JP2018059786A - Device and method for detecting target material using olfactory receptor complex and method for manufacturing the detector - Google Patents

Abstract

PROBLEM TO BE SOLVED: To detect octenol, in particular, as an ingredient of human sweat from a detection target gas with a high sensitivity, using an olfactory receptor complex.SOLUTION: The present invention relates to a detector for detecting a target material 12 in a gaseous detection target sample, the detector including: a first region 10 in which a hydrogel in a direct contact with the sample is arranged; a lipid double film 20; a second region 11 adjacent to the first region 10 with the lipid double film 20 in between, in which a lipid double membrane forming lipid solution 14 and a water-based medium 16 are arranged; and measurement means for applying a voltage to between the first region 10, the second region 11 and measuring a current flowing between the regions, and detecting a standard material 12.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a target substance detection device and detection method using an olfactory receptor complex, and a method for producing the detection device, specifically, using a lipid bilayer membrane in which an olfactory receptor complex is incorporated, The present invention relates to an apparatus and method for detecting a target substance in a gaseous test sample, and a method for manufacturing the detection apparatus.

  In recent years, various techniques for measuring volatile chemical substances (odor substances, odor molecules) are known. Such a technique is expected to be applied to the diagnosis / healthcare field such as cancer diagnosis, disaster prevention / security field such as human search, detection of narcotics, and environmental field such as detection of harmful substances.

  For detection of odorous substances, organisms such as dogs and nematodes are sometimes used. However, although the method using living organisms can detect odorous substances with high sensitivity, it is not stable due to variations in physical condition and individuals, and it is difficult to use for a long time because the duration of concentration is limited. There was also a side.

  For this reason, attention is paid to the olfactory function of the organism, not the organism itself. In particular, the olfactory function of insects is considered to have high recognition specificity for odorous substances, and its use for olfactory sensors and the like is being sought. Insect olfactory organs include olfactory receptors (hereinafter sometimes referred to as “OR”) that recognize odor substances and olfactory receptor co-receptors (hereinafter referred to as “ORCO” or “co-receptors”). The olfactory receptor complex formed by the odorant is present, and when activated by an odor substance, the complex exhibits ion channel activity, thereby detecting the odor substance. (Non-Patent Document 1).

  On the other hand, with regard to a detection device (sensor) for detecting a target substance using a channel protein that is not an olfactory receptor complex, if the channel protein is retained in the lipid bilayer membrane, the ion channel via the lipid bilayer membrane is changed. It has been reported (Non-patent Document 2), and by electrically measuring the opening and closing of the ion channel of the channel protein retained in the lipid bilayer membrane, a small amount of narcotics such as cocaine can be obtained. A detection device capable of detection has also been reported (Patent Document 1). However, this sensor can detect cocaine, which is a target substance contained in a liquid, with high sensitivity, but it has been difficult to detect target substance contained in the atmosphere with high sensitivity.

  As an attempt to detect a target substance in the atmosphere, a detection device using a hydrogel such as agarose gel has been reported (Non-patent Document 3). This detection apparatus has succeeded in detecting ometoate in a test gas, but does not utilize an olfactory receptor complex and is not for detecting an odor substance.

JP 2012-103055 A

U. Benjamin Kaupp, Nature Reviews Neuroscience, vol 11 (2010), p188-200. R. Kawano et al., Small, vol 6 (2010), p2100-2104. Aiko Nobukawa et al., 19th International Conference on Miniaturized Systems for Chemistry and Life Sciences, October 25-29, 2015, Gyeongju Korea

  The present invention relates to a detection apparatus and a detection method for a target substance, and a method for producing the detection apparatus, which can detect octenol, which is a component of human sweat, in particular from a test gas with high sensitivity using an olfactory receptor complex. The purpose is to provide.

  In the detection apparatus using hydrogel, the present inventors have used octenol as a test gas when using a lipid bilayer membrane in which a complex of the deer olfactory receptor OR8 and deer olfactory receptor co-receptor is incorporated. It was found that it can be detected with high sensitivity. The present invention is based on these findings.

That is, the present invention relates to the following [1] to [13], for example.
[1] A detection device for detecting a target substance contained in a gaseous test sample,
A first region in which a hydrogel that is in direct contact with the test sample is disposed;
A lipid bilayer;
A second region adjacent to the first region via the lipid bilayer, wherein the lipid bilayer-forming lipid solution / aqueous medium is disposed;
Measuring means for applying a voltage between the first region and the second region and measuring a current flowing between these regions;
The lipid bilayer membrane has a through-hole that can be opened and closed through the lipid bilayer membrane,
The current flows through the through-hole, and the flow of the current differs depending on whether or not the target substance is included in the test sample.
The olfactory receptor complex is an ion channel of the olfactory receptor complex held in the lipid bilayer membrane, and the olfactory receptor complex can recognize a target substance. An olfactory receptor complex formed from an olfactory receptor co-receptor.
[2] The detection device according to [1], wherein the target substance is octenol.
[3] The detection device according to [1] or [2], wherein the hydrogel is agarose.
[4] The detection device according to any one of [1] to [3], wherein the lipid solution is a lipid solution having a composition in which the weight ratio of DOPC: DOPE is 3: 1.
[5] An olfactory receptor complex formed from a mosquito insect olfactory receptor capable of recognizing a target substance and an olfactory receptor co-receptor of the same type of insect as the olfactory receptor complex. The detection device according to any one of [1] to [4].
[6] The olfactory receptor complex is an olfactory receptor complex formed from an olfactory receptor OR8 of Aedes aegypti and an olfactory receptor co-receptor of Aedes aegypti [1] to [5] The detection apparatus in any one of.
[7] The detection device according to any one of [1] to [6], wherein the detection device includes a double well chamber, and the first region and the second region are each well of the double well chamber. Detection device.
[8] A detection method for detecting a target substance contained in a gaseous test sample,
Preparing the detection device according to any one of [1] to [7];
Exposing the test sample to the detection device, applying a voltage between the first region and the second region of the detection device, and measuring a current flowing between these regions;
And determining whether or not the target substance is contained in the test sample based on the measured current value.
[9] The detection method according to [8], wherein the target substance is octenol.
[10] A method for producing the detection device according to any one of [1] to [7],
Providing a device comprising the first region, the second region, and the measuring means;
Preparing the lipid solution, the aqueous medium containing proteoliposomes incorporating the olfactory receptor complex, and the hydrogel;
Heating and melting the hydrogel, adding to the first region and gelling;
Adding the lipid solution and the aqueous medium to the second region to form the lipid bilayer at the interface with the hydrogel;
Manufacturing method.
[11] The production method according to [10], wherein the step of preparing the hydrogel further includes adding the lipid solution to the first region in order to form the lipid bilayer membrane.
[12] The production method according to [11], further comprising removing the lipid solution added to the first region.
[13] Any of [10] to [12], wherein the olfactory receptor complex is an olfactory receptor complex purified from a cell in which the olfactory receptor and the olfactory receptor co-receptor are coexpressed. The manufacturing method of crab.

  ADVANTAGE OF THE INVENTION According to this invention, the detection apparatus and detection method of the target substance which can detect especially the octenol which is a component of a human sweat from a test gas with high sensitivity, and the manufacturing method of this detection apparatus can be provided.

It is a schematic cross section of the detection device of one embodiment. It is a figure which shows the result confirmed by Western blotting about affinity refined AaOrco and Flag-AaOR8. It is a figure which shows the result (B) confirmed by Western blotting about the result (A) of gel filtration chromatography after affinity purification, and AaOrco and Flag-AaOR8 which passed through gel filtration chromatography. It is a figure which shows the result confirmed by Western blotting about the affinity refined protein, the proteoliposome by the freeze-thaw method, and the proteoliposome by the biobead method (lane 1, 2 and 3 respectively). It is a figure which shows the result of having confirmed the incorporation of the proteoliposome by the density gradient ultracentrifugation method by Western blotting. A schematic diagram (A) of a conventional liquid-liquid type detection device based on a droplet contact method, a schematic diagram (B) of a hydrogel-liquid type detection device according to the present embodiment, and a comparison of adsorption amounts of odor molecules by both ( It is a figure which shows C and D). It is a figure which shows the result of protein uptake | capture to a lipid bilayer membrane by a droplet contact method. It is a figure which shows the specificity with respect to the target substance of the lipid bilayer membrane in which the olfactory receptor complex was integrated. It is a figure which shows the signal detection frequency at the time of using the proteoliposome which integrated the unpurified (crudely refined) or refined olfactory receptor complex. It is a figure which shows the examination result of optimization of the expression method of an olfactory receptor complex. It is a figure which shows the examination result of the optimization of the preparation method of a proteoliposome. It is a figure which shows the examination result of the optimization of a composition of a lipid solution. It is a figure which shows the electrophysiology of an olfactory receptor co-receptor Orco. It is a figure which shows the result of examination of the formation rate of the lipid bilayer membrane by a liquid-liquid type and a liquid-gel type. It is a figure which shows the formation method of an example of the detection apparatus of this embodiment. It is a figure which shows the electric current value distribution of a signal step. It is a figure which shows distribution of the electric current value change by the presence or absence of octenol gas. It is a figure which shows the result of the influence on electric current generation | occurrence | production by the presence or absence of an olfactory receptor complex and a target substance. It is a figure which shows the result of the comparison of the response with respect to octenol and a similar substance by the detection apparatus of this embodiment. It is a figure which shows the influence on the shrinkage | contraction by drying of hydrogel by the presence or absence of water supply. It is a figure which shows the influence on the maintenance time of the lipid bilayer membrane by the presence or absence of water supply. It is a figure which shows the maintenance time by the electrical measurement of the lipid bilayer membrane in the device which has a water supply groove | channel.

