JP2018000174A - Polynucleotide encoding human fcrn and method for producing human fcrn using the polynucleotide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a polynucleotide that can efficiently express human FcRn in a host, and a method for efficiently producing human FcRn by using the polynucleotide.SOLUTION: Of human FcRn, a protein containing at least a part of an extracellular region is converted using coliform codon to obtain a polynucleotide, and use of the polynucleotide makes it possible to efficiently produce human FcRn with Escherichia coli.SELECTED DRAWING: Figure 3

Description

  The present invention relates to a polynucleotide encoding human neonatal FcR (FcRn) and a method for producing human FcRn using the polynucleotide. In particular, the present invention relates to a polynucleotide capable of efficiently expressing human FcRn in a host and a method for producing human FcRn using the polynucleotide.

Unlike human Fcγ receptors belonging to the immunoglobulin superfamily, human FcRn is a major histocompatibility complex (MHC) class I-related molecule composed of heavy chain (α chain) and β2 microglobulin (β chain). (Non-Patent Document 1). FcRn is involved in the recycling mechanism of IgG and has a function of suppressing the degradation of IgG. FcRn binds to IgG in a pH-dependent manner, and binds at pH 6.5 or less (Non-patent Document 2).
The amino acid sequence of the α chain of human FcRn (SEQ ID NO: 1) is published in public databases such as UniProt (Accession number: P55899). The amino acid sequence of the β chain (SEQ ID NO: 2) is published in UniProt (Accession number: P61769). Similarly, the functional domain in the structure of human FcRn, the signal peptide sequence for penetrating the cell membrane, and the position of the transmembrane region are also published. Fig. 1 shows the structure of the human FcRn α chain, and Fig. 2 shows the structure of the β chain. The amino acid numbers in FIG. 1 correspond to the amino acid numbers described in SEQ ID NO: 1. That is, the first methionine (Met) to the 23rd glycine (Gly) in SEQ ID NO: 1 is the signal sequence (S), and the 24th alanine (Ala) to the 297th serine (Ser) is the extracellular region. (EC) From the 298th valine (Val) to the 321st tryptophan (Trp) is the transmembrane region (TM) and from the 322th arginine (Arg) to the 365th alanine (Ala) is the intracellular region (C). ). The amino acid numbers in FIG. 2 correspond to the amino acid numbers described in SEQ ID NO: 2. That is, the signal sequence (S) from the first methionine (Met) to the 20th alanine (Ala) in SEQ ID NO: 1 and the β2 microglobulin from the 21st isoleucine (Ile) to the 119th methionine (Met). (B2M).

  As for the expression of FcRn using a genetic engineering technique, an example in which animal cells such as HEK293 cells are used as a host and expressed at an expression level of 10 mg / L has been reported (Non-patent Document 3). However, when Escherichia coli, which is simpler and cheaper to produce than animal cells, is expressed as a host, it has not been reported to be expressed as soluble FcRn.

N. E. Simster et al., Nature, 337, 184-187, 1989. M.M. Raghavan et al., Biochemistry, 34, 14649-14657, 1995. Y. Feng et al., Protein Expr Purif. 79 (1), 66-71, 2011

  An object of the present invention is to provide a polynucleotide capable of efficiently expressing human FcRn in a host and a method for efficiently producing human FcRn using the polynucleotide.

  As a result of intensive studies to solve the above problems, the present inventors have used an E. coli type codon when converting the amino acid sequence of a region including at least part of the extracellular region of human FcRn into a nucleotide sequence. Thus, the production of human FcRn using Escherichia coli as a host was realized, and the present invention was completed.

That is, the present invention includes the following aspects:
(A) From the amino acid residue of at least the 24th alanine to the 297th serine of the amino acid sequence described in SEQ ID NO: 1 and from the isoleucine of at least the 21st amino acid sequence of SEQ ID NO: 2 to the 119th methionine A polynucleotide encoding human FcRn obtained by converting a protein containing the amino acid residues of E. coli using an E. coli type codon.

  (B) From the amino acid residue of at least the 24th alanine to the 297th serine of the amino acid sequence described in SEQ ID NO: 1 and from the isoleucine of at least the 21st amino acid sequence of SEQ ID NO: 2 to the 119th methionine And a protein encoding human FcRn, wherein a protein in which one or more of the amino acid residues are substituted, inserted, or deleted with another amino acid residue is converted using an E. coli type codon .

