JP2018126078A - Methods for analyzing rna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide RNA analyzing methods enabling one step analysis of the entire sequence of a full length RNA including 3' and 5' termini and intermediate region between them.SOLUTION: Disclosed herein is an RNA analyzing method comprising the steps of: synthesizing a full length cDNA first strand from a full length RNA having a CAP structure at 5' terminus; obtaining a double stranded DNA comprising a hybrid constituted from the first strand of the full length cDNA and a second strand complementary thereto, a first unique molecular identifier and a first lead sequence attached to one of the termini of the hybrid, and a second unique molecular identifier and a second lead sequence attached to another terminus; cleaving the double stranded DNA and linking the first and second lead sequence; and amplifying and sequencing the double stranded DNA.SELECTED DRAWING: None

Description

  The present invention relates to a method for analyzing RNA, comprising producing double-stranded DNA each having a unique molecular identifier and a lead sequence at both ends from full-length RNA having a CAP structure at the 5 'end.

A CAGE (Cap Analysis of Gene Expression) method is known as a transcript analysis method (Non-patent Document 1). In the CAGE method, cDNA is prepared by complementing the CAP structure present at the 5 ′ end of eukaryotic mRNA, and its sequence is determined. The CAGE method is useful as a method that can detect the transcription start point and quantitatively analyze the expression level of the transcript for each transcription start point.
However, in order to analyze the transcript in more detail, in addition to the 5 ′ end of the transcript, the entire transcript including the intermediate region such as the coding region present downstream and the 3 ′ end (transcription termination point) is analyzed. It is desirable to do.

  As an RNA sequence analysis method, an analysis method using Illumina's Nextera kit is known. However, since this method cannot recover 5′-end or 3′-end cDNA, information on the 5′-end and 3′-end can be obtained. Missing. A SAGE (Serial Analysis of Gene Expression) method is known as a method for analyzing the 3 'end of an RNA sequence (Non-patent Document 2).

  Furthermore, as a method for analyzing full-length RNA, Smart Seq. The law (Non-Patent Document 3) is known.

Shiraki, T. et al., Proc. Natl. Acad. Sci. USA Vol. 100, No. 26, Pages 15776-15781 (2003) Velculescu, V.E., et al., Science, Volume 270, Pages 484-487 (1995) Simone, P. et al., Nature Protocols, 9, 171-181 (2014)

  In the method described in Non-Patent Document 3, the template switch method is used on the 5 ′ end side, and complete end information cannot always be obtained. That is, this method has a problem in that the 5 'terminal side is not complete when preparing a full-length cDNA. Furthermore, since the amplification bias that occurs during the PCR process is not taken into consideration, it is difficult to obtain accurate quantitative information about the expression level.

  The present invention provides a method for analyzing RNA such that the analysis of the 5 ′ end and 3 ′ end of the full-length RNA and the analysis of the entire sequence including the intermediate region thereof can be performed in the same step. Providing is a problem to be solved.

  As a result of diligent studies to solve the above problems, the present inventors have introduced a unique molecular identifier and a lead sequence at both ends of a cDNA sequence prepared from full-length RNA, respectively, so that both ends of the cDNA can be identified. It was recovered in a possible state, and it was found that the analysis of the entire sequence including the 5 ′ and 3 ′ ends and their intermediate region can be analyzed in the same step. Further, the inventors have found that the problem of amplification bias occurring during the PCR process can be solved by using a unique molecular identifier, and that quantitative analysis can be performed, and the present invention has been completed.

That is, according to the present invention, the following inventions are provided.
<1> (Step 1) Full-length cDNA using a full-length RNA having a CAP structure at the 5 ′ end, a primer having a base sequence complementary to the base sequence on the 3′-end side of the full-length RNA, and a DNA synthase Synthesizing the first strand;
(Step 2) A hybrid composed of the first full-length cDNA first strand and the second strand complementary thereto, the first unique molecular identifiers (Unique molecular identifiers) added to one end thereof, and the first strand Obtaining a double-stranded DNA comprising the first read sequence and the second unique molecular identifiers added to the other end and the second read sequence;
(Step 3) A step of cleaving the double-stranded DNA and ligating the first lead sequence and the second lead sequence,
(Step 4) a step of amplifying the double-stranded DNA obtained in Step 3, and (Step 5) a step of sequencing the double-stranded DNA amplified in Step 4;
A method for analyzing RNA, comprising:
<2> The primer used in step 1 is a primer having a base sequence represented by (T) _x (U) _y (T) _z VN (wherein, N represents G or A or T or C; V represents G or C or A, x represents an integer of 2 or more, y represents an integer of 2 to 5, z represents an integer of 2 to 10), and the RNA analysis method according to <1> .
<3> The RNA analysis method according to <2>, further comprising a step of shortening a sequence derived from a primer by treating the first strand of the full-length cDNA obtained in step 1 with an endonuclease that removes uracil.
<4> In step 2, a linker is added to the 3 ′ end of the first full-length cDNA obtained in step 1, and a second unique molecular identifier (Unique molecular identifiers) is added to the 5 ′ end of the first full-length cDNA strand. And a linker containing the second lead sequence, and synthesizing the second strand using the first unique molecular identifiers and the primer containing the first lead sequence, thereby producing double-stranded DNA. The method for synthesizing RNA according to any one of <1> to <3>.
<5> In any one of <1> to <4>, in step 3, the double-stranded DNA is cleaved using transposase, and the first lead sequence and the second lead sequence are ligated. A method for synthesizing the described RNA.
<6> The RNA synthesis method according to any one of <1> to <5>, wherein in step 4, double-stranded DNA is amplified by PCR.
<7> The method for synthesizing RNA according to any one of <1> to <6>, comprising classifying the determined sequence as follows in step 5:
(A) having a first unique molecular identifier (Unique molecular identifiers) and a first read sequence at one end, and having no unique molecular identifier (Unique molecular identifiers) at the other end A sequence having a lead sequence is a sequence including a transcription start site;
(B) the first read sequence without unique molecular identifiers at one end and the second read without unique molecular identifiers at the other end A sequence having a sequence is an intermediate sequence; and (c) a first lead sequence without unique molecular identifiers at one end and a second unique at the other end. A sequence having molecular identifiers (Unique molecular identifiers) and a second read sequence is a sequence containing a transcription start point.

