JP2018082622A - Internal standard molecule for immunoprecipitation and immunoprecipitation method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new internal standard molecule for comparison between lots and between samples in different conditions, in quantification of a target product using immunoprecipitation.MEANS FOR SOLVING THE PROBLEM: The present invention provides an internal standard molecule for immunoprecipitation, which contains a protein containing an epitope recognized by an antibody used in immunoprecipitation, or its partial peptide, and a nucleic acid bound to it.SELECTED DRAWING: Figure 1

Description

  The present invention relates to an internal standard molecule for immunoprecipitation and an immunoprecipitation method.

  Antibodies that specifically bind to specific proteins are widely used as research tools in the life science field. Among them, the immunoprecipitation method is a very utilized method for separating and purifying a specific protein, and various reagents have been developed. In addition, for example, co-immunoprecipitation has been developed to separate and purify proteins and protein complexes present in cell lysates, and various co-immunoprecipitation tools have been developed.

In recent years, studies have been made to clarify the site on DNA to which a specific protein such as a transcription factor binds and the base sequence of that site. Chromatin immunoprecipitation, which uses antibodies against specific proteins such as transcription factors.
ChIP) is used (Patent Document 1).

  Recently, the ChIP-seq method, which combines this chromatin immunoprecipitation method and DNA sequencing using a next-generation sequencer, is also widely used. In the ChIP-seq method, first, the nucleotide sequence of a DNA fragment obtained by immunoprecipitation using an antibody that binds to a specific protein such as a transcription factor is determined using a next-generation sequencer. Maps to a reference array that is As the number of base sequences mapped to the reference sequence (number of reads) increases, the DNA region is a region where more proteins that bind to the antibody used in the chromatin immunoprecipitation method form a complex, Identified as a region under expression control. For example, if the number of reads in the base sequence of a specific DNA region increases as a result of administration of a specific substance, the DNA region forms a complex with more proteins recognized by the antibody by that specific substance, and expression control It is evaluated that a change has occurred.

  However, this number of leads is due to errors due to the crossover rate between proteins and antibodies, experimental procedures, etc., between lots of reagents such as antibodies, between samples with different conditions, and between multiple experiments performed under the same experimental conditions. Usually it fluctuates. To solve this problem, a method has been developed to detect a difference between the two groups of mapped states (Non-Patent Documents 1 and 2). There is a risk of failing to output a certain difference, and the fact is that it is close to semi-quantitative rather than quantitative. This is due to the development of means to properly correct the error factors that affect the data obtained in the ChIP-seq method, the acquisition of appropriately corrected quantitative data by that means, and multiple experiments. Appropriate quantitative comparative analysis with appropriately corrected quantitative data indicates that the observed variation is necessary and important to understand that the variation is biologically meaningful.

  As a method for quantifying a target protein contained in a biological sample, a method using an internal standard peptide has been developed (Patent Document 2). In this method, a peptide that binds to a target protein is synthesized, and a known amount is added to a biological sample as an internal standard. Thereafter, the protein is digested into peptides with a protease, and then the peptides are separated and analyzed with a mass spectrometer. Then, the quantification is performed by comparing the signal areas of the known amount of the internal standard peptide and the protein-derived peptide. However, this method is not a method applicable to the above-described immunoprecipitation method, co-immunoprecipitation method, or ChIP-seq method.

In addition, in the conventional ChIP-seq method, for example, an immunoprecipitation system using an anti-histone H3 antibody is used as a positive control experiment, and a ChIP-seq method kit containing an anti-histone H3 antibody is also commercially available. Has been. The results obtained by immunoprecipitation by the binding of histone H3 and anti-histone H3 antibody are for confirming that there is no problem in the chip-seq method or a kit therefor, and are used for the correction that is the subject of the present invention. It is not possible. The first reason is that it cannot be considered that the crossover rate of histone H3 and anti-histone H3 antibody is equal to the crossover rate of the analysis target, for example, transcription factor protein. The difference in crossover rate also affects the sedimentation efficiency. That is, ChIP-seq data using an antibody against a protein different from the analysis target cannot be used for correction of data which is a problem of the present invention.

JP 2005-156266 A JP 2006-300758 A

Zhang et al, Genome Biology 2008, 9: R137 Park PJ, Nature Reviews Genetics 10, 669-680 (October 2009)

  It is an object of the present invention to provide a new internal standard molecule for comparison between lots or samples having different conditions in quantification of a target substance using an immunoprecipitation method.

  As a result of intensive studies in view of the above problems, the present inventors have found that a nucleic acid having a specific base sequence that can be detected after immunoprecipitation binds to a protein containing an epitope recognized by the antibody used in the immunoprecipitation or a partial peptide thereof. It has been found that the above problem can be solved by using an internal standard molecule. The present invention is as follows.

(1) An internal standard molecule for immunoprecipitation,
An internal standard molecule comprising a protein containing an epitope recognized by an antibody used in immunoprecipitation or a partial peptide thereof, and a nucleic acid bound thereto.
(2) The immunoprecipitation is chromatin immunoprecipitation,
The protein is a protein that binds to DNA on chromatin;
The internal standard molecule according to (1), wherein the nucleic acid sequence is a sequence that is not included in the genome of the biological species from which the test sample is derived.
(3) The internal standard molecule according to (1) or (2), wherein the nucleic acid sequence is derived from yeast.
(4) The internal standard molecule according to (3), wherein the sequence of the nucleic acid derived from the yeast is represented by any one of SEQ ID NOs: 1 to 4.
(5) The nucleic acid is labeled with biotin, the protein or a partial peptide thereof is a fusion protein or peptide of avidin or streptavidin, and the nucleic acid becomes the protein or the protein by interaction of biotin and avidin or streptavidin. The internal standard molecule according to any one of (1) to (4), which is bound to a partial peptide.
(6) The nucleic acid is subjected to SMCC (succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carbbox) through amine modification to the nucleic acid.
the protein or its partial peptide is a cysteine-added protein or its partial peptide in which a cysteine residue is added to the end of the protein or its partial peptide, and the interaction between SMCC and cysteine residue The internal standard molecule according to any one of (1) to (4), wherein the nucleic acid is bound to the protein or a partial peptide thereof.
(7) The internal standard molecule according to any one of (1) to (6), wherein the protein is a transcription factor, a transcription regulatory factor, a histone protein, or a chromatin regulatory factor.
(8) The internal standard molecule according to (7), wherein the transcription factor or transcription control factor is IRF4 protein, p53 protein, NF-κB, Rb protein, BRCA1 protein, MYC protein, or Pax5 protein.
(9) An immunoprecipitation method comprising the following steps.
Mixing the test sample with the internal standard molecule according to any one of (1) to (8);
An immunoprecipitation step, and
Normalizing immunoprecipitation results by detecting the nucleic acid portion of the internal standard molecule.
(10) A chromatin immunoprecipitation method comprising the following steps.
Mixing the test sample with the internal standard molecule according to any one of (1) to (8);
Chromatin immunoprecipitation process,
Amplifying the target DNA and the DNA portion of the internal standard molecule in the sample obtained in the chromatin immunoprecipitation step; and
A step of correcting the amount of amplified DNA of the target fragment DNA in the sample, using the amount of amplified DNA of the DNA portion of the internal standard molecule obtained in the amplification step as an index.
(11) A chromatin immunoprecipitation method comprising the following steps.
Mixing the test sample with the internal standard molecule according to any one of (1) to (8);
Chromatin immunoprecipitation process,
Amplifying the target DNA in the sample obtained in the chromatin immunoprecipitation step and the DNA portion of the internal standard molecule;
Analyzing the base sequence of the DNA portion of the target DNA and the internal standard molecule in the sample amplified in the amplification step; and
A step of correcting the sequence amount of the base sequence of the target DNA in the sample using the sequence amount of the base sequence of the DNA portion of the internal standard molecule obtained in the step of analyzing the base sequence as an index.

  By using the internal standard molecule of the present invention, correction for comparison between lots or samples with different conditions can be performed more accurately than in the prior art in quantification of a target substance using an immunoprecipitation method.

The agarose gel electrophoresis photograph which shows the result of PCR using each of the supernatant after precipitating non-biotinylated DNA and biotinylated DNA with streptavidin. The photograph which shows the confirmation result by the Western blot of fusion protein. The figure which shows the result of quantitative PCR which used the supernatant and precipitation when performing immunoprecipitation using each sample of Table 1 as a template. The figure which shows the amount of sedimentation of the target DNA immunoprecipitated when the quantity of an internal standard is changed. The figure which shows the amount of sedimentation of the internal standard yeast DNA which is immunoprecipitated when the amount of an internal standard is changed, when the operation which removes an unbound biotinylated DNA is performed. The figure (photograph) which shows the result of the Western blot which shows the induction | guidance | derivation of IRF4 protein expression by a chemical | medical agent. The figure which shows the result of quantitative RT-PCR which shows the expression induction of the target gene accompanying the induction of IRF4 gene expression by a chemical | medical agent. The figure which shows the result of the immunoprecipitation of the endogenous arrangement | sequence which shows IRF4 gene expression induction | guidance | derivation by a chemical | medical agent. The figure which shows the mapping result of the arrangement | sequence of each internal standard molecule when changing the density | concentration of a chemical | medical agent and adding the internal standard molecule, and carrying out immunoprecipitation. The figure which shows the result of the immunoprecipitation of the endogenous arrangement | sequence which shows IRF4 gene expression induction | guidance | derivation by a chemical | medical agent. The figure which shows the collection amount of yeast DNA of ID1 or ID2 by immunoprecipitation. The figure which shows the result of having mapped the DNA of the (kappa) 3'E area | region of the Ig (kappa) gene which the Irf4 protein induced | guided | derived by the medicine obtained by immunoprecipitation binds on a mouse genome. The figure which shows the result of having counted the number of reads in a binding peak range based on the map in the case of each DOX density | concentration. The figure which shows the result of the correction | amendment (left) which remove | divides the number of leads in a peak range by the total number of reads, and the correction | amendment (right) using an internal standard molecule | numerator. The figure which shows the precipitation result of an internal arrangement | sequence and an internal standard arrangement | sequence in the chromatin immunoprecipitation of the histone H3 protein in which lysine 27 was acetylated.