  (C) The polynucleotide according to (A), comprising the nucleotide sequence according to SEQ ID NO: 3.

  (D) A vector comprising the polynucleotide according to any one of (A) to (C).

  (E) A transformant obtained by transforming E. coli with the vector according to (D).

  (F) A method for producing human FcRn, wherein the transformant according to (E) is cultured, and human FcRn is recovered from the obtained culture broth.

  Hereinafter, the present invention will be described in detail.

  The present invention relates to the serine from the 24th alanine to the 297th serine, which is the extracellular region (EC in FIG. 1) of the α chain of human FcRn consisting of the amino acid sequence shown in SEQ ID NO: 1 and the sequence described in SEQ ID NO: 2. A protein comprising at least an amino acid residue from isoleucine at the 21st to 119th methionine in the β chain of human FcRn consisting of an amino acid sequence is converted using an E. coli type codon when converted to a polynucleotide. Yes. The protein is a part of the extracellular region of the α chain (EC in FIG. 1), from the 24th alanine to the 297th serine and the 21st isoleucine of the β chain consisting of the amino acid sequence set forth in SEQ ID NO: 2. It only needs to contain at least amino acid residues up to the 119th methionine, and may contain all or part of the signal peptide region (S in FIG. 1) on the N-terminal side of the extracellular region (EC in FIG. 1). In addition, all or part of the transmembrane region (TM in FIG. 1) and the extracellular region (C in FIG. 1) on the C-terminal side of the extracellular region may be included. Further, among the α chain of human FcRn consisting of the amino acid sequence shown in SEQ ID NO: 1, the protein is an amino acid residue from the 24th alanine to the 297th serine and β of human FcRn consisting of the amino acid shown in SEQ ID NO: 2. A protein comprising at least amino acid residues from the 21st isoleucine to the 119th methionine in the chain, wherein at least one of the amino acid residues is substituted, inserted or deleted by another amino acid residue, Are also included in the present invention.

  The polynucleotide of the present invention is a human FcRn α chain consisting of the amino acid sequence shown in SEQ ID NO: 1 and the human amino acid consisting of the amino acid residue from the 24th alanine to the 297th serine and the amino acid shown in SEQ ID NO: 2. Amino acid residues from the 21st isoleucine to the 119th methionine of the β chain of FcRn (or one or more of the amino acid residues substituted, inserted or deleted). It is obtained by converting a codon having a low use frequency (rare codon) into a codon having a high use frequency in the translation mechanism of E. coli without changing the encoded amino acid from a protein containing at least Specifically, in the case of Escherichia coli, AGA / AGG / CGG / CGA for arginine (Arg), ATA for isoleucine (Ile), CTA for leucine (Leu), GGA for glycine (Gly), Since CCC is a rare codon in proline (Pro), it may be converted so as to avoid those codons. The frequency of codon usage in the host can be analyzed using a public database (for example, Codon Usage Database on the Kazusa DNA Research Institute website). In the polynucleotide of the present invention, an α chain and a β chain may be expressed, respectively, and the α chain and the β chain may be combined with a linker. An example is a polynucleotide comprising the sequence of SEQ ID NO: 3 in which the α chain and β chain of human FcRn are linked by a linker.

As a production method of the polynucleotide of the present invention,
(I) a method of introducing a mutation into a polynucleotide encoding human FcRn to form an E. coli type codon using a DNA amplification method such as PCR,
(II) a method of designing a human FcRn amino acid sequence converted into a nucleotide sequence using an E. coli type codon and artificially synthesizing a polynucleotide comprising the designed sequence;
Can be illustrated. A polynucleotide encoding a signal peptide may be added to the 5 ′ end of the polynucleotide of the present invention produced by the method of (I) or (II). When the host is Escherichia coli, Examples include pelB, DsbA, MalE (regions from the first to the 26th amino acid sequence described in UniProt No. P0AEX9) and signal peptides that secrete proteins to the periplasm such as TorT (Japanese Patent Laid-Open No. 2011-097889). ).