  According to the RNA analysis method of the present invention, the analysis of the 5 'end and the 3' end of the full-length RNA can be performed in the same step.

FIG. 1 is a diagram showing an example of step 1 and step 2 in the method of the present invention. FIG. 2 is a diagram showing an example of steps 3 to 5 in the method of the present invention. FIG. 3 shows the results of measuring the length distribution of the prepared double-stranded full-length cDNA.

Hereinafter, the present invention will be described more specifically.
In the following examples of the present invention, first, full-length single-stranded cDNA was prepared using a cap trapper with an oligo dT reverse transcription primer. When preparing a full-length cDNA library, oligonucleotides (linker or adapter) are ligated to both ends. A unique molecular identifier (UMI) and a lead sequence were introduced into the adapter at the 5 ′ end of the cDNA (3 ′ end of RNA). For the 3 ′ end of the cDNA (5 ′ end of RNA), UMI and a lead sequence were introduced using primers. The resulting full-length cDNA library was subjected to tagmentation (ie, cleavage and ligation of the lead sequence to the breakpoint) to prepare an RNA-seq library. By sequencing the obtained library, a TSS (transcription start point) / TTS (transcription start point) tag was extracted based on the UMI and the read sequence, and mapped onto the reference genome. The TSS / TTS tag count was corrected by using UMI present at both ends of the cDNA to eliminate PCR bias. The remaining tags were mapped as RNA-seq. By this method, quantitative TSS / TTS information can be obtained together with the transfer region. According to the present invention, the total RNA length can be analyzed with quantitativeness and directionality.
Here, the unique molecular identifier (UMI) refers to a random nucleotide sequence of a certain length. One UMI is linked to one end of one nucleic acid molecule. A UMI has a sufficiently diverse nucleotide sequence to be identified as derived from the same starting nucleic acid molecule after the linked nucleic acid molecule has been amplified. This makes it possible to calibrate the bias during amplification. For example, the first UMI can be represented by N _n (G or A or T or C is shown, and n is an arbitrary integer), and n is, for example, 6, 7, 8, 9 or 10. When n is 8 (ie, NNNNNNNNN), the first UMI sequence has 4 ⁸ (65536) variations. For example, the second UMI can be represented by V _n (V represents G or C or A, and n represents an arbitrary integer), and n is, for example, 7, 8, 9, 10 or 11. When n is 8 (ie, VVVVVVVV), the second UMI sequence has 3 ⁸ (6561) variations.
The lead sequence is a specific sequence used for amplification and sequencing of double-stranded DNA. The first lead sequence and the second lead sequence are different from each other.

  Moreover, according to the method of the present invention, full-length RNA analysis can be performed in the same reaction step. By adding the UMI (Unique Molecular Identifier) and Nextera kit primer sequences to the oligo dT primer, which is a reverse transcription primer, and the second strand synthesis primer, the sequences at the 5 'end and 3' end are identified and analyzed in the same step. Can be done.

The RNA analysis method according to the present invention includes the following steps 1 to 5.
(Step 1) Full-length cDNA first strand using a full-length RNA having a CAP structure at the 5 ′ end, a primer having a base sequence complementary to the base sequence on the 3′-end side of the full-length RNA, and a DNA synthase Synthesizing
(Step 2) A hybrid composed of the first full-length cDNA first strand and the second strand complementary thereto, the first unique molecular identifiers (Unique molecular identifiers) added to one end thereof, and the first strand Obtaining a double-stranded DNA comprising the first read sequence and the second unique molecular identifiers added to the other end and the second read sequence;
(Step 3) A step of cleaving the double-stranded DNA and ligating the first lead sequence and the second lead sequence,
(Step 4) A step of amplifying the double-stranded DNA obtained in Step 3, and (Step 5) a step of sequencing the double-stranded DNA amplified in Step 4.

