromethane and brought to room temperature under an argon atmosphere. And stirred overnight. 30 mL of water was added to the reaction solution, and the mixture was extracted twice with 25 mL of chloroform. The organic layer was washed 4 times with water (30 mL) and once with a saturated aqueous sodium chloride solution (25 mL), and then dried over anhydrous sodium sulfate. The solvent was distilled off under reduced pressure using a rotary evaporator to obtain Compound 2-2 (0.88 g, 5.3 mmol) as a colorless liquid (yield 53%).

The physical property values relating to NMR of Compound 2-2 measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (400 MHz, CDCl ₃ ) δ 8.12 (m, 1H), 7.41-7.40 (m, 1H), 7.06 (m, 1H), 5.81 (ddt, J = 17.2, 10.1, 6.8 Hz, 1H), 5.18 (dtd, J = 17.4, 1.5, 1.5 Hz, 1H), 5.15 (dtd, J = 10.4, 1.4, 1.5 Hz, 1H), 4.46 (t, J = 6.6 Hz, 2H), 2.55 (tdt, J = 6.7, 6.7, 1.4 Hz, 2H); ¹³ C NMR (150 MHz, CDCl ₃ ) δ 148.2, 136.7, 132.5, 130.2, 117.8, 116.7, 66.1, 32.5.HRMS (ESI) m / z: Calcd. For C ₈ H ₁₁ N ₂ O ₂ [M + H] ⁺ 167.082, found: 167.0813; Calcd. For C ₈ H ₁₀ N ₂ NaO ₂ [M + Na] ⁺ 189.0640, found: 189.0632.

[Synthesis of Compound 2-3]
Compound 2-3 is a compound [Nakatani K et. Al. (2013) "A dimeric form of N-methoxycarbonyl-2-amino-1,8-naphthyridine bound to the AA mismatch in the CAG / CAG base triad in dsRNA" Bioorganic Medicinal Chemistry Letters, vol. 23 (issue 2): pp. 558-561], and synthesized according to the method described in Supplementary Material.

[Synthesis of Compound 2-4]
Compound 2-3 (0.432 g, 1.0 mmol) was dissolved in 2 mL of anhydrous tetrahydrofuran and cooled to 0 ° C. Subsequently, potassium tert-butoxide-tetrahydrofuran solution (1M, 3.0 mL, 3.0 mmol) and 18-crown ether (catalytic amount) were added, and the mixture was stirred at 0 ° C. for 30 minutes in an argon atmosphere. Further, Compound 2-2 (2.5 mmol) dissolved in 3 mL of tetrahydrofuran was added, and the temperature was raised from 0 ° C. to room temperature with stirring (temperature raising time: 1 hour). Crushed ice was added to quench the reaction, and tetrahydrofuran was distilled off under reduced pressure using a rotary evaporator. The residue was diluted with 10 mL of water and extracted three times with 20 mL of chloroform. The organic layer was recovered, washed with 10 mL of saturated aqueous sodium chloride solution, and then dried over anhydrous sodium sulfate. After the solvent was distilled off under reduced pressure using a rotary evaporator, separation and purification were performed by silica gel column chromatography (in chloroform, methanol 0 to 0.1%) to obtain compound 2-4 (0.42 g, 0.66 mmol) as an off-white solid. Obtained (yield 66%).