  When transforming a host using the polynucleotide of the present invention, the polynucleotide of the present invention itself may be used, but an expression vector (for example, bacteriophage, cosmid, or the like commonly used for transformation of prokaryotic cells or eukaryotic cells) may be used. It is more preferable to use a plasmid or the like in which the polynucleotide of the present invention is inserted at an appropriate position. The expression vector is not particularly limited as long as it is stably present in the host to be transformed and can be replicated. When Escherichia coli is used as a host, pET plasmid vector, pUC plasmid vector, pTrc plasmid vector, pCDF plasmid vector A pBBR plasmid vector can be exemplified. The appropriate position means a position where the replication function of the expression vector, a desired antibiotic marker, and a region related to transmissibility are not destroyed. When inserting the polynucleotide of the present invention into the expression vector, it is preferable to insert it in a state linked to a functional polynucleotide such as a promoter required for expression. Examples of the promoter include trp promoter, tac promoter, trc promoter, lac promoter, T7 promoter, recA promoter, lpp promoter, λ phage λPL promoter, λPR promoter and the like when the host is Escherichia coli. it can. In order to transform a host with a vector (including the polynucleotide of the present invention) into which the polynucleotide of the present invention prepared by the above method is inserted (including the polynucleotide of the present invention), those skilled in the art may carry out the methods.

  To prepare the vector of the present invention from the transformant of the present invention obtained by transforming a host with the vector into which the polynucleotide of the present invention is inserted, a culture obtained by culturing the transformant of the present invention It may be prepared using a commercially available extraction kit such as alkali extraction method or QIAprep Spin Miniprep kit (manufactured by Qiagen).

  Human FcRn can be produced by culturing the transformant of the present invention and recovering human FcRn from the obtained culture. In the present specification, the culture includes not only the cultured cells of the transformant of the present invention itself but also a medium used for the culture. The transformant used in the protein production method of the present invention may be cultured in a medium suitable for culturing the target host. When the host is Escherichia coli, an LB (Luria-Bertani) medium supplemented with necessary nutrient sources is preferable. An example of the medium is given. In order to selectively proliferate the transformant of the present invention depending on the presence or absence of the introduction of the vector of the present invention, it is preferable to add a drug corresponding to the drug resistance gene contained in the vector to the medium and culture. For example, when the vector contains a kanamycin resistance gene, kanamycin may be added to the medium. In addition to the carbon, nitrogen, and inorganic salt sources, an appropriate nutrient source may be added to the medium, and a reagent that promotes protein secretion from the transformant such as glycine to the culture solution may be added. More specifically, when the host is Escherichia coli, it is preferable to add glycine to the medium at 2% (w / v) or less. When the host is Escherichia coli, the culture temperature is generally 10 ° C. to 40 ° C., preferably 20 ° C. to 37 ° C., more preferably around 25 ° C., but may be selected depending on the characteristics of the protein to be expressed. When the host is Escherichia coli, the pH of the medium is pH 6.8 to pH 7.4, preferably around pH 7.0. In addition, when an inducible promoter is contained in the vector of the present invention, it is preferable to induce the protein under conditions that allow the protein of the present invention to be expressed well. An example of the inducer is IPTG (isopropyl-β-D-thiogalactopyranoside). When the host is Escherichia coli, the turbidity (absorbance at 600 nm) of the culture solution is measured, and when it reaches about 0.5 to 1.0, an appropriate amount of IPTG is added and then cultured, so that human FcRn Expression can be induced. The addition concentration of IPTG may be appropriately selected from the range of 0.005 to 1.0 mM, but is preferably in the range of 0.01 to 0.5 mM. Various conditions relating to the IPTG induction may be performed under conditions well known in the art.

  In order to recover human FcRn from the culture obtained by culturing the transformant of the present invention, it is separated / purified from the culture by a method suitable for the expression form of human FcRn in the transformant of the present invention. Thus, human FcRn may be recovered. For example, when expressed in the culture supernatant, the cells are separated by centrifugation, and human FcRn may be purified from the resulting culture supernatant. In the case of expression in cells (including periplasm), the cells are collected by centrifugation, and then added with an enzyme treatment agent, a surfactant, etc., and the cells are crushed by ultrasonic waves to human FcRn. After extraction, it may be purified. In order to purify human FcRn, a method known in the art may be used, and an example is separation / purification using liquid chromatography. Liquid chromatography includes ion exchange chromatography, hydrophobic interaction chromatography, gel filtration chromatography, affinity chromatography, etc .. By performing purification operations by combining these chromatography, human FcRn is purified to high purity. Can be prepared.