  An example of step 1 and step 2 is shown in FIG. 1, and an example of step 3 to step 5 is shown in FIG.

  In step 1, a full-length RNA having a CAP structure at the 5 ′ end (indicated as total RNA / polyA tailed RNA in FIG. 1) and a primer having a base sequence complementary to the base sequence on the 3 ′ end side of the full-length RNA A first full-length cDNA strand is synthesized using a DNA synthase (shown as RT primer in FIG. 1) (the top diagram in FIG. 1).

As RNA, RNA derived from a biological sample can be used.
A biological sample is any material obtained from organisms including microorganisms, animals and plants; cells; infectious particles such as viruses and prions.

  RNA is any form of nucleic acid molecule composed of ribonucleotides. RNA may be spliced or unspliced, may be incompletely spliced or processed, independent of its natural origin, synthetically obtained, artificial It may be derived from a template, mRNA, tRNA, rRNA designed in any of the above, or any mixture thereof.

  Examples of RNA include RNA having a CAP structure (also referred to as a cap structure or a capping structure) and RNA having no CAP structure. In the present invention, a full-length RNA having a CAP structure at the 5 'end is used. Such RNA includes eukaryotic mRNA. Eukaryotic mRNA usually has a CAP structure at the 5 'end and a poly A tail at the 3' end.

  As the primer having a base sequence complementary to the base sequence on the 3 ′ end side of the full-length RNA used in Step 1, any primer can be used as long as it has a base sequence complementary to the base sequence on the 3 ′ end side. For example, a primer comprising an oligo dT sequence can be used. By using a primer containing an oligo dT sequence, the primer can be annealed to the poly-A sequence if present on the 3 ′ end side of the full-length RNA, whereby the sequence of the sequence on the 3 ′ end side of the RNA can be determined. Single-stranded cDNA containing the complementary strand is synthesized.

The primer used in step 1 is more preferably a primer having a base sequence represented by (T) _x (U) _y (T) _z VN. In the formula, N represents G or A or T or C, V represents G or C or A, x represents an integer of 2 or more, y represents an integer of 2 to 5, and z represents 2 to 10 Indicates an integer. As described above, by placing a nucleotide (V) other than T downstream of (T) _z , the poly T sequence of the primer can be annealed to the 5 ′ end portion of the poly A sequence of RNA, and (U ) By using a primer containing _y , the length of oligo dT can be shortened by cleaving and _digesting the region of (U) _y in a later step. That is, the present invention can further include a step of shortening the sequence derived from the primer by treating the full-length cDNA first strand obtained in Step 1 with an endonuclease that removes uracil (FIG. 1 shows USER). Process displayed as). Thereby, the problem resulting from the T stretch at the time of sequencing can be solved.

A reverse transcriptase that synthesizes DNA from RNA can be used as the DNA synthase. As reverse transcriptase, a well-known thing can be used and various commercial items can be used. As an example of reverse transcriptase, SuperScript ^™ III RT (Thermo Fisher) can be used.

  In step 2, a hybrid composed of the first strand of the full-length cDNA obtained in step 1 and a second strand complementary thereto, a first unique molecular identifier (Unique molecular identifiers) added to one end of the hybrid. ) And the first lead sequence, as well as a second unique molecular identifier added to the other end and a second lead sequence.

In an example of step 2, a linker (shown as 5 'linker in FIG. 1) is added to the 3 ′ end of the first full-length cDNA obtained in step 1 (in FIG. 1, RT / Oxi / Bio / CapTrap / 5 'Step shown as SSLL), a linker (indicated as 3'linker in Fig. 1) containing the second unique molecular identifiers and the second read sequence at the 5' end of the first strand of the full length cDNA. Added (step shown as 3 ′ SSLL in FIG. 1), and using a primer (labeled 2nd primer in FIG. 1) containing the first unique molecular identifiers and the first read sequence. It is possible to obtain double-stranded DNA by synthesizing double-stranded DNA (step shown as 2 ^nd strand synthesis in FIG. 1). it can.

  In step 3, the double-stranded DNA obtained in step 2 is cleaved and a reaction for linking the first lead sequence and the second lead sequence is performed (step shown as Tagation in FIGS. 1 and 2). .

  In Step 3, any means that can be used for cleaving double-stranded DNA and ligating lead sequences can be used. However, transposase is used to cleave double-stranded DNA and It is preferable to carry out a reaction for linking the two lead sequences. This cleavage and ligation of the lead sequence (also referred to as adapter sequence) can be performed using a commercially available kit, Nextera XT DNA Library Preparation Kit (Illumina).