  The present invention includes an invention related to an internal standard molecule for immunoprecipitation (first invention) and an invention related to an immunoprecipitation method (second invention).

<1. First Invention>
The first invention of the present invention is:
An internal standard molecule for immunoprecipitation,
An internal standard molecule comprising a protein containing an epitope recognized by an antibody used in the immunoprecipitation or a partial peptide thereof and a nucleic acid bound thereto.

[Immunoprecipitation]
Immunoprecipitation is a technique known in the art. In short, it is a technique for detecting, separating, and / or purifying an antigen using an immunoprecipitation reaction in which a soluble antigen is specifically reacted with an antigen-specific antibody and precipitated. The immunoprecipitation in the present invention is not particularly limited, and examples thereof include general immunoprecipitation, co-immunoprecipitation, and chromatin immunoprecipitation. In the present invention, other experimental systems may be assembled before and after immunoprecipitation, and an immunoprecipitation system may be assembled as one of the entire experimental systems.

(Chromatin immunoprecipitation)
The immunoprecipitation in the present invention is preferably chromatin immunoprecipitation. As described above, in the immunoprecipitation method using the internal standard molecule of the first invention of the present invention, correction for comparison between lots or samples with different conditions is performed more accurately than in the past in the quantification of the target substance. be able to.
In the case of chromatin immunoprecipitation, proteins with large dissociation constants or proteins with unstable binding, such as proteins such as transcription factors that bind to DNA on chromatin, are targeted between lots or samples with different conditions. The effect of being able to perform correction for comparison of the above more accurately than in the past is great.

[Internal standard molecule]
The internal standard molecule of the first invention of the present invention is an internal standard molecule for immunoprecipitation, and is a combination of a nucleic acid and a protein containing an epitope recognized by the antibody used in the immunoprecipitation or a partial peptide thereof. Details of the internal standard molecule of the first invention of the present invention are described below.

[Nucleic acid]
The internal standard molecule of the first invention of the present invention contains a nucleic acid.

  Examples of the type of nucleic acid include DNA, RNA, and artificial nucleic acid. From the viewpoints of ease of synthesis, relevance to other experimental systems, and stability that is difficult to decompose, DNA is preferable, and double-stranded DNA is more preferable. It may contain a modified base.

  The nucleotide sequence of the nucleic acid is not particularly limited as long as it can be detected by hybridization or PCR, but in order to minimize the interaction such as binding to the substance in the test sample, the species of the species from which the test sample is derived is used. It preferably consists of a sequence not contained in the genome. That is, when used for chromatin immunoprecipitation, it is preferable to use a sequence not included on the chromosome of the sample. Furthermore, in order to minimize the interaction such as the binding with a substance in the test sample, it is preferable not to include a protein binding sequence such as a gene regulatory sequence of a biological species from which the test sample is derived.

Examples thereof include sequences derived from fungi such as yeast, bacteria such as Escherichia coli, and fruit fly. Among them, when a mammalian sample is used as the test sample, a sequence derived from a bacterium such as yeast or Escherichia coli is preferable, and a sequence derived from yeast is more preferable.
Examples of the nucleic acid sequence derived from yeast include the sequences represented by SEQ ID NO: 1 to SEQ ID NO: 4.
An artificial sequence not derived from any species may be used.

  Moreover, it is preferable not to include a repeat sequence for the convenience of primer design when amplifying by PCR.

  In addition, as long as the nucleic acid can be detected by PCR reaction or hybridization reaction, the type, GC content, length of base sequence, etc. are not particularly limited, but the GC content is preferably 30% or more, more Preferably it is 40% or more, Preferably it is 70% or less, More preferably, it is 60% or less. By having a GC content within this range, amplification of non-specific sequences can be suppressed, and the target sequence can be efficiently amplified.

  The length of the base sequence of the nucleic acid is not particularly limited as long as DNA is amplified by PCR, which will be described later, but usually 15 bases or more, preferably 20 bases or more, more preferably 25 bases or more, and usually 200 bases or less, preferably Is less than 100 bases.

(Method for producing nucleic acid)
The method for producing the nucleic acid having the selected base sequence is not particularly limited, and a known method can be used. For example, if the length of the base sequence is short, it may be artificially synthesized by a known method, or a known trust service may be used.
It can also be produced by a known genetic engineering technique. For example, it can also be obtained by performing PCR using a primer set designed to amplify the target base sequence using the genomic DNA of the biological species from which the selected base sequence is derived as a template.

[protein]
The internal standard molecule of the first invention of the present invention includes a protein. The protein is a protein containing an epitope recognized by the antibody used in the immunoprecipitation or a partial peptide thereof. Further, the protein may be a protein containing an epitope recognized by the antibody or a partial peptide thereof and a protein or a partial peptide thereof to which a tag sequence is added. Here, the tag sequence refers to a protein or peptide that functions as a label for a protein containing an epitope recognized by the antibody or a partial peptide thereof. Specific examples of the tag sequence include a histidine (His) tag, a glutathione-S-transferase (GST) tag, and a FLAG tag. The tag sequence may be added to a protein containing an epitope recognized by the antibody or a partial peptide thereof by using a genetic recombination technique using an expression vector that expresses a fusion protein with the tag sequence that is commercially available. it can. The tag sequence can be used, for example, for recovery or purification of a protein containing an epitope recognized by the antibody or a partial peptide thereof.

  The protein contained in the internal standard molecule of the first invention of the present invention usually means the full length of the amino acid sequence, but also includes the full length of the mature protein from which the signal sequence is removed and the mutant protein. In the case of the full length, the protein contained in the internal standard molecule of the first invention of the present invention naturally contains an epitope recognized by the antibody used in the immunoprecipitation.

  The protein contained in the internal standard molecule of the first invention of the present invention is not particularly limited, and there is no limitation on the amino sequence or its length. As the protein contained in the internal standard molecule, for example, a DNA binding protein is preferable, and specific examples include a transcription factor, a transcription control factor, a histone protein, a chromatin control factor, and the like.

  Although it does not specifically limit as a transcription factor, For example, IRF4 protein, p53 protein, NF- (kappa) B, MYC protein, Pax5 protein etc. are mentioned. The transcription control factor is not particularly limited, and examples thereof include Rb protein and BRCA1 protein.

  Although it does not specifically limit as histone protein, For example, linker histones, such as core histone proteins, such as H2A protein, H2B protein, H3 protein, and H4 protein, H1 protein etc. are mentioned.

  These may be variants. Furthermore, these histone proteins may be chemically modified. For example, acetylation, phosphorylation, methylation, and ubiquitination may be performed. In the case of methylation, it may be monomethylated, dimethylated or trimethylated.

  In the case of the H3 protein, for example, when the 9th lysine residue is methylated (H3K9me), when the 27th lysine residue is methylated (H3K27me), the 9th lysine residue is acetylated. (H3K9Ac) and the like. In addition, the case where the 9th lysine residue is trimethylated (H3K9me3), the case where the 27th lysine residue is trimethylated (H3K27me3), and the like can also be mentioned.

  Similarly, in the case of the H2A protein, for example, when the fifth lysine residue is acetylated (H2AK5Ac) and when the first serine residue is phosphorylated (H2AS1ph), the 120th threonine residue Examples include a case where the group is phosphorylated (H2AT120ph) and a case where the 119th lysine residue is ubiquitinated (H2AK119ub).

  Similarly, for the H2B protein, for example, when the fifth lysine residue is acetylated (H2BK5Ac), when the 14th serine residue is phosphorylated (H2BS14ph), the 120th lysine residue Examples include a case where the group is ubiquitinated (H2BK120ub).

  Similarly, in the case of H4 protein, for example, when the fifth lysine residue is acetylated (H4K5Ac), when the first serine residue is phosphorylated (H4S1ph), the third arginine residue Examples include a case where the group is methylated (H4R3me).

  Although it does not specifically limit as a chromatin control factor, For example, Brg1, p300, Pc4 etc. are mentioned.

[Partial peptide]
The partial peptide of the protein contained in the internal standard molecule of the first invention of the present invention is not particularly limited as long as it contains an epitope recognized by the antibody used in immunoprecipitation. For example, a partial peptide of 20 to 100 amino acids is exemplified. Is done.

(Method for producing protein or partial peptide thereof)
When the length of the amino acid sequence of the protein or its partial peptide is short, its production method is not particularly limited and can be produced according to a known peptide synthesis method. For example, a solid phase synthesis method and a liquid phase synthesis method can be mentioned. As the purification method, for example, solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like can be combined, whereby the peptide can be isolated and purified. When the obtained peptide is a free form, it can be converted into an appropriate salt by a known method. Conversely, when it is obtained as a salt, it is converted into a free form or other salt by a known method. You can also Modifications such as phosphorylation, acetylation, and methylation recognized by the antibody can also be added to the peptide.

  Even when the amino acid sequence of the protein or its partial peptide is long or short, it can be produced by genetic engineering techniques. For example, a DNA encoding a protein or a partial peptide thereof can be prepared, a recombinant expression vector can be constructed using the DNA, introduced into a host, expressed, and purified for production. Any of them can be performed using a known method.

  The above protein or a partial peptide thereof may be a fusion protein containing a tag sequence such as a streptavidin tag, a His tag, a GST tag, or a Flag tag.

[Binding of nucleic acid and protein or partial peptide thereof]
(Modification of nucleic acid)
The internal standard molecule of the first invention of the present invention is one in which a nucleic acid and a protein or partial peptide are bound. The bonding mode is not particularly limited, but irreversible bonding is preferable. Regarding the nucleic acid side, for example, modification of the end of the nucleic acid so that it can be bound to a protein or a partial peptide can be mentioned.
The mode of modification of the nucleic acid is not particularly limited as long as it binds to a protein or partial peptide. For example, a labeling substance that binds to the end of a nucleic acid by reacting with a labeling substance or functional group introduced into the protein or peptide described later And introducing a functional group. For example, introduction of a labeling substance such as biotin, a thiol group or an amino group at the end of the nucleic acid can be mentioned. These labeling substances and functional groups may be introduced into the nucleic acid via a spacer.