  As a method for measuring the binding activity of the obtained human FcRn to IgG, for example, the binding activity to IgG may be measured using an enzyme-linked immunosorbent assay (hereinafter referred to as ELISA) method or a surface plasmon resonance method. The IgG used for measuring the binding activity is preferably human IgG.

The present invention relates to a human FcRn α-chain amino acid sequence shown in SEQ ID NO: 1 consisting of 24th alanine to 297th serine, which is part of the extracellular region, and the amino acid sequence shown in SEQ ID NO: 2. FcRn β chain at least amino acid residues from isoleucine to 119th methionine (or one or more of the amino acid residues substituted, inserted or deleted) ) Can be efficiently produced in E. coli by transforming E. coli using the polynucleotide.
Furthermore, since human FcRn obtained in the present invention is soluble, it can be processed more easily than insoluble human FcRn when used for industrial applications.

It is the schematic of the alpha chain of human FcRn. The numbers in the figure indicate the amino acid sequence numbers described in SEQ ID NO: 1. In the figure, S represents a signal sequence, EC represents an extracellular region, TM represents a transmembrane region, and C represents an intracellular region. FIG. 2 is a schematic diagram of the β chain of human FcRn. The numbers in the figure indicate the amino acid sequence numbers described in SEQ ID NO: 2. In the figure, S represents a signal sequence, and B2M represents β2 microglobulin. FIG. 3 shows the binding of human FcRn expressed in the transformant obtained in Example 1 to human IgG. It is the figure which compared the nucleotide sequence when converting human FcRn into a polynucleotide using a human type | mold codon (human, the upper stage) and an E. coli type codon (E. coli, the lower stage). It is the figure which compared the nucleotide sequence when converting human FcRn into a polynucleotide using a human type | mold codon (human, the upper stage) and an E. coli type codon (E. coli, the lower stage). It is the figure which compared the nucleotide sequence when converting human FcRn into a polynucleotide using a human type | mold codon (human, the upper stage) and an E. coli type codon (E. coli, the lower stage).

  Hereinafter, examples will be shown to describe the present invention in more detail, but the present invention is not limited to the examples.

Example 1 Preparation of human FcRn expression vector (E. coli type codon)
(1) Of the amino acid sequence of human FcRn described in SEQ ID NO: 1, among the amino acid sequence of β chain of human FcRn consisting of 24th alanine to 297th serine and the amino acid sequence described in SEQ ID NO: 2 Based on the amino acid sequence from the 21st isoleucine to the 119th methionine, using the DNAworks method (Nucleic Acids Res., 30, e43, 2002), the codon was converted from human to Escherichia coli and linked with a linker. The nucleotide sequence was designed. In addition, NcoI and HindIII restriction enzymes were included at both ends. The designed nucleotide sequence is shown in SEQ ID NO: 3.
(2) The designed nucleotide was artificially synthesized.
(3) The polynucleotide obtained in (2) is digested with restriction enzymes NcoI and HindIII, and then ligated to an expression vector pETmalE (Japanese Patent Application Laid-Open No. 2011-206046) previously digested with restriction enzymes NcoI and HindIII. Was used to transform E. coli BL21 strain (DE3).
(4) After culturing the obtained transformant in an LB medium containing 50 μg / mL kanamycin, the expression vector pET-eFcRn was extracted using QIAprep Spin Miniprep kit (Qiagen).
(5) The Big Dye Terminator Cycle Sequencing FS read Reaction kit (manufactured by Life Sciences) based on the chain terminator method for the polynucleotide encoding FcRn and the surrounding region of the expression vector pET-eFcRn prepared in (4) The nucleotide sequence was analyzed using a fully automatic DNA sequencer ABI Prism 3700 DNA analyzer (manufactured by Life Sciences). In this analysis, the oligonucleotide described in SEQ ID NO: 4 (TAATACGACTCACTATAGGGG ') or SEQ ID NO: 5 (5'-TATGCTAGTTATTGCTCAG-3') was used as a sequencing primer.