  Hereinafter, a mode for carrying out the present invention (hereinafter referred to as “the present embodiment”) will be described in detail. In addition, this invention is not limited to the following embodiment.

The detection device of this embodiment is a detection device for detecting a target substance contained in a gaseous test sample,
A first region in which a hydrogel that is in direct contact with the test sample is disposed;
A lipid bilayer;
A second region adjacent to the first region through the lipid bilayer, wherein the lipid bilayer-forming lipid solution / aqueous medium is disposed;
Measuring means for applying a voltage between the first region and the second region and measuring a current flowing between these regions;
The lipid bilayer has pores that can open and close through the lipid bilayer,
The current flows through the through-hole, and the current flow differs depending on whether or not the target substance is contained in the test sample.
An insect olfactory receptor and an olfactory receptor co-receptor of an insect, which are ion channels of an olfactory receptor complex in which a pore is held in a lipid bilayer membrane, and the olfactory receptor complex can recognize a target substance A detection device, which is an olfactory receptor complex formed from

(Target substance)
The target substance that is the object of detection is octenol (1-Octen-3-ol). It is a volatile odor substance and a component of sweat of animals such as humans.

(Gaseous test sample)
The gaseous test sample is not limited as long as it contains a target substance to be detected, and typical examples include air and indoor air, but are not limited thereto. is not.

(Olfactory receptor complex)
Insect olfactory receptor complexes are olfactory receptors and olfactory receptor co-receptors that form a heterocomplex. An insect olfactory receptor is a kind of G protein-coupled receptor having a seven-transmembrane structure, and has high recognition specificity for the odorant. Several odorant-specific olfactory receptors are known. On the other hand, the olfactory receptor co-receptor of insects is a membrane protein having a 7-transmembrane structure like the olfactory receptor, but does not recognize odorants and forms a hetero complex with the olfactory receptor. And function. The olfactory receptor co-receptor known as the Orco family is conserved in all insects with relatively high homology. The olfactory receptor complex has an ion channel activity activated by an odor substance. When activated, a cation such as sodium ion (Na ⁺ ) or calcium ion (Ca ²⁺ ) flows into the cell. .

  As the olfactory receptor complex in this embodiment, an olfactory receptor complex formed from an olfactory receptor of an insect capable of recognizing a target substance and an olfactory receptor co-receptor of the same kind of insect as the insect is preferably used. Can be applied. The olfactory receptor complex has an ion channel activity activated by a target substance, exists in the lipid bilayer membrane, and forms a pore that can be opened and closed. An insect olfactory receptor capable of recognizing a target substance includes an insect olfactory receptor capable of recognizing octenol.

  Examples of the olfactory receptor complex include an olfactory receptor complex formed by a mosquito insect olfactory receptor capable of recognizing a target substance and an olfactory receptor co-receptor of the same kind of insect as the insect. . Examples of olfactory receptors for mosquitoes that can recognize target substances include olfactory receptors for mosquitoes that can recognize octenol. More specifically, the olfactory receptor complex includes an olfactory receptor complex formed from an olfactory receptor OR8 of Aedes aegypti and an olfactory receptor co-receptor of Aedes aegypti. The olfactory receptor OR8 of Aedes aegypti is known to specifically recognize octenol. The olfactory receptor OR8 of Aedes aegypti includes the olfactory receptor having the amino acid sequence shown in SEQ ID NO: 16, and the olfactory receptor co-receptor of Aedes aegypti has the amino acid sequence shown in SEQ ID NO: 4. The body is mentioned.

  In the olfactory receptor complex of this embodiment, the olfactory receptor and the olfactory receptor co-receptor interact at a ratio of 1: 1 to form a complex. The olfactory receptor and the olfactory receptor co-receptor may each form a complex, may each form a complex from two, or may form a complex from four each. May be.

  The olfactory receptor complex of the present embodiment is a method in which an olfactory receptor and an olfactory receptor co-receptor are simultaneously expressed in the cell membrane of the same cell and purified in some cases, or an olfactory receptor and an olfactory receptor co-receptor It can be prepared by a method in which each cell is expressed in different cells, purified and then mixed. The method for expressing the olfactory receptor and olfactory receptor co-receptor in cells is not particularly limited, and a known method can be used. As such a method, for example, an expression plasmid incorporating a DNA encoding the olfactory receptor and an expression plasmid incorporating a DNA encoding the olfactory receptor co-receptor are introduced into a cell. There is a method of expressing. At this time, the expression plasmid incorporating the DNA encoding the olfactory receptor and the expression plasmid incorporating the DNA encoding the olfactory receptor co-receptor are introduced into the same cell, so that the olfactory sensation is formed on the cell membrane. Receptor complexes can also be formed and prepared directly. The introduction of various plasmids into the cells can be confirmed by a method such as PCR. The olfactory receptor, olfactory receptor co-receptor, or olfactory receptor complex expressed in cells can be purified by various known protein purification methods such as affinity purification or gel filtration purification after solubilizing the cell membrane. it can. The obtained protein (olfactory receptor, olfactory receptor co-receptor, or olfactory receptor complex) can be confirmed by known methods such as SDS-PAGE and Western blotting.

  Host cells for introducing the plasmid include, for example, Escherichia coli K12 and other Escherichia coli, Bacillus subtilis MI114 and other Bacillus bacteria, Saccharomyces cerevisiae AH22-derived yeast, and Spodoptera frugiper cells. Insect cells of the system, animal cells such as COS7 cells, and the like. The animal cells are preferably cultured cells derived from mammals, specifically, COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, Hela cells, PC12 cells, N1E-115 cells, SH-SY5Y cells and the like. It is done.

  When incorporating into a lipid bilayer membrane, the olfactory receptor complex formed in advance by the above method may be used, or a mixture of separately prepared olfactory receptor and olfactory receptor co-receptor may be used. Good. As the medium for incorporation into the lipid bilayer, liposomes (proteoliposomes) incorporating membrane proteins, membrane fractions prepared from cells expressing membrane proteins, and the like are preferably used. Proteoliposomes can be prepared by a known method such as a biobead method or a freeze-thaw method, or a combination of both.

  Proteoliposomes are prepared by the biobead method. After preparing the liposomes, crudely purified or purified protein is added, biobeads (manufactured by Bio-Rad) are added to remove the surfactant, and biobeads are added. After removal, the proteoliposome can be prepared by collecting the proteoliposome by ultracentrifugation or the like.

  Proteoliposome preparation by freeze-thaw method was performed after preparing liposomes, adding crudely purified or purified protein, ultrasonically crushing a mixed solution of lipid and protein, freezing with liquid nitrogen, and setting at 25 ° C., for example. It can be prepared by melting in a constant temperature water bath and collecting the proteoliposome by ultracentrifugation or the like. Whether or not the membrane protein is incorporated in the liposome can be confirmed by detecting the membrane protein in the upper layer of the centrifuge tube by performing ultracentrifugation under a density gradient using Accudenz or the like.

  Liposomes can be prepared by known methods. Preferably, phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, and cholesterol are dissolved in an organic solvent such as chloroform, mixed at an appropriate weight ratio, and then subjected to a nitrogen stream and vacuum. The organic solvent is removed with a desiccator or the like. Next, liposomes are prepared by dissolving lipids in an appropriate buffer, sonicating, and repeating freeze-thawing. Furthermore, it is preferable to make the diameter of the liposome uniform, for example, 100 nm to 500 nm. As a mixing ratio of phosphatidylethanolamine: phosphatidylserine: phosphatidylcholine: cholesterol, a weight ratio of 0 to 10: 0 to 3: 0 to 3: 0 to 2 can be mentioned, and a weight ratio of 5: 3: 3: 1 is preferable. .

  It can be confirmed by Western blotting that the obtained proteoliposome contains a desired protein.

