JP2017535292A - Modified γδ T cells - Google Patents

Abstract

The present invention relates to modified γδ T cell (s) and methods of use thereof as therapeutic agents having the potency and ability to target selected antigens. The modified γδ T cells of the present disclosure are useful for the treatment of various cancers, infectious diseases, and immune disorders. Also disclosed are methods of expanding the modified and unmodified γδ T cell (s) population to a therapeutically useful amount. The modified γδ T cells of the present disclosure can be a universal donor and can be administered to subjects of any MHC haplotype. [Selection] Figure 4

Description

  Antigen recognition by T lymphocytes can be achieved by the highly diverse heterodimeric receptor, the T cell receptor (TCR). Approximately 95% of human T cells in the blood and lymphoid organs express heterodimeric αβTCR receptors (αβ T cell lineage). Approximately 5% of human T cells in blood and lymphoid organs express heterodimeric γδ TCR receptors (γδ T cell lineage). These T cell subsets are sometimes referred to as “αβ” and “γδ” T cells, respectively. αβ and γδ T cells have different functions. αβ T cells induce MHC restricted adoptive immunity, and γδ T cells bridge innate and non-MHC restricted adoptive immunity. Activation of αβ T cells occurs when antigen presenting cells (APCs) present antigen in the context of class I / II MHC. Dendritic cells are the most powerful known activators of naïve T cells. Complete αβ T cell activation requires two signals: a) a signal generated by the interaction of the MHC-peptide with the TCR-CD3 complex; and b) CD28 on T cells and the B7 family on APC. A signal (costimulatory signal) generated by interaction with a member. In contrast to αβ T cells, γδ T cells can recognize antigens directly and do not require interaction between MHC-peptide and TCR-CD3 complex. Therefore, it is said that γδT cells are not MHC restricted. In endogenous T cells, the lack of costimulatory signals results in clonal anergy.

  The ability to directly recognize endogenous γδ T cell antigens makes γδ T cells an attractive therapeutic tool. However, the difficulty in manipulating and inducing endogenous γδ T cells limits the therapeutic utility of patient-derived γδ T cells in the clinic.

In some embodiments, the present disclosure provides modified γδ T cells, wherein the modified γδ T cells are modified to express one, two, or more different tumor recognition moieties, wherein each tumor recognition moiety is Recognize tumor antigens. Tumor recognition moieties recognize different epitopes of the same tumor antigen, different tumor antigens, tumor antigens and activated or inactivated costimulatory / immunomodulatory receptors, antigens complexed with MHC molecules, or homing receptors Can be designed as In some cases, the present disclosure provides a method of treating cancer with modified γδ T cells. The modified γδ T cells can be designed allogeneically for the subject, and the modified γδ T cells can be tumor-specific allogenic γδ T cells. In some cases, the modified γδ T cells lack the human HLA locus. The HLA locus can be selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR, Modified γδ T cells can be engineered to lack expression from more than one HLA locus. In some cases, at least one modified tumor recognition moiety is a modified T cell receptor. The T cell receptor can be a human T cell receptor, a mouse T cell receptor, a rat T cell receptor, or a chimeric T cell receptor. The modified T cell receptor can be a modified αβTCR and can be designed such that two different modified αβTCRs recognize different epitopes of the same antigen. In other cases, the modified T cell receptor is a modified γδ TCR. In some embodiments, the modified γδ T cells are designed to invade solid tumors. Modified γδ T cells can be designed to recognize tumor antigens expressed intracellularly or extracellularly in tumor cells. In the case of extracellularly expressed tumor antigens, the modified γδ T cells can be configured to recognize antigens that are peptides complexed with MHC molecules. In some cases, the tumor antigen is lymphoma antigen, leukemia antigen, multiple myeloma antigen, breast cancer antigen, prostate cancer antigen, bladder cancer antigen, colon and rectal cancer antigen, brain cancer antigen, stomach cancer antigen, head and neck cancer antigen, kidney cancer Antigen, lung cancer antigen, pancreatic cancer antigen, sarcoma antigen, mesothelioma antigen, ovarian cancer antigen or melanoma antigen. In some cases, the modified γδ T cells are derived from Vδ1 ⁺ T cells, Vδ2 ⁺ T cells or Vδ3 ⁺ T cells, or a mixture of Vδ1 ⁺ , Vδ2 ⁺ , or Vδ3 ⁺ T cells. The modified γδ T cells can be derived from CD3 ⁺ T cells or CD3 ⁻ T cells. Modified γδ T cells can be designed to recognize different epitopes of the same antigen.

  In some cases, two or more different tumor recognition portions are encoded by different polynucleotide sequences, and each different polynucleotide sequence is modified to recognize a different epitope of the same antigen. In some cases, at least one tumor recognition moiety is cloned from the tumor cells. In other cases, at least one tumor recognition moiety is synthetically modified. In some cases, at least one tumor recognition moiety is an antibody fragment that recognizes a tumor antigen, or an antigen-binding fragment thereof. The tumor recognition moiety can be a modified immunoglobulin light chain, a modified immunoglobulin heavy chain, or any fragment thereof. In some cases, the modified γδ T cells also express migration and homing receptors. The homing molecule can attach modified γδ T cells to solid tumors. In some cases, the modified γδ T cell is further modified to lack at least one immune checkpoint gene, the immune checkpoint gene being a CTLA-4 gene, PD-1 gene, LAG3 gene, CEACAM-1 gene, or another gene It can be. In some cases, the tumor antigen is CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA) ), CEACAM5, CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP -1, STEAP-2, mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK , Gp100, MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGE family gene (eg MAGE3A, MAGE4A etc.), KKLC1, mutant ras, βraf, p53, MHC class I chain related molecule A ( MICA), MHC class I chain related molecule B (MICB), HPV, or CMV. In other cases, the at least one tumor recognition moiety is a chimeric antigen receptor (CAR) designed to recognize any antigen, portion or fragment of an antigen described herein.

  In other embodiments, the modified γδ T cells have been modified to express an antigen recognition moiety, and the antigen recognition moiety recognizes an antigen associated with an autoimmune disease. Such cells can be modified to express one, two, or more antigen recognition moieties, each antigen recognition moiety capable of recognizing a different epitope of the same autoimmune antigen. In some cases, the tumor recognition moiety recognizes different antigens, antigens and activated or inactivated costimulatory / immunomodulatory receptors, antigens complexed with MHC molecules, or homing receptors associated with autoimmune diseases.

  In an alternative embodiment, the modified γδ T cells have been modified to express an antigen recognition moiety, and the antigen recognition moiety recognizes a pathogenic antigen. Such cells are modified to express more than one antigen recognition moiety, and each antigen recognition moiety can recognize a different epitope of the same pathogenic antigen. In some cases, the tumor recognition moiety recognizes different antigens, antigens and activated or inactivated costimulatory / immunomodulatory receptors, antigens complexed with MHC molecules, or homing receptors associated with pathogenic antigens.

  The pathogenic antigen can be a bacterial or viral molecule, such as a bacterial or viral protein.

  In other cases, the disclosure provides a γδ T cell population in which the growth of the γδ T cell population is activated by an agent that stimulates the growth of the γδ T cell population at an average rate of about one cell division in less than 24 hours. To do. In some cases, the expanded γδ T cell population includes a percentage of δ1 T cells, δ2 T cells, or δ3 T cells, and the percentage of any one of the expanded γδ T cells described above can be greater than 5%. In some cases, the percentage of δ1, δ2, or δ3 T cells in the γδ T cell population expands at an average rate of about one cell division in less than 24 hours in vitro or in vivo. In some cases, the γδ T cell population further comprises an amount of modified γδ T cells, wherein the modified γδ T cells have been modified to express an antigen recognition moiety. Modified γδ T cells can also be designed to lack the human HLA locus. The agent that stimulates the growth of the γδ T cell population can be an antibody, and the antibody is 5A6. It can be selected from the group consisting of antibodies E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, and 11F2. In some cases, the antibody is immobilized on the surface.

  In some cases, the present disclosure relates to activating epitopes of γδ T cells. In some cases, the activated epitope stimulates the growth of the γδ T cell population with an average rate of cell division of once per less than 24 hours or another suitable time that can withstand the rapid growth of the population of γδ T cells. In some cases, the activation epitope is an amino acid sequence such as a δTCR, eg, δ1, δ2, or δ3 TCR. In some cases, the activation epitope is 5A6. Bound by any one of the antibodies selected from the group consisting of E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, and 11F2 antibodies It is an epitope. The activated epitope can include amino sequences from the Vδ1 gene segment and the Jδ1, Jδ2, Jδ3, or Jδ4 gene segment. In some cases, the activation epitope is a conformational epitope; in other cases, the activation epitope is a linear epitope.

  In some cases, the disclosure provides a method for determining epitopes of a γδ T cell receptor, the method comprising: (a) preparing a library of epitopes from the γδ T cell receptor; And (c) identifying the amino acid sequence of at least one epitope bound by the antibody in the library of epitopes. The antibody is 5A6. It can be selected from the group consisting of antibodies E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, 11F2. In some cases, the antibody is attached to a solid support. An epitope of a T cell receptor can correspond to a continuous or discontinuous sequence of amino acids in the T cell receptor. The library of epitopes can comprise fragments ranging from about 10 amino acids to about 30 amino acids, about 10 amino acids to about 20 amino acids, about 5 amino acids to about 12 amino acids in length. In some cases, the antibody is labeled. The label can be a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin. In some cases, the library of epitopes includes peptides translated from synthetically designed cDNAs, and the synthetically designed cDNAs include multiple synthetically designed γTCRs and multiple synthetically designed cDNAs. Includes segments of δTCR. In other cases, the library of epitopes comprises peptides amplified from total RNA extracted from human PBMC or human δγ T cells of lymphocyte origin isolated from human malignant or normal epithelial tissue. A synthetically designed library of cDNAs can contain multiple Vδ1, Vδ2, and Vδ3 gene segments that differ in their Jδ region, and the library can also include multiple Vγ2, Vγ3, Vγ4, Vγ5. , Vγ8, Vγ9, Vγ10, δ1, δ2, and δ3 gene segments.

  In some embodiments, the present disclosure provides a method of treating a subject in need, the method comprising administering to the subject a γδ T cell described herein. While further aspects and advantages of the present disclosure will be readily apparent to those skilled in the art from the following detailed description, only exemplary embodiments of the present disclosure are presented and described. As will be realized, the disclosure is capable of other and different embodiments, and its several details are capable of modification without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature and not as restrictive.