  The amino acid sequence of the polypeptide expressed by the expression vector pET-eFcRn is shown in SEQ ID NO: 6, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 7, respectively. In SEQ ID NO: 6, the first methionine (Met) to the 26th alanine (Ala) are MalE signal peptides, and the 27th lysine (Lys) to the 33rd glycine (Gly) are linker sequences. , From the 34th isoleucine (Ile) to the 132nd methionine (Met) is the human FcRn β chain (21st to 119th region of SEQ ID NO: 2), and the 157th from the 133rd glycine (Gly) From the 158th alanine (Ala) to the 431rd serine (Ser) is the extracellular region of the α chain of human FcRn (from the 24th to the 297th in SEQ ID NO: 1). The 432 th to 437 th histidine (His) is the tag sequence.

Example 2 Confirmation of Antibody Binding of Human FcRn (1) 4 mL of 2YT liquid medium containing 50 μg / mL kanamycin (E. coli BL21 (DE3) strain transformed with the expression vector pET-eFcRn obtained in Example 1) Peptone 16 g / L, yeast extract 10 g / L, sodium chloride 5 g / L), and then precultured by aerobic shaking culture at 37 ° C. overnight.
(2) A 15 mL 2YT liquid medium supplemented with 50 μg / mL kanamycin was inoculated with 150 μL of the preculture solution of (1), and aerobically cultured at 37 ° C. with shaking.
(3) 150 minutes after the start of the culture, IPTG was added to a final concentration of 0 mM / 0.1 mM, and the culture was aerobically shaken at 20 ° C. for 4 hours.
(4) After completion of the culture, the cells were collected by centrifugation, and a protein extract in the soluble fraction was prepared using an ultrasonic generator (manufactured by Tommy Seiko Co., Ltd.).
(5) The antibody binding activity of human FcRn contained in the protein extract prepared in (4) was measured using the ELISA method shown below.
(5-1) A gamma globulin preparation (manufactured by Chemical and Serum Therapy Research Laboratories), which is a human antibody, was immobilized on a well of a 96-well microplate at 10 μg / well (at 4 ° C. for 18 hours). After completion of immobilization, blocking was performed with a phosphate buffer (pH 6.0) containing 2% (w / v) SKIM MILK (manufactured by BD).
(5-2) After washing with a washing buffer (phosphate buffer (pH 6.0)), the solution containing human FcRn prepared in (4) was reacted with immobilized gamma globulin (1 hour at 30 ° C.) .
(5-3) After completion of the reaction, the antibody was washed with the washing buffer and diluted to 100 ng / mL with a blocking solution, and Anti-6His antibody (Bethyl Laboratories) was added at 100 μL / well.
(5-4) After reacting at 30 ° C. for 1 hour and washing with the washing buffer, TMB Peroxidase Substrate (manufactured by KPL) was added at 50 μL / well. Color development was stopped by adding 1 M phosphoric acid at 50 μL / well, and absorbance at 450 nm was measured with a microplate reader (manufactured by Tecan).

  FIG. 3 shows a diagram summarizing the relationship of absorbance (450 nm) corresponding to antibody binding activity when the solution containing human FcRn prepared in (4) was added. In FIG. 3, pETmalE is a plasmid obtained by similarly culturing and extracting a plasmid without the FcRn gene inserted (negative control). Compared with the case where the FcRn gene is not inserted, the absorbance is increased in the inserted one, indicating that human FcRn is expressed in an active state.

Claims (6)

Amino acid residues from at least 24th alanine to 297th serine in the amino acid sequence described in SEQ ID NO: 1 and at least 21st isoleucine to 119th methionine in the amino acid sequence described in SEQ ID NO: 2 A polynucleotide encoding human FcRn obtained by converting a protein containing a group using an E. coli type codon. Amino acid residues from at least 24th alanine to 297th serine in the amino acid sequence described in SEQ ID NO: 1 and at least 21st isoleucine to 119th methionine in the amino acid sequence described in SEQ ID NO: 2 A polynucleotide encoding human FcRn, wherein a protein comprising a group and having one or more of the amino acid residues substituted, inserted or deleted is replaced with an E. coli type codon. The polynucleotide of claim 1 comprising the nucleotide sequence set forth in SEQ ID NO: 3. A vector comprising the polynucleotide according to any one of claims 1 to 3. A transformant obtained by transforming Escherichia coli with the vector according to claim 4. A method for producing human FcRn, comprising culturing the transformant according to claim 5 and recovering human FcRn from the obtained culture.

Images