(Lipid solution)
A lipid bilayer membrane, that is, a lipid molecule having a hydrophilic region and a hydrophobic region in one molecule can form a membrane in which two layers are arranged with the hydrophobic region on the inside and the hydrophilic region on the outside. Although not particularly limited, in order to simulate the reaction in the biological membrane, the same or similar one as the biological membrane is preferable, and phospholipids widely used in this field, for example, diphytanoylphosphatidylcholine (Diphytanoyl phosphatidylcholine, DPhPC), dipalmitoyl phosphatidyl choline (dipalmytoyl phosphatidyl choline) Les oil phosphatidylcholine (Dio1eoy1phosphatidylcholine, DOPC), dioleoyl phosphatidyl serine (Dioleoyl phosphatidylserine, DOPS), dioleoyl phosphatidylethanolamine (Dioleoyl phosphatidylserine, DOPE) and the like can be mentioned as preferred examples of. Further, sphingophospholipid (sphingomyelin), glycosphingolipid (ganglioside), cardiolipin, or cholesterol can also be mixed. Since many of these are commercially available, commercially available products can be preferably used.

  You may use combining said lipid, for example, DOPC + DOPE, DOPC + DOPE + cardiolipin, DOPC + DOPE + sphingomyelin is mentioned. Moreover, as a composition of these phospholipids, a weight ratio of DOPC: DOPE of 3: 1, DOPC: DOPE: cardiolipin = 1: 1: 0.1, and a weight ratio of DOPC: DOPE: sphingomyelin is 1: 1. : 0.4. A lipid solution having a composition in which the weight ratio of DOPC: DOPE is 3: 1 is preferably used.

  The concentration of the phospholipid in the solution used for forming the lipid bilayer membrane is not particularly limited as long as the lipid bilayer membrane can be formed, but is usually about 19 g / L to 50 g / L, preferably 5 g / L. L to about 25 g / L. The solvent of the phospholipid solution is not particularly limited, but an organic solvent is preferable, and an aliphatic hydrocarbon solvent such as n-decane or n-hexadecane is preferable.

(Aqueous medium)
As the aqueous medium, water or a buffer solution using water as a solvent is used. As the buffer solution, a known buffer solution known to be biocompatible, such as a phosphate buffer solution, can be used. When the aqueous medium is added, the aqueous medium is spontaneously formed into a form in which the membrane of the lipid solution covers the periphery. “Lipid solution / aqueous medium” means such a medium in which the membrane of the lipid solution is coated around the aqueous medium. As a kind of buffer solution, a HEPES buffer is preferable.

The aqueous medium preferably contains the olfactory receptor complex in the form of a proteoliposome. What is necessary is just to adjust the addition amount of a proteoliposome so that a through-hole can be formed, for example, 10 ^<-9 > ^-10 < ^-1 > mg / ml is mentioned.

(Hydrogel)
As the hydrogel, agarose, agar, gelatin or the like can be used, but is not limited thereto. Agarose is preferably used. The concentration of the material used is not particularly limited as long as it is a concentration capable of forming a gel, but in the case of agarose, 0.1 wt% to 5 wt% can be mentioned, and 0.1 wt% to 0.5 wt% preferable.

(Lipid bilayer)
The lipid bilayer is interposed between the first region and the second region, and carries an olfactory receptor complex that forms an openable / closable hole that penetrates the lipid bilayer. It is also formed at the interface between the hydrogel and the lipid solution / aqueous medium. It is preferable from the viewpoint of stability that the lipid bilayer membrane is formed so as to close a minute through-hole provided in the self-supporting film. That is, a lipid bilayer membrane is formed so as to block the minute through-holes of the self-supporting film, the olfactory receptor complex is held in the lipid bilayer membrane, and the ion channel of this olfactory receptor complex is perforated. It is preferable to use as. Examples of the diameter of the minute through hole include 100 to 2000 μm, and 400 to 1000 μm is particularly preferable.

(Structure of detector)
A structure of a detection apparatus according to an embodiment (hereinafter, sometimes referred to as “device”) will be described. The detection apparatus according to one embodiment has a structure of a double well chamber (a substrate having two wells), and a schematic cross-sectional view thereof is shown in FIG. In FIG. 1, 10 indicates a first region which is one well of a double well chamber, and 13 indicates a hydrogel 13 disposed in the first region 10. The hydrogel 13 may contain the target substance 12 contained in the gaseous test sample as a result of contact between the hydrogel and the test sample. In FIG. 1, the target substance 12 is illustrated for the sake of understanding, but the scale is completely different from the actual substance, and since the target substance is actually a molecule, it is not visible. Much smaller than through holes.

  The other well of the double well chamber constituting the second region 11 contains a lipid solution and an aqueous medium. In FIG. 1, the lipid solution is indicated by 14 and the aqueous medium is indicated by 16. The aqueous medium is preferably water or an aqueous buffer. As shown in the figure, the membrane of the lipid solution 14 covers the periphery of the aqueous medium 16. The first region and the second region are separated by the above-described self-supporting film 18 having a through hole. A lipid bilayer membrane 20 is formed in the through-hole portion of the self-supporting film 18. Although not shown in the figure, the olfactory receptor complex is held in the lipid bilayer membrane 20, and the ion channel of the olfactory receptor complex becomes a through hole and penetrates the lipid bilayer membrane. As measuring means for applying voltage and measuring current, electrodes 21 are arranged at the bottom of each well, and a circuit for measuring the flowing current by applying a voltage to these electrodes is connected. The circuit for applying voltage and measuring current is not limited to that shown in FIG. 1, and any circuit that can measure the current flowing between the electrodes by applying a voltage between the electrodes. Any of them may be used. The applied voltage may be 50 to 200 mV, preferably 50 to 100 mV, and more preferably 60 mV. Usually, the measurement is performed at a sampling rate of 1 kHz, a low-pass filter of 200 Hz, room temperature, and 30 minutes to 1 hour.

(Manufacturing method of detection device)
A manufacturing method (manufacturing method) of the detection apparatus shown in FIG. 1 will be described. The double well chamber, lipid solution, aqueous medium, and hydrogel as devices to be used are as described above.

  Heat-melted hydrogel is added to one well (first region) of the double-well chamber, and the mixture is solidified and gelled by being left at room temperature. The lipid solution may or may not be added to the first region before the hydrogel is added. When a lipid solution is added, a lipid bilayer is easily formed at the interface between the first region and the second region. The order of addition of the hydrogel and the lipid solution may be mixed.

  A lipid solution and an aqueous medium are added to the other well (second region).

  A lipid solution and an aqueous medium are added to the second region, and a lipid bilayer membrane is formed at the interface with the hydrogel in the through hole. The olfactory receptor complex contained in the aqueous medium in the form of proteoliposome is preferably an olfactory receptor complex purified from a cell in which the olfactory receptor and the olfactory receptor co-receptor are coexpressed.

  The lipid solution and the aqueous medium may be added simultaneously or before and after. Moreover, you may divide into several times and may add little by little, simultaneously or alternately. Preferably, a small amount of the lipid solution is added first, and then a small amount of the aqueous medium is added with a dropper or the like, and this is repeated a plurality of times. When an aqueous medium is added to the lipid solution, the aqueous medium is spontaneously formed so that a lipid solution membrane covers the periphery of the aqueous medium.

  In addition, after contacting the hydrogel and the test sample, a lipid solution / aqueous medium may be added to the second region to form a lipid bilayer at the interface. After formation, the hydrogel may be brought into contact with the test sample. Under any condition, the target substance in the test sample can be detected because it is absorbed by the hydrogel.

  In the above description, the embodiment using each well of the double well chamber as the first region and the second region has been described. However, the first region and the second region are each well of the double well chamber. For example, a method of sequentially laminating a first aqueous medium, a lipid solution, and a second aqueous medium on a hydrophilic pattern on a substrate as disclosed in Japanese Patent Application Laid-Open No. 2014-21025. In this case, the hydrogel can be used as the second aqueous medium. That is, in this case, the region where the hydrogel and the lipid solution are present is the first region, and the region where the aqueous medium and the lipid solution are present is the second region.

(Detection method)
A detection method for detecting a target substance contained in a gaseous test sample using the above detection apparatus will be described.

  The method of the present embodiment includes a step of preparing the above-described detection device, exposing a test sample to the detection device, applying a voltage between the first region and the second region of the detection device, A detection method comprising a step of measuring a current flowing between regions and a step of determining whether or not a target substance is contained in a test sample based on a value of the measured current.

  For the step of measuring the current, as described above, when the target substance is absorbed into the hydrogel, it quickly diffuses into the hydrogel and binds to the olfactory receptor complex carried on the lipid bilayer, When the ion channel is activated and opened, a cation is taken into the second region side of the artificial cell membrane, and a current is temporarily generated.

  With respect to the step of determining whether or not a target substance is contained in the test sample, it can be determined that the test sample exists when a change in current is measured.

  Hereinafter, the present invention will be specifically described based on examples. However, the present invention is not limited to the following examples.