INCORPORATION BY REFERENCE All publications, patents, and patent applications mentioned in this specification are as if specifically and individually indicated as if each individual publication, patent, or patent application was incorporated by reference, Which is incorporated herein by reference.

  The novel features of the invention are set forth with particularity in the appended claims. DETAILED DESCRIPTION OF THE INVENTION Refer to the following detailed description showing exemplary embodiments utilizing the principles of the present invention, and the accompanying drawings (also referred to herein as “FIGURE” and “FIG.”). This provides a deeper understanding of the features and advantages of the present invention.

1 schematically shows modified γδ T cells. Panel A shows modified γδ T cells expressing one tumor recognition moiety. Panel B shows modified γδ T cells expressing two tumor recognition moieties. The treatment method of a subject is shown schematically. 1 schematically illustrates a method of administering a population of modified γδ T cells to a subject. 2 shows a graph illustrating the growth of γδ1 and γδ2 lymphocytes isolated from liver metastatic colon adenocarcinoma (TIL1) and kidney tumor (TIL2) and known to express CCR4 and CCR7. 2 shows a graph illustrating γδ T cell growth in serum-containing and serum-free media. 5A6. 2 shows a graph illustrating anti-γδTCR antibody blocking experiments with E9, B1, TS8.2, 15D, B3, B6, TS-1, γ3.20, IMMU510, or 11F2. 5A6. 2 shows a graph illustrating anti-γδTCR antibody blocking experiments with E9, B1, TS8.2, 15D, B3, B6, TS-1, γ3.20, IMMU510, or 11F2. Shown are competition experiments with anti-TCR Vδ1 TS-1 antibody. Shown are competition experiments with anti-TCR Vδ1 TS8-2 antibody. 2 shows a graph illustrating the activation and proliferation of PBMC-derived δ1 T cells. 2 shows a graph illustrating the activation and proliferation of PBMC-derived δ2 T cells. 2 shows a graph illustrating the proliferation rate of PBMC-derived δ1T cells. 2 shows a graph illustrating the proliferation rate of PBMC-derived δ2 T cells.

  While various embodiments of the present invention have been presented and described herein, it will be apparent to those skilled in the art that such embodiments are provided for illustrative purposes only. Those skilled in the art can readily devise numerous variations, modifications, and substitutions without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.

Overview In humans, γδ T cell (s) are a subset of T cells that link between innate and adaptive immune responses. These cells undergo V- (D) -J segment rearrangement to produce antigen-specific γδ T cell receptor (γδ TCR), and γδ T cell (s) are independently activated to activate γδ T cell effector function. Can be activated directly through recognition of the antigen by either γδ TCR or other non-TCR proteins acting together or together. In mammals, γδ T cells make up a small portion of the total T cell population, approximately 1-5% of T cells in peripheral blood and lymphoid organs, mainly like skin, liver, digestive tract, airways, and reproductive tract It appears to be in the epithelial cell rich compartment. Unlike αβTCR, which recognizes antigen bound to a major histocompatibility complex molecule (MHC), γδTCR is a bacterial antigen in the form of an intact protein or non-peptide compound, a viral antigen, a stress antigen expressed by diseased cells, And can directly recognize tumor antigens.

  The ability of γδ T cells to recognize a broad spectrum of antigens can be enhanced by genetic modification of γδ T cells. By modifying the γδ T cell (s), a universal allogenic therapy that recognizes the antigen selected in vivo is possible. ΓδT cell (s) modified to express an expression cassette comprising at least one tumor recognition moiety bound to a transmembrane domain and / or an intracellular T cell activation domain, such as αβTCR or γδTCR It describes. Activation domains can be derived from the T cell αβTCR or γδTCR apparatus. For example, the activation domain can be derived from a CD28, CD2, CTLA-4, ICOS, JAMAL, PD-1, 41-BB, CD27, CD30, OX40, NKG2D, HVEM, or CD46 molecule. γδ T cells can be modified to express two or more different TCRs, different antibodies, or antigen-binding fragments that recognize different epitopes of the same antigen. When administered to a subject, binding to the modified αβTCR, γδTCR, antibody, or antigen of the chimeric antigen receptor CAR effectively imparts significant cytotoxicity to the γδ T cells in vivo. TCRs can be derived from human T cells, mouse T cells, rat T cells, humanized mice, humanized rats, immunized mammals, or phage or yeast libraries. The antibody, CAR, or any antigen-binding fragment can be derived from human B cells, mouse B cells, rat B cells, camel B cells, llama B cells, immunized mammals, or phage or yeast libraries. Tumor recognition moieties expressed by modified γδ T cells can recognize antigens expressed intracellularly or extracellularly by diseased cells. For example, the cell may be infected with an oncogenic virus, such as human papilloma virus, and the diseased cell may express one or more HPV antigens intracellularly. Diseased cells may process intracellularly expressed HPV antigens into small fragments, allowing antigenic peptides to bind to MHC class I molecules and transport to the cell surface. The tumor recognition portion of the modified γδ T cell is designed to recognize various antigen fragments or epitopes that are expressed intracellularly by diseased cells and complexed with MHC class I or II molecules and presented on the cell surface Can do. Alternatively, the tumor recognition portion of modified γδ T cells can be designed to recognize exogenous antigens expressed on the surface of tumor cells or derived peptides posted on the cell surface in complex with MHC class molecules. .

  Provided herein are modified γδ T cell (s) and methods for their use as therapeutic products having the potency and ability to target selected antigens on diseased cells. From one or more αβ or γδ T cell (s) combined with tumor antigen (s), bacterial antigen (s), viral antigen (s), or stress antigen (s) by standard techniques The αβ or γδ TCR polynucleotide or protein sequences can be cloned. Alternatively, the αβ or γδ TCR polynucleotide sequences can be designed in silico on a computer program product. An expression cassette containing the modified γδ TCR can be synthesized, for example, by oligonucleotide synthesis. High-throughput screening techniques can be used to assess the binding properties of modified TCRs to tumor antigens. Modification of an expression cassette comprising an αβ or γδ TCR, a transmembrane domain and an activation domain increases the activity and cytotoxicity of the γδ T cell, thereby conferring strong cytotoxicity on the modified γδ T cell.

  Modified γδ T cells can be derived from blood, umbilical cord blood, stem cells, tumors, or unmodified T cells isolated from tumor infiltrating lymphocytes (TIL). Isolated T cells can be derived from a mammal, eg, a human. One or more cells in the isolated T cell population are modified to express the polynucleotide (s) of the expression cassette comprising, for example, a tumor recognition moiety bound to a T cell activation or inactivation domain. obtain. The tumor recognition moiety is designed to recognize the target tumor antigen, tumor cell inactivation or T cell inactivation domain. The tumor recognition moiety is designed to recognize a target tumor antigen, activated or inactivated costimulatory / immunomodulatory receptor, or homing receptor. The tumor antigen can be, for example, a peptide derived from an intracellular or extracellular protein complexed with a major histocompatibility complex (MHC) and expressed on the cell surface. In some cases, the tumor recognition moiety is an αβTCR and the antigen is a peptide complexed with MHC presented by tumor cells. Antigens can be found in cells at risk, such as cancer cells, or in pathogens that replicate in the cells, such as viruses or intracellular bacteria, or pathogens or products that are internalized from the extracellular fluid by endocytosis. It can be a molecule derived from. In some cases, the engineered γδ T cells are designed to express two or more different tumor recognition portions, and each tumor recognition portion is designed to recognize a different epitope of the same antigen. Universally modified γδ T cells can express tumor recognition moieties capable of recognizing antigens with different MHC haplotypes. The tumor recognition moiety can comprise either a TCR (αβ or γδTCR) or an antibody that recognizes a peptide-MHC complex. For example, for a given antigen, different tumor recognition moieties, either TCRs or antibodies, can recognize the same or different antigen-derived peptides complexed with different HLA haplotypes.

  Modified γδ T cells weaken or kill cells that express the target antigen when administered to a subject. The modified γδ T cell (s) can be introduced into a human in need of treatment for the disease. In a preferred embodiment, the cells are administered to a person with cancer, in which case the cells are modified to recognize tumor antigens or other disease-related antigens. FIG. 1 schematically shows γδT cells. Panel A shows modified γδ T cells expressing one tumor recognition moiety. Panel B shows modified γδ T cells expressing two tumor recognition moieties.

The recognition moiety encoded by the expression cassette, such as a chimeric antigen receptor (CAR), is derived from a cell surface tumor antigen, a tumor antigen expressed on the cell surface as a complex with MHC (peptide-MHC complex). Complete antibody binding to peptide, antibody fragment, single chain variable fragment (scFv), single domain antibody (sdAb), Fab, F (ab) ₂ , Fc, light or heavy chain on antibody, variable region of antibody Or constant region, or any combination thereof, or two different antigens, different epitopes of the same antigen, or tumor antigen and costimulatory / activator molecule, immunomodulatory molecule (s), or homing receptor (s) Bispecific constructs comprising two different antibodies directed to The antibody can be derived from, for example, human B cells, mouse B cells, rat B cells, or hybridoma cell lines. Murine hybridoma cell lines are derived from immunized wild type or humanized mice, rat B cells, rat hybridoma cells isolated from immunized wild type or humanized rats, or humans, mice, rats, camels, or llamas. It can be derived from an antibody library. The modified tumor recognition moiety can be a CAR that recognizes a cell surface antigen or peptide MHC-antigen complex. The modified tumor recognition moiety can be a modified αβTCR that recognizes a tumor-specific antigen complexed with MHC class I or II. The recognition moiety may be a γδ TCR that recognizes a tumor-specific antigen in a non-MHC-restricted manner. The tumor recognition moiety can be a modified TCR or CAR that recognizes cell surface antigens, peptide-MHC complexes, carbohydrates, or lipids.