By the step 3 described above, three types of double-stranded DNAs described in the following (a) to (c) are produced.
(A) a first read sequence containing a first unique molecular identifier (Unique molecular identifiers) at one end and a second read sequence not containing a unique molecular identifier (Unique molecular identifiers) Double-stranded DNA at the ends,
(B) A first read sequence that does not contain unique molecular identifiers (Unique molecular identifiers) at one end and a second read sequence that does not contain unique molecular identifiers (Unique molecular identifiers) at the other end A double-stranded DNA having, and (c) a first read sequence that does not contain unique molecular identifiers at one end and a second unique molecular identifiers. Double-stranded DNA having two lead sequences at the other end.

  In step 4, the double-stranded DNA obtained in step 3 is amplified (step shown as amplification in FIG. 2). Amplification of double-stranded DNA can be preferably performed by PCR. Any DNA polymerase can be used for amplification by PCR. For example, commercially available enzymes such as Deep Vent, Phusion, KAPA HiFi, and KOD Plus can be used.

In step 5, the double-stranded DNA amplified in step 4 is sequenced.
In step 5, by classifying the determined sequences as follows, it is possible to simultaneously analyze the transcription start point sequence, the intermediate part (coding region) sequence, and the transcription end point sequence. It is.

(A) having a first unique molecular identifier (Unique molecular identifiers) and a first read sequence at one end, and having no unique molecular identifier (Unique molecular identifiers) at the other end A sequence having a lead sequence is a sequence including a transcription start site;
(B) the first read sequence without unique molecular identifiers at one end and the second read without unique molecular identifiers at the other end A sequence having a sequence is an intermediate sequence; and (c) a first lead sequence without unique molecular identifiers at one end and a second unique at the other end. A sequence having molecular identifiers (Unique molecular identifiers) and a second read sequence is a sequence containing a transcription start point.

  The present invention is illustrated by the following examples, but the present invention is not limited to the examples.

Example 1: Preparation of linker (1) Linker oligo sequence The following oligonucleotides were synthesized.
5'linker N6 up: 5'-GTGGTAUCAACGCAGAGUACNNNNNN-P-3 '(SEQ ID NO: 1)
5'linker GN5 up: 5'-GTGGTAUCAACGCAGAGUACGNNNNN-P-3 '(SEQ ID NO: 2)
5'linker down: 5'-P-GTACTCTGCGTTGATACCAC-P-3 '(SEQ ID NO: 3)
3'linker up: 5'- AAAAABBBBBBBBGCAUCGCUGTCTCUTAUACACAUCUCCGAGCCCACGAGAC-P-3 '(SEQ ID NO: 4)
3'linker down: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGATGC -3 '(SEQ ID NO: 5)
P: Phosphate group modification

(2) Preparation of 5'linker
An N6 / GN5 overhanging double-stranded linker was prepared by annealing up and down strand oligonucleotides.
Referring to the data sheet, the oligonucleotide was dissolved in 1 × TE to 1.5 mM, and the concentration was measured. Based on the measured concentration, it was adjusted to 1 mM with 1 × TE. Reagents were mixed as follows and lightly centrifuged.
[5 'N6 linker]
5 'linker N6 up (1 mM) 1 μl
5 'linker down (1 mM) 1 μl
1 M NaCl 1 μl
1x TE 7 μl
10 μl total

[5 'GN5 linker]
5 'linker GN5 up (1 mM) 1 μl
5 'linker down (1 mM) 1 μl
1 M NaCl 1 μl
1x TE 7 μl
10 μl total

The following program was run to anneal the oligo up and down strands.
95 ° C 5 minutes → Decrease to 83 ° C at -0.1 ° C / second → 83 ° C 5 minutes → 71 ° C at -0.1 ° C / second → 71 ° C 5 minutes → 59 ° C at -0.1 ° C / second → 59 ° C 5 minutes → -0.1 ℃ / sec to 47 ℃ → 47 ℃ 5min → -0.1 ℃ / sec to 35 ℃ → 35 ℃ 5min → -0.1 ℃ / sec to 23 ℃ → 23 ℃ 5min → -0.1 ℃ / Up to 11 ° C in seconds

The annealed linker was mixed as follows to prepare 5 ′ linker (100 μM).
5 'N6 linker 2.5 μl
5 'GN5 linker 10.0 μl

A part was diluted to the concentration to be used, and 5 'linker (10 μM) was prepared.
5 'linker (100 μM) 1 μl
0.1 M NaCl 9 μl

(3) Preparation of 3'linker
After annealing the up-strand and down-strand oligos, the complementary strand of the UMI portion is extended by the polymerase reaction.
In the same manner as in (2) above, the oligo was dissolved, the concentration was measured, and adjusted to 1 mM.
Reagents were mixed as follows and lightly centrifuged.
3 'linker up (1 mM) 1 μl
3 'linker down (1 mM) 1 μl
1M NaCl 1 μl
1x TE 7 μl
10 μl total

The oligo was annealed in the same manner as in (2) above to prepare pre-3 ′ linker (100 μM).
The following reagents were mixed to prepare 10 mM dVTPs.
100 mM dATP / dGTP / dCTP 3 μl each
21 μl water
30 μl total

The following reaction mixture was mixed with 10 μl of pre-3′linker (100 μM) and heated at 68 ° C. for 10 minutes to synthesize complementary strands of the UMI part.
Water 23.2 μl
ExTaq Buffer (10x) 4 μl
10 mM dVTPs 0.8 μl
ExTaq (5U / μl) (TaKaRa) 2 μl
30 μl total

  AMPure XP (Agencourt AMPure XP Kit (BECKMAN COULTER)) was allowed to stand at room temperature for 30 minutes or more and mixed well by inversion mixing, tapping, vortexing or the like before use.