I. Preparation of olfactory receptor complex (1) Preparation of expression plasmid (i) Preparation of expression plasmid of scent olfactory receptor co-receptor (hereinafter also referred to as AaORCO) The head of Aedes aegypti is liquid After freezing with nitrogen, TRIzol (manufactured by Life Technologies) was added and crushed using a mortar and pestle in the presence of liquid nitrogen. From the obtained crushed material, RNA was extracted according to the instructions attached to the TRIzol reagent. The extracted RNA was purified using an RNA purification kit (RNeasy Mini Kit; manufactured by QIAGEN) according to the instructions attached to the kit. Using the obtained total RNA as a template, Super Script III reverse transcriptase (manufactured by Invitrogen) was added, and the mixture was incubated at 55 ° C. for 50 minutes and then at 75 ° C. for 15 minutes to obtain a cDNA. . Using 1 μL of the obtained cDNA as a template, 10 μM forward primer AaOrco-5 ′ (5′-tggaattctgcagatcaccatgaacgtccaaccgacaaagtacc; SEQ ID NO: 1) 1 μL, 10 μM reverse primer AaOrco-3 ′ (5′-gccactgtgctggatttatttcaactgcaccaacaccLg sequence) PCR was performed using 1 μL of Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pcDNA3.1 (Life Technologies) digested with EcoRV using In-Fusion HD Cloning Kit (TAKARA). Subsequently, this was introduced into E. coli and cultured to obtain a plasmid named pcDNA3.1-AaOrco. When the nucleotide sequence of plasmid pcDNA3.1-AaOrco was analyzed by a DNA sequencer, it was found to contain the nucleotide sequence represented by SEQ ID NO: 3. The base sequence represented by SEQ ID NO: 3 encodes the amino acid sequence represented by SEQ ID NO: 4.

  10 μM forward primer Halo-AaOrco-1-5 ′ (5′-cagagcgataacgcgatgaacgtccaaccgacaaagtac; SEQ ID NO: 5) 1 μL, 10 μM reverse primer Halo-AaOrco-1-3 ′ using 0.1 μg of plasmid pcDNA3.1-AaOrco as a template (5′-agcccgaattcgtttttatttcaactgcaccaacaccatg; SEQ ID NO: 6) PCR was performed using 1 μL and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pFN21A (Bio-Rad) digested with Sgf1 and Pme1 using an In-Fusion HD Cloning Kit (TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pFN21A-Halo-AaOrco. When the base sequence of plasmid pFN21A-Halo-AaOrco was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 7. The base sequence represented by SEQ ID NO: 7 encodes the amino acid sequence represented by SEQ ID NO: 8.

  10 μM forward primer Halo-AaOrco-2-5 ′ (5′-aaccaagtgaccatggcagaaatcggtactggctttcc; SEQ ID NO: 9) 1 μL, 10 μM reverse primer Halo-AaOrco-2-3 ′ using 0.1 μg of plasmid pFN21A-Halo-AaOrco as a template PCR was performed using 1 μL (5′-ctgccaattgggatcttatttcaactgcaccaacaccatg; SEQ ID NO: 10) and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pIEX-4 (manufactured by Life Technologies) digested with Nco1 and BamH1 using In-Fusion HD Cloning Kit (manufactured by TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pIEX-4-Halo-AaOrco. When the base sequence of plasmid pIEX4-Halo-AaOrco was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 7. The base sequence represented by SEQ ID NO: 7 encodes the amino acid sequence represented by SEQ ID NO: 8.

  Plasmid pIEX-4-Halo-AaOrco 0.1 μg was used as a template, 10 μM forward primer Halo-AaOrco-3-5 ′ (5′-catcgggcgcggatcatggcagaaatcggtactggctttc; SEQ ID NO: 11) 1 μL, 10 μM reverse primer Halo-AaOrco-3- PCR was performed using 1 μL of 3 ′ (5′-gtaggcctttgaattttatttcaactgcaccaacaccatg; SEQ ID NO: 12) and 1 μL of KOD Plus neo DNA polymerase (manufactured by Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pFastBacDual (manufactured by Life Technologies) digested with EcoR1 and BamH1 using In-Fusion HD Cloning Kit (manufactured by TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pFastBacDual-Halo-AaOrco. When the base sequence of the plasmid pFastBac Dual-Halo-AaOrco was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 7. The base sequence represented by SEQ ID NO: 7 encodes the amino acid sequence represented by SEQ ID NO: 8.

(Ii) Preparation of an expression plasmid for an olfactory receptor derived from sika (AaOR8) 10 μM of forward primer AaOR8-5 ′ (5′-tggaattctgcagatcaccatgaacgacctggtgaagtttgagt; SEQ ID NO. 13) PCR was performed using 1 μL, 1 μL of 10 μM reverse primer AaOR8-3 ′ (5′-gccactgtgctggattcacttctgacttggttcatagatggt; SEQ ID NO: 14) and 1 μL of KOD Plus neoDNA polymerase (manufactured by Toyobo). The PCR reaction was performed at (1) 94 ° C. for 2 minutes, (2) 98 ° C. for 10 seconds, (3) 68 ° C. for 1 minute, and the steps (2) to (4) were repeated 30 cycles. The obtained PCR product was ligated to pcDNA3.1 (Life Technologies) digested with EcoRV using In-Fusion HD Cloning Kit (TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pcDNA3.1-AaOR8. When the base sequence of plasmid pcDNA3.1-AaOR8 was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 15. The base sequence represented by SEQ ID NO: 15 encodes the amino acid sequence represented by SEQ ID NO: 16.

  10 μM forward primer Halo-AaOR8-1-5 ′ (5′-cagagcgataacgcgatgaacgacctggtgaagtttg; SEQ ID NO: 17) 1 μL, 10 μM reverse primer Halo-AaOR8-1-3 ′ using 0.1 μg of plasmid pcDNA3.1-AaOR8 as a template PCR was performed using 1 μL of 5′-agcccgaattcgttttcacttctgacttggttcatag; SEQ ID NO: 18 and 1 μL of KOD Plus neoDNA polymerase (manufactured by Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pFN21A (Bio-Rad) digested with Sgf1 and Pme1 using an In-Fusion HD Cloning Kit (TAKARA). Subsequently, this was introduced into E. coli and cultured to obtain a plasmid named pFN21A-Halo-AaOR8. When the base sequence of plasmid pFN21A-Halo-AaOR8 was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 19. The base sequence represented by SEQ ID NO: 19 encodes the amino acid sequence represented by SEQ ID NO: 20.

  10 μM forward primer Halo-AaOR8-2-5 ′ (5′-aaccaagtgaccatggcagaaatcggtactggctttcc; SEQ ID NO: 21) 1 μL, 10 μM reverse primer Halo-AaOR8-2-3 ′ using 0.1 μg of plasmid pFN21A-Halo-AaOR8 as a template PCR was performed using 1 μL of 5′-ctgccaattgggatctcacttctgacttggttcatagatg; SEQ ID NO: 22 and 1 μL of KOD Plus neoDNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pIEX-4 (manufactured by Life Technologies) digested with Nco1 and BamH1 using In-Fusion HD Cloning Kit (manufactured by TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pIEX-4-Halo-AaOR8. When the base sequence of plasmid pIEX4-Halo-AaOR8 was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 19. The base sequence represented by SEQ ID NO: 19 encodes the amino acid sequence represented by SEQ ID NO: 20.

  10 μM forward primer Halo-Flag-AaOR8-1-5 ′ (5′-cagagcgataacgcggattacaaggatgacgacgataagatggcagaaatcggtactgg; SEQ ID NO: 23) PCR was performed using 1 μL of 1-3 ′ (5′-ctgccaattgggatctcacttctgacttggttcatagatg; SEQ ID NO: 24) and 1 μL of KOD Plus neo DNA polymerase (manufactured by Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. In addition, 10 μM forward primer inverse-5 ′ (5′-gatcccaattggcagatctc; SEQ ID NO: 25) 1 μL, 10 μM reverse primer inverse-3 ′ (5′-cgcgttatcgctctgaaag; sequence using plasmid pIEX4-Halo-AaOR70.1 μg as a template No. 26) PCR was performed using 1 μL and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained two PCR products were ligated using In-Fusion HD Cloning Kit (manufactured by TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pIEX-4-Halo-Flag-AaOR8. When the base sequence of plasmid pIEX4-Halo-Flag-AaOR8 was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 27. The base sequence represented by SEQ ID NO: 27 encodes the amino acid sequence represented by SEQ ID NO: 28.

  Plasmid pIEX-4-Halo-Flag-AaOR8 0.1 μg was used as a template, 10 μM forward primer Halo-Flag-AaOR8-2-5 ′ (5′-catcgggcgcggatcatggcagaaatcggtactggctttc; SEQ ID NO: 29) 1 μL, 10 μM reverse primer Halo- PCR was performed using 1 μL of Flag-AaOR8-2-3 ′ (5′-gtaggcctttgaatttcacttctgacttggttcatagatg; SEQ ID NO: 30) and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out at (1) 94 ° C for 2 minutes, (2) 98 ° C for 10 seconds, (3) 63 ° C for 30 seconds, (4) 68 ° C for 1.5 minutes, (2) to (4 ) Was repeated 35 cycles. The obtained PCR product was ligated to pFastBac Dual (Life Technologies) digested with EcoR1 and BamH1 using In-Fusion HD Cloning Kit (TAKARA). Thereafter, this was introduced into E. coli and cultured to obtain a plasmid named pFastBacDual-Halo-Flag-AaOR8. When the base sequence of plasmid pFastBac Dual-Halo-Flag-AaOR8 was analyzed by a DNA sequencer, it was found to contain the base sequence represented by SEQ ID NO: 27. The base sequence represented by SEQ ID NO: 27 encodes the amino acid sequence represented by SEQ ID NO: 28.