  One, two, or more tumor recognition moieties can be designed to recognize the same or different antigens. One, two, or more tumor recognition moieties can be designed to recognize different epitopes of the same or different antigens. In some cases, the tumor recognition moiety is an αβTCR receptor expressed by an expression cassette designed into the genome of γδT cells. In some cases, by modified γδ T cells so as to recognize peptides derived from antigens expressed intracellularly, extracellularly or on the cell surface by tumor cells or another diseased cell, or peptidemers (such as 9-mers). Design the modified αβ TCR to be expressed. Intracellular antigens can be produced, for example, by viruses and bacteria that replicate in infected cells, or by the subject's own protein. The subject's cells can process the antigen into a peptide and complex it with an MHC class I or II molecule to present the peptide. The modified γδ T cell (s) of the present disclosure can be designed to recognize a variety of different epitopes of a variety of different intracellular antigens. Extracellular or exogenous antigens, such as bacteria, parasites, viruses, or even cancer cells, can be phagocytosed by antigen presenting cells, processed into small fragments, and presented in complex with MHC class II molecules. The modified γδ T cell (s) of the present disclosure can be designed to recognize a variety of different epitopes of a variety of different extracellular antigens. In some cases, the tumor recognition moiety is a γδ TCR receptor that provides new antigen recognition to the cell. The expression cassette may include, for example, a CAR that expresses an antibody or ligand, which is integrated into the genome of the γδT cell and expressed by the γδT cell. In some cases, the tumor recognition moiety can be a bispecific construct comprising, for example, an antibody, TCR, antigen-binding fragment, or any combination thereof described herein. γδ T cells can be modified from tumor infiltrating lymphocytes (TIL) and / or the tumor recognition portion encoded by the expression cassette can be isolated from TIL. ΓδT cells modified from TIL can be tumor-specific allogenic cells that effectively migrate, home, and interact with the tumor microenvironment. Modified γδ T cells are specific tumors such as breast cancer, prostate cancer, bladder cancer, colon and rectal cancer, brain cancer, stomach cancer, head and neck cancer, kidney cancer, lung cancer, pancreatic cancer, sarcoma, mesothelioma, ovarian cancer antigen or It can be modified from TIL isolated from melanoma and the like. The tumor recognition moiety can be derived from a synthetic library, or the tumor recognition moiety can be, for example, lymphoma, leukemia, multiple myeloma, breast cancer, prostate cancer, bladder cancer, colon and rectal cancer, brain cancer, gastric cancer, head and neck It can be derived from B cells, T cells isolated from cancer, kidney cancer, lung cancer, pancreatic cancer, sarcoma, mesothelioma, ovarian cancer antigen or melanoma. In some cases, the tumor recognition moiety is derived from tumor infiltrating lymphocytes isolated from the cancer.

  The modified γδ T cell may further comprise a T cell costimulatory / activation domain. The T cell activation domain can be derived from αβ T cells and / or γδ T cells. For example, a modified αβTCR can be designed to link to either a γδ costimulation / activation domain or an αβ costimulation / activation domain. Non-limiting examples of αβ costimulation / activation domains include CD28, CD2, CTLA4, ICOS, PD-1, 4-1BB (CD137), OX40, CD27, HVEM. Non-limiting examples of γδ costimulation / activation domains include CD28, CD2, ICOS, JAMAL, CD27, CD30, OX40, NKG2D, CD46. The tumor recognition moiety can be linked to a T cell activation domain or any other suitable domain. T cell activation domain is CD3ζ domain, CD28 domain, or CD2, ICOS, 4-1BB (CD137), OX40 (CD134), CD27, CD30, CD46, CD70, CD80, CD86, DAP, CD122, CTLA4, CD152, It may be another suitable activation domain including PD-1, JAMAL, NKG2D, CD314, and / or FceRIg. Examples of the transmembrane domain include CD28, CD4, CD3e, CD16 and immunoglobulin related domains.

  The invention disclosed herein preferably provides a modified γδ T cell that expresses an expression cassette encoding a recognition molecule. In some cases, the nucleic acid sequence corresponding to the expression cassette is cloned and stably introduced into the genome of the modified γδ T cell. Nucleic acid sequences comprising an expression cassette that can include a tumor recognition moiety and associated activation domain may be synthetically modified to stably introduce it into the genome of the modified γδ T cell. Two or more different tumor recognition moieties can be expressed from the same or different expression cassettes.

  Various techniques can be used to modify such cells. For example, genome editing methods using modified nucleases such as a) CRISPR / Cas system; b) transcription activator-like effector nuclease (TALEN); c) zinc finger nuclease (ZFN); d) and modified meganuclease homing endonuclease Can insert, replace, or remove cloned or synthetically modified DNA to generate modified γδ T cells. A sleeping beauty transposon system can be used to transfer nucleic acids containing the tumor recognition portion code to generate modified γδ T cells. Various other polynucleotide delivery methods known in the art may be suitable for modification of γδT cells, such as transfection, electroporation, transduction, lipofection, nanofabricated materials, eg, ormosil, adenoviruses, Virus delivery methods including retroviruses, lentiviruses, adeno-associated viruses, or other suitable methods.

  In some cases, the recognition moiety is derived from a single or multiple species, eg, the polynucleotide sequence of the recognition moiety is, for example, human (Homo sapiens), mouse (eg, Mus musculus), rat (eg, Rattus norvegicus or Rattus rats). Can be derived from camels (eg Camelus dromedarius or Camelus bactrianus) or llamas (Lama vicugna) or the polynucleotide sequence of the recognition moiety can be a chimeric conjugate of both. The tumor recognition moiety is preferably derived from a human, but in some cases may be derived from a mouse or other species, preferably a mammal. In some cases, the tumor recognition moiety is a chimeric TCR receptor or a chimeric CAR. In some cases, the polynucleotide sequence of a tumor recognition portion derived from a non-human species is modified to increase similarity to a polynucleotide sequence from a human species, thereby “humanizing” the tumor recognition portion. In some cases, species such as mice and rats are “humanized” to obtain, for example, humanized antibodies and TCRs.

The tumor recognition moiety is preferably constitutively expressed from an expression cassette in the modified γδ T cell. In some cases, the tumor recognition moiety is under expression in an inducible expression system, such as a tetracycline-regulated T-REx ™ mammalian expression system, a suitable Tet-on / Tet-off expression system, or another suitable system. . In certain cases, the modified γδ T cells are derived from human Vδ1 ⁺ T cells, human Vδ2 ⁺ T cells, human Vδ3 ⁺ T cells, human CD3 ⁺ T cells, or human CD3 ⁻ T cells.

  The present disclosure provides methods and modified γδ T cell (s) for expressing a tumor recognition moiety from an expression cassette capable of sensing and targeting a specific antigen in a subject's body. The subject can be a subject in need of treatment with a therapeutic agent that can effectively and selectively recognize and kill or weaken the cell (s) expressing a particular antigen. In preferred cases, the antigen is associated with cancer. The antigen can be a lineage specific tumor antigen. In one embodiment, the antigen is CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA) ), CEACAM5, CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP -1, STEAP-2, mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK , Gp100, MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGE family gene (eg MAGE3A, MAGE4A etc.), KKLC1, mutant ras, βraf, p53, MHC class I chain related molecule A ( MICA), MHC class I chain-associated molecule B (MICB), HPV, or tumor antigens such as CMV.

  The modified γδ T cells of the present disclosure can be autologous or allogenic to the subject's MHC locus. For example, autologous and allogenic bone marrow transplantation (BMT) have been used as a treatment for several pathologies, particularly hematological malignancies. However, for allogenic BMT, acute graft-versus-host disease (GVHD) and host-versus-graft disease (HVGD) remain the most important BMT complications.

  Donor T cells and host antigen presenting cells (APC) are critical for the induction of GVHD. Since γδ T cells do not recognize host-derived MHC molecules, antigen recognition by the modified γδ T cells of the present invention cannot induce GVHD. The modified γδ T cells of the present disclosure can be designed to be administered to non-autologous subjects without inducing graft-versus-host disease. Furthermore, modified γδ T cells can be designed to lack gene expression from one or more MHC loci. Alternatively, γδ T cells can be modified to lack one or more MHC locus (s). Deletion of the MHC locus in the modified γδ T cell or disruption of gene expression can be achieved by gene editing techniques such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR, and modified meganuclease. Or by β2m deletion. In some cases, the modified γδ T cells of the present disclosure are modified to lack or disrupt gene expression at multiple MHC loci. In other cases, the modified γδ T cells are modified to lack or disrupt gene expression at at least one MHC class I locus, at least one MHC class II locus, or both. Deletion of one or more MHC loci yields modified γδ T cells that are universal donors for any subject with any MHC haplotype without inducing host versus graft disease, and thus the host Modified γδ T cells can be obtained that can grow, survive, proliferate, and function in the host without being targeted by the immune system.

  The teachings and compositions described herein can be used in a variety of applications. In a preferred embodiment, the tumor antigen is a breast cancer antigen, prostate cancer antigen, bladder cancer antigen, colon and rectal cancer antigen, brain cancer antigen, stomach cancer antigen, head and neck cancer antigen, kidney cancer antigen, lung cancer antigen, pancreatic cancer antigen, sarcoma antigen Mesothelioma antigen, ovarian cancer antigen or melanoma antigen. In such cases, the tumor recognition moiety is designed to recognize an epitope derived from a modified αβTCR, or an intracellular or extracellular tumor antigen that is complexed with a class I or class II MHC and presented on the tumor cell surface. Antibody. Modified αβ TCRs are, for example, in the context of HLA-A, HLA-B, or HLA-C complexes, or HLA-DP, HLA-DQ, HLA-DR, HLA-DM, HLA-DO, or other HLA It can recognize intracellular tumor antigens presented by tumors or APCs in the context of molecules.

  In some cases, the antigen is a self-antigen. The autoantigen can be, for example, an immunoglobulin, a T cell receptor, an intracellular tumor antigen, an extracellular tumor antigen, an MHC molecule, or an extracellular portion associated with a disease state. For example, cellular expression of human HLA DR2 is associated with systemic lupus and multiple sclerosis, and cellular expression of human HLA DR4 is associated with rheumatoid arthritis and diabetes mellitus.

  In other cases, the antigen is a foreign antigen. The foreign antigen can be, for example, a virus, bacterium, protozoan, or allergen, such as pollen or food. Foreign antigens can be associated with, for example, infections, autoimmune disorders, or tissue injury.

  The modified γδ T cells of the present disclosure can be designed to home to a specific physical site within the subject's body, and thus can target antigens in specific tissues, organs or body sites. Endogenous T cells have different repertoires of transport ligands and receptors that affect their migration pattern. The modified γδ T cells of the present disclosure may include one or more transport ligands that induce migration of the modified γδ T cells to a specific tissue, organ, or body part from an expression cassette that includes a tumor recognition moiety or from a separate expression cassette. Or the receptor (s) can be designed to be expressed.