72 μl of AMPure XP was added to 40 μl of the sample after the synthesis reaction and mixed well by pipetting. Further, 88 μl of isopropanol was added and mixed well by pipetting, and then allowed to stand at room temperature for 5 minutes. The plate was set on a magnetic bar (DynaMag ^™ -96 Side Skirted (Thermo Fisher)), allowed to stand for 5 minutes, and then the supernatant was removed. With the plate set on a magnetic bar, 200 μl of 70% ethanol was added and the supernatant was gently removed. Washing with ethanol was repeated twice. 42 μl of water heated at 37 ° C. was added, and the aggregated beads were sufficiently suspended by pipetting about 60 times, and then heated at 37 ° C. for 5 minutes. The plate was set on a magnetic bar and allowed to stand for 5 minutes, and then 40 μl of the supernatant was gently collected and transferred to a new 16-well plate. The following reagents were mixed with 40 μl of the collected supernatant to prepare 3′linker (10 μM).

1 M NaCl 10 μl
50 μl of water

Example 2: Library creation (1) Reverse transcription reaction
In a 16-well plate (16 well micro PCR plate, clear (AXYGEN)), 7.5 μg THP-1 total RNA per well, 1 μl of 100 μM RT primer (5′-TTTTTTTTTUUUTTTTTVN-3 ′) (SEQ ID NO: 6 ) And made up to 10 μl with water. This RNA / primer mix was prepared for 4 wells. Until [(13) SAP / USER treatment], the process was divided into 4 wells. The plate was set on a thermal cycler, heated at 65 ° C. for 5 minutes to be heat denatured, and then placed on ice for 2 minutes. The reaction solution was prepared as follows. Below is one sample. 4.4 samples were adjusted together.

Water 6.1 μl
5 × First-Strand Buffer 7.6 μl
0.1 M DTT 1.9 μl
10 mM dNTPs 1.0 μl
4.9M Trehalose / 2.12M Sorbitol mix 7.6 μl
SuperScript ^TM III RT (200 U / μl) (Thermo Fisher) 3.8 μl
28 μl total

 28 μl of the reaction mixture was added to each RNA / primer mix on ice and mixed. A reverse transcription reaction was performed by heating at 50 ° C. for 60 minutes and 55 ° C. for 10 minutes to prepare a cDNA / RNA hybrid.

(2) Purification
RNAClean XP (Agencourt RNAClean XP Kit (BECKMAN COULTER)) was allowed to stand at room temperature for 30 minutes or more and mixed well by inversion mixing, tapping, vortexing or the like before use. 68.4 μl of RNAClean XP was added to 38 μl of the sample after the reverse transcription reaction, mixed well by pipetting, and allowed to stand at room temperature for 5 minutes. The plate was set on a magnetic bar and allowed to stand for 5 minutes, after which the supernatant was removed. With the plate set on a magnetic bar, 200 μl of 70% ethanol was added and the supernatant was gently removed. Washing with ethanol was repeated twice. 42 μl of water heated at 37 ° C. was added, and the aggregated beads were sufficiently suspended by pipetting about 60 times, and then heated at 37 ° C. for 5 minutes. The plate was set on a magnetic bar and allowed to stand for 5 minutes, after which the supernatant was gently collected and transferred to a new 16-well plate.

(3) Oxidation reaction With 40 μl of the purified sample after reverse transcription reaction placed on ice, the following reagents were mixed and allowed to stand for 30 minutes in the dark.
1 M NaOAc (pH4.5) 2 μl
250 mM NaIO ₄ 2 μl

  16 μl of 1 M Tris-HCl (pH 8.5) was added and mixed. The same operation as in “(2) Purification” was performed. However, the amount of RNAClean XP added to 60 μl of the sample after the oxidation reaction was 108 μl.

(4) Biotinylation reaction The following reagents were mixed with 40 μl of the purified oxidized sample and heated at 65 ° C. for 30 minutes.
1 M NaOAc (pH6.0) 4 μl
10 mM Biotin Hydrazide 4 μl

  The same operation as in “(2) Purification” was performed. However, the amount of RNAClean XP added to 48 μl of the sample after the biotinylation reaction was 108 μl, and 12 μl of isopropanol was further added.