(Nucleic acid modification method)
The method of modifying the nucleic acid is not particularly limited, and a method using a primer with a labeled base introduced at the end when the nucleic acid is amplified by PCR, a method using a labeled base as the terminal base when synthesizing the nucleic acid with a nucleic acid synthesizer A known method can be followed.
For example, as a primer for amplifying a nucleic acid by PCR, DNA having a biotinylated 5 ′ end or a nucleic acid having an aminated 5 ′ end can be used. In the case of using DNA aminated at the 5 ′ end, a method of binding to an N-hydroxysuccinimide active ester via the amino group is further exemplified. For example, a method of binding N-hydroxysuccinimide active ester and N-hydroxysuccinimide active ester of SMCC (succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate), which is a bivalent reagent having a maleimide group introduced, is mentioned. It is done.

(Modification of protein or partial peptide)
The internal standard molecule of the first invention of the present invention is one in which the nucleic acid contained in the internal standard molecule and a protein or partial peptide are bound. The protein or partial peptide side is modified so that it can bind to a nucleic acid.
The modification of the protein or partial peptide is not particularly limited as long as it binds to the nucleic acid and can recognize the antibody used for immunoprecipitation. For example, the labeling substance or functional group introduced into the nucleic acid in the protein or partial peptide is not limited. Introducing a labeling substance or a functional group that reacts with and binds. The modification of the protein or partial peptide may or may not be at the end of the protein or partial peptide.

  Examples of protein or partial peptide modifications include avidin labeling and streptavidin labeling when a biotin-labeled nucleic acid is used as the nucleic acid. Moreover, when using the nucleic acid couple | bonded with N-hydroxysuccinimide active ester through the amino group as a nucleic acid, a cysteine label | marker is mentioned. Cysteine may label the endogenous cysteine or introduce a new cysteine residue.

(Protein or partial peptide modification method)
The method for modifying the protein or its partial peptide is not particularly limited, but genetic engineering techniques can be used. For example, in the above-described method for producing a protein or a partial peptide thereof, when a vector is produced, the vector encoding a label molecule such as avidin or streptavidin is linked to a DNA encoding a protein or a partial peptide thereof. And can be expressed as a fusion protein.
At this time, as long as the protein or partial peptide binds to the nucleic acid and the antibody used in immunoprecipitation can be recognized, the DNA encoding the labeled molecule can be located downstream of the DNA encoding the protein or partial peptide. It may be arranged.

(Method of binding nucleic acid to protein or partial peptide thereof)
The binding between the nucleic acid and the protein or its partial peptide can be performed by a known method.
For example, in the case of binding between a nucleic acid modified with biotin at the end and a fusion protein of streptavidin and a protein, both may be simply mixed in a solution. The ratio may be changed by experiment.

<2. Immunoprecipitation method>
The immunoprecipitation method of the second invention of the present invention comprises:
Mixing the test sample with the internal standard molecule;
An immunoprecipitation step, and
An immunoprecipitation method comprising a step of performing normalization by detecting a nucleic acid portion of the internal standard molecule.

[Process of mixing test sample and internal standard molecule]
The mixing method of the test sample and the internal standard molecule in this step is not particularly limited, and may be performed by a method usually performed in the technical field such as pipetting.

[Immunoprecipitation process]
The method of immunoprecipitation is not particularly limited, and a known immunoprecipitation method can be used. An antibody is bound to a carrier such as a bead, added to a mixed solution of a test sample and an internal standard molecule, incubated for a certain time, for example, 30 minutes to 1 day, and then a precipitate is obtained by centrifugation or the like. . The precipitate is washed with a buffer and used for the next step.

As an antibody in immunoprecipitation, an antibody against a protein that is expected to bind to a target fragment DNA may be used in the same manner as in a normal immunoprecipitation method. A complex of protein and fragment DNA bound thereto, and
Internal standard molecules can be precipitated.
Then, the nucleic acid portion of the internal standard molecule is detected, and the measurement result of immunoprecipitation is standardized based on the detection result. Regarding the measurement result of normal co-immunoprecipitation, it is possible to correct variations in experimental conditions between different samples.

  Below, the specific aspect of a chromatin immunoprecipitation is demonstrated. However, it is not limited to these examples.

<2-1. First Embodiment of Chromatin Immunoprecipitation>
The first embodiment of the chromatin immunoprecipitation method of the second invention of the present invention comprises:
Mixing the test sample with the internal standard molecule;
Chromatin immunoprecipitation process,
Amplifying the target DNA and the DNA portion of the internal standard molecule in the sample obtained in the chromatin immunoprecipitation step; and
A chromatin immunoprecipitation method comprising a step of correcting the amount of amplified DNA of a target fragment DNA in a sample using the amount of amplified DNA of the DNA portion of the internal standard molecule obtained in the amplification step as an index.

[Process of mixing test sample and internal standard molecule]
The mixing method of the test sample and the internal standard molecule in this step is not particularly limited, and may be performed by a method usually performed in the technical field such as pipetting.

[Chromatin immunoprecipitation process]
The method of chromatin immunoprecipitation is not particularly limited, and a known chromatin immunoprecipitation method can be used.
For example, a complex of DNA and protein on chromatin present in a test sample is cross-linked with a cross-linking agent such as formaldehyde (for example, at room temperature for 10 minutes), and then the cells are recovered and the DNA is 100 Sonicate to a length of ~ 500 bp. And the method of performing immunoprecipitation using the sample containing the composite_body | complex of DNA and protein which were ultrasonically disrupted is mentioned.
When the test sample and the internal standard molecule are mixed, the internal standard molecule is also precipitated by the antibody together with the complex of DNA and protein on chromatin.

[Amplification of target DNA and DNA portion of internal standard molecule in sample obtained in chromatin immunoprecipitation step]
The amplification method in this step is not particularly limited as long as the target DNA and the DNA of the internal standard molecule can be amplified, and the amplified DNA in the subsequent step can be quantified, and a known method can be used. A PCR method is preferably used, and examples thereof include a real-time PCR method.

  In this step, a primer set for amplifying the target DNA in the sample and a primer set for amplifying the DNA of the internal standard molecule may be used, and a primer set for amplifying each DNA may be used.

As a method for amplifying the target DNA and the internal standard molecule DNA in the sample using the real-time PCR method, a known method can be used. For example, intercalation method, hybridization method, LUX method and the like can be mentioned.
In the intercalation method, for example, a dye that specifically intercalates with double-stranded DNA and emits fluorescence, such as SYBR Green I, can be used.
In the hybridization method, for example, a probe in which a fluorescent formula is bound to an oligonucleotide specific to a DNA sequence, such as a TaqMan probe, can be used.

[Step of correcting the amount of target DNA in the sample using the amplification amount of the DNA portion of the internal standard molecule obtained in the amplification step as an index]
The amount of the DNA portion of the internal standard molecule mixed with the test sample is known. Therefore, in this step, if the DNA portion of the amplified internal standard molecule can be quantified, it can be amplified using a known method such as a method of comparing Ct values or a method of microchannel electrophoresis using this as an index. In addition, the amount of target DNA in the sample can be corrected and quantified.

In general, in chromatin immunoprecipitation, it is determined that the greater the amount of the complex of DNA and protein that is precipitated, the greater the amount of protein bound to the DNA region. Thus, assuming a known sequence as a transcription factor binding sequence as the target DNA in the sample and using a primer set for amplifying the known sequence, the amplification amount obtained in the amplification step after immunoprecipitation is It can be determined that the greater the amount, the greater the amount of transcription factor binding. Then, by correcting this amount with the amplification amount of the internal standard, the amount of binding can be grasped more accurately.
For example, if the amount of a complex of precipitated DNA and protein increases by administration of a specific substance, the amount of protein binding to the DNA region increases by the specific substance, that is, the expression control changes. It is evaluated. In addition, the relationship between the disease or mutation and the amount of protein binding can also be examined by comparing the diseased patient with a healthy person and comparing the mutation carrier with a non-carrier.

<2-3. Second Embodiment of Chromatin Immunoprecipitation>
A second embodiment of the chromatin immunoprecipitation method of the second invention of the present invention comprises:
Mixing the test sample with the internal standard molecule;
Chromatin immunoprecipitation process,
Amplifying the target DNA in the sample obtained in the chromatin immunoprecipitation step and the DNA portion of the internal standard molecule;
Analyzing the base sequence of the DNA portion of the target DNA and the internal standard molecule in the sample amplified in the amplification step; and
The immunoprecipitation method includes a step of correcting the sequence amount of the base sequence of the target DNA in the sample using the sequence amount of the base sequence of the DNA portion of the internal standard molecule obtained in the step of analyzing the base sequence as an index.

[Process of mixing test sample and internal standard molecule]
For this step, the description of “the step of mixing the test sample and the internal standard molecule” in the first embodiment described above is applied.

[Chromatin immunoprecipitation process]
The description of the “immunoprecipitation step” in the first embodiment is applied to this step.

[Amplification of the target fragment DNA obtained in the chromatin immunoprecipitation step and the DNA portion of the internal standard molecule]
The description of “the step of amplifying the target DNA and the DNA portion of the internal standard molecule in the sample obtained in the chromatin immunoprecipitation step” in the first embodiment is applied to this step.

[A step of analyzing the base sequence of the DNA portion of the target DNA and internal standard molecule in the amplified sample]
The method for analyzing the base sequence of the target DNA in the sample amplified in the amplification step and the DNA portion of the internal standard molecule is not particularly limited, but can be performed using, for example, a next-generation sequencer. Commercially available next-generation sequencers include, for example, Illumina, SOLiD, Helicos, Complete Genomics, Polonator, Ion Torrent, Pacific Biosciences next-generation sequencers and next-generation sequencers (for example, Mardis, Annu. Rev.
Genom. Human Genet. (2008) vol. 9, p.387-402 and Persson et al., Chem. Soc. Rev. (2010) vol.39, p.985-999). The next-generation sequencer is based on the principle of determining base sequences in a super parallel manner by light detection such as fluorescence and luminescence using a sequential DNA synthesis method using DNA polymerase or DNA ligase. GS FLX (Roche Diagnostics), Solexa (Illumina), etc. are known as methods using DNA polymerase, and SOLiD (Applied Biosystems), Polonator (Dover Systems), etc. are known as methods using DNA ligase. In addition, DNA synthesis is performed with DNA polymerase using one DNA molecule as a template, and the base sequence is determined by real-time observation of one molecule by detecting the reaction of each base with light such as fluorescence and luminescence. SMRT, SMRT (Pacific Biosciences) and the like are known. In addition, the principle of determining base sequences in a massively parallel manner using a detection method other than light detection, such as fluorescence and luminescence, called post-light sequencing, has also been reported. DNA can be obtained using a semiconductor (CMOS) chip. This includes Ion Torrent Systems, which determines the base sequence by detecting hydrogen ions (pH change) released when each base is taken in by polymerase. Other Nanopore
(Oxford Nanopore Technologies) and the like are known.