  The modified γδ T cells of the present disclosure can be tumor-specific allogenic cells. For example, the modified γδ T cells can be derived from unmodified γδ T cells that are tumor infiltrating lymphocytes (TIL) isolated from the tumor. Different TILs can be isolated from different tumor types. Expression cassettes encoding the tumor recognition portion and the activation domain, or another modified feature, can be inserted into the genome of TIL isolated from various tumors. Such γδ T cells can infiltrate solid tumors, can weaken and kill tumor cells expressing one or more target antigens, and can provide effective treatment for malignant tumors. . Tumor-specific allogenic γδ T cells can be modified to express at least one tumor recognition moiety that recognizes a selected epitope. In some cases, tumor-specific allogenic γδ T cells are designed to express at least two different tumor recognition portions, each of which has a different epitope, different antigen, antigen and activated or inactivated of the same antigen Designed to recognize costimulatory / immunomodulatory receptor (s), antigen complexed with MHC molecule, or homing receptor.

In some cases, the modified γδ T cells of the present disclosure are designed to express specific alleles of the TCRδ and TCRγ receptor chains. Certain alleles of the TCRδ and TCRγ receptor chains of the modified γδ T cell can induce migration or homing of the modified γδ T cell to one or more physical sites in the subject's body. For example, in humans, γδ T cells that express Vδ1 ⁺ TCR home exclusively to the epithelial tissue of the skin or epithelial-related / mucosal tissue, the respiratory tract, gastrointestinal and genitourinary tracts, and some internal organs. Human γδ T cells that express Vδ3 ⁺ TCR are abundant in the liver. The modified γδ T cells of the present disclosure may be constitutively activated. In wild type T cells, TCR exists as a complex of multiple proteins, including CD3 proteins such as CD3εγ, CD3εδ, and ζ chain (CD3ζ homodimer). Multiple immunoreceptor tyrosine activation motifs (ITAMs) on the ζ chain can be phosphorylated to generate an activation signal in T lymphocytes. Unlike α / βTCR CD8 and CD4 cells, which are activated upon recognition of specific antigens associated with MHC class I or class II molecules, respectively, γδ T cells are activated by directly recognizing antigens in a non-MHC-restricted manner To do. Such antigens include antigens expressed by tumor cells, such as MHC class I chain related molecules A and B (MICA and MICB), CD1, NKG2A, ULBP1-3, lipids, and phosphorylated antigens. The modified γδ T cells of the present disclosure can be modified to constitutively activate. In some cases, the modified γδ T cells of the present disclosure are modified to include a tumor recognition portion and an activation portion. The activating moiety can be a protein in the TCR-CD3 complex. In some cases, the modified γδ T cells of the present disclosure constitutively express a recombinant CD3ζ gene, where the immunoreceptor tyrosine activation motif of the CD3ζ gene is a phosphorylation mimic of tyrosine in the YxxL / I motif. It has been modified to include. Various T cell activation domains and transmembrane domains such as CD3ζ, CD28, CD2, ICOS, 4-1 BB (CD137), OX40 (CD134), CD27, CD70, CD80, CD86, DAP, CD122, FceRIg, CD4, CD3e, JAMAL, NKG2D, or CD16 can be modified to include, for example, a phosphorylated mimic or another nucleic acid mutation.

  Further disclosed herein are methods for in vitro (ex vivo) expansion of the modified γδ T cells of the present disclosure. In some cases, modified γδ T cells can be expanded ex vivo without stimulation with antigen presenting cells or aminophosphate (s). The antigen-responsive modified T cells of the present disclosure can be expanded ex vivo and in vivo. In some cases, the active population of modified γδ T cells of the present disclosure can be obtained without antigen stimulation by antigen presenting cells, antigenic peptides, non-peptide molecules, or small molecule compounds such as aminophosphate (s), but specific It can be grown ex vivo using antibodies, cytokines, mitogens or fusion proteins such as IL-17 Fc fusions, MICA Fc fusions, and CD70 Fc fusions. Examples of antibodies that can be used to grow a γδ T cell population include anti-CD3, anti-CD27, anti-CD30, anti-CD70, anti-OX40, anti-NKG2D, or anti-CD2 antibodies, and examples of cytokines include IL- 2, IL-15, IL-12, or IL-21, IL-18, IL-9, IL-7, IL-33, and examples of mitogens are ligands for human CD27 CD70, phytohemaglutinin (PHA), concavalin A (ConA), pork weed mitogen (PWM), protein peanut agglutinin (PNA), soy agglutinin (SBA), les culinaris agglutinin (LCA), pisum sativumulinum (PSA), Helix pomatia agglutinin (HPA), Vicia graminea lectin (VGA) or another suitable mitogen capable of stimulating T cell proliferation. In some cases, the population of modified γδ T cells can be expanded in less than 60 days, less than 48 days, 36 days, less than 24 days, less than 12 days, or less than 6 days.

  Further disclosed herein are methods of treating various disease states with the modified γδ T cell (s) of the present disclosure. The modified γδ T cells of the present disclosure can be used to treat a subject in need of treatment for a disease state. The condition is cancer, such as bladder cancer, breast cancer, lung cancer, prostate cancer, liver cancer, skin cancer, colon and rectal cancer, lymphoma, leukemia, multiple myeloma, ovarian cancer, sarcoma, head and neck cancer, mesothelioma, brain cancer Sarcoma or another cancer. The condition can be an infection, autoimmune disorder, transplantation, or sepsis. Also disclosed herein are methods for providing a modified γδ T cell to a subject. In some cases, the modified γδ T cells can be administered to a subject suffering from a pathological condition. In some cases, modified γδ T cells can be administered to a subject during surgery, such as bone marrow transplantation. The disclosure further provides a method of administering a modified γδ T cell to a subject without co-administration of a regulatory cytokine such as IL-2. In some cases, one or more cytokines or hormones, such as IL-2, IL-7, IL-15, IL-21, that can enhance growth, survival, and function when administered ex vivo and administered in vivo. ΓδT cells are modified to express IL-12, IL-18, IL-9, and the like. γδ T cells can be modified to express one or more cytokines or hormones from the same or different expression cassettes containing the recognition moiety. Cytokines include chemokines, interferons, interleukins, and tumor necrosis factors. Non-limiting examples of cytokines include IL-2, IL-7, IL-15, IL-21, IL-12, IL-18, IL-9, erythropoietin (EPO), G-CSF, GM-CSF, thrombopoietin (TPO), and interferon (IFN) subfamily members.

  In some cases, the modified γδ T cells can be administered to a subject as a combination therapy. In some cases, the combination therapy includes a) modified γδ T cells of the present disclosure; and b) immune checkpoint therapy.

Modified γδ T cells
Modified γδ T cells can be generated in various ways known in the art. Modified γδ T cells can be designed to stably express a particular tumor recognition moiety. Transposon / transposase system, or virus-based gene transfer system such as lentivirus or retrovirus system, or another suitable method such as transfection, electroporation, transduction, lipofection, calcium phosphate (CaPO ₄ ), nano-processing Poly-encoding an expression cassette comprising a tumor recognition or another type of recognition moiety, such as by a substance such as viral delivery methods including adenoviruses, retroviruses, lentiviruses, adeno-associated viruses, or other suitable methods, such as ormosyl Nucleotides can be stably introduced into γδ T cells. Any of the antigen-specific TCR, αβ or γδ can be introduced into the modified γδ T cell by stably inserting a polynucleotide comprising the antigen-specific TCR gene code into the genome of the γδ T cell. A polynucleotide encoding CAR together with a tumor recognition moiety can be introduced into a modified γδ T cell by stably inserting the polynucleotide into the γδ T cell genome. In some cases, the modified tumor recognition moiety is a modified T cell receptor and the expression cassette integrated into the genome of the modified γδ T cell is a modified TCRα (TCRalpha) gene, a modified TCRβ (TCRbeta) gene, TCRδ (TCRdelta) It includes a gene or a polynucleotide encoding a modified TCRγ (TCRgamma) gene. In some cases, the expression cassette that is integrated into the genome of the modified γδ T cell comprises a polynucleotide encoding an antibody fragment or antigen binding portion thereof. In some cases, the antibody fragment or antigen-binding fragment thereof is a complete antibody, antibody fragment, single chain variable fragment (scFv), single domain antibody (sdAb), Fab, F (ab) ₂ , Fc, light on antibody. A chimeric antigen receptor comprising a CAR and a T cell receptor (TCR) in a chain or heavy chain, an antibody variable or constant region, or any combination thereof, or multiple CARs with antibodies directed to different antigens ( CAR) constructs, or polynucleotides encoding those that bind to cell surface tumor antigens as part of a bispecific construct. In some cases, the polynucleotide is from a human or another species. Antibody fragments derived from non-human species or antigen-binding fragment polynucleotides thereof can be modified to increase similarity to antibody variants naturally produced in humans, wherein the antibody fragment or antigen-binding fragment is partially or It can be fully humanized. The antibody fragment or antigen-binding fragment polynucleotide thereof may be a chimera, for example, a mouse-human antibody chimera. Modified γδ T cells that express CAR can also be modified to express a ligand for an antigen recognized by the tumor recognition moiety.

  Various techniques known in the art can be used to introduce a cloned or synthetically modified nucleic acid containing the genetic code of the tumor recognition portion into a specific location in the genome of the modified γδ T cell. RNA-derived Cas9 nuclease derived from the microbial clustering equidistant short palindrome (CRISPR) system described in WO201409370, WO2003087341, WO201434412, and WO2011090804, respectively, the entire contents of each of which are incorporated herein by reference. , Zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and meganuclease technology can be used to efficiently perform genomic modification in γδT cells. The techniques described herein can also be used to insert an expression cassette at a genomic location that results in the simultaneous knockout of one gene and the knockin of another gene. For example, a polynucleotide containing the expression cassette of the present disclosure can be inserted into the genomic region encoding the MHC gene. Such modification simultaneously results in the knock-in of one or more genes, such as a gene contained in an expression cassette, and the knock-out of another gene, such as an MHC locus.

  In some cases, a sleeping beauty transposon comprising a nucleic acid encoding a tumor recognition moiety is introduced into the modified γδ T cell. Polynucleotides using mutant sleeping beauty transposases that lead to improved integration compared to wild-type sleeping beauty, such as the transposase described in US 7,985,739 (incorporated herein by reference in its entirety) Can be introduced into modified γδ T cells.