The physical property values relating to NMR of Compound 2-4 measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (400 MHz, CDCl ₃ ) δ 8.30 (d, J = 8.4 Hz, 2H), 8.14 (d, J = 9.2 Hz, 2H), 8.09 (t, J = 7.0 Hz, 2H), 7.77 (br , 1H), 7.76 (br, 1H), 7.49 (d, J = 8.4 Hz, 1H), 7.34 (d, J = 8.4 Hz, 1H), 5.82 (ddt, J = 17.0, 10.2, 6.8 Hz, 2H) , 5.19-5.09 (m, 4H), 4.94 (s, 2H), 4.82 (s, 2H), 4.27 (t, J = 6.8 Hz, 4H), 2.47 (q, J = 6.8 Hz, 4H), 1.40 ( s, 9H); ¹³ C NMR (150 MHz, CDCl ₃ ) δ 162.6, 162.2, 155.9, 154.4, 153.6, 153.5, 153.0, 139.0, 137.3, 137.1, 133.5, 119.4, 119.0, 118.7, 118.0, 117.6, 113.2, 80.7, 64.7, 53.5, 53.4, 33.2, 28.2; HRMS (ESI) m / z: Calcd. For C ₃₃ H ₃₈ N ₇ O ₆ [M + H] ⁺ 628.2884, found: 628.2870, Calcd. For C ₃₃ H ₃₇ N ₇ NaO ₆ [M + Na] ⁺ 650.2703, found: 650.2699.

[Synthesis of Compound 2-5 and Compound 2-6]
Compound 2-4 (31.4 mg, 0.05 mmol) was dissolved in dichloromethane (10 mL) and Grubbs catalyst (2nd generation, 12.8 mg, 0.015 mmol) was added. The container containing the reaction solution was sealed, heated to 95 ° C., and reacted for 1 hour. The filtrate obtained by filtering the reaction solution through Celite and the washing solution obtained by washing the residue with dichloromethane (10 mL) three times were collected, and the solvent was distilled off under reduced pressure using a rotary evaporator. The compound was separated and purified by silica gel chromatography (Compound 2-5: Methanol 0.5 to 1% in chloroform; Compound 2-6: Methanol 2 to 3% in chloroform) and preparative thin layer chromatography. Compound 2-5 (white solid, 23.1 mg, 0.0385 mmol) was obtained in 77% yield, and compound 2-6 (white solid, 3.5 mg, 0.0058 mmol) was obtained in 12% yield.

The physical property values relating to NMR of Compound 2-5 measured by JNM-ECA600 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (600 MHz, CDCl ₃ ) δ 8.02 (d, J = 9.6 Hz, 1H), 8.00 (d, J = 9.6 Hz, 1H), 7.72 (d, J = 9.0 Hz, 1H), 7.69 (d , J = 9.0 Hz, 1H), 7.61 (br, 1H), 7.54 (br, 1H), 7.52 (d, J = 8.4 Hz, 1H), 7.44 (d, J = 8.4 Hz, 1H), 7.12 (d , J = 7.8 Hz, 1H), 6.91 (d, J = 7.8 Hz, 1H), 5.67 (t, J = 3.6 Hz, 2H), 4.90 (s, 4H), 4.88 (s, 2H), 4.33-4.30 (m, 4H), 2.92 (br, 4H), 1.62 (s, 9H); ¹³ C NMR (150 MHz, CDCl ₃ ) δ 161.7, 155.3, 153.4, 153.3, 153.1, 137.7, 135.9, 135.7, 129.1, 128.9 , 119.6, 118.4, 118.1, 117.9, 113.0, 80.9, 64.9, 64.7, 55.2, 54.5, 31.5, 31.4, 28.5; HRMS (ESI) m / z: Calcd.for C ₃₁ H ₃₄ N ₇ O ₆ [M + H ] ⁺ 600.2571, found: 600.2554; Calcd. For C ₃₁ H ₃₃ N ₇ NaO ₆ [M + Na] ⁺ 622.2390, found: 622.2372.