[Step of correcting the sequence amount of the base sequence of the target DNA in the sample using the sequence amount of the base sequence of the DNA portion of the internal standard molecule obtained in the step of analyzing the base sequence as an index]
The sequence amount of each base sequence of the target DNA in the sample analyzed by mapping the base sequence of the target DNA in the amplified sample to the genome sequence (reference sequence) of the species from which the test sample is derived I understand.
The amount of the DNA portion of the internal standard molecule mixed with the test sample is known. Therefore, the sequence amount of the base sequence of the target DNA in the sample can be corrected using the sequence amount of the base sequence of the DNA portion of the internal standard molecule as an index.

  In general, in the ChIP-seq method, the larger the number of base sequences mapped to the reference sequence (number of reads), the more the DNA region forms a complex with the protein that binds to the antibody used in the chromatin immunoprecipitation method. Thus, it is identified as a region that is subject to some expression control.

  However, the number of reads is usually different between samples having different lots and conditions due to errors due to the crossover rate between the protein and the antibody or experimental operations. Therefore, for example, when a specific substance is administered to two groups of test samples and, as a result, there is a difference in the number of reads in the base sequence of a specific DNA region, the difference is determined by the administration of the specific substance. It is not possible to determine whether the difference is a significant difference due to the fact that the error has occurred or the error described above.

  In such a case, if the immunoprecipitation method of this embodiment is used, the sequence amount of the base sequence of the target DNA in the two groups of test samples is corrected using the sequence amount of the base sequence of the DNA portion of the internal standard molecule as an index. And can determine whether the resulting difference is a significant difference or an error due to the administration of the particular substance. For example, when the expression level of a specific protein is small and the difference from the background does not appear significantly, the risk of judging the error as a significant difference, or conversely, the significant difference is judged as an error. Risk can be reduced.

According to the method of the present invention, it is possible to evaluate the relationship between gene expression control and disease, the therapeutic effect, and the like with high accuracy.
For example, if the number of reads in the base sequence of a specific DNA region is increased by administration of a specific substance, it is evaluated that the expression control of the DNA region has changed due to the specific substance. For example, by evaluating the interaction between a transcription factor that controls the expression of an oncogene and its binding sequence by chromatin immunoprecipitation, the prediction and evaluation of a disease state, and further the therapeutic effect can be examined.
Moreover, the relationship between transcription control by a DNA binding protein such as a transcription factor and a disease can be examined by comparing using a sample derived from a patient and a sample derived from a healthy person.
Furthermore, the relationship between transcriptional control by a DNA-binding protein such as a transcription factor and gene mutation can be examined by comparing a subject having a gene mutation and a subject having no mutation using each sample.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to the following examples without departing from the gist thereof.

[Test Example 1]
<Analysis of Trimethylation State of Histone H3 Protein Lysine 27 Using ChIP-seq Method>
(Overview)
NIH3T3 cells (ATCC CRL-1658) were infected with the viral vector pMX-puro incorporating the human RasG12V gene, and RasG12V protein was expressed in the cells. Separately, NIH3T3 cells were infected with a control virus vector pMX-puro not incorporating the RasG12V gene. In each cell group, ChIP-seq method was performed using an antibody (anti-histone H3K27me3 antibody) that recognizes histone H3 protein trimethylated with lysine 27 (hereinafter sometimes referred to as “H3K27me3”), Decoded the sequence.
According to the results of Western blotting, it was confirmed that the amount of H3K27me3 was not changed by the expression of RasG12V gene. If so, the amount of genome to which H3K27me3 binds in each cell group should be equivalent.
Details of test methods and test results are described below.

(Culture of NIH3T3 cells)
NIH3T3 cells were treated with 10% fetal calf serum, 1% penicillin streptomycin, 2 mM L-glutamine, 1% non-essential amino acid, 1% pyruvate in an environment of 95% air and 5% carbon dioxide gas at 37 ° C. Cultured in Dulbecco's modified Eagle's medium (DMEM medium) containing sodium.

(Insertion of RasG12V gene into viral vector pMX-puro)
The cloning site of viral vector pMX-puro (provided by Dr. T. Kitamura of the Institute of Medical Science, University of Tokyo) was cleaved with restriction enzyme EcoR I (Takara Bio) and KOD DNA polymerase (Toyobo) With blunt ends.
On the other hand, human RasG12V gene (received by Dr. M. Narita of Tohoku University Institute of Aging Medicine) was treated with restriction enzymes Hind III (Takara Bio) and Not I (Takara Bio) The ends were made blunt with KOD DNA polymerase (Toyobo) and inserted into pMX-puro using T4 DNA Ligase (Takara Bio).

(Virus infection of NIH3T3 cells)
Viral vectors and control vectors incorporating the human RasG12V gene were distributed by Plat-E cells (Dr. T. Kitamura, Institute of Medical Science, University of Tokyo).
) And cultivated in DMEM medium in the same manner as described above to produce a human RasG12V-expressing virus. Gene transfer is described in Hosogane et al. PLoS Genet. Aug 2013; 9 (8): e1003698. (2013). The DMEM medium subjected to the culture was collected as a virus-containing solution, and NIH3T3 cells were cultured in the virus-containing solution in the presence of polybrene to establish infection.

(Immunoprecipitation)
NIH3T3 cells were fixed with 1.0% formalin for 5 minutes at room temperature with stirring. After the cells were lysed, the genomic DNA was fragmented into 200 to 700 bases using an ultrasonic generator Covaris S2 (Covaris).
On the other hand, an anti-histone H3K27me3 antibody (Millipore, catalog number 07-449) was bound to magnetic beads (Life Technologies) having Protein A immobilized on the surface.
Then, the magnetic beads to which the anti-histone H3K27me3 antibody was bound via Protein A and the fragmented genomic DNA were mixed at 4 ° C. for 14 hours for immunoprecipitation.

(Sequence analysis)
10 ng of immunoprecipitate was added to TruSeq DNA LT Sample Prep Kit
A sequence library was prepared using v2 (Illumina), and sequence analysis was performed with Illumina HiSeq2000. Sequence library preparation and sequence analysis were performed according to protocols provided by Illumina.

(result)
The number of bases for decoding was 6.79 × 10 ⁹ bases in the cells infected with the viral vector incorporating the RasG12V gene, whereas it was 3.68 in the cells infected with the control viral vector not incorporating the RasG12V gene. × 10 ⁹ bases.
As described above, it was assumed that the amount of H3K27me3 was not related to the expression of the RasG12V gene. Therefore, if the sequence was decoded by the ChIP-seq method in each cell group, an equivalent result should be obtained. However, in reality, it was found that the number of decoding bases varies among cell groups.
This seems to indicate that the amount of H3K27me3 cannot be accurately measured by the conventional Western blot method.

[Example 1: Chromatin immunoprecipitation of transcription factor Irf4 protein]
<1. Preparation of internal standard molecules for chromatin immunoprecipitation>
According to the following method, an internal standard molecule used for chromatin immunoprecipitation of the transcription factor Irf4 protein was prepared.

<1-1. Preparation of yeast DNA>
(Selection of yeast DNA sequence)
In this example, a specific DNA sequence was selected from the DNA sequences of the budding yeast Saccharomyces cerevisiae as the nucleic acid of the internal standard molecule. That is, using the genomic DNA sequence information of the budding yeast, a DNA sequence having a length of 250 bases that is not a repeat sequence nor a gene control sequence of the budding yeast itself was selected on a computer. Further, a sequence having a GC content of 40% or more and 60% or less was selected, and four types having fewer binding sites of known transcription factors were selected (hereinafter, these base sequences are ID1, ID2, ID3, ID4). And). ID1 to ID4 are base sequences represented by SEQ ID NO: 1 to SEQ ID NO: 4, respectively.

ID1 (SEQ ID NO: 1)
CTGTCGTTCTCAACGTCAACCCGTACTTCCAACTGCAGGACGACCCAACCATCAAAGACACACCAGAGACGGCGGCACAGGGCCCCTATGGCGCACACACGGTGCAGGTTCGTCGTGCCGCACGACTCACCACCTCTATTCTCAAGTTCATCCGCCAGATTCGCCACGAGCACTGGGCCGGTGC

ID2 (SEQ ID NO: 2)
TGAATCTGGTGAAGAAGAAGTACGTACTGATGGGGTGCACGCTGGCCAAAGGGTTGTTCCTGAAAAGGACCTTTCTACGGACCCTGCGTATGGTTTGACTTCGGATGAAGTCGCCAGGAGAAGAAAGAAATATGGGTTAAATCAAATGGCTGAGGAGAATGAATCGTTGATTGTGATGCTGCTGTGTTTTTT

ID3 (SEQ ID NO: 3)
CAAATGTCCCATCAATCACGCGCAAGCGCCGCCTTCTGCCGCTGCCGCCGCTACCAGAAAATGTCCTGTTGATCACTCCGCGTTTTCGTCTGGCATGGTGGCCCCAAAGGAGGAGACTCCTCTTCCTAGGAAATGTCCAGTTGACCACACCATGTTCTCTTCGGGGACCGTATTTCTCCCGCGACGT

ID4 (SEQ ID NO: 4)
TTCAAAAATAGTGTAAAATGGTACCATTTCGACCACAACGACAAAAAACTATCTATAAACTCTGCAGCAAGGAACATTCAACATCTTCTGTACGGGAAGAGGTTTTTCCCTTACTACGTTCATACGATCATTGCGGGTCTTGACGAAGATGGTAAGGGCGCTGTCTATTCGTTCGACCCAGTTGGCTTGTACTTTGTAGGGTTTT

(Preparation of yeast DNA of ID1 to ID4 to be inserted into a vector)
The chromatin fraction containing the DNA of the budding yeast Saccharomyces cerevisiae BY4741 strain was obtained from Dr. M.M. Obtained from Harada (Tohoku University Faculty of Agriculture).
Amplified by PCR using primer sets designed to amplify the yeast DNA of ID1 to ID4 from their 5 'and 3' ends, using the DNA in the chromatin fraction containing DNA of BY4741 as a template did.