(2) Production of baculovirus Baculovirus was produced as follows using Bac-to-Bac Baculovirus Expression System of Life Technologies. Add 0.1 μg of plasmid (pFastBac Dual-Halo-AaOrco or pFastBac Dual-Halo-Flag-AaOR8) to 20 μL of DH10Bac (Life Technologies), incubate on ice for 20 minutes, at 42 ° C. for 1 minute, on ice for 2 minutes. did. Then, 200 μL of SOC medium (Life Technologies) was added and cultured at 37 ° C. for 4 hours. The obtained culture broth was cultured at 37 ° C. for about 48 hours on an LB agar plate (containing 50 μg / mL Kanmycin, 7 μg / mL Gentamicin, 10 μg / mL Tetracycline, 100 μg / mL Bluo-gal, 40 μg / mL IPTG), and white colonies Confirmed the generation of. The white colonies were cultured in LB liquid medium (containing 50 μg / mL Kanamicin, 7 μg / mL Gentamicin, 10 μg / mL Tetracline) to obtain Balovirus DNA of Halo-AaOrco or Halo-Flag-AaOR8.

Sf9 cells (manufactured by Life Technologies) were seeded at 3 × 10 ⁵ cells / mL, and cultured in Sf-900II medium (manufactured by Life Technologies) at 27 ° C. for about 24 hours. Any 2.5 μg of the prepared baculovirus DNA was mixed with 250 μL of Grace's medium (manufactured by Life Technologies) and 5 μL of TransIT-Insect Transfection Reagent (manufactured by Mirus) and held for 15 minutes. Thereafter, this mixed solution was added to the cells. After culturing at 27 ° C. for 7 days, the medium was collected, and Balo virus of Halo-AaOrco or Halo-Flag-AaOR8 was obtained by centrifugation. Furthermore, the baculovirus was propagated by transfecting the obtained baculovirus into Sf9 cells.

(3) Preparation of crudely purified membrane fraction expressing AaOrco or AaOR8 HEK293FT cells (manufactured by Life Technologies) were seeded with 3 × 10 ⁶ cells and in DMEM medium (manufactured by Nacalai Tesque) containing 10% FBS. The cells were cultured at 37 ° C. under 5% CO _{2 for} about 24 hours. 3 μg of plasmid pcDNA3.1-AaOrco and 6 μg of plasmid pcDNA3.1-AaOR8 were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (manufactured by Life Technologies) and held for 30 minutes. Thereafter, this mixed solution was transfected into the cells. One day after the transfection, the cells were collected, and the cells were suspended in a buffer (50 mM sodium phosphate pH 7.0, 300 mM NaCl, 8% sucrose, 10% glycerol, 10 mM KCl). The suspension was sonicated and the supernatant was collected by centrifugation (10000 g, 10 minutes). Furthermore, the supernatant was collected by ultracentrifugation (120,000 g, 45 minutes), and suspended in a buffer (50 mM Sodium Phosphate pH 7.0, 300 mM NaCl, 8% sucrose). Finally, buffer (50 mM Sodium Phosphate pH 7.0, 300 mM NaCl, 40% sucrose) and the ultracentrifugation precipitate solution are added to the swing rotor tube in order, and then roughly purified by ultracentrifugation (180000 g, 90 min). The membrane fraction was collected.

(4) Expression and purification of AaOrco or Flag-AaOR8 Sf9 cells were seeded at 0.5 to 1.0 × 10 ⁶ cells / mL and about 24 at 27 ° C. in Sf-900II medium containing 5% FBS. Incubate for hours. Next, the prepared baculovirus (Halo-AaOrco, Halo-Flag-AaOR8) was added separately or simultaneously to Sf9 cells at a multiple infectivity (MOI) of 5, and cultured at 27 ° C. for about 72 to 96 hours. Sf9 cells were obtained in which AaOrco was expressed alone, Flag-AaOR8 was expressed alone, or AaOrco and Flag-AaOR8 were co-expressed. After culture, the cell pellet was collected by centrifugation and suspended in a buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl).

  For solubilization, Zwittergent 3-16 was added to the cell pellet suspension so as to be 0.1% (w / v), and after ultrasonic disruption, the supernatant was collected by centrifugation.

  HaloLink Resin (manufactured by Bio-Rad) was equilibrated with a buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.03% Zwittergent 3-16), and then the above supernatant was added to Resin. It was washed several times with 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1-0.01% Zwittergent 3-16). Subsequently, Resin was reduced with a buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.01% Zwittergent 3-16) to which an enzyme Halo-TEV protease (manufactured by Bio-Rad) for cleaving the Halo tag was added. Affinity-purified samples were collected by incubating for 1 hour at room temperature. Finally, a part of the sample after affinity purification was subjected to gel filtration chromatography (column: Superose 6 or Superose 12 (manufactured by GE)) to obtain a final purified sample.

(5) SDS-PAGE, Western blotting
SDS-PAGE was performed using a 10% polyacrylamide gel (mini-PROTEAN TGX precast gel, manufactured by Bio-rad) according to the manual of Bio-rad. The sample for SDS-PAGE was mixed with Tris βME sample buffer (manufactured by Cosmo Bio) at a ratio of 1: 2, incubated at room temperature, and then subjected to SDS-PAGE. Western blotting is the transfer of polyacrylamide gel after SDS-PAGE to a nitrocellulose membrane using iBlot (Life Technologies), blocking with iBind Western System (Life Technologies), primary antibody, secondary antibody reaction Was washed according to the manual. As the primary antibody, anti-flag M2 (manufactured by Sigma-Aldrich), or anti-AgOrco (antibody against Gambier spider ORCO, Sigma-Aldrich custom antibody production (polyclonal)), the secondary antibody includes Anti -Mouse IgG, HRP-Linked Whole Ab Sheep or Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (manufactured by GE) was used.

  FIG. 2 shows the result of confirming the sample obtained by affinity purification of the crude membrane fraction obtained from cells co-expressing AaOrco and Flag-AaOR8 by Western blotting. Since the AaOrco and Flag-AaOR8 bands were confirmed, it was confirmed that the affinity purification was successful.

Further, the results of gel filtration chromatography after affinity purification (A ²⁸⁰ absorbance) are shown in FIG. The peak detected in Void Volume was considered to be derived from the aggregate. Moreover, the result confirmed by Western blotting about the first peak detected after the aggregate was shown to B of FIG. Since AaOrco and Flag-AaOR8 bands could be confirmed, this peak was considered to be derived from the complex of AaOrco and Flag-AaOR8.

(6) Production of proteoliposomes Production of proteoliposomes by the biobead method was performed as follows. Lipids (phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, cholesterol) were each dissolved in chloroform, mixed at a weight ratio of 5: 3: 3: 1, and then the chloroform was removed with a nitrogen stream and a vacuum desiccator. Next, these lipids were dissolved in a buffer (15 mM HEPES pH 7.6, 300 mM NaCl, 200 mM sucrose), subjected to ultrasonic disruption, and freeze-thawing was repeated to prepare liposomes. Furthermore, in order to make the pore size of the liposomes uniform, the treatment was performed 11 times in total with a mini-extruder (manufactured by Avanti Polar Lipids) with a 100 nm filter set. The prepared liposomes were incubated with 0.2% CHAPS for 15 minutes at room temperature, and then affinity purified protein or gel filtration purified protein was added. Next, biobeads (manufactured by Bio-Rad) were added to remove the surfactant. Furthermore, after removing the biobeads by centrifugation, the proteoliposomes were recovered by ultracentrifugation (100,000 g, 1 h).

  Production of proteoliposomes by freeze-thaw method was performed as follows. Lipids (phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, cholesterol) were each dissolved in chloroform, mixed at a weight ratio of 5: 3: 3: 1, and then the chloroform was removed with a nitrogen stream and a vacuum desiccator. Next, the lipid was dissolved in a buffer (15 mM HEPES pH 7.6, 300 mM NaCl, 200 mM sucrose), and then affinity purified protein or gel filtration purified protein was added. The mixed solution of lipid and protein was sonicated, frozen with liquid nitrogen, and then thawed in a constant temperature water bath set at 25 ° C. This operation was performed twice. Furthermore, proteoliposomes were recovered by ultracentrifugation (100,000 g, 1 h).