  In some cases, viral methods are used to introduce a polynucleotide containing a tumor recognition moiety into the genome of the modified γδ T cell. Several viral methods have been used for human gene therapy, such as the method described in WO1993020221, which is incorporated herein in its entirety. Non-limiting examples of viral methods that can be used to modify γδT cells include retrovirus, adenovirus, lentivirus, herpes simplex virus, vaccinia virus, poxvirus, or adenovirus-associated virus methods.

  Polynucleotides comprising the genetic code of the tumor recognition portion may be modified γδT cells, or antigens specific to tumor cells, such as testis-specific cancer antigens, mutations or other transgenes that affect the growth, proliferation, activation state Can be included. The γδ T cells of the present disclosure can be modified to express a polynucleotide comprising an activation domain linked to an antigen recognition moiety, such as a molecule or costimulatory factor in the TCR-CD3 complex. Modified γδ T cells can express an intracellular signaling domain that is a T lymphocyte activation domain. γδT cells can be modified to express an intracellular activation domain gene or an intracellular signaling domain. Intracellular signaling domain genes include, for example, CD3ζ, CD28, CD2, ICOS, JAMAL, CD27, CD30, OX40, NKG2D, CD4, OX40 / CD134, 4-1BB / CD137, FcεRIγ, ILRB / CD122, IL-2RG / CD132, It can be a DAP molecule, CD70, cytokine receptor, CD40, or any combination thereof. In some cases, the modified γδ T cells are also modified to express cytokines, antigens, cell receptors, or other immunoregulatory molecules.

  Appropriate tumor recognition moieties expressed by the modified γδ T cells can be selected based on the disease to be treated. For example, in some cases, the tumor recognition moiety is a TCR. In some cases, the tumor recognition moiety is a receptor for a ligand expressed on cancer cells. Non-limiting examples of suitable receptors include NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1, and NKp80. In some cases, the tumor recognition moiety can include a ligand for a tumor antigen, such as an IL-13 ligand, or a ligand mimic, such as an IL-13 mimic for IL13R.

  γδ T cells are ligand binding domains derived from NKG2D, NKG2A, NKG2C, NKG2F, LLT1, AICL, CD26, NKRP1, NKp30, NKp44, NKp46, CD244 (2B4), DNAM-1, and NKp80, or anti-tumor antibodies, for example It can be modified to express a chimeric tumor recognition moiety including anti-Her2neu or anti-EGFR, and signaling domains derived from CD3-ζ, Dap10, CD28, 4 IBB, and CD40L. In some examples, the chimeric receptor is MICA, MICB, Her2neu, EGFR, mesothelin, CD38, CD20, CD19, PSA, RON, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), CEACAM5, CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP-1, STEAP-2, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK6, gp100, MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGEA family genes (eg MAGE3A, MAGE4A, etc.), It binds to KKLC1, mutant ras, βraf, p53, MHC class I chain related molecule A (MICA), or MHC class I chain related molecule B (MICB), HPV, CMV.

  In a γδ T cell, from a genetically different, substantially different, or substantially the same αβ TCR polynucleotide stably expressed from the modified γδ T cell, or from a genetically different αβ TCR polynucleotide stably introduced into the modified γδ T cell More than one tumor recognition moiety can be expressed. In the case of genetically different αβTCR (s), αβTCR (s) that recognize different antigens associated with the same pathology can be utilized. In a preferred embodiment, γδ T cells are modified to express different TCRs from human or mouse origin that recognize the same antigen in the context of different MHC haplotypes from one or more expression cassettes. In another preferred embodiment, γδ T cells are modified to express two or more antibodies directed to the same or different peptides from a given antigen complexed with one TCR and different MHC haplotypes. In some cases, expression of a single TCR by modified γδ T cells facilitates proper TCR pairing. Universal allogeneic modified γδ T cells can be obtained by modified γδ T cells expressing different TCRs. In a second preferred embodiment, γδ T cells are modified to express one or more different antibodies directed to peptide-MHC complexes, each antibody complexed with the same or different MHC haplotypes. Target the same or different peptides. In some cases, the tumor recognition moiety can be an antibody that binds to a peptide-MHC complex.

  γδ T cells can be modified from one or more expression cassettes to express TCRs that recognize the same antigen in the context of different MHC haplotypes. In some cases, the modified γδ T cells are designed to express a single TCR in the modified cell or to express a TCR with CAR to minimize the possibility of TCR mismatch. Tumor recognition moieties expressed from two or more expression cassettes preferably have different polynucleotide sequences and encode tumor recognition moieties that recognize different epitopes of the same target. Universal allogeneic modified γδ T cells can be obtained by such modified γδ T cells expressing different TCRs or CARs.

  In some cases, the γδ T cells are modified to express one or more tumor recognition moieties. Two or more tumor recognition moieties can be expressed from genetically identical or substantially identical antigen-specific chimeric (CAR) polynucleotides that are modified in γδT cells. Two or more tumor recognition moieties can be expressed from genetically distinct CAR polynucleotides that are modified in γδT cells. Genetically different CAR (s) can be designed to recognize different antigens associated with the same pathology.

  The γδ T cells may alternatively be bispecific. Bispecific engineered γδ T cells can express more than one tumor recognition moiety. Bispecific modified γδ T cells can express both TCR and CAR tumor recognition moieties. Bispecific modified γδ T cells can be designed to recognize different antigens associated with the same pathology. Modified γδ T cells can express two or more CAR / TCR (s) bispecific polynucleotides that recognize the same or substantially the same antigen. Modified γδ T cells can express two or more CAR / TCR (s) bispecific constructs that recognize different antigens. In some cases, the bispecific constructs of the present disclosure bind to the activation and inactivation domains of the target cell, resulting in increased target specificity. γδ T cells are at least one tumor recognition portion, at least two tumor recognition portions, at least three tumor recognition portions, at least four tumor recognition portions, at least five tumor recognition portions, at least six tumor recognition portions. A portion, at least 7 tumor recognition portions, at least 8 tumor recognition portions, at least 9 tumor recognition portions, at least 10 tumor recognition portions, at least 11 tumor recognition portions, at least 12 tumor recognition portions, Alternatively, it can be modified to express another suitable number of tumor recognition moieties.

  Appropriate TCR function can be enhanced by two functional ζ (zeta) proteins containing ITAM motifs. Appropriate TCR function is also enhanced by expression of αβ or γδ activation domains such as CD28, CD2, CTLA4, ICOS, JAMAL, PD-1, CD27, CD30, 41-BB, OX40, NKG2D, HVEM, or CD46. obtain. The expressed polynucleotide can include the genetic code of the tumor recognition portion, the linker portion, and the activation domain. Translation of polynucleotides by modified γδ T cells can yield tumor recognition moieties and activation domains linked by protein linkers. In many cases, the linker comprises amino acids that do not interfere with tumor recognition moieties and activation domain folding. The linker molecule is at least about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 12 amino acids, about 13 amino acids, about 14 amino acids, about 15 amino acids, about 16 The length can be about 17 amino acids, about 18 amino acids, about 19 amino acids, or about 20 amino acids. In some cases, at least 50%, at least 70%, or at least 90% of the amino acids in the linker are serine or glycine.

  In some cases, the activation domain can include one or more mutations. A suitable mutation may be, for example, a mutation that makes the activation domain a constitutively active form. Changing the identity of one or more nucleic acids changes the amino acid sequence of the translated amino acid. Nucleic acids can be mutated such that the encoded amino acid is modified to a polar, nonpolar, basic or acidic amino acid. Nucleic acids can be mutated so that the tumor recognition moiety is optimized for tumor-derived epitope recognition. The modified tumor recognition portion, modified activation domain, or another modified component of γδ T cell is 1 amino acid mutation, 2 amino acid mutation, 3 amino acid mutation, 4 amino acid mutation, 5 amino acid mutation, 6 amino acid mutation, 7 amino acid mutation, 8 amino acid mutation Mutation, 9 amino acid mutation, 10 amino acid mutation, 11 amino acid mutation, 12 amino acid mutation, 13 amino acid mutation, 14 amino acid mutation, 15 amino acid mutation, 16 amino acid mutation, 17 amino acid mutation, 18 amino acid mutation, 19 amino acid mutation, 20 amino acid mutation, 21 amino acid mutation, 22 amino acid mutation, 23 amino acid mutation, 24 amino acid mutation, 25 amino acid mutation, 26 amino acid mutation, 27 amino acid mutation, 28 amino acid mutation, 29 amino acid mutation, 30 amino acid mutation, 31 amino acid mutation, 32 amino acid mutation, 33 amino acid mutation Mutation, 34 amino Acid mutation, 35 amino acid mutation, 36 amino acid mutation, 37 amino acid mutation, 38 amino acid mutation, 39 amino acid mutation, 40 amino acid mutation, 41 amino acid mutation, 42 amino acid mutation, 43 amino acid mutation, 44 amino acid mutation, 45 amino acid mutation, 46 amino acid mutation 47 amino acid mutations, 48 amino acid mutations, 49 amino acid mutations, or more than 50 amino acid mutations.

In some cases, the γδ T cells of the present disclosure do not express one or more MHC molecules. Deletion of one or more MHC loci in the modified γδ T cells can reduce the likelihood that the modified γδ T cells will be recognized by the host immune system. The human major histocompatibility complex (MHC) locus, known as the human leukocyte antigen (HLA) system, comprises a large gene family that is expressed in antigen presenting cells, including γδ T cells. HLA-A, HLA-B, and HLA-C molecules function to present intracellular peptides as antigens to antigen-presenting cells. HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA DR molecules function to present extracellular peptides as antigens to antigen presenting cells. Several alleles of the HLA gene have been associated with GVHD, autoimmune disorders, and cancer. The modified γδ T cells described herein can be further modified to lack or disrupt gene expression of one or more HLA genes. The modified γδ T cells described herein can be further modified to lack or disrupt gene expression of one or more components of the MHC complex, eg, one or more complete deficiencies of the MHC gene. loss, and the like deletion of deletion of a particular exon or beta ₂ microglobulin, (B2m). Gene removal or gene disruption of at least one HLA gene can yield clinical therapeutic γδ T cells that can be administered to subjects of any HLA haplotype without causing host versus graft disease. The modified γδ T cells described herein can be a universal donor for human subjects of any HLA haplotype.