(5) Preparation of cap trap
The beads for 4.4 samples were prepared in one tube. Place 30 μl of Dynabeads® M-270 Streptavidin (Thermo Fisher) per sample in a 1.5 ml tube and place on a magnetic stand (Dynal MPC-S (Thermo Fisher)) to separate the beads Qing was removed. Remove the tube from the magnetic stand, suspend in 30 μl Wash buffer A (4.5 M NaCl, 50 mM EDTA (pH 8.0), 0.1% Tween20) per sample, separate on the magnetic stand, and then remove the supernatant. Excluded. This was repeated twice. The beads were resuspended with 105 μl Wash buffer A per sample and kept on ice until use.

(6) RNaseONE treatment The following reagents were mixed in 40 μl of the purified biotinylated sample and heated at 37 ° C. for 30 minutes.
RNaseONE buffer, 10 × 4.5 μl
RNase ONE ^TM Ribonuclease (10 U / μl) (Promega) 0.5 μl
Total 5 μl

(7) Cap trap
Streptavidin beads 105 μl prepared in “(5) Preparation of cap trap” were mixed with 45 μl of the sample after RNaseONE treatment, and heated at 37 ° C. for 30 minutes while being suspended by pipetting every 10 minutes. The heated plate was allowed to stand in a magnetic bar for 2 minutes, and the supernatant was removed. The plate was removed from the magnetic bar and the beads were completely suspended in 150 μl Wash buffer A. The plate was placed in a magnetic bar for 2 minutes and the supernatant was removed. Remove the plate from the magnetic bar and heat at 37 ° C. 150 μl Wash buffer B (10 mM Tris-HCl (pH8.5), 1 mM EDTA (pH8.0), 0.5 M NaOAc (pH6 .1), 0.1% Tween20) completely suspended the beads. The plate was placed in a magnetic bar for 2 minutes and the supernatant was removed. Similarly, the beads were washed with 150 μl of Wash buffer C (0.3 M NaCl, 1 mM EDTA (pH 8.0), 0.1% Tween 20) that had been heated at 37 ° C., and the supernatant was removed. The beads were well suspended in 35 μl of elution buffer (1 × RNaseONE buffer, 0.01% Tween20), heated at 95 ° C. for 5 minutes, and then rapidly cooled on ice for 2 minutes. The plate was placed in a magnetic bar for 2 minutes and the supernatant was collected in a new 16-well plate. The beads were well suspended again with 30 μl of elution buffer, and the supernatant was recovered in the same manner. The collected supernatant totaled 65 μl.

(8) RNase H / I treatment The following reagents were mixed in 65 μl of the sample after the cap trap treatment and heated at 37 ° C. for 30 minutes.
RNaseH (60 U / μl) (TaKaRa) 0.1 μl
RNase ONE ^TM Ribonuclease (10 U / μl) 2 μl
1x RNase ONE buffer 2.9 μl
Total 5 μl

  The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 70 μl of the sample after RNase H / I treatment was 126 μl. A portion (4 μl) of the eluted cDNA sample was dried by centrifugal concentration (75 minutes at 37 ° C.) of the remaining sample, specifically for cDNA QC. The pellet was well dissolved in 3 μl of water.

(9) cDNA QC
A diluted solution of Quant-iT ^™ OliGreen (registered trademark) ssDNA reagent (Component A) (Thermo Fisher) and 20 × TE (Component B) was prepared. The dilution method followed the product manual. In order to prepare a calibration curve, 100-mer oligos were prepared at final concentrations of 0, 10, 20, 40, 60, 80, 100, and 200 ng / ml.
(100mer oligo: GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTAT
TGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG) (SEQ ID NO: 7)

An equal amount of diluted Component A was mixed with the oligo diluted solution prepared to each concentration (calibration curve solution).
Component A and B diluted to 4 μl of sample prepared for QC were mixed as follows (sample solution).

1 x Component B 6 μl
1 x Component A 10 μl

  Dispense 9 μl of the above solution (calibration curve solution, sample solution) into 384 plates. The calibration curve solution was dispensed in 3 wells at each concentration, and the sample solution was dispensed in 2 wells. Measurements were made using an ARVO SX 1420 Multilabel counter (Wallac). A calibration curve was drawn from the measurement results, and the concentration of the sample was determined from the obtained equation. As a result, 9.33 ng of cDNA was obtained from 7.5 μg of total RNA.

(10) 5′-end linker ligation reaction 3 μl of the concentrated cDNA sample was heat denatured by heating at 95 ° C. for 5 minutes, and then placed on ice for rapid cooling. The following reagents were mixed with the cDNA sample in the order of linker and enzyme, and reacted at 30 ° C. for 4 hours.
10 μM 5 'linker 2 μl
DNA ligation kit <Mighty mix> (TaKaRa) 10 μl

  The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 15 μl of the sample after the ligation reaction was 27 μl.

(11) USER processing
After the 5′-end linker ligation reaction, 40 μl of the purified sample was mixed with the following reagents, heated at 37 ° C. for 30 minutes and at 95 ° C. for 5 minutes, and then rapidly cooled on ice.
2 μl water
CutSmart buffer (10 ×) 5 μl
USER (NEB) 3 μl
10 μl total

  The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 50 μl of the sample after USER treatment was 90 μl. 40 μl of the eluted cDNA sample was concentrated by centrifugation (at 37 ° C. for 75 minutes) and dried. The pellet was well dissolved in 4 μl of water.