  Production of proteoliposomes by freeze-thawing and biobead method was performed as follows. Lipids (phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, cholesterol) were each dissolved in chloroform, mixed at a weight ratio of 5: 3: 3: 1, and then the chloroform was removed with a nitrogen stream and a vacuum desiccator. Next, the lipid was dissolved in a buffer (15 mM HEPES pH 7.6, 300 mM NaCl, 200 mM sucrose), and then affinity purified protein or gel filtration purified protein was added. The mixed solution of lipid and protein was sonicated, frozen with liquid nitrogen, and then thawed in a constant temperature water bath set at 25 ° C. This operation was performed twice. Subsequently, biobeads were added to remove the surfactant. After removing the biobeads by centrifugation, the proteoliposomes were recovered by ultracentrifugation (100,000 g, 1 h).

  The affinity purified protein obtained in (5) above was confirmed by Western blotting for the various proteoliposomes obtained in accordance with the above three methods. The results are shown in FIG. Lanes 1, 2 and 3 show the results of affinity purified protein, proteoliposome by freeze-thaw method, and proteoliposome by biobead method, respectively.

(7) Confirmation of incorporation of proteoliposomes by density gradient ultracentrifugation A solution (10 mM HEPES pH 7.5, 300 mM NaCl) with Accudenz concentration of 80, 35, 30% was prepared. Next, the proteoliposome and the protein after affinity purification and an 80% solution of Accudenz were mixed in equal amounts, and the tubes were layered in the order of Accudenz concentrations of 30, 35, and 40% in a swing rotor tube. Furthermore, after layering a buffer (25 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol), ultracentrifugation was performed at 400000 for 4 hours at 100000 g. After the ultracentrifugation, an equal amount of the solution was collected from the upper layer of the tube and subjected to SDS-PAGE and Western blotting. The result of having confirmed the collect | recovered solutions 1-10 (lanes 1-10) by Western blotting is shown in FIG. Since proteoliposome was detected in the upper part of the centrifuge tube (fraction Nos. 2 to 4), it was considered that Orco and Flag-OR8 were incorporated in the liposome.

II System Using Lipid Bilayer Membrane Formed by Droplet Contact Method FIG. 6A shows a conventional system using a droplet contact method as described in JP2012-81405A or JP2015-77559A. The schematic diagram of this liquid-liquid type | mold detection apparatus is shown. When the olfactory receptor complex is incorporated into the lipid bilayer membrane of such a liquid-liquid type detection device, the odor molecule binding site of the complex is in contact with the liquid phase (buffer). In order for odor molecules to reach the olfactory receptor complex, they need to reach the liquid phase. However, in the case of the conventional liquid-liquid type detection device shown in A, since the liquid phase is covered with oil (lipid), there is a problem that the air odor molecules cannot directly contact the liquid phase. On the other hand, the hydrogel-liquid type detection device of the present embodiment as shown in the schematic diagram of FIG. 6B is exposed to the air and can adsorb odor molecules. Can be detected. C in FIG. 6 is a gas chromatographic measurement result of the amount of odor molecules dissolved (adsorption amount) by the conventional type and the detection apparatus of the present embodiment (adsorption amount). As shown in this graph, the hydrogel-liquid type detection device according to the present embodiment is more effective in adsorbing odor molecules in the air than the conventional liquid-liquid type detection device. Is suitable. This measurement is a sufficient amount of 1088ppm vaporized 1-octen-3-ol (the volume at the time of the experiment is about 2L, but since it is an experimental system in which the vapor pressure of the solution is constantly evaporated and the saturated vapor pressure is continued, the change in concentration is No), exposed to 250 μL hydrogel (C in FIG. 6), or 36 μL (D in FIG. 6), and analyzed the amount adsorbed on the hydrogel over time.

  Hereinafter, a lipid bilayer is formed by a conventional droplet contact method, and in such a system (liquid-liquid type detection device) by the conventional droplet contact method, an olfactory receptor complex detects an odor molecule. It was confirmed. The liquid-liquid type | mold detection apparatus used the thing of Unexamined-Japanese-Patent No. 2012-81405 and Unexamined-Japanese-Patent No. 2015-77559.

  The double well chamber was produced as follows. First, a double well chamber (DWC) was produced as described in Examples of JP2012-81405A. However, a 75 μm thick acrylic film provided with one through hole having a diameter of 600 μm was prepared as a partition.

(1) Incorporation of protein into lipid bilayer membrane by droplet contact method Using hemolysin as a protein incorporated into the lipid bilayer membrane, a lipid bilayer membrane (artificial cell membrane) was formed in the liquid-liquid type detection apparatus. This is because hemolysin detects a change in ionic current value as soon as a liposome is fused to an artificial cell membrane.

  As described in JP-A-2015-77559, a double well chamber was prepared, and 4.2 μL of a decane solution of DOPC: DOPE = 3: 1 was dropped into each well. Subsequently, 21 μL of proteoliposome in which alpha hemolysin was incorporated in the lipid membrane was dropped into both wells. Proteoliposomes were prepared by dissolving lipids (phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, cholesterol) in chloroform, mixing them in a weight ratio of 5: 3: 3: 1, and then removing the chloroform using a nitrogen stream and vacuum desiccator. This was prepared by mixing with a buffer (5 mM HEPES, 96 mM NaCl, 2 mM KCl, 5 mM MgCl 2, 0.8 mM CaCl 2) solution containing 5 μM alpha hemolysin. The proteoliposome solution was collected as a precipitate by centrifugation at 20000 G for 10 minutes, suspended in the same buffer composition (without alpha hemolysin), and then mini-extruder (Avanti Polar Lipids Co., Ltd.) with a 100 nm filter set. Made a total of 11 times. When JET, a microcurrent measurement amplifier manufactured by Tecella, is connected to the instrument, a voltage of 60 mV is applied between the wells, and the sample is left standing for a while while measuring current under the conditions of a sampling rate of 5 kHz and a filter of about 1 kHz. A membrane was formed and alpha hemolysin was reconstituted to confirm the channel current.

  The results are shown in FIG. A is a schematic diagram showing that a membrane protein is taken into a lipid bilayer membrane, B shows a change in current due to incorporation of the membrane protein, the horizontal axis shows time, and the vertical axis shows current between wells. FIG. 7 shows the results of direct measurement of the process of fusion of liposomes to the artificial cell membrane. From this result, it was confirmed that the liposomes were definitely fused to the artificial cell membrane. In addition, the frequency of incorporation can be quantified based on changes in current.

(2) Response of lipid bilayer membrane incorporating olfactory receptor complex to target substance The above liquid-liquid type using a liposome incorporating an olfactory receptor complex instead of hemolysin in (1) above In the detection device, a lipid bilayer membrane in which the olfactory receptor complex was incorporated was formed.

  1-octen-3-ol was used as a target substance, and 1-octen and 3-octaneone, which are similar substances, were used as control substances. A 1 μM solution of each substance (buffer: dissolved in 5 mM HEPES, 96 mM NaCl, 2 mM KCl, 5 mM MgCl 2, 0.8 mM CaCl 2) was dropped into both wells of the detector, and the change in current was measured. Inhibitors that inhibit the binding of 1-octen-3-ol and olfactory receptor complex (IR3535, 1 mM; dissolved in buffer 5 mM HEPES, 96 mM NaCl, 2 mM KCl, 5 mM MgCl2, 0.8 mM CaCl2) The change in current was also measured after dripping.

  The result of the current change is shown in FIG. FIG. 8A shows that the ionic current value increased after 1-octen-3-ol was dropped, and the ionic current value dropped after the inhibitor was dropped.

  FIG. 8B shows a high signal intensity with respect to 1-octen-3-ol, whereas there is no reaction with a substance similar in structure to 1-octen-3-ol.

  Based on these results, it was confirmed that the lipid bilayer membrane in which the olfactory receptor complex was incorporated was specifically responding to 1-octen-3-ol.

(3) Effect of presence or absence of protein purification Proteoliposome incorporating an unpurified (crudely purified) or purified olfactory receptor complex is converted into a lipid bilayer membrane of a liquid-liquid detection device according to the method of (2) above. Incorporated. The unpurified (crudely purified) or purified olfactory receptor complex is obtained by “(3) Preparation of a crudely purified membrane fraction expressing AaOrco or AaOR8” in “I Preparation of olfactory receptor complex” and “ (4) Expression and purification of AaOrco or Flag-AaOR8 ”. An unpurified (crudely purified) or purified olfactory receptor complex was incorporated into a liposome according to the method described in “(6) Preparation of proteoliposome” in “I Preparation of olfactory receptor complex” (freeze-thaw and The data was mixed with the biobead method.) The obtained proteoliposome was incorporated into the lipid bilayer membrane of the liquid-liquid type detector according to the method (2) above. 1-octen-3-ol was added dropwise in the same manner as in the above “(2) Response of lipid bilayer membrane incorporating olfactory receptor complex to target substance”, and the ratio of signals detected when the solution was dropped (signal detection Frequency) was measured, and the influence of the presence or absence of protein purification on the detection frequency of the apparatus was examined (data obtained by mixing freeze-thaw and biobead method production methods were used).