  Γδ T cells can be modified to lack one or various HLA locus (s). Modified γδ T cells can be modified to lack the HLA-A allele, HLA-B allele, HLA-C allele, HLA-DR allele, HLA-DQ allele, or HLA-DP allele. In some cases, HLA alleles are associated with human pathologies, such as autoimmune diseases. For example, the HLA-B27 allele is associated with arthritis and uveitis, the HLA-DR2 allele is associated with systemic lupus erythematosus, the HLA-DR3 allele is associated with 21 hydroxylase deficiency, and HLA-DR4 is Associated with rheumatism and type 1 diabetes. For example, modified γδ T cells lacking the HLA-B27 allele can be administered to a subject suffering from arthritis without being easily recognized by the subject's immune system. In some cases, deletion of one or more HLA loci results in modified γδ T cells that are universal donors for any subject with any HLA haplotype.

  In some cases, modification of γδ T cells requires deletion of a portion of the γδ T cell genome. In some cases, the portion of the genome to be deleted includes a portion of the MHC locus (s). In some cases, the modified γδ T cells are derived from wild type human γδ T cells and the MHC locus is an HLA locus. In some cases, the deleted portion of the genome includes a portion of the gene corresponding to a portion in the MHC complex. In some cases, the portion of the genome to be deleted comprises a β2 microglobulin gene. In some cases, the deleted portion of the genome is an immune checkpoint gene such as PD-1, CTLA-4, LAG3, ICOS, BTLA, KIR, TIM3, A2aR, B7-H3, B7-H4, and CECAM-1. including. In some cases, modified γδ T cells can be designed to express activation domains that enhance T cell activation and cytotoxicity. Non-limiting examples of activation domains that can be expressed by modified γδ T cells include CD2, ICOS, 4-1 BB (CD137), OX40 (CD134), CD27, CD70, CD80, CD86, DAP, CD122, GITR, FceRIg.

  Any portion of the modified γδ T cell genome can be deleted to disrupt the expression of the endogenous γδ T cell gene. Non-limiting examples of genomic regions that can be deleted or destroyed in the γδ T cell genome include promoters, activators, enhancers, exons, introns, noncoding RNAs, microRNAs, small nuclear RNAs, variable number tandem repeats ( VNTR), short tandem repeat (STR), SNP pattern, hypervariable region, minisatellite, dinucleotide repeat, trinucleotide repeat, tetranucleotide repeat or simple repeat sequence. In some cases, the deleted portion of the genome is from 1 nucleic acid to about 10 nucleic acids, 1 nucleic acid to about 100 nucleic acids, 1 nucleic acid to about 1,000 nucleic acids, 1 nucleic acid to about 10,000 nucleic acids, 1 nucleic acid to about 100,000 nucleic acids. Range from 1 nucleic acid to about 1,000,000 nucleic acids, or other suitable range.

  HLA gene expression in modified γδ T cells can also be disrupted by various techniques known in the art. In some cases, gene editing techniques for large loci are used to remove genes from the modified γδ T cell genome, or to disrupt gene expression of at least one HLA locus in the modified γδ T cells. Non-limiting examples of gene editing techniques that can be used to edit desired loci on the genome of modified γδ T cells include clustered equidistant short palindromic sequences (CRISPR) -Cas, zinc finger nuclease (ZFN) ), Transcription activator-like effector nuclease (TALEN), and meganuclease technology, which are described in WO201409370, WO2003088731, WO2014134412, and WO2011090804, respectively, the entire contents of each of which are incorporated herein by reference. Incorporate.

  Modified γδ T cells can be modified from isolated unmodified γδ T cells already expressing a tumor recognition moiety. The modified γδ T cells can leave a tumor cell recognition moiety that is endogenously expressed by the isolated wild type γδ T cells. In some cases, the wild type γδTCR is replaced with a modified γδT cell tumor cell recognition moiety.

  γδ T cells can be modified to express one or more homing molecules, such as lymphocyte homing molecules. The homing molecule can be, for example, a lymphocyte homing receptor or a cell adhesion molecule. The homing molecule can help the modified γδ T cells migrate and infiltrate the solid tumor, including the target solid tumor, when the modified γδ T cells are administered to the subject. Non-limiting examples of homing receptors include CCR family members such as CCR2, CCR4, CCR7, CCR8, CCR9, CCR10, CLA, CD44, CD103, CD62L, E-selectin, P-selectin, L-selectin, integrin, Examples include VLA-4 and LFA-1. Non-limiting examples of cell adhesion molecules include ICAM, N-CAM, VCAM, PE-CAML1-CAM, Nectin (PVRL1, PVRL2, PVRL3), LFA-1, integrin αXβ2, αVβ7, macrophage 1 antigen, CLA-4, Examples include glycoprotein IIb / IIIa. Other examples of cell adhesion molecules include antibodies to calcium-dependent molecules such as T-cadherin and matrix metalloproteinases (MMPs) such as MMP9 or MMP2.

  Steps involved in T cell maturation, activation, proliferation and function can be regulated via costimulatory and inhibitory signals by immune checkpoint proteins. Immune checkpoints are costimulatory and inhibitory elements inherent in the immune system. Immune checkpoints maintain self-tolerance and regulate the duration and intensity of the physiological immune response to prevent injury to the tissue when the immune system responds to a medical condition, such as cell malignant transformation or infection. Useful. The balance between costimulatory and inhibitory signals used to control the immune response from either γδ and αβ T cells can be regulated by immune checkpoint proteins. Immune checkpoint proteins such as PD1 and CTLA4 are present on the surface of T cells and can be used to switch the immune response “on” or “off”. Tumors can dysregulate checkpoint protein function, particularly as an immune resistance mechanism against T cells that are specific for tumor antigens. The modified γδ T cells of the present disclosure may include one or more immune checkpoint locus (s), such as PD-1, CTLA-4, LAG3, ICOS, BTLA, KIR, TIM3, A2aR, CECAM-1, B7-H3. , And B7-H4 and the like can be further modified. Alternatively, the expression of endogenous immune checkpoints in the modified γδT cells of the present disclosure can be disrupted by gene editing techniques.

  An immune checkpoint is a molecule that modulates an inhibitory signaling pathway (exemplified by CTLA4, PD1, and LAG3) or a molecule that modulates a stimulatory signaling pathway (exemplified by ICOS) in the modified γδ T cells of the present disclosure obtain. Several proteins of the broad immunoglobulin superfamily can be ligands for immune checkpoints. Non-limiting examples of immune checkpoint ligand proteins include B7-H4, ICOSL, PD-L1, PD-L2, MegaCD40L, MegaOX40L, and CD137L. In some cases, the immune checkpoint ligand protein is an antigen expressed by the tumor. In some cases, the immune checkpoint gene is a CTLA-4 gene. In some cases, the immune checkpoint gene is the PD-1 gene.

  PD1 is an inhibitory receptor belonging to the CD28 / CTLA4 family and is expressed on activated T lymphocytes, B cells, monocytes, DCs, and T-regs. Two ligands PD-L1 and PD-L2 are known for PD1, are expressed on T cells, APCs and malignant cells, suppress autoreactive lymphocytes, and TAA-specific cytotoxic T lymphocytes Functions to inhibit the effector function of the sphere (CTL). Therefore, modified γδT cells lacking PD1 can retain cytotoxic activity regardless of the expression of PD-L1 and PD-L2 by tumor cells. In some cases, the modified γδ T cells of the present disclosure lack the PD-1 gene locus. In some cases, the expression of the PD-1 gene in modified γδ T cells is disrupted by gene editing techniques.

CTLA4 (cytotoxic T lymphocyte antigen 4) is also known as CD152 (differentiation antigen group 152). CTLA4 shares sequence homology and ligands (CD80 / B7-1 and CD86 / B7-2) with costimulatory molecule CD28, but differs by delivering an inhibitory signal to T cells expressing CTLA4 as a receptor . CTLA4 has a much higher overall affinity for both ligands than CD28 for binding when ligand density is limited. CTLA4 is often expressed on the surface of CD8 ⁺ effector-T cells and plays a functional role in the early activation stage of naive and memory T cells. In the early stages of T cell activation, CTLA4 counteracts the activity of CD28 with a high affinity for CD80 and CD86. Major functions of CTLA4 include downregulation of helper T cells and enhancement of regulatory T cell immunosuppressive activity. In some cases, the modified γδ T cells of the present disclosure lack the CTLA4 gene. In some cases, the expression of the CTLA4 gene in modified γδ T cells is disrupted by genetic editing techniques.

LAG3 (Lymphocyte activating gene 3) is expressed on activated antigen-specific cytotoxic T cells, enhances the function of regulatory T cells and independently inhibits CD8 ⁺ effector-T cell activity Can do. LAG3 is a CD-4-like negative regulatory protein with high affinity that binds to MHC class II proteins and is upregulated in several epithelial cancers, leading to tolerance of T cell proliferation and homeostasis. Reduction of LAG-3 / Class II interaction using LAG-3-IG fusion protein can enhance the anti-tumor immune response. In some cases, the modified γδ T cells of the present disclosure lack the LAG3 gene locus. In some cases, the expression of the LAG3 gene in modified γδ T cells is disrupted by genetic editing techniques.

Modified γδ T Cell Phenotypes Modified γδ T cells can home to a specific physical site within a subject's body. Modified γδ T cell migration and homing may depend on a combination of expression and action of specific chemokines and / or adhesion molecules. Modified γδ T cell homing can be controlled by the interaction between the chemokine and its receptor. For example, but not limited to CXCR3 (its ligands are represented by IP-10 / CXCL10 and 6Ckine / SLC / CCL21) CCR4 + CXCR5 + (receptors for RANTES, MIP-1α, MIP-1β) including CCR6 + and CCR7 Cytokines can affect homing of modified γδ T cells. In some cases, modified γδ T cells may home to sites of inflammation and injury, as well as diseased cells to repair function. In some cases, the modified γδ T cells can home to cancer. In some cases, the modified γδ T cells are thymus, bone marrow, skin, larynx, trachea, pleura, lung, esophagus, abdomen, stomach, small intestine, large intestine, liver, pancreas, kidney, urethra, bladder, testis, prostate, vas deferens, ovary The uterus, mammary gland, parathyroid gland, spleen or other site within the subject's body may be homed. Modified γδ T cells can express one or more homing moieties, such as specific TCR alleles and / or lymphocyte homing molecules.