(12) 3′-end linker ligation reaction 4 μl of the concentrated cDNA sample was heat denatured by heating at 95 ° C. for 5 minutes, and then placed on ice for rapid cooling. The following reagents were mixed with the cDNA sample in the order of linker and enzyme, and reacted at 16 ° C. for 16 hours.
10 μM 3'linker 1 μl
DNA ligation kit <Mighty mix> (TaKaRa) 10 μl

  The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 15 μl of the sample after the ligation reaction was 27 μl.

(13) SAP / USER processing
After the 3 ′ end linker ligation reaction, the following reagents were mixed in 40 μl of the purified sample, heated at 37 ° C. for 30 minutes and at 65 ° C. for 15 minutes, and then placed on ice.
4 μl of water
SAP buffer (10x) 5 μl
SAP (Affymetrix) 1 μl
10 μl total

  50 μl of SAP-treated sample was mixed with 2 μl of USER, heated at 37 ° C. for 30 minutes and at 95 ° C. for 5 minutes, and then rapidly cooled on ice. The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 52 μl of the sample after SAP / USER treatment was 93.6 μl. The eluted cDNA sample (40 μl, 4 wells) was collected into one 1.5 ml, and concentrated by centrifugation (at 37 ° C. for 75 minutes) and dried. The pellet was well dissolved in 10 μl of water and transferred to a 16 well plate.

(14) Second strand synthesis reaction The following reaction solution was mixed with 10 μl of the concentrated sample, and the second strand was synthesized by heating at 95 ° C. for 5 minutes, 55 ° C. for 5 minutes, and 72 ° C. for 30 minutes.
(2 ^nd strand synthesis primer:
5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGTATCAACGCAGAGTAC -3 ') (SEQ ID NO: 8)

27 μl water
Reaction Buffer (5x) 10 μl
10 mM dNTP 1 μl
100 μM 2 ^nd strand synthesis primer 1 μl
Phusion 1 μl
40 μl total

  1 μl of Exonuclease I (E. coli) (NEB) was mixed with 50 μl of the sample after the synthesis reaction and heated at 37 ° C. for 30 minutes. The same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to 51 μl of the sample after Exonuclease I treatment was 91.8 μl. Again, the same operation as in “(2) Purification” was performed. However, the amount of AMPure XP added to the sample was 56 μl. 40 μl of the eluted sample was concentrated by centrifugation (at 37 ° C. for 75 minutes) and dried. The pellet was well dissolved in 7 μl of water. 1 μl was used for concentration measurement of library QC and 1 μl for Bioanalyzer.

(15) Library QC
A diluted solution of Quant-iT ^™ PicoGreen (registered trademark) dsDNA reagent (Component A) (Thermo Fisher), 20 × TE (Component B), and Lambda DNA standard (Component C) was prepared. The dilution method followed the product manual.

Component C was prepared to a final concentration of 0, 10, 20, 40, 60, 80, 100, and 200 ng / ml for preparing a calibration curve. An equal amount of diluted Component A was mixed with the Component C solution prepared at each concentration (calibration curve solution).
Samples separated for QC Component A and B diluted to 1 μl were mixed as follows (sample solution).
1 x Component B 9 μl
1 x Component A 10 μl

  Dispense 9 μl of the above solution (calibration curve solution, sample solution) into 384 plates. The calibration curve solution was dispensed in 3 wells at each concentration, and the sample solution was dispensed in 2 wells. Measurements were made using an ARVO SX 1420 Multilabel counter (Wallac). A calibration curve was drawn from the measurement results, and the concentration of the sample was determined from the equation obtained. As a result, 0.91 ng of double-stranded full-length cDNA was obtained.

  Using 1 μl of the collected sample, the length distribution was measured with an Agilent Bioanalyzer High Sensitivity DNA kit. Contaminants such as Linker dimer were not observed (FIG. 3).

Example 3: Cap Trap RNA-seq (CTRS)
(1) Preparation of sequence library 100 pg of full-length cDNA was collected, and fragmentation and addition of adapter sequences (tagging) were performed by transposase using Nextera XT DNA Library Preparation Kit (Illumina). Thereafter, PCR was performed using primers and PCR enzymes packed in the kit, and purification was performed by Agencourt AMPure XP (BECKMAN COULTER) to perform buffer replacement and removal of reaction byproducts. The details of the procedure are as follows. Reagents marked with “*” indicate that they are packed with Nextera XT DNA Library Preparation Kit (Illumina) and Nextera Index Kit (Illumina)