  The results are shown in FIG. The vertical axis represents the ratio of detecting a signal when the odor molecule solution is dropped. Compared with unpurified, the purified olfactory receptor complex showed higher detection frequency.

(4) Optimization of membrane protein preparation method (i) Optimization of expression method of olfactory receptor complex An olfactory receptor and an olfactory receptor co-receptor were co-expressed in the same cell to obtain a complex Lipid bilayer of liquid-liquid type detection device using the case (complex by co-expression) and the case of obtaining a complex by mixing proteins expressed in different cells (complex by mixing) In order to optimize the expression method of the olfactory receptor complex, it was used for electrical measurement and compared with the response probability (yield) to odorants (dropping of liquid).

  A complex by co-expression and a complex by mixing and a method for producing a proteoliposome incorporating the complex are described in “(4) Expression and purification of AaOrco or Flag-AaOR8” in “I Olfactory receptor complex” And “(6) Production of Proteoliposome” (data obtained by mixing freeze-thaw and biobeads production methods were used).

The results are shown in FIG. The number of trials was 13 times for co-expression and 7 times for mixing, and the measurement results were arranged in descending order of yield. According to FIG. 10, it was confirmed that the use of proteoliposomes prepared by co-expression compared with mixing showed a higher yield and was more useful.
(Ii) Optimization of proteoliposome preparation method

  The co-expressed complex was used, and the proteoliposome preparation method was optimized based on the difference in yield due to the difference in the proteoliposome preparation method. Three types of purified complexes (purified with HaloLink Resin and used with a sample not purified with a gel filtration column) were used for (1) freeze-thaw method, (2) biobead method after freeze-thaw method, (3) Proteoliposomes were prepared by the biobead method.

  The preparation methods of the complex and the proteoliposome are respectively described in “(4) Expression and purification of AaOrco or Flag-AaOR8” and “(6) Preparation of proteoliposome” in “I Preparation of Olfactory Receptor Complex”. (The data obtained by mixing freeze-thaw and bio-bead method was used).

  The results are shown in FIG. The number of trials was (1) 13 times by freeze-thaw method, (2) 4 times by biobead method after freeze-thaw method, and (3) 3 times by biobead method. Lined up. According to FIG. 11, it was confirmed that the use of proteoliposomes prepared by the freeze-thaw method showed higher yield and was more useful.

(5) Optimization of composition of lipid solution Artificial cell membranes formed by the droplet contact method were prepared with 14 different lipid compositions. Each lipid composition is shown on the left side of FIG. Using these 14 lipid compositions, an artificial cell membrane in a liquid-liquid type detection apparatus was formed, an olfactory receptor was incorporated into the artificial cell membrane, and the response probability when an odorant (liquid) was dropped was analyzed.

  The right side of FIG. 12 shows the result of the response probability. The numerical value on the horizontal axis represents the number of times a signal was detected out of 8 trials. Depending on the lipid composition, some lipids are deposited without being mixed with oil, and measurement data is not obtained (ND: lipid cloudiness). As a result of examining various compositions, it was shown that a lipid solution prepared with DOPC: DOPE = 3: 1 was most suitable.

(6) Electrophysiology of the olfactory receptor co-receptor Orco The olfactory receptor co-receptor Orco alone has a function of generating an ionic current in response to a substance called VUAA1. Proteoliposomes prepared with Orco alone were incorporated into an artificial cell membrane, and the responsiveness to VUAA1 was evaluated.

  The results are shown in FIG. A is a schematic diagram showing an olfactory receptor complex. B is the result of plotting ionic current values that responded when VUAA1 was dropped and various applied voltages (-90 to 90 mV) were applied to an artificial cell membrane incorporating Orco. It was shown that the ion current value shows a positive correlation with the voltage.

III. System using lipid bilayer membrane formed at the interface between lipid solution and hydrogel (1) Examination of formation rate of lipid bilayer membrane by liquid-liquid type, liquid-gel type As a device used in this study, A double well chamber described in JP 2012-81405 A or JP 2015-77559 A was used. However, one through hole having a diameter of 600 μm was provided in the partition wall (separator) between the wells of the double well chamber.

The main materials used are as follows. As for the liquid-liquid type, lipid (DOPC: DOPE = 3: 1, 20 mg / mL) / decane as a lipid solution (oil), and proteoliposome incorporating an olfactory receptor complex as an aqueous medium (aqueous solution) A buffer containing 5 mM HEPES (pH 7.6), 96 mM NaCl, 2 mM KCl, 5 mM MgCl ₂ , 0.8 mM CaCl ₂ (hereinafter sometimes referred to as “olfactory receptor complex buffer” or “OR8 buffer”) used. Regarding the liquid-gel type, 1% or 0.1% (wt / wt) ultra low melting temperature agarose (melting temperature <50 ° C., transition temperature 8 to 17 ° C.) stock (hereinafter simply referred to as “agarose”). Or “gel”).

(I) When aqueous solution and oil are added to both wells (aqueous solution / oil / aqueous solution / oil),
(II) When aqueous solution and oil are added to the well on the signal electrode side (buffer side, second region), and only aqueous solution is added to the well on the opposite side (gel side, first region) (aqueous solution / oil / Aqueous solution),
(III) When aqueous solution and oil are added to the well on the signal electrode side (buffer side, second region), and only 0.1% gel is added to the well on the opposite side (gel side, first region) ( Aqueous solution / oil / 0.1% gel),
(IV) When an aqueous solution and oil are added to the well on the signal electrode side (buffer side, second region) and only 1% gel is added to the well on the opposite side (gel side, first region) (aqueous solution / Oil / 1% gel), and (V) aqueous solution and oil are added to the well on the signal electrode side (buffer side, second region), and 1% gel is added to the well on the opposite side (gel side, first region). And oil added (aqueous solution, oil / 1% gel, oil)
The formation rate of the lipid bilayer was evaluated by microscopic observation. The presence or absence of lipid bilayer formation was determined based on the presence or absence of the lipid bilayer region shown in FIG.

  The results are shown in FIG. (V) When oil was added to both sides of the well, the lipid bilayer membrane formation rate was high, and the membrane formation rate in (I) was comparable to the liquid-liquid type.

(2) Example of Detection Device of the Present Embodiment An example of the detection device of the present embodiment (hereinafter sometimes referred to as “device”) was formed as follows using a double well chamber. A schematic diagram is shown in FIG. As the double well chamber, those described in JP 2012-81405 A and JP 2015-77559 A were used. However, one through hole having a diameter of 600 μm was provided in the partition wall (separator) between the wells of the double well chamber.

The main materials used are as follows. As a hydrogel, 1% (wt / wt) ultra low melting temperature agarose (melting temperature <50 ° C., transition temperature 8 to 17 ° C.) stock (hereinafter simply referred to as “1% agarose”) as a lipid solution (oil) , Lipids (DOPC: DOPE = 3: 1, 20 mg / mL) / decane as an aqueous medium, proteoliposomes incorporating an olfactory receptor complex (proteosome incorporating an olfactory receptor complex purified by co-expression) Liposomes were prepared according to the protocol described above, and used when diluted 100-fold with buffer 5 mM HEPES, 96 mM NaCl, 2 mM KCl, 5 mM MgCl 2, 0.8 mM CaCl 2), 5 mM HEPES (pH 7.6), 96 mM. NaCl, 2 mM KCl, 5 mM A buffer containing MgCl ₂ and 0.8 mM CaCl ₂ (hereinafter sometimes referred to as “olfactory receptor complex buffer” or “OR8 buffer”) was used.

The creation procedure is shown below (numbers correspond to the numbers in A of FIG. 15).
(I) 1% agarose stored at 4 ° C. was previously warmed to 98 ° C. for 5 minutes or more.
(II) The gel was removed from 98 ° C., allowed to cool for about 10 minutes, and returned to room temperature.
(III) An applied voltage of +60 mV was applied to the device.
(IV) 4.2 μL of oil was added to both wells of the device.
(V) 21 μL of OR8 buffer was added to the well on the signal electrode side (buffer side, second region).
(VI) 21 μL of 1% agarose was added to the well on the opposite side (gel side, first region).
(VII) 5 μL of OR8 buffer was added to the well on the buffer side.
(VIII) 5 μL of 1% agarose was added to the well on the gel side.
(IX) 5 μL of OR8 buffer was added to the well on the buffer side.
(X) 5 μL of 1% agarose was added to the well on the gel side.
(XI) 4 μL of OR8 buffer was added to the well on the buffer side (total buffer volume: 35 μL).
(XII) 5 μL of 1% agarose was added to the well on the gel side.
(XIII) 4 μL of 1% agarose was added to the gel-side well (total gel volume: 40 μL).
(XIV) The olfactory receptor was reconstituted into a lipid bilayer, and an odor sensor element (detection device, detection device) in which the gel touched the outside air was formed.