The primer sets used to amplify the yeast DNAs ID1 to ID4 are as follows.
For the amplification of yeast DNA of ID1, forward primer: 5′-CGTTCGTTCTCAACGTCAACC-3 ′ (SEQ ID NO: 5) and reverse primer: 5′-ATTCACTGGAGCCGAATAGC-3 ′ (SEQ ID NO: 6) were used.

  For the amplification of yeast DNA of ID2, forward primer: 5'-TGAATCTGGGTGAAGAAGAAGTAC-3 '(SEQ ID NO: 7) and reverse primer: 5'-AGACAAACCGGCAGCCAAAATAG-3' (SEQ ID NO: 8) were used.

  For the amplification of the yeast DNA of ID3, forward primer: 5'-CAAATGTCCCCATCAATCAGCGC-3 '(SEQ ID NO: 9) and reverse primer: 5'-GGGCGGCATCATTCCTCGGAGA-3' (SEQ ID NO: 10) were used.

  For the amplification of ID4 yeast DNA, forward primer: 5'-TTCAAAAATAGGTTAAAATGG-3 '(SEQ ID NO: 11) and reverse primer: 5'-CCAAAAATGGCATGATCAATG-3' (SEQ ID NO: 12) were used.

  PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under conditions of 35 cycles (98 ° C for 10 seconds, 57 ° C for 30 seconds, 68 ° C for 20 seconds). After PCR amplification, A was added to the 5 'end and 3' end of the amplified DNA using 10x A-attachment Mix (TOYOBO).

(Insertion of yeast DNA of ID1 to ID4 into pTA2 vector)
T4 DNA ligase (TAKARA, Clontech) was used in the ligation for inserting the yeast DNAs ID1 to ID4 into the pTA2 vector. Each yeast DNA of ID1 to ID4 amplified by PCR was inserted into a pTA2 vector (TOYOBO) by TA cloning to obtain recombinant vectors (hereinafter referred to as “pTA2-ID1 vector”, “pTA2-ID2”, respectively). Sometimes referred to as “vector”, “pTA2-ID3 vector”, “pTA2-ID4 vector”, etc.).

(Preparation of biotinylated yeast DNA of ID1 to ID4)
ID1-ID4 biotinylated yeast DNAs were obtained by PCR using the pTA2-ID1 vector, pTA2-ID2 vector, pTA2-ID3 vector, and pTA2-ID4 vector as template DNAs, respectively.
As a primer set in PCR amplification, a primer set designed to amplify from the 5 ′ end and 3 ′ end of each of the yeast DNAs ID1 to ID4 (for the amplification of ID1, the above SEQ ID NO: 5, SEQ ID NO: 6, ID2 For amplification, the SEQ ID NO: 7 and SEQ ID NO: 8, for the amplification of ID3, the SEQ ID NO: 9 and SEQ ID NO: 10, for the amplification of ID4, the SEQ ID NO: 11 and SEQ ID NO: 12), A biotinylated 5 ′ end was used.

  PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under conditions of 35 cycles (98 ° C for 10 seconds, 57 ° C for 30 seconds, 68 ° C for 20 seconds). After PCR amplification, ID1-ID4 biotinylated yeast DNA was purified using PCR purification kit (QIAGEN).

The biotinylated yeast DNA generated by the PCR is included in the magnetic bead fraction when immunoprecipitation is performed using magnetic beads having streptavidin immobilized on the surface.
FIG. 1 is a photograph of agarose gel electrophoresis suggesting that biotinylated yeast DNA was generated by the PCR. Here, yeast DNA of ID1 was used as the yeast DNA, and primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 6 were used in PCR. In addition, Dynabeads M-280 Streptavidin magnetic beads from Dynal / Invitrogen were used as magnetic beads having streptavidin immobilized on the surface, and immunoprecipitation was performed according to the attached protocol.

  Lane 1 shows the results when PCR amplification was performed using DNA contained in the supernatant fraction when immunoprecipitation was performed using non-biotinylated yeast DNA of ID1 and magnetic beads having streptavidin immobilized on the surface as a template. It is the lane which electrophoresed the obtained PCR product.

  Lane 2 shows the results when PCR amplification was performed using DNA contained in the magnetic bead fraction obtained by immunoprecipitation using ID1 non-biotinylated yeast DNA and magnetic beads with streptavidin immobilized on the surface as a template. It is the lane which electrophoresed the obtained PCR product.

  Lane 3 is obtained when PCR amplification is performed using biotinylated yeast DNA of ID1 and DNA contained in the supernatant fraction when immunoprecipitation is performed using magnetic beads with streptavidin immobilized on the surface as a template. It is the lane which electrophoresed the obtained PCR product.

  Lane 4 is obtained when PCR amplification is performed using biotinylated yeast DNA of ID1 and DNA contained in the magnetic bead fraction when immunoprecipitation is performed using magnetic beads having streptavidin immobilized on the surface as a template. It is the lane which electrophoresed the obtained PCR product.

When non-biotinylated yeast DNA is used, the yeast DNA does not bind to magnetic beads having streptavidin immobilized on the surface. Therefore, although it was considered that yeast DNA was contained in the supernatant fraction, but not in the magnetic bead fraction, a band was confirmed in lane 1 and no band was confirmed in lane 2.
When biotinylated yeast DNA is used, the yeast DNA binds to magnetic beads having streptavidin immobilized on the surface. Therefore, although it was considered that yeast DNA was contained in the bead fraction but not in the supernatant fraction, a band was confirmed in lane 4 and no band was confirmed in lane 3.
From the above, it was found that biotinylated yeast DNA can be prepared by this method.

<1-2. Preparation of Fusion Protein Containing Transcription Factor Irf4 Protein Sequence, Streptavidin Sequence, and 4xFlag Sequence>
(Preparation of IRF4 gene to be inserted into vector)
The IRF4 gene sequence (SEQ ID NO: 13) was amplified by PCR using MigR LVP IRF4 vector (distributed by the University of Chicago, Harinder Singh laboratory) as a template.

The primer set used for PCR was designed to amplify from the 5 ′ end and 3 ′ end of the IRF4 gene sequence (SEQ ID NO: 13), and was further added with a restriction enzyme Hind III site. Specifically, forward primer: 5′-gcgAAGCTTattagagtgtgagaggggc-3 ′ (SEQ ID NO: 14), reverse primer: 5′-gcgAAGCTtcactctgtgaggaga-3 ′ (
SEQ ID NO: 15) was used. The base sequence described in capital letters is the restriction enzyme Hind III site.

  PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under conditions of (35 ° C. for 10 seconds, 57 ° C. for 30 seconds, 68 ° C. for 40 seconds) × 35 cycles. After PCR amplification, the IRF4 gene sequence was purified using a PCR purification kit (QIAGEN).

(Preparation of Pax5 gene to be inserted into vector)
The Pax5 gene sequence (SEQ ID NO: 16) was amplified by PCR using the MigR Pax5 vector (distributed by the University of Chicago, Harinda Singh Laboratory) as a template.

The primer set used for PCR was designed to amplify from the 5 ′ end and 3 ′ end of the Pax5 gene sequence (SEQ ID NO: 16), and was further added with a restriction enzyme Hind III site. Specifically, a forward primer: 5′-gcg AAGCTTatggattagagaaaaattacc-3 ′ (SEQ ID NO: 17) and a reverse primer: 5′-gcgAAGCTTcagtgacgggtcatggcgg-3 ′ (SEQ ID NO: 18) were used. The base sequence described in capital letters is the restriction enzyme Hi.
nd III site.

PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under conditions of 35 cycles (98 ° C for 10 seconds, 57 ° C for 30 seconds, 68 ° C for 20 seconds). P
After CR amplification, the Pax5 gene sequence was purified using PCR purification kit (QIAGEN).

(Preparation of 4xFlag gene to be inserted into vector)
pMSCV 4xFlag vector (distributed by the University of Chicago, Harinda Singh Lab.) The 4xFlag gene sequence (SEQ ID NO: 19) was amplified by PCR using DNA as a template.

  The primer set used for PCR was designed to amplify from the 5 ′ end and 3 ′ end of the 4 × Flag gene sequence (SEQ ID NO: 19), and further, the restriction enzyme EcoR I site was used as the forward primer and the reverse primer as the reverse primer. A Hind III site is added. Specifically, the forward primer: 5'-gcgGAATTCggcgggcatgactacaagagacgagg-3 '(SEQ ID NO: 20) and the reverse primer: 5'-gcgAAGCTTgccgccctttatcgtcgtcatctttg-3' (SEQ ID NO: 21) were used. The base sequence described in capital letters is a restriction enzyme site.

  PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under the conditions of (35 ° C for 10 seconds, 57 ° C for 30 seconds, 68 ° C for 15 seconds) x 35 cycles. After PCR amplification, the 4xFlag gene sequence was purified using PCR purification kit (QIAGEN).

(Preparation of streptavidin gene to be inserted into vector)
Streptavidin gene sequence (SEQ ID NO: 22) was amplified by PCR using pET21a-Streptavidin-Alive (Plasmid # 20860; Addgene) vector DNA as a template.

The primer set used for PCR was designed to amplify from the 5 ′ end and 3 ′ end of the streptavidin gene sequence (SEQ ID NO: 22). Further, the restriction primer Xho I site was used as the forward primer, and the reverse primer To which EcoRI site is added. Specifically, forward primer: 5′-gcgCTCGGAGATGgctgaagctggtatcac-3 ′ (SEQ ID NO: 23) and reverse primer: 5′-gcgGAATTCatgtgtgtgtgtgtgtg-3 ′ (SEQ ID NO: 24) were used. The base sequence described in capital letters is a restriction enzyme site.
PCR amplification was performed using a highly successful PCR enzyme KOD FX NEO (TOYOBO) under the conditions of (35 ° C for 10 seconds, 57 ° C for 30 seconds, 68 ° C for 15 seconds) x 35 cycles. After PCR amplification, the streptavidin gene sequence was purified using a PCR purification kit (QIAGEN).