The physical property values relating to NMR of Compound 2-5 measured by JNM-ECA600 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (600 MHz, CDCl ₃ ) δ 10.22 (brs, 2H), 8.275 (d, J = 8.4 Hz, 1H), 8.22 (d, J = 7.8 Hz, 1H), 7.93 (d, J = 8.4 Hz , 1H), 7.92 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 8.4 Hz, 1H), 7.88 (d, J = 8.4 Hz, 1H), 7.86 (d, J = 9.6 Hz, 1H ), 7.31 (d, J = 6.0 Hz, 1H), 7.16 (d, J = 7.2 Hz, 1H), 5.55 (t, J = 5.4 Hz, 2H), 4.87 (brs, 2H), 4.76 (brs, 2H ), 4.38 (brm, 2H), 4.35 (brm, 2H), 2.58 (brm, 4H), 1.31 (s, 9H); ¹³ C NMR (175 MHz, CDCl ₃ ) δ 161.6, 161.4, 155.7, 154.6, 154.3 , 154.0, 153.9, 138.2, 136.6, 136.4, 129.2, 129.1, 120.5, 119.6, 118.2, 118.0, 114.0, 113.9, 81.1, 64.9, 64.7, 28.4, 27.5, 27.4; HRMS (ESI) m / z: Calcd. For C ₃₁ H ₃₄ N ₇ O ₆ [M + H] ⁺ 600.2571, found: 600.2551; Calcd. For C ₃₁ H ₃₃ N ₇ NaO ₆ [M + Na] ⁺ 622.2390, found: 622.2369.

[Synthesis of Compound 2-7]
A mixture of compound 2-5 and compound 2-6 (0.012 g, 0.02 mmol) and cyclohexene (1.0 mL) were dissolved in absolute ethanol (2.5 mL), and nitrogen bubbling was performed at room temperature for 30 minutes. I was degassed. Subsequently, palladium carbon (10%) was added (5 mol%), and the mixture was heated to reflux for 6 to 7 hours under a nitrogen atmosphere. After completion of the reaction, a filtrate obtained by filtering the catalyst through a glass filter and a washing solution obtained by washing the residue with ethyl acetate were collected, and the solvent was distilled off under reduced pressure using a rotary evaporator. The obtained residue was separated and purified by silica gel chromatography (chloroform-methanol) to obtain compound 2-7 (7.5 mg, 0.0124 mmol) as an off-white solid (yield 62%).

The physical properties of NMR for Compound 1-4 measured by AVANCEIII700 (manufactured by Bruker BioSpin) were as follows.
¹ H NMR (700 MHz, DMSO-d ₆ ) δ 10.29 (brs, 1H), 10.28 (brs, 1H), 8.04 (d, J = 9.1 Hz, 1H), 8.03 (d, J = 9.1 Hz, 1H) , 7.925 (d, J = 8.4 Hz, 1H), 7.88 (d, J = 7.7 Hz, 1H), 7.86 (d, J = 8.4 Hz, 2H), 7.07 (d, J = 8.4 Hz, 1H), 7.03 (d, J = 8.4 Hz, 1H), 4.64 (s, 4H), 4.18 (t, J = 5.25 Hz, 4H), 1.64 (quint, J = 5.4, 4H), 1.57 (s, 9H), 1.49 ( quint, J = 3.3 Hz, 4H); ¹³ C NMR (175 MHz, DMSO-d ₆ ) δ160.8, 160.6, 154.9, 154.0, 153.9, 153.5, 138.3, 136.9, 136.8, 118.6, 118.3, 117.8, 113.5, 80.3, 64.7, 53.9, 53.1, 28.7, 28.1, 25.9; HRMS (ESI) m / z: Calcd. For C ₃₁ H ₃₅ N ₇ NaO ₆ [M + Na] ⁺ 624.2547, found: 624.2538.

[Synthesis of Compound 2-8]
Compound 2-5 (21 mg, 0.035 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). After the solvent was distilled off under reduced pressure using a rotary evaporator, a 7N ammonia-methanol mixed solution was added. Thereafter, the synthesized product was separated and purified by silica gel chromatography (1 to 4% methanol in chloroform) to obtain compound 2-8 (14.1 mg) as a white solid (yield 81%).