  A micrograph and a schematic diagram of the region of the obtained lipid bilayer membrane are shown in FIG.

(3) Current value distribution of signal step The measurement method is the same as the following conditions. The current value of the signal confirmed in each measurement result is plotted on the horizontal axis and the number of times is plotted on the vertical axis. Obtained.
・ Applied voltage 60mV
・ Sampling rate 1000-5000Hz
・ Bessel filter (low-pass filter) 200-1000Hz
・ Measurement temperature: Room temperature ・ Measurement time 0 minutes to 2 hours

  The results are shown in FIG. Among the obtained changes in current value, a change in current value of several hundred pA was also observed, but it was confirmed that the current value was frequently observed in the range of several to 20 pA. In the reports of previous studies conducted in similar systems, changes in the current value of several hundred pA level are not observed or processed as signals. Therefore, the system of this embodiment is caused by other than the assumed ion channel. However, the main current range is considered to correspond to the assumed signal.

(4) Distribution of current value change depending on presence / absence of octenol gas A 6.55 M octenol solution was dropped on a 1 μL filter paper and placed at a position about 5 mm away from the device. During exposure to the odorous molecule gas, the ion current was measured under the following conditions:
・ Applied voltage 60mV
・ Sampling rate 1000-5000Hz
・ Bessel filter (low-pass filter) 200-1000Hz
・ Measurement temperature: Room temperature ・ Measurement time 0 minutes to 2 hours

  As a control, measurement was also performed without octenol. The results are shown in FIG. The measurement result shows that a current value change of about several to 20 pA is measured, and when there is no octenol, the ion channel closed state is long and the current value change is distributed around 0 pA in the center, whereas in the octenol gas When exposed, an open state of the ion channel was confirmed, and a peak (downward black arrow) also appeared in the vicinity of about 15 pA.

(5) Influence on current generation by presence / absence of olfactory receptor complex and target substance According to the method according to (4) above, presence / absence of olfactory receptor complex (OR), OR-free liposome or OR-containing liposome The signal step detection frequency distribution with and without octenol was measured. The results are shown in FIG. As shown in the table, signals were frequently confirmed only when the olfactory receptor complex was present and octenol was present.
(6) Comparison between octenol and its similar substances

  According to the method according to (4) above, signal step detection frequency (measured number of detected signals) using octenol as target substance and geraniol, 3-octanone, 3-octanol, which are similar to octenol as control substance Value divided by the time taken). The response to the target substance by the detection apparatus of the present invention was examined. The result is shown in FIG. It turned out that it responds specifically only to the target octenol.

(7) Hydrogel Shrinkage and Water Supply Examination in Detection Device For the purpose of preventing shrinkage due to drying of the hydrogel, a device having a water supply groove (water server) attached to the gel well was prepared and evaluated. That is, a columnar shape with a bottom having a donut shape so that an outer wall (intermediate wall) stands around the top of the well by drilling a substantially cylindrical well (bottom diameter is about 3 mm) on a 4 mm thick acrylic plate. Water supply groove (outer diameter is about 7 mm. The outer wall (intermediate wall) formed between the well and the water supply groove is provided with slits at four positions at approximately equal intervals, and the water supply groove communicates with the well through the slit. To make a model device. In FIG. 20, when 40 μL of 1% agarose gel is installed in a well and the agarose gel is in contact with a total of 70 μL of water through four slits on the outer wall (intermediate wall) (when water is supplied), The comparison result about the shrinkage | contraction of an agarose gel in the case where the same agarose gel is installed in the same model device and water is not supplied (when water is not supplied) is shown. Within at least 30 minutes, a decrease rate of 0.2 mg / min was exhibited without water supply (at 25 ° C. and humidity of about 20%). On the other hand, in the case of water supply, the rate of decrease was 0.04 mg / min (the rate of decrease due to water evaporation was calculated by removing the effect after separate measurement), and gel shrinkage due to drying was reduced by water supply. I was able to confirm.

A double well chamber having a water supply groove was prepared as follows. A double well chamber was drilled in a 4 mm thick acrylic plate, and a groove for accommodating a partition wall between wells of the double well chamber and a water supply groove around one well of the double well chamber were formed. . The double well chamber had a diameter of 4 mm, a groove length of 6 mm, a width of 0.45 mm, and a depth of 3 mm. The partition wall was provided with one through hole having a diameter of 600 μm, and the partition wall was stored in a groove for storing the partition wall. A through hole was formed at the bottom of each well, and an Ag / AgCl paste was filled in each through hole to form an electrode at the bottom of each well, thereby producing a double well chamber having a water supply groove.
According to the method according to the above, a double well chamber is provided with a water supply groove, and the agarose gel is in contact with water at 7 locations. The result evaluated by observation is shown in FIG. Regardless of whether water was supplied or not, both lipid bilayers were maintained for nearly 1 hour as long as they could be confirmed by microscopic observation. FIG. 22 shows the evaluation results of the lipid bilayer maintenance time by electrical measurement with a device provided with a water supply groove. The evaluation criteria are as shown in FIG. Regardless of the presence or absence of water supply, as the applied voltage increases, the lipid bilayer maintenance time on electrical measurement tends to decrease.
As described above, as another embodiment of the independent invention, a chamber (cell) used in a detection device using a lipid bilayer, a substrate, a double well drilled on the substrate, An outer wall (intermediate wall) provided around the upper portion of one well of the double well and a water supply portion (water supply groove) drilled around the outer wall, and a communication hole (slit) in the outer wall It was possible to provide a chamber for a lipid bilayer membrane detection device, characterized in that In addition, the structure which appeared except this paragraph can be diverted to this form suitably.

DESCRIPTION OF SYMBOLS 10 ... 1st area | region, 11 ... 2nd area | region, 12 ... Target substance, 13 ... Hydrogel, 14 ... Lipid solution, 16 ... Aqueous medium, 18 ... Self-supporting film, 20 ... Lipid bilayer, 21 ... electrode

Claims (13)

A detection device for detecting a target substance contained in a gaseous test sample,
A first region in which a hydrogel that is in direct contact with the test sample is disposed;
A lipid bilayer;
A second region adjacent to the first region via the lipid bilayer, wherein the lipid bilayer-forming lipid solution / aqueous medium is disposed;
Measuring means for applying a voltage between the first region and the second region and measuring a current flowing between these regions;
The lipid bilayer membrane has a through-hole that can be opened and closed through the lipid bilayer membrane,
The current flows through the through-hole, and the flow of the current differs depending on whether or not the target substance is included in the test sample.
The olfactory receptor complex is an ion channel of the olfactory receptor complex held in the lipid bilayer membrane, and the olfactory receptor complex can recognize a target substance. An olfactory receptor complex formed from an olfactory receptor co-receptor.   The detection device according to claim 1, wherein the target substance is octenol.   The detection device according to claim 1, wherein the hydrogel is agarose.   The detection apparatus according to any one of claims 1 to 3, wherein the lipid solution is a lipid solution having a composition in which the weight ratio of DOPC: DOPE is 3: 1.   The olfactory receptor complex is an olfactory receptor complex formed from a mosquito insect olfactory receptor capable of recognizing a target substance and an insect olfactory receptor co-receptor of the same kind as the insect. Item 5. The detection device according to any one of Items 1 to 4.   The olfactory receptor complex is an olfactory receptor complex formed from an olfactory receptor OR8 of Aedes aegypti and an olfactory receptor co-receptor of Aedes aegypti. The detection device according to 1.   The detection device according to any one of claims 1 to 6, wherein the detection device includes a double well chamber, and the first region and the second region are each well of the double well chamber. A detection method for detecting a target substance contained in a gaseous test sample,
Preparing the detection device according to any one of claims 1 to 7,
Exposing the test sample to the detection device, applying a voltage between the first region and the second region of the detection device, and measuring a current flowing between these regions;
And determining whether or not the target substance is contained in the test sample based on the measured current value.   The detection method according to claim 8, wherein the target substance is octenol. A method for manufacturing the detection device according to any one of claims 1 to 7,
Providing a device comprising the first region, the second region, and the measuring means;
Preparing the lipid solution, the aqueous medium containing proteoliposomes incorporating the olfactory receptor complex, and the hydrogel;
Heating and melting the hydrogel, adding to the first region and gelling;
Adding the lipid solution and the aqueous medium to the second region to form the lipid bilayer at the interface with the hydrogel;
Manufacturing method.   The manufacturing method according to claim 10, wherein the step of preparing the hydrogel further includes adding the lipid solution to the first region in order to form the lipid bilayer membrane.   The production method according to claim 11, further comprising removing the lipid solution added to the first region. 13. The olfactory receptor complex according to claim 10, wherein the olfactory receptor complex is an olfactory receptor complex purified from a cell in which the olfactory receptor and the olfactory receptor co-receptor are coexpressed. Manufacturing method.