(Insertion of streptavidin gene and 4xFlag gene, and IRF4 gene or Pax5 gene into pcDNA3 vector)
The multicloning site of pcDNA3 vector (Life technologies) was treated with restriction enzymes Xho I and EcoR I. On the other hand, the streptavidin gene amplified by PCR was similarly treated with restriction enzymes Xho I and EcoR I. The streptavidin gene was inserted into the pcDNA3 vector using T4 DNA Ligase to prepare a recombinant vector (hereinafter sometimes referred to as “pcDNA3 SA vector”).

Next, the multiple cloning site of pcDNA3 SA vector was treated with restriction enzymes EcoR I and Hind III. On the other hand, the 4xFlag gene amplified by PCR was similarly treated with restriction enzymes EcoR I and Hind III. A 4xFlag gene was inserted into a pcDNA3 SA vector using T4 DNA Ligase to prepare a recombinant vector (hereinafter sometimes referred to as "pcDNA3 SA-4xFlag vector").

  Next, the multicloning site of pcDNA3 SA-4xFlag vector was treated with restriction enzyme Hind III. On the other hand, the IRF4 gene amplified by PCR or the Pax5 gene treated with the restriction enzyme Hind III was similarly treated with the restriction enzyme Hind III. T4 DNA ligase was similarly treated with the restriction enzyme Hind III. The recombinant vectors (hereinafter, sometimes referred to as “pcDNA3 SA-4xFlag-IRF4 vector” and “pcDNA3 SA-4xFlag-Pax5 vector”) were prepared.

(In-vitro translation)
The pcDNA3 vector carries the T7 promoter. In vitro translation was performed using a TNT T7 Quick Coupled Transmission / Translation System (Promega) according to the attached protocol.
Using the pcDNA3 SA-4xFlag-IRF4 vector or pcDNA3 SA-4xFlag-Pax5 vector prepared above as a template and in vitro translation, a fusion protein containing streptavidin, 4xFlag protein, and IRF4 protein, or streptavidin, 4xFlag protein, And a fusion protein containing Pax5 protein was produced.

Next, it was confirmed whether the target protein could be translated by the in vitro translation. The results are shown in FIG.
The translation products translated in vitro using pcDNA3 SA-4xFlag-IRF4 vector or pcDNA3 SA-4xFlag-Pax5 vector as a template were separated by SDS-PAGE electrophoresis, and anti-IRF4 antibody (Santa Cruz), anti-Pax5 antibody (Santa Cruz) Or, wetanblot analysis with anti-Flag antibody (Sigma).
When pcDNA3 SA-4xFlag-IRF4 vector was used as a template for in vitro translation, specific bands were confirmed with anti-IRF4 antibody and anti-Flag antibody, and pcDNA3
When in vitro translation was performed using the SA-4xFlag-Pax5 vector as a template, specific bands were confirmed between the anti-Pax5 antibody and the anti-Flag antibody, indicating that the target fusion protein was translated in vitro. .

<1-3. Production of internal standard molecules>
(Manufacture of internal standard molecules)
Next, using the ID1-ID4 biotinylated yeast DNA prepared above and a fusion protein containing streptavidin, 4xFlag protein, and IRF4 protein, or a fusion protein containing streptavidin, 4xFlag protein, and Pax5 protein An internal standard molecule was produced as follows.

(Biotin-streptavidin binding)
ID1-ID4 biotinylated yeast DNA is mixed with a fusion protein containing streptavidin, 4xFlag protein, and IRF4 protein, or a fusion protein containing streptavidin, 4xFlag protein, and Pax5 protein, and allowed to stand at 4 ° C for 1 hour. Then, biotin and streptavidin were bound.

(Relationship between the amount of biotinylated yeast DNA and the amount of internal standard molecule produced)
Next, the change in the amount of the internal standard molecule produced by the amount of biotinylated yeast DNA added in the binding reaction between the biotinylated yeast DNA and the fusion protein was confirmed. Here, yeast DNA of ID1 was used as the yeast DNA, and a fusion protein containing streptavidin, 4 × Flag protein, and IRF4 protein was used as the fusion protein.

  Biotinylated yeast DNA (concentration 10 ng / μL), fusion protein, 10 × phosphate buffered saline (PBS), and distilled water were mixed in the volumes shown in Table 1, and biotin-streptavidin was used at 4 ° C. for 1 hour. A reaction was performed.

In addition, (a)-(d) in a table | surface represents the following.
(A): Addition amount (μL) of biotinylated yeast DNA (concentration: 10 ng / μL)
(B): Amount of fusion protein added (μL)
(C): Addition amount of 10 × PBS (μL)
(D): Addition amount of distilled water (μL)

  After the reaction, 5 μL of magnetic beads (anti-FLAG (registered trademark) M2 antibody magnetic beads> 0.6 mg / mL binding capacity; Sigma-Aldrich) having anti-Flag antibody immobilized on the surface are added and reacted at 4 ° C. for 1 hour. It was. After the reaction, the magnetic beads were attracted to the inner wall of the test tube with a magnet, and the magnetic beads were washed with PBS three times. At this time, the supernatant fraction was collected separately.

  Next, the yeast DNA contained in the supernatant fraction and the magnetic bead fraction was quantified by quantitative PCR using the primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 6, respectively. The PCR reaction was carried out using a 7500 real-time PCR system (ABI) instrument, SYBR Advantage qPCR premix (TaKaRa Clontech) for 10 minutes at 95 ° C (15 seconds at 95 ° C, 33 seconds at 60 ° C, 15 seconds at 95 ° C). ) X 40 cycles.

  The results of quantitative PCR are shown in FIG. It was found that DNA was amplified to the same extent in samples 4 to 7 among the produced internal standard molecules. On the other hand, the amount of unreacted biotinylated yeast DNA not bound to the fusion protein and contained in the supernatant fraction gradually increased from sample 4 onwards, depending on the amount of biotinylated yeast DNA added ID1. (Ct value decreased). That is, it was found that 1 μL of sample 4 was sufficient for the biotinylated yeast DNA for the fusion protein used.

<1-4. Evaluation of manufactured internal standard molecules>
(Effect of the presence of internal standard molecules on immunoprecipitation of endogenous proteins)
Next, it was confirmed how the presence of an internal standard molecule affects when an endogenous protein is immunoprecipitated. Here, yeast DNA of ID1 was used as the yeast DNA, and a fusion protein containing streptavidin, 4 × Flag protein, and IRF4 protein was used as the fusion protein.

Antibody gene transgenic mouse B1-8 ^Hi (provided by Prof. Michel C. Nussenzweig (The
Spleen B lymphocytes were isolated from Rockefeller University)), and 95% air and 5 at 37 ° C
After culturing for 3 days in the presence of antigen NP (40) -ficol and cytokine (IL-2, IL-4, IL-5, CD40L) in a test tube in an environment of 1% carbon dioxide gas, 1.0% formalin Fix at room temperature for 10 minutes.

The fixation reaction was stopped by adding 2.5 M Glycine to a final concentration of 1/20, the fixed cells were washed with PBS, a cytoplasmic lysis buffer was added, and the mixture was allowed to react on ice for 10 minutes. After removing the supernatant containing the cell fraction by centrifugation, the precipitate, which is the nuclear fraction, is dissolved in the nuclear fraction lysis buffer, and genomic DNA is 100 to 100 using a sonic generator Bioruptor (Cosmo Bio, Dianode). Fragmented to 500 bases. Fragmented genomic DNA and magnetic beads (Novex / life technologies) with protein A / G immobilized on the surface were mixed at 4 ° C for 1
The reaction was performed for a period of time, and the fraction that non-specifically bound to the protein A / G magnetic beads was removed.

Next, after the protein A / G magnetic beads were adsorbed on the inner wall of the test tube with a magnet, the supernatant fraction that did not bind non-specifically to the protein A / G magnetic beads was collected. Then, after adding 0, 1, 2, 5, or 10 μL of the internal standard molecule, it was reacted with anti-Irf4 antibody (sc-6059, Santa Cruz) at 4 ° C. overnight, and then protein A / G magnetic beads were added at 4 ° C. Immunoprecipitation was performed by reacting for 2 hours. In addition, 10 μL of an internal standard molecule was added, and the antibody immunoprecipitated with an IgG antibody was used as a control.

  Here, there is yeast DNA that does not bind to streptavidin in the fusion protein via biotin during the production of the internal standard molecule. Therefore, in order to remove yeast DNA that did not bind, after the biotin-streptavidin binding reaction, magnetic beads with streptavidin immobilized on the surface were added, reacted for 1 hour at 4 ° C. with stirring, and a magnet was used. Thus, the magnetic bead fraction attracted to the inner wall of the test tube was removed. In addition, what did not perform this operation was prepared as control, and the difference was examined afterwards.

  After immunoprecipitation, magnetic beads with anti-Irf4 antibody immobilized on the surface are reacted for 1 hour at 4 ° C. with stirring, and the magnetic bead fraction drawn to the inner wall of the test tube using a magnet is recovered as an immunoprecipitate. did.

  Next, the yeast DNA contained in the magnetic bead fraction was quantified by quantitative PCR using the primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6. The PCR reaction was carried out using a 7500 real-time PCR system (ABI) instrument, SYBR Advantage qPCR premix (TaKaRa Clontech) for 10 minutes at 95 ° C (15 seconds at 95 ° C, 33 seconds at 60 ° C, 15 seconds at 95 ° C). ) X 40 cycles.

The results are shown in FIG. The vertical axis represents the relative amount of immunoprecipitated DNA (input%) when the amount of fragmented chromatin DNA used for immunoprecipitation is 100%, and was calculated by quantitative PCR. From this result, the Irf4 protein inherently contained in the cells even when the internal standard molecule is added binds to the DNA of the κ3′E region of the Igκ gene, which is the target gene, and this binding is caused by the addition of the internal standard molecule. Was found not to be greatly disturbed.
In addition, in the case of 1 μL of the fusion protein and 2 μL, the input% is larger than that in the case where the fusion protein is not added, but this is considered to be an experimental error range.