The physical property values relating to NMR of Compound 2-8 measured by JNM-ECA600 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (600 MHz, CDCl ₃ ) δ 8.89 (br, 2H), 8.19 (d, J = 9.0 Hz, 2H), 8.00 (d, J = 8.4 Hz, 2H), 7.86 (d, J = 7.8 Hz , 2H), 7.17 (d, J = 7.8 Hz, 2H), 5.65 (t, J = 3.3 Hz, 2H), 4.31 (t, J = 5.4 Hz, 4H), 4.21 (s, 4H), 2.48-2.47 (m, 4H); ¹³ C NMR (150 MHz, CDCl ₃ ) δ 163.5, 154.0, 153.6, 153.4, 153.2, 138.5, 136.0, 129.2, 119.7, 118.3, 113.0, 64.7, 55.5, 31,7, 31.6; HRMS (ESI) m / z: Calcd. For C ₂₆ H ₂₆ N ₇ O ₄ [M + H] ⁺ 500.2046, found: 500.2040, Calcd. For C ₂₆ H ₂₅ N ₇ NaO ₄ [M + Na] ⁺ 522.1866, found : 522.1857.

[Synthesis of Compound 2-9]
Compound 2-6 (10 mg, 0.017 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). After the solvent was distilled off under reduced pressure using a rotary evaporator, a 7N ammonia-methanol mixed solution was added. Thereafter, the synthesized product was separated and purified by silica gel chromatography (5-8% methanol in chloroform) to obtain compound 2-8 (6 mg) as a white solid (yield 72%).

The physical property values relating to NMR of Compound 2-9 measured by JNM-ECA600 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (600 MHz, CDCl ₃ ) δ 8.19 (d, J = 7.8 Hz, 2H), 8.02 (d, J = 7.8 Hz, 2H), 7.90 (d, J = 7.8 Hz, 2H), 7.19 (d , J = 8.4 Hz, 2H), 5.60-5.55 (br, 2H), 4.33 (brs, 4H), 4.26-4.21 (m, 4H), 2.55 (m, 4H); ¹³ C NMR (150 MHz, CDCl ₃ ) δ 163.7, 154.0, 153.6, 153.4, 138.6, 136.0, 129.2, 119.7, 118.4, 112.9, 64.7, 55.6, 31.7; HRMS (ESI) m / z: Calcd.for C ₂₆ H ₂₆ N ₇ O ₄ (M + H] ⁺ 500.2046, found: 500.2039; calculated for C ₂₆ H ₂₅ N ₇ NaO ₄ [M + Na] ⁺ 522.1866, found: 522.1855.

[Synthesis of Compound 2-10]
Compound 2-7 (75 mg, 0.0125 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). After the solvent was distilled off under reduced pressure using a rotary evaporator, a 7N ammonia-methanol mixed solution was added. Thereafter, the synthesized product was separated and purified by silica gel chromatography (methanol 5 to 8% in chloroform) to obtain Compound 8 (4.26 mg) as an off-white solid (yield 68%).

The physical property values relating to NMR of Compound 2-10 measured by JNM-ECS400 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (400 MHz, CDCl ₃ ) δ 8.85 (br, 2H), 8.22 (d, J = 8.8 Hz, 2H), 8.04 (d, J = 8.8 Hz, 2H), 7.91 (d, J = 8.0 Hz , 2H), 7.22 (d, J = 8.0 Hz, 2H), 4.28 (t, J = 5.0 Hz, 4H), 4.18 (s, 4H), 1.75 (quint, J = 5.5 Hz, 4H), 1.63 (quint , J = 3.1 Hz, 4H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 163.3, 154.1, 153.8, 153.5, 138.6, 136.2, 119.7, 118.5, 113.1, 66.4, 55.2, 28.7, 27.7; HRMS (ESI) m / z: Calcd. for C ₂₆ H ₂₈ N ₇ O ₄ [M + H] ⁺ 502.2203; Found: 502.2197; calcd. for C ₂₆ H ₂₇ N ₇ NaO ₄ [M + Na] ⁺ 524.2022; Found: 524.2013.

[Synthesis of Compound 2-11]
Compound 2-11 has been reported in [Hagihara S et. Al. (2004) "Detection of guanine-adenine mismatches by surface plasmon resonance sensor carrying naphthyridine-azaquinolone hybrid on the surface" Nucleic Acids Research, vol.32 (issue 1): pp .278-286] and synthesized according to the method described in Supplementary Material.