  Modified γδ T cells may have a specific phenotype, which can be described in terms of cell surface marker expression. Various types of γδ T cells can be modified as described herein. In preferred embodiments, the modified γδ T cells are derived from humans, but the modified γδ T cells may be derived from different sources, such as mammals or synthetic cells.

Antigens The invention disclosed herein provides modified γδ T cells that express an antigen recognition moiety that recognizes a disease-specific epitope. An antigen can be a molecule that elicits an immune response. This immune response may involve either antibody production, activation of specific immunocompetent cells, or both. The antigen can be, for example, a peptide, protein, hapten, lipid, carbohydrate, bacterium, pathogen, or virus. The antigen can be a tumor antigen. Tumor epitopes can be presented on the surface of tumor cells by MHC I or MHC II complexes. An epitope can be part of an antigen that is expressed on the cell surface and recognized by a tumor recognition moiety.

  Non-limiting examples of antigens recognized by modified γδ T cells include CD-19, CD-30, CD-22, CD37, CD38, CD-33, CD-138, CD-123, CD-79b, CD-70. , CD-75, CA6, GD2, α-fetoprotein, carcinoembryonic antigen, CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77 , Fibroblast activation protein, PSMA, STEAP-1, STEAP-2, mesothelin, c-met, CSPG4, Nectin4, VEGFR2, PSCA, folate binding protein receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R , IL-3R, SLTRK6, gp100, MART , Tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen, MAGEA, KKLC1, mutated ras, Betaraf, include different antigens associated with p53, MICA and MICB or condition. Revised list of CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), RON, CEACAM5 CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP-1, STEAP-2, Mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, Folate binding protein / receptor, SLC44A4, Crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK6, gp 00, MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGEA family gene (eg MAGE3A, MAGE4A, etc.), KKLC1, mutant ras, βraf, p53, MHC class I chain related molecule A (MICA ), Or MHC class I chain related molecule B (MICB), HPV, CMV.

  The antigen may be expressed in the intracellular or extracellular compartment of the cell, and the modified γδ T cells can recognize intracellular or extracellular tumor antigens. In some cases, αβTCR in modified γδT cells recognizes peptides derived from either intracellular or extracellular tumor antigens. For example, the antigen can be a protein produced intracellularly or extracellularly by cells infected with the virus, such as HIV, EBV, CMV, or HPV proteins. The antigen may be a protein expressed intracellularly or extracellularly by cancer cells.

  The antigen recognition moiety can recognize an antigen derived from a cell in a dangerous state, such as a cancer cell or a cell infected with a virus. For example, human MHC class I chain related genes (MICA and MICB) are located in the HLA class I region of chromosome 6. MICA and MICB proteins are believed to be markers of “stress” in the human epithelium and function as ligands for cells expressing the common natural killer cell receptor (NKG2D). As stress markers, MICA and MICB can be highly expressed from cancer cells. Modified γδ T cells can recognize MICA or MICB tumor epitopes.

  The tumor recognition portion can be modified to recognize the antigen with a certain avidity. For example, a tumor recognition moiety encoded by a TCR or CAR construct has at least 10 fM, at least 100 fM, at least 1 picomolar (pM), at least 10 pM, at least 20 pM, at least 30 pM, at least 40 pM, at least 50 pM, at least 60 pM, at least 7 pM, At least 80 pM, at least 90 pM, at least 100 pM, at least 200 pM, at least 300 pM, at least 400 pM, at least 500 pM, at least 600 pM, at least 700 pM, at least 800 pM, at least 900 pM, at least 1 nanomolar (nM), at least 2 nM, at least 3 nM, at least 4 nM, at least 5nM, at least 6nM, at least 7nM, low At least 8 nM, at least 9 nM, at least 10 nM, at least 20 nM, at least 30 nM, at least 40 nM, at least 50 nM, at least 60 nM, at least 70 nM, at least 80 nM, at least 90 nM, at least 100 nM, at least 200 nM, at least 300 nM, at least 400 nM, at least 500 nM, at least 600 nM At least 700 nM, at least 800 nM, at least 900 nM, at least 1 μM, at least 2 μM, at least 3 μM, at least 4 μM, at least 5 μM, at least 6 μM, at least 7 μM, at least 8 μM, at least 9 μM, at least 10 μM, at least 20 μM, at least 30 μM, at least 40 μM, at least 50μM, a little Both 60 [mu] M, at least 70 [mu] M, at least 80 microM, may recognize antigen with a dissociation constant of at least 90μM, or at least 100 [mu] M,.

  In some cases, the tumor recognition moiety is at most 10 fM, at most 100 fM, at most 1 picomolar (pM), at most 10 pM, at most 20 pM, at most 30 pM, at most 40 pM, at most 50 pM, at most 60 pM, at most 7 pM, at most 80 pM, at most 90 pM, at most 100 pM, at most 200 pM, at most 300 pM, at most 400 pM, at most 500 pM, at most 600 pM, at most 700 pM, at most 800 pM, at most 900 pM, at most 1 Nanomolar (nM), at most 2 nM, at most 3 nM, at most 4 nM, at most 5 nM, at most 6 nM, at most 7 nM, at most 8 nM, at most 9 nM, at most 10 nM, at most 20 nM, at most 30 nM, at most Both 4 nM, at most 50 nM, at most 60 nM, at most 70 nM, at most 80 nM, at most 90 nM, at most 100 nM, at most 200 nM, at most 300 nM, at most 400 nM, at most 500 nM, at most 600 nM, at most 700 nM, At most 800 nM, at most 900 nM, at most 1 μM, at most 2 μM, at most 3 μM, at most 4 μM, at most 5 μM, at most 6 μM, at most 7 μM, at most 8 μM, at most 9 μM, at most 10 μM, at most It can be modified to recognize an antigen with a dissociation constant of 20 μM, at most 30 μM, at most 40 μM, at most 50 μM, at most 60 μM, at most 70 μM, at most 80 μM, at most 90 μM, or at most 100 μM.

Isolation of γδ T Cells In some embodiments, the present disclosure provides a method for genetic modification of γδ T cells isolated from a subject. γδ T cells can be isolated from a composite sample of a subject. The composite sample may be a peripheral blood sample, umbilical cord blood sample, tumor, stem cell precursor, tumor biopsy, tissue, lymph, or from a subject's epithelial site in direct contact with the external environment, or It may be derived from stem progenitor cells. γδ T cells can be isolated directly from a composite sample of a subject, for example by sorting γδ T cell (s) expressing one or more cell surface markers by flow cytometry. Wild-type γδT cells exhibit numerous antigen recognition, antigen presentation, costimulation, and adhesion molecules that can be associated with γδT cell (s). One or more cell surface markers, such as a specific γδ TCR, antigen recognition, antigen presentation, ligand, adhesion molecule, or costimulatory molecule, can be used to isolate wild type γδ T cells from the composite sample. Various molecules associated with or expressed by γδT cells can be used to isolate γδT cells from a composite sample. In some cases, the present disclosure provides methods for the isolation of a mixed population of Vδ1 ⁺ , Vδ2 ⁺ , Vδ3 ⁺ cells, or any combination thereof.

  Peripheral blood mononuclear cells can be collected from a subject with an apheresis machine, such as, for example, a Ficoll-Paque ™ PLUS (GE Healthcare) system, or another suitable device / system. The γδ T cell (s), or a desired subpopulation of γδ T cell (s), can be purified from the collected sample, for example, by flow cytometry. Umbilical cord blood cells can also be obtained from umbilical cord blood during the birth of the subject.

  Using a positive and / or negative selection of cell surface markers expressed on the collected γδ T cell (s), the subject's peripheral blood sample, umbilical cord blood sample, tumor, tumor biopsy, tissue, lymph, or A population of γδ T cells or γδ T cells expressing similar cell surface markers can be directly isolated from the epithelial sample. For example, CD2, CD3, CD4, CD8, CD24, CD25, CD44, Kit, TCRα, TCRβ, TCRγ, TCRδ, NKG2D, CD70, CD27, CD30, CD16, CD337 (NKp30), CD336 (NKp46), OX40, CD46, Γδ T cells can be isolated from composite samples based on positive or negative expression of CCR7, and other suitable cell surface markers.

  γδT cells can be isolated from complex samples cultured in vitro. In some embodiments, the entire PBMC population can be activated and expanded without prior removal of specific cell populations such as monocytes, αβ T cells, B cells, and NK cells. In other embodiments, the enriched γδ T cell population can be generated prior to its specific activation and proliferation. In some embodiments, γδ T cell activation and proliferation is performed in the absence of native or modified APC. In some embodiments, isolation and expansion of γδ T cells from tumor samples uses immobilized γδ T cell mitogens, including antibodies specific for γδ TCR, and other γδ TCR activators including lectins. Can be done.

In some embodiments, the γδ T cell (s) can proliferate rapidly in response to contact with one or more antigens. Some γδT cell (s), such as Vγ9Vδ2 ⁺ γγT cell (s), are contacted with several antigens such as prenyl pyrophosphate, alkylamines, and metabolites or microbial extracts during tissue culture. Proliferates rapidly in vitro in response to In addition, some wild type γδ T cell (s), such as Vγ2Vδ2 ⁺ γδT cell (s), etc., rapidly proliferate in the human body in response to a particular type of vaccination (s). Stimulated γδ T cells can exhibit multiple antigen presentation, costimulation, and adhesion molecules that can facilitate the isolation of γδ T cell (s) from the composite sample. The γδ T cell (s) in the composite sample may be stimulated with at least one antigen in vitro for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or another suitable period. Can do. Stimulation of γδ T cells with a suitable antigen can expand the γδ T cell population in vitro.

  Non-limiting examples of antigens that can be used to stimulate the growth of γδ T cell (s) from a composite sample in vitro include prenyl pyrophosphate, eg, isopentenyl pyrophosphate (IPP), alkylamines, human microbial pathogens Metabolites, metabolite of symbiotic bacteria, methyl-3-butenyl-1-pyrophosphate (2M3B1PP), (E) -4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), ethyl Pyrophosphate (EPP), farnesyl pyrophosphate (FPP), dimethylallyl phosphate (DMAP), dimethylallyl pyrophosphate (DMAP), ethyl adenosine triphosphate (EPPPA), geranyl pyrophosphate (GPP), geranylgeranyl pyrophosphate (GGPP) ), Isopentenyl-adenosine triphosphate (IPPPA) Monoethyl phosphate (MEP), monoethyl pyrophosphate (MEPP), 3-formyl-1-butyl-pyrophosphate (TUBAg1), X-pyrophosphate (TUBAg2), 3-formyl-1-butyl-uridine triphosphate ( TUBAg3), 3-formyl-1-butyl-deoxythymidine triphosphate (TUBAg4), monoethylalkylamine, allyl pyrophosphate, crotoyl pyrophosphate, dimethylallyl-γ-uridine triphosphate, crotoyl -Γ-uridine triphosphate, allyl-γ-uridine triphosphate, ethylamine, isobutylamine, sec-butylamine, isoamylamine and nitrogen-containing bisphosphonates.