  The results of quantitative PCR are shown in FIG. From this result, it was found that the internal standard molecule could be immunoprecipitated in the immunoprecipitation step because the amount of yeast DNA to be immunoprecipitated increases as the amount of the internal standard molecule added increases. In addition, there is no difference in the amount of yeast DNA used as a template for quantitative PCR, whether or not through the step of removing yeast DNA that did not bind to streptavidin in the fusion protein via biotin as described above. I understood.

<2. Correction of data using internal standard molecules>
<2-1. Establishment of test cell line>
In this example, cell lines that can regulate the expression level of the transcription factor Irf4 protein described above (in this specification, “Irf4-induced B cell line”, “pre-B cell line”, “B Cell line "and so on.) Was established.

(Establishment of Irf4-induced B cell line)
Mice deficient in both Irf4 and its analogous factor Irf8 (dKO, provided by Dr. R. Sciammas (Houston Methodist)) were treated with doxycycline (DOX).
Inducible Irf4 expression gene (rtTA: TetO-Irf4) was introduced by crossing genetically modified mice.

From the same mice, bone marrow B cells were selected with B220, a B cell surface marker.
The selected cells were treated with 5 ng / mL of IL-7-containing OptiMEM medium (5% FCS, 50 μM β-mercaptoethanol, 2 mM L-glutamine, 100 U / mL penicillin-streptomycin added) at 37 ° C. with 95% air and 5%. By culturing for 5 to 10 days in an environment of 10% carbon dioxide gas, an Irf4-induced B cell line was established.

(Relationship between DOX concentration and Irf4 protein expression level)
Next, it was confirmed that the B cell line established above highly expresses Irf4 protein in a DOX concentration-dependent manner.
Non-Irf4-induced cells (dKO) were used as control cells, and Irf4-induced cells were added to the medium so that the final concentration of DOX was 0, 100, 200, or 400 ng / mL, and cultured for 48 hours.

After the culture, the cells were collected, and the expression of Irf4 protein was confirmed by Western blotting using the whole cell extract. The result is shown in FIG.
From this result, it was found that the expression level of Irf4 protein increased in the B cell line established above depending on the DOX concentration.

(Relationship between DOX concentration and expression level of Igκ gene)
An Igκ gene is known as an Irf4 target gene. Then, next, the change in the expression of the Igκ gene depending on the DOX concentration was examined.

Changes in the expression of the Igκ gene were analyzed by quantitative reverse transcription PCR (qRT-PCR).
For amplification of Igκ gene, forward primer: 5′-GAGGGGGTTAAGCTTTCGCCTACCCAC-3 ′ (SEQ ID NO: 25), reverse primer: 5′-GTTATGTCGTTCATACTCGTCCTTGGTCAAC-3 ′ (SEQ ID NO: 26)
) Was used.

Quantitative reverse transcription PCR uses a 7500 real-time PCR system (ABI) instrument and SYBR Advantage qPCR premix (TaKaRa Clontech), 95 ° C for 10 minutes (95 ° C for 15 seconds, 60 ° C for 33 seconds, 95 ° C for 95 ° C). 15 seconds) x 4
The test was performed under the condition of 0 cycle.

  The result of quantitative reverse transcription PCR is shown in FIG. From this result, it was found that Igκ gene expression induction increases with an increase in the expression level of Irf4 protein depending on the DOX concentration. As a positive control, B cells BM1 and BM2 collected from two different mouse bone marrows are compared.

(Relation between DOX concentration and amount of Irf4 protein bound to κ3′E region of Igκ gene)
Further, chromatin immunoprecipitation and quantitative PCR using an anti-Irf4 antibody were performed as follows, and changes in binding of the Irf4 protein to the Igκ gene depending on the DOX concentration were examined.

The B cell line established above is cultured in a test tube in the presence of 5 ng / mL IL-7 under the conditions of a DOX concentration of 0, 100, 200, or 400 ng / mL for 2 days, and then with 1.0% formalin. Fix at room temperature for 10 minutes.
After removing the cytoplasmic fraction, the nuclear fraction was lysed, and the genomic DNA was fragmented into 100 to 500 bases using an ultrasonic generator Bioruptor (Cosmo Bio, diagenode). Thereto, an anti-Irf4 antibody (sc-6059, Santa Cruz) was added and immunoprecipitation was performed. An antibody immunoprecipitated with an IgG antibody was used as a control.
After immunoprecipitation, magnetic beads with anti-Irf4 antibody immobilized on the surface are reacted for 1 hour at 4 ° C. with stirring, and the magnetic bead fraction drawn to the inner wall of the test tube using a magnet is recovered as an immunoprecipitate. did.

Next, DNA in the κ3′E region of the Igκ gene contained in the magnetic bead fraction was quantified by quantitative PCR. For amplification of the DNA in the κ3′E region of the Igκ gene, forward primer: 5′-TCATAGCTACCGTCACACTG-3 ′ (SEQ ID NO: 27), reverse primer: 5′-AACAGATGTGCCTAAGGTTC-3 ′ (SEQ ID NO: 28)
) Was used.

  The PCR reaction was performed using a 7500 real-time PCR system (ABI) instrument, SYBR Advantage qPCR premix (TaKaRa Clontech), 95 ° C for 10 minutes (95 ° C for 15 seconds, 60 ° C for 33 seconds, 95 ° C for 15 seconds) ) X 40 cycles.

  The results of quantitative PCR are shown in FIG. The vertical axis represents the relative amount of immunoprecipitated DNA when the amount of fragmented chromatin DNA used for immunoprecipitation is 100%. From this result, it can be seen that as the expression level of the Irf4 protein depending on the DOX concentration increases, the immunoprecipitation rate by the Irf4 protein increases, that is, the binding amount of the Irf4 protein to the κ3′E region of the Igκ gene increases. It was.

<2-2. ChIP-Seq>
(Immunoprecipitation)
In the same manner as described above, the Irf4-induced B cell line was cultured in a medium supplemented with various DOX concentrations (0, 100, 200, 400 ng / mL) for 48 hours, and fixed with 1.0% formalin for 10 minutes at room temperature. Then, after removing the cytoplasmic fraction, the nuclear fraction was dissolved, and the genomic DNA was fragmented into 100 to 500 bases using an ultrasonic generator Bioruptor (Cosmo Bio, diagenode).

Next, each yeast DNA of ID1 to ID4 is used as yeast DNA for 50 μg of chromatin.
Then, 0.1 ng of an internal standard molecule containing a fusion protein containing streptavidin, 4 × Flag protein, and IRF4 protein was added as a fusion protein, and immunoprecipitation using an anti-Irf4 antibody was performed. An antibody immunoprecipitated with an IgG antibody was used as a control.

(Sequencing)
The immunoprecipitate obtained by the above immunoprecipitation was applied to a next-generation sequencer to decode the base sequence. The sequence analysis was performed with Illumina HiSeq2000 by preparing a sequence library using TruSeq DNA LT Sample Prep Kit v2 (Illumina). Library preparation and sequence analysis were both performed according to the protocol provided by Illumina.

  When the obtained sequence was mapped to the genomic DNA of yeast, the number of reads as shown in FIG. 9 was obtained for each of the internal standard molecules containing yeast DNA of ID1 to ID4. It was shown that a substantially constant amount of yeast DNA was precipitated regardless of the DOX concentration. The cause of the difference in the number of leads between ID1 to ID4 may be a difference in amplification efficiency at the time of library creation.

(Amount of DNA fragment recovered by immunoprecipitation)
In the same manner as described above, the Irf4-induced B cell line was cultured in a medium supplemented with various DOX concentrations (0, 100, 200, 400 ng / mL) for 48 hours, and fixed with 1.0% formalin for 10 minutes at room temperature. Then, after removing the cytoplasmic fraction, the nuclear fraction was dissolved, and the genomic DNA was fragmented into 100 to 500 bases using an ultrasonic generator Bioruptor (Cosmo Bio, diagenode).

  Next, to each 50 μg of chromatin, 0.1 ng of an internal standard molecule containing each of the yeast DNAs ID1 to ID2 as yeast DNA, and a fusion protein including streptavidin, 4 × Flag protein, and IRF4 protein as fusion proteins was added. Immunoprecipitation using anti-Irf4 antibody was performed. An antibody immunoprecipitated with an IgG antibody was used as a control.

  Thereafter, the amount of DNA in the κ3′E region of the Igκ gene to which the endogenous Irf4 protein binds and the amount of yeast DNA of ID1 or ID2 in the immunoprecipitate obtained by the immunoprecipitation were quantified by quantitative PCR.

The primer set represented by SEQ ID NO: 27 and SEQ ID NO: 28 was used for amplification of DNA in the κ3′E region of the Igκ gene.
The primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6 was used for the amplification of ID1 yeast DNA.
The primer set represented by SEQ ID NO: 7 and SEQ ID NO: 8 was used for the amplification of ID2 yeast DNA.

  The PCR reaction was performed using a 7500 real-time PCR system (ABI) instrument, SYBR Advantage qPCR premix (TaKaRa Clontech), 95 ° C for 10 minutes (95 ° C for 15 seconds, 60 ° C for 33 seconds, 95 ° C for 15 seconds) ) X 40 cycles.

(Recovery amount of κ3′E region DNA of Igκ gene to which endogenous Irf4 protein binds by immunoprecipitation)
The results are shown in FIG. Irf which depends on the DOX concentration even in the presence of an internal standard molecule
It was found that with the increase in the expression level of the 4 protein, the immunoprecipitation rate by the Irf4 protein increased, that is, the binding amount of the Irf4 protein to the κ3′E region of the Igκ gene increased.

(Recovery amount of ID1 or ID2 yeast DNA by immunoprecipitation)
The results are shown in FIG. Since the input sample does not contain an internal standard molecule, the amount of yeast DNA amplified by ID1 and ID2 is low (the Ct value is large) regardless of the DOX concentration. On the other hand, in the case of immunoprecipitation using an anti-Irf4 antibody after adding an internal standard molecule containing a fusion protein including streptavidin, 4xFlag protein, and IRF4 protein as each yeast DNA and fusion protein, control antibody IgG As compared with, the amount of amplification of ID1 and ID2 is large in all samples (Ct value is small), and the ratio does not depend on the DOX concentration.
From this result, it was found that the immunoprecipitation of yeast DNA was not greatly influenced by the DOX concentration.