[Synthesis of Compound 2-12 (CMBL3aL)]
Compound 2-8 (12 mg, 0.024 mmol) and compound 2-11 (9.3 mg, 0.036 mmol) were dissolved in anhydrous chloroform (2.5 mL), and sodium triacetoxyborohydride (7.6 mg, 0.036 mmol) was dissolved. ) Was added. The pH of the reaction solution was adjusted to 6 with acetic acid and stirred at room temperature for 1 hour. To the reaction solution was further added 20 mL of chloroform, and the organic layer was washed once with 10 mL of saturated aqueous sodium hydrogen carbonate solution, 10 mL of water and 10 mL of saturated aqueous sodium chloride solution, and dried over anhydrous sodium sulfate. After the solvent was distilled off under reduced pressure using a rotary evaporator, the synthesized product was separated and purified by silica gel chromatography (methanol 2.5 to 3% in chloroform) to obtain a compound (8.2 mg) with a linker added as an off-white solid. (43% yield).

  The obtained compound (7.7 mg, 0.012 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). After the solvent was distilled off under reduced pressure using a rotary evaporator, a 7N ammonia-methanol mixed solution was added. Thereafter, the synthesized product was separated and purified by silica gel chromatography (2-5% methanol in chloroform) to obtain Compound 2-12 (CMBL3aL, 2.7 mg) as an off-white solid (yield 40%).

The physical property values of NMR of Compound 2-12 (CMBL3aL) measured by JNM-ECA600 (manufactured by JEOL RESONANCE) were as follows.
¹ H NMR (600 MHz, CD ₃ OD) δ 8.50 (d, J = 9.0 Hz, 2H), 8.33 (d, J = 7.8 Hz, 2H), 7.77 (d, J = 9.0 Hz, 2H), 7.65 ( d, J = 8.4 Hz, 2H), 5.69-5.67 (m, 2H), 5.03 (s, 4H), 4.35 (t, J = 5.4 Hz, 4H), 3.67 (t, J = 7.2 Hz, 2H), 3.37 (t, J = 6.0 Hz, 2H), 3.13 (t, J = 6.6 Hz, 2H), 2.57 (t, J = 6.6 Hz, 2H), 2.47 (td, J = 5.4, 5.25 Hz, 4H), 2.11 (quint, J = 6.75 Hz, 2H), 2.02 (quint, J = 6.45 Hz, 2H); ¹³ C NMR (150 MHz, CD ₃ OD) δ 176.7, 158.3, 154.8, 141.3, 130.4, 123.6, 120.2, 116.1, 71.4, 67.6, 60.3, 56.3, 40.8, 37.1, 34.4, 33.0, 26.3, 24.0; HRMS (ESI) m / z: Calcd. For C ₃₃ H ₄₀ N ₉ O ₅ [M + H] ⁺ 642.3152; Found : 642.3132; calcd. For C ₃₃ H ₃₉ N ₉ NaO ₅ [M + Na] ⁺ 664.2972; Found: 664.2949.

[Synthesis of Compound 2-13 (CMBL3bL)]
Compound 2-9 (15 mg, 0.030 mmol) and compound 2-11 (12 mg, 0.045 mmol) were dissolved in anhydrous chloroform (2.5 mL), and sodium triacetoxyborohydride (9.5 mg, 0.045 mmol) was dissolved. Added. The pH of the reaction solution was adjusted to 6 with acetic acid and stirred at room temperature for 1 hour. To the reaction solution was further added 20 mL of chloroform, and the organic layer was washed once with 10 mL of saturated aqueous sodium hydrogen carbonate solution, 10 mL of water and 10 mL of saturated aqueous sodium chloride solution, and dried over anhydrous sodium sulfate. After distilling off the solvent under reduced pressure using a rotary evaporator, the synthesized product was separated and purified by silica gel chromatography (methanol 2.5 to 3% in chloroform) to obtain a compound (11.8 mg) to which a linker was added as an off-white solid. (53% yield).