An amount equivalent to 100 pg was fractionated from the obtained full-length cDNA (0.13 ng / μl) and made up to 5 μl with nuclease-free pure water. Thereto, 10 μl of Tagment DNA Buffer * and 5 μl of Amplicon Tagment Mix * were added and incubated at 55 ° C. for 10 minutes. After the incubation, 5 μl of Neutralized Buffer * was added and left at room temperature for 5 min. Index primer S507 * 5 μl, N702 * 5 μl and Nextera PCR Master Mix * 15 μl were added to the solution after standing. The PCR reaction was carried out under the following conditions after setting in a thermal cycler.
72 ℃ 3min-95 ℃ 30sec -11cycle [95 ℃ 10sec-55 ℃ 30sec-72 ℃ 30sec]-72 ℃ 1min-10 ℃ hold

  Buffer replacement and removal of reaction byproducts were performed using 1.2 times (60 μl) of Agencourt AMPure XP (BECKMAN COULTER) with respect to the liquid volume (50 μl). In order to remove the reaction product as much as possible, the same purification operation was repeated two more times (3 times in total). The purified sample (sequence library) was eluted in 20 μl of Resuspension Buffer *.

Primer sequence used in the examples
Nextera Index Kit-PCR primers Package
S505
AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTC (SEQ ID NO: 9)
N702
CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGG (SEQ ID NO: 10)

(2) Sequence and data analysis The obtained sequence library was sequenced by HiSeq 2500 (Illumina). The sequence conditions are as follows.
High output mode, 100 paired-end, equivalent to 1/4 lane Input sequence library concentration 10pM

About 44 million reads were obtained by sequencing.
When the obtained reads were divided into those having a 5 ′ end recognition sequence, those having a 3 ′ end recognition sequence, and those having no recognition sequence, they were 18.1%, 10.6% and 64.3%, respectively (Table 1). ).
When the obtained sections were mapped to the human genome reference sequence, the map ratios were 83.1%, 80.5%, and 72.6% at the 5 ′ end, 3 ′ end, and others, respectively (Table 2).
Further, when the mapped area in each section was examined, it was confirmed that most of each section was mapped to the expected transcript area (Table 3).

  70-80% of the leads are analyzable, and the yield is good.

Upstream100, 5UTR_exon: 5 'side of the known transcriptome
3UTR_exon, Downstream 100: 3 'side of the known transcriptome
Coding_exon: An area located in a known transcriptome

Claims (7)

(Step 1) Full-length cDNA first strand using a full-length RNA having a CAP structure at the 5 ′ end, a primer having a base sequence complementary to the base sequence on the 3′-end side of the full-length RNA, and a DNA synthase Synthesizing
(Step 2) A hybrid composed of the first full-length cDNA first strand and the second strand complementary thereto, the first unique molecular identifiers (Unique molecular identifiers) added to one end thereof, and the first strand Obtaining a double-stranded DNA comprising the first read sequence and the second unique molecular identifiers added to the other end and the second read sequence;
(Step 3) A step of cleaving the double-stranded DNA and ligating the first lead sequence and the second lead sequence,
(Step 4) a step of amplifying the double-stranded DNA obtained in Step 3, and (Step 5) a step of sequencing the double-stranded DNA amplified in Step 4;
A method for analyzing RNA, comprising: The primer used in step 1 is a primer having a base sequence represented by (T) _x (U) _y (T) _z VN (wherein N represents G or A or T or C, and V represents G Or C or A, x represents an integer of 2 or more, y represents an integer of 2 to 5, and z represents an integer of 2 to 10, and the RNA analysis method according to claim 1. The method for analyzing RNA according to claim 2, further comprising a step of shortening a sequence derived from a primer by treating the first strand of the full-length cDNA obtained in step 1 with an endonuclease that removes uracil. In step 2, a linker is added to the 3 ′ end of the first full-length cDNA obtained in step 1, and a second unique molecular identifier (Unique molecular identifier) and a second unique molecular identifier are added to the 5 ′ end of the first full-length cDNA first strand. A double-stranded DNA is obtained by adding a linker containing the first read sequence and synthesizing the second strand using the first unique molecular identifiers and a primer containing the first read sequence. The method for synthesizing RNA according to any one of claims 1 to 3. In the step 3, the reaction of cleaving double-stranded DNA using transposase and ligating the first lead sequence and the second lead sequence is performed. Synthesis method. The method for synthesizing RNA according to any one of claims 1 to 5, wherein in step 4, double-stranded DNA is amplified by PCR. The method of synthesizing RNA according to any one of claims 1 to 6, comprising classifying the determined sequence as follows in step 5:
(A) having a first unique molecular identifier (Unique molecular identifiers) and a first read sequence at one end, and having no unique molecular identifier (Unique molecular identifiers) at the other end A sequence having a lead sequence is a sequence including a transcription start site;
(B) the first read sequence without unique molecular identifiers at one end and the second read without unique molecular identifiers at the other end A sequence having a sequence is an intermediate sequence; and (c) a first lead sequence without unique molecular identifiers at one end and a second unique at the other end. A sequence having molecular identifiers (Unique molecular identifiers) and a second read sequence is a sequence containing a transcription start point.