(Relationship between DOX concentration and the number of reads in next-generation sequencers)
The mapping result of the κ3′E region of the Igκ gene to which the DOX-induced Irf4 protein binds is obtained by mapping the sequence read obtained by applying the precipitated DNA obtained by the above immunoprecipitation to a next-generation sequencer onto the mouse genome. As shown in FIG.

Next, the DOX-induced Irf4 binding peak as obtained in FIG. 12 was identified throughout the genome, and the peak was determined at each concentration. Thereafter, the sum of the peak ranges of each concentration was taken, and the number of reads mapped within the range was counted.
The results are shown in FIG. The horizontal axis represents the DOX concentration, and the vertical axis represents the number of reads within the binding peak range determined above. From this result, it was found that the number of leads within the binding peak range determined above increases in a DOX concentration-dependent manner.

(Correction of data using internal standard molecule)
Correction of data using the internal standard molecule of this example will be described with reference to FIG. In the graph of FIG. 14, the horizontal axis represents the number of leads in the combined peak range, and the vertical axis represents the density distribution indicating the ratio of the specific number of leads to the total number of leads in the combined peak range.
The density distribution when the conventional correction for dividing the number of leads within the combined peak range by the total number of leads is shown in the left diagram of FIG. In addition, the density distribution when the correction of this example is performed in which the number of reads in the binding peak range is divided by the number of reads of yeast DNA, which is an example of an internal standard molecule, is shown in the right diagram of FIG.
In the density distribution of the present example, since the separation becomes particularly clear between the case where the DOX concentration is 100 ng / mL and the case where the DOX concentration is 200 ng / mL, the correction of the present example is performed on samples with different DOX concentrations. It was found that the comparison between samples with different amounts of Irf4 protein was effective.

[Example 2: Chromatin immunoprecipitation of histone H3 protein acetylated with lysine 27]
<2. Preparation of internal standard molecules for chromatin immunoprecipitation>
In accordance with the following procedure, an internal standard molecule used for chromatin immunoprecipitation of histone H3 protein acetylated with lysine 27 (hereinafter sometimes referred to as “H3K27Ac”) was prepared.

<2-1. Preparation of ID1 aminated yeast DNA>
ID1 aminated yeast DNA was obtained by PCR using the pTA2-ID1 vector as a template DNA. As a primer set in PCR amplification, 5 ′ of yeast DNA of ID1
A primer set (SEQ ID NO: 5 and SEQ ID NO: 6) designed to amplify from the end and the 3 ′ end, in which the 5 ′ end of each primer was modified with an amino group, was used. A primer having a 6 carbon (C6) spacer was used between the 5 ′ end of each primer and the amino group.

(SMCC conversion of ID1 aminated yeast DNA)
The amplified aminated yeast DNA was purified using a urea-containing gel, and after adding a 100 mM KH ₂ PO ₄ (pH 7.2) solution, 200 nmole of SMCC was added and mixed well, followed by reaction at room temperature for 30 minutes.

<2-2. Preparation of Histone H3 Protein Acetylated with Lysine 27>
We obtained H3K27 acetylation-specific modified peptide information from Dr. Kimura (Tokyo Institute of Technology) and requested Sigma to synthesize peptides including cysteine.

<2-3. Production of internal standard molecules>
(Manufacture of internal standard molecules)
Next, the ID1 SMCC-modified aminated yeast DNA prepared above and H3K27Ac labeled with cysteine were bound to produce an internal standard molecule of this example.

(SMCC-cysteine bond)
The SMCC yeast DNA was dissolved in a 100 mM KH ₂ PO ₄ (pH 7.2) solution, cysteine-labeled H3K27Ac was added and mixed, and the mixture was reacted at room temperature for 3 hours or more. In order to remove unreacted SMCC-modified yeast DNA, the reaction solution was run using a Mg ²⁺ -containing TAG gel to purify POCs (SMCC-converted yeast DNA-H3K27Ac).

<2-4. Evaluation of manufactured internal standard molecules>
(Effect of the presence of internal standard molecules on immunoprecipitation of endogenous proteins)
Next, it was confirmed how the presence of the internal standard molecule affects the immunoprecipitation of the endogenous protein.

  Similarly to the above, spleen B lymphocytes were isolated from antibody gene transgenic mouse B1 / 8Hi (originally Prof. Michel C. Nussenzweig (The Rockefeller University)) donated by Prof. Tomohiro Kurosaki of RIKEN. After culturing for 3 days in the presence of antigen NP (40) -ficol and cytokine (IL-2, IL-4, IL-5, CD40L) in a test tube in an environment of 95% air and 5% carbon dioxide gas And fixed with 1.0% formalin for 10 minutes at room temperature.

  After removing the cytoplasmic fraction, the nuclear fraction was lysed, and the genomic DNA was fragmented into 100 to 500 bases using an ultrasonic generator Bioruptor (Cosmo Bio, diagenode). The fragmented genomic DNA was reacted with magnetic beads with protein A / G immobilized on the surface for 1 hour at 4 ° C. to remove fractions that non-specifically bound to protein A / G magnetic beads. .

  Next, after the protein A / G magnetic beads were adsorbed on the inner wall of the test tube with a magnet, the supernatant fraction that did not bind non-specifically to the protein A / G magnetic beads was collected. Then, after adding 0, 0.01, 0.1, or 1 ng of an internal standard molecule, the mixture was reacted with anti-H3K27Ac antibody (Abcam) at 4 ° C. overnight, and then protein A / G magnetic beads were added at 4 ° C. Immunoprecipitation was performed by reacting for 2 hours. In addition, 0.1 ng of an internal standard molecule was added, and an antibody immunoprecipitated with an IgG antibody instead of an anti-H3K27Ac antibody was used as a control.

  After immunoprecipitation, magnetic beads with anti-streptavidin antibody immobilized on the surface are allowed to react at 4 ° C. for 1 hour with stirring, and the magnetic bead fraction drawn to the inner wall of the test tube using a magnet is used as the immunoprecipitate. It was collected.

  Next, the yeast DNA contained in the magnetic bead fraction was quantified by quantitative PCR using the primer set represented by SEQ ID NO: 5 and SEQ ID NO: 6. The PCR reaction was carried out using a 7500 real-time PCR system (ABI) instrument, SYBR Advantage qPCR premix (TaKaRa Clontech) for 10 minutes at 95 ° C (15 seconds at 95 ° C, 33 seconds at 60 ° C, 15 seconds at 95 ° C). ) X 40 cycles.

  The results are shown in FIG. The vertical axis represents the relative amount of immunoprecipitated DNA (input%) when the amount of DNA when chromatin DNA is fragmented is 100%. From this result, it was found that even when the internal standard molecule was added, H3K27Ac inherent in the cells bound to the DNA of the κ3′E region of the target gene Igκ and was not significantly inhibited by the addition of the internal standard molecule. It was.

  In addition, from the results of quantitative PCR, it can be seen that the amount of yeast DNA that is immunoprecipitated increases as the amount of internal standard molecule added increases, so that the internal standard molecule can be immunoprecipitated in the immunoprecipitation process. It was.

Claims (11)

An internal standard molecule for immunoprecipitation,
An internal standard molecule comprising a protein containing an epitope recognized by an antibody used in immunoprecipitation or a partial peptide thereof, and a nucleic acid bound thereto. The immunoprecipitation is chromatin immunoprecipitation,
The protein is a protein that binds to DNA on chromatin;
The internal standard molecule according to claim 1, wherein the sequence of the nucleic acid is a sequence that is not included in the genome of the biological species from which the test sample is derived.   The internal standard molecule according to claim 1 or 2, wherein the nucleic acid sequence is derived from yeast.   The internal standard molecule according to claim 3, wherein the sequence of the nucleic acid derived from the yeast is represented by any one of SEQ ID NOs: 1 to 4.   The nucleic acid is labeled with biotin, the protein or a partial peptide thereof is a fusion protein or peptide with avidin or streptavidin, and the nucleic acid is bound with the protein or the partial peptide by the interaction of biotin and avidin or streptavidin. The internal standard molecule according to any one of claims 1 to 4, which is bound. The nucleic acid is subjected to SMCC (succinimidyl-4-4) via amine modification to the nucleic acid.
(N-maleimidomethyl) cyclohexane-1-carboxylate), the protein or a partial peptide thereof is a cysteine-added protein or a partial peptide in which a cysteine residue is added to the end of the protein or the partial peptide; The internal standard molecule according to any one of claims 1 to 4, wherein the nucleic acid is bound to the protein or a partial peptide thereof by an interaction between SMCC and a cysteine residue.   The internal standard molecule according to any one of claims 1 to 6, wherein the protein is a transcription factor, a transcription regulatory factor, a histone protein, or a chromatin regulatory factor.   The internal standard molecule according to claim 7, wherein the transcription factor or transcription control factor is IRF4 protein, p53 protein, NF-κB, Rb protein, BRCA1 protein, MYC protein, or Pax5 protein. An immunoprecipitation method comprising the following steps.
Mixing the test sample and the internal standard molecule according to any one of claims 1 to 8,
An immunoprecipitation step, and
Normalizing immunoprecipitation results by detecting the nucleic acid portion of the internal standard molecule. A chromatin immunoprecipitation method comprising the following steps.
Mixing the test sample and the internal standard molecule according to any one of claims 1 to 8,
Chromatin immunoprecipitation process,
Amplifying the target DNA and the DNA portion of the internal standard molecule in the sample obtained in the chromatin immunoprecipitation step; and
A step of correcting the amount of amplified DNA of the target fragment DNA in the sample, using the amount of amplified DNA of the DNA portion of the internal standard molecule obtained in the amplification step as an index. A chromatin immunoprecipitation method comprising the following steps.
Mixing the test sample and the internal standard molecule according to any one of claims 1 to 8,
Chromatin immunoprecipitation process,
Amplifying the target DNA in the sample obtained in the chromatin immunoprecipitation step and the DNA portion of the internal standard molecule;
Analyzing the base sequence of the DNA portion of the target DNA and the internal standard molecule in the sample amplified in the amplification step; and
A step of correcting the sequence amount of the base sequence of the target DNA in the sample using the sequence amount of the base sequence of the DNA portion of the internal standard molecule obtained in the step of analyzing the base sequence as an index.

Images