  The obtained compound (11 mg, 0.012 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). The solvent was distilled off under reduced pressure using a rotary evaporator, and the mixture was made basic by adding a 7N ammonia-methanol mixed solution. Thereafter, the synthesized product was separated and purified by silica gel chromatography (2-5% in methanol in chloroform) to obtain Compound 2-13 (CMBL 3bL, 5.8 mg) as an off-white solid (61% yield).

Physical property values of NMR of Compound 2-13 (CMBL3bL) measured by AVANCEIII700 (manufactured by Bruker BioSpin) were as follows.
¹ H NMR (700 MHz, DMSO-d ₆ ) δ 8.50 (t, J = 5.3 Hz, 1H), 7.96 (d, J = 8.4 Hz, 2H), 7.77 (d, J = 7.7 Hz, 2H), 7.53 (d, J = 8.4 Hz, 2H), 7.20 (d, J = 7.7 Hz, 2H), 5.500-5.59 (m, 2H), 4.25 (t, J = 5.95 Hz, 4H), 3.85 (s, 4H) , 3.10-3.07 (m, 2H), 2.84-2.81 (m, 4H), 2.5-2.49 (m, 2H), 2.28 (t, J = 7.0 Hz, 2H), 1.96 (quint, J = 7.0 Hz, 2H ), 1.85 (s, 3H, CH ₃ from acetate salt), 1.79 (quint, J = 7.5 Hz, 2H), 1.74 (quint, J = 6.8 Hz, 2H); ¹³ C NMR (175 MHz, DMSO-d ₆ ) δ 171.7, 171.3, 162.9, 153.3, 153.1, 153.0, 138.5, 136.1, 128.4, 121.3, 117.4, 69.8, 64.2, 62.5, 38.9, 32.6, 32.3, 32.3, 27.5, 27.2, 24.3, 24.3, 22.5 (CH ₃ from acetate salt); HRMS (ESI) m / z: Calcd. for C ₃₃ H ₄₀ N ₉ O ₅ [M + H] ⁺ 642.3152; Found: 642.3131; calcd. for C ₃₃ H ₃₉ N ₉ NaO ₅ [M + Na] ⁺ 664.2972; Found: 664.2948.

[Synthesis of Compound 2-14 (CMBL3bL)]
Compound 2-10 (25 mg, 0.050 mmol) and compound 2-11 (19 mg, 0.075 mmol) were dissolved in anhydrous chloroform (2.5 mL) and sodium triacetoxyborohydride (16 mg, 0.075 mmol) was added. . The pH of the reaction solution was adjusted to 6 with acetic acid and stirred at room temperature for 1 hour. 30 mL of chloroform was added to the reaction solution, and the organic layer was washed once with 10 mL of a saturated aqueous solution of sodium bicarbonate, 10 mL of water and 10 mL of a saturated aqueous solution of sodium chloride, and dried over anhydrous sodium sulfate. After distilling off the solvent under reduced pressure using a rotary evaporator, the synthesized product was separated and purified by silica gel chromatography (methanol 2.5 to 3% in chloroform) to obtain a compound (19.7 mg) to which a linker was added as an off-white solid. (53% yield).

  The obtained compound (16 mg, 0.022 mmol) was dissolved in chloroform (1 mL) and cooled to 0 ° C. Subsequently, 1 mL of 4N hydrochloric acid-ethyl acetate mixed solution was added, and it heated from 0 degreeC to room temperature, stirring under argon atmosphere (temperature rising time: 1 hour). The solvent was distilled off under reduced pressure using a rotary evaporator, and the mixture was made basic by adding a 7N ammonia-methanol mixed solution. Thereafter, the synthesized product was separated and purified by silica gel chromatography (2-5% in methanol in chloroform) to obtain Compound 2-14 (CMBL3cL, 8.5 mg) as an off-white solid (61% yield).

Physical property values of NMR of Compound 2-14 (CMBL3cL) measured by AVANCEIII700 (manufactured by Bruker BioSpin) were as follows.
¹ H NMR (700 MHz, DMSO-d ₆ ) δ 8.06 (t, J = 4.9 Hz, 1H), 7.94 (d, J = 9.1 Hz, 2H), 7.79 (d, J = 8.4 Hz, 2H), 7.75 (d, J = 8.4 Hz, 2H), 7.67-7.60 (br, 2H), 7.23 (d, J = 7.7 Hz, 2H), 4.19 (t, J = 4.9 Hz, 4H), 4.15-4.13 (br, 2H), 3.86 (s, 4H), 3.32 (q, J = 6.3 Hz, 2H), 2.95 (t, J = 6.3 Hz, 2H), 2.66 (t, J = 7.0 Hz, 2H), 2.17 (t, J = 7.35 Hz, 2H), 1.70-1.65 (m, 4H), 1.52-1.50 (brm, 4H), 1.28-1.22 (m, 4H); ¹³ C NMR (175 MHz, DMSO-d ₆ ) δ 172.0, 162.9, 153.8, 153.5, 153.4, 138.1, 135.5, 120.6, 117.5, 113.0, 69.8, 64.7, 62.6, 55.9, 40.0, 36.7, 33.0, 31.0, 28.5, 27.8, 22.4, 22.1; HRMS (ESI) m / z: _{. calcd for C 33 H 42 N} 9 O 5 [M + H] + 644.3309; Found: 644.3311; calcd for C 33 H 41 N 9 NaO 5 [M + Na] + 666.3128; Found:. 666.3128.

  The present invention can be used as a microRNA formation inhibitor. The microRNA formation inhibitor is useful, for example, in the medical field, life science field, and agricultural field.

Claims (5)

The microRNA formation inhibitor containing at least 1 sort (s) among the compounds represented by following Chemical formula 1-6.
Wherein R ¹ and R ^{2 in} Formula 1 are each independently selected from primary amine residues, secondary amine residues, and tertiary amine residues;
X in Chemical Formula 3 is a linker having 1 to 40 carbon atoms, and the linker may have an aryl moiety,
R ^{5 in} Chemical Formula 4 is a hydrogen atom or an amino group, A is a methylene group or an acyl group, m is a natural number of 0 to 10,
R ^{6 in} Chemical Formula 5 is a hydrogen atom or an amino group, n is a natural number of 0 to 10,
“*” And “*” in Chemical Formula 6 are connected via a linker having 1 to 10 carbon atoms, and the linker may have a double bond or a triple bond. ]   The precursor of the microRNA has a bulge structure, a UGG / UGG mismatch structure, a GGGUGGGAGGU sequence (SEQ ID NO: 22) located in the loop portion, and / or a UGG sequence located in the loop portion. MicroRNA formation inhibitor.   The microRNA formation inhibitor according to claim 1 or 2, wherein the microRNA precursor has a cytosine bulge structure. The said compound is a microRNA formation inhibitor as described in any one of Claims 1-3 represented by following Chemical formula 7.
[Wherein R3 and R4 are each independently selected from primary amine residues, secondary amine residues and tertiary amine residues. ] The manufacturing method of a microRNA formation inhibitor including the process of preparing a microRNA formation inhibitor using at least 1 sort (s) of compounds represented by following Chemical formula 1-6.
Wherein R ¹ and R ^{2 in} Formula 1 are each independently selected from primary amine residues, secondary amine residues, and tertiary amine residues;
X in Chemical Formula 3 is a linker having 1 to 40 carbon atoms, and the linker may have an aryl moiety,
R ^{5 in} Chemical Formula 4 is a hydrogen atom or an amino group, A is a methylene group or an acyl group, m is a natural number of 0 to 10,
R ^{6 in} Chemical Formula 5 is a hydrogen atom or an amino group, n is a natural number of 0 to 10,
“*” And “*” in Chemical Formula 6 are connected via a linker having 1 to 10 carbon atoms, and the linker may have a double bond or a triple bond. ]