Activation and proliferation of γδ T cells can be performed using the activation and costimulatory agents described herein that induce specific γδ T cell proliferation and persistence populations. In some embodiments, different clones or mixed polyclonal population subsets can be obtained by activation and expansion of γδ T cells from different cultures. In some embodiments, different agonist agents can be used to identify agents that produce a particular γδ activation signal. In one aspect, the agent that provides a particular γδ activation signal can be a different monoclonal antibody (MAb) directed against γδTCR. In one embodiment, the MAb can bind to a different epitope on the constant or variable region of γTCR and / or δTCR. In one aspect, the MAb can comprise a pan γδTCR MAb. In one aspect, the pan-γδTCR MAb may recognize domains shared by different γ and δTCRs in both δ1 and δ2 cell populations. In one embodiment, the antibody is 5A6. It can be E9 (Thermo scientific), B1 (Biolegend), IMMU510 and / or 11F12 (Beckman Coulter). In one embodiment, the MAb is a specific domain specific to the variable region of the γ chain (7A5 Mab (Thermo Scientific # TCR1720) targeting Vγ9 TCR, etc.) or a domain on the Vδ1 variable region (Mab TS8.2 (Thermo). scientific # TCR1730; MAb TC1, MAb R9.12 (Beckman Coulter)), or Vδ2 chain (MAb 15D (Thermo Scientific # TCR1732)), which may be targeted to a single population Vδ1 or Vδ2 cell subset. The ability to specifically activate and proliferate was tested (FIG. 4), which shows that serum-containing medium (R2: RPMI + 10% FBS) and serum-free medium (AIMV + bovine albumin; CTS serum-free supplement) All media contain 100 IU / mL IL-2, 2 mM glutamine and 1 × penicillin / streptomycin, 1, 5 on day 0. 1. δ2T cell growth in CTS Optimizer serum-free medium containing Cells were stimulated with 20 μM zoledronic acid, medium supplemented every 2-3 days without further addition of zoledronic acid, total δ2 T cells grown from 10 ⁶ PBMC after 13 days, and proliferation fold are shown for each condition. In some embodiments, combining antibodies against different domains of γδTCR (antibodies that recognize specific variable region epitopes on the pan antibody and subset population) to assess their ability to enhance activation of γδT cells In some embodiments, the γδ T cell activator includes γδT. There may be mentioned R-binding agents, eg agonist antibodies to NKG2D, such as MICA, MICA (Fc tag) fusion proteins, ULBP1, ULBP3 (R & D systems Minneapolis, MN) ULBP2, or ULBP6 (Sino Biological Beijing, China). In such embodiments, concomitant costimulators can be identified that assist in the induction of specific γδ T cell proliferation without causing cellular anergy and apoptosis, such as receptors expressed on γδ cells. Bodies such as NKG2D, CD161, CD70, JAML, DNAX accessory molecule 1 (DNAM-1) ICOS, CD27, CD137, CD30, HVEM, SLAM, CD122, DAP, and C A ligand for D28- and the like can be mentioned. In some embodiments, the costimulatory agent can be an antibody specific for a unique epitope on CD2 and CD3 molecules. CD2 and CD3 can have different conformational structures when expressed on αβ or γδ T cell (s), and in some cases, specific antibodies against CD3 and CD2 result in different activation of γδ T cells Can do.

  A population of γδ T cell (s) may be expanded ex vivo before modification of γδ T cell (s). Non-limiting examples of reagents that can be used to promote the growth of γδ T cell populations in vitro include anti-CD3 or anti-CD2, anti-CD27, anti-CD30, anti-CD70, anti-OX40 antibodies, IL-2, IL- 15, IL-12, IL-9, IL-33, IL-18, or IL-21, CD70 (CD27 ligand), phytohemaglutinin (PHA), concavalin A (ConA), pork weed (PWM) ), Protein peanut agglutinin (PNA), soy agglutinin (SBA), Les Culinaris agglutinin (LCA), Pisum Sativum agglutinin (PSA), Helix pomatia agglutinin (HPA), Vicia graminea lectin (VGA), Others include another preferred mitogen capable stimulate T cell proliferation. Genetic modification of γδ T cell (s) includes tumor recognition moieties such as CAR encoding αβTCR, γδTCR, antibodies, antigen binding fragments thereof, or lymphocyte activation domains, ex vivo and in vivo T cell proliferation, survival, And cytokines that improve function (IL-15, IL-12, IL-2, IL-7, IL-21, IL-18, IL-19, IL-33, IL-4, IL-9, IL-23 , IL1β) can be stably integrated into the genome of the isolated γδ T cell (s). The genetic modification of the isolated γδ T cell may further comprise removing or destroying gene expression from one or more endogenous genes in the genome of the isolated γδ T cell, such as the MHC locus (s). .

In another aspect, the present disclosure provides a method for ex vivo expansion of a modified γδ T cell population for adoptive transfer therapy. The modified γδ T cells of the present disclosure can be expanded ex vivo. The modified γδ T cells of the present disclosure can be grown in vitro without activation by APC or without co-culture with APC and aminophosphate.

The methods of the present invention can expand various γδ T cell (s) populations, such as Vγ1 ⁺ , Vγ2 ⁺ , Vγ3 ⁺ γδ T cell populations. In some cases, less than 36 days, less than 35 days, less than 34 days, less than 33 days, less than 32 days, less than 31 days, less than 30 days, less than 29 days, less than 28 days, less than 27 days, less than 26 days, less than 25 days Less than 24 days less than 23 days less than 22 days less than 21 days less than 20 days less than 19 days less than 18 days less than 17 days less than 16 days less than 15 days less than 14 days less than 13 days <12 days, <11 days, <10 days, <9 days, <8 days, <7 days, <6 days, <5 days, <4 days, <3 days, γδ T cell population can be expanded in vitro .

  In some embodiments, methods are provided for growing various γδ T cells, including modified and unmodified γδ T cells, by contacting the γδ T cells with an activator. In some cases, the activator binds to a specific epitope on the cell surface receptor of γδ T cells. The activator can be an antibody, such as a monoclonal antibody. An activator can specifically activate the growth of one or more γδ T cells, eg, a δ1, δ2, or δ3 cell population. In some embodiments, the activator specifically activates the growth of the δ1 cell population. In other cases, the activator specifically activates the growth of the δ2 cell population.

  Activators can stimulate the proliferation of modified and unmodified γδ T cells at a fast growth rate. For example, one cell division in less than 30 hours, one cell division in less than 29 hours, one cell division in less than 28 hours, one cell division in less than 27 hours, one cell in less than 26 hours Division, cell division once in less than 25 hours, cell division once in less than 24 hours, cell division in less than 23 hours, cell division in less than 22 hours, cell in less than 21 hours Division, cell division once in less than 20 hours, cell division once in less than 19 hours, cell division in less than 18 hours, cell division in less than 17 hours, cell in less than 16 hours Division, cell division once in less than 15 hours, cell division once in less than 14 hours, cell division in less than 13 hours, cell division in less than 12 hours, cell in less than 11 hours Division, cell division once every 10 hours, cell division once every 9 hours, 1 cell division in less than 1 hour, 1 cell division in less than 7 hours, 1 cell division in less than 6 hours, 1 cell division in less than 5 hours, 1 cell division in less than 4 hours, 3 An agent that stimulates the proliferation of a γδ T cell population at an average rate of cell division once in less than 2 hours and once in less than 2 hours.

  In some cases, the activator may have an average rate of about 1 split every about 4 hours, an average rate of about 1 split every about 5 hours, an average rate of about 1 split every about 6 hours. Average rate of about 1 split every about 7 hours, average rate of about 1 split every about 8 hours, average rate of about 1 split every about 9 hours, about 1 every about 10 hours Average rate of about 1 split every about 11 hours, average rate of about 1 split every about 12 hours, average rate of about 1 split every about 13 hours, Average rate of about 1 split every 14 hours, average rate of about 1 split every about 15 hours, average rate of about 1 split every about 16 hours, about once every about 17 hours Average rate of division, average rate of about 1 split every about 18 hours, average rate of about 1 split every about 19 hours, about 20 hours Average rate of about 1 split every about 21 hours, average rate of about 1 split every about 21 hours, rate of about 1 split every about 22 hours, rate of about 1 split every about 23 hours Average rate of about 1 split every about 24 hours, average rate of about 1 split every about 25 hours, average rate of about 1 split every about 26 hours, about 1 every about 27 hours Average rate of splitting, rate of about 1 split every about 28 hours, rate of about 1 split every about 29 hours, average rate of about 1 split every about 30 hours, about 31 hours The average rate of about 1 split every about 32 hours, the average rate of about 1 split every about 32 hours, the average rate of about 1 split every about 33 hours, the rate of about 1 split every about 34 hours Modified and unmodified γδT cells at a rate of about 1 split every about 35 hours and an average rate of about 1 split every about 36 hours It can stimulate growth.

  Activators can stimulate the growth of subpopulations of modified and unmodified γδ T cells at different growth rates. For example, the agent is 10-fold, 100-fold, 200-fold, 300-fold, 400-fold over a 1-90 day culture period than another γδ T cell population, such as a δ2 or δ3 population or another γδ subpopulation. , Δ1 cell population at a rapid rate that results in over 500, 600, 700, 800, 900, 1,000, 10,000, 100,000, or 1,000,000 times proliferation Can stimulate growth. In other cases, the agent is 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold over a 1-90 day culture period, such as a δ1 T cell population or another γδ T cell subpopulation, Growth of δ2 or δ3 populations at such a high rate that proliferation is over 600, 700, 800, 900, 1,000, 10,000, 100,000, or 1,000,000. Can irritate. In other cases, the agent is 10-fold, 100-fold, 200-fold, 300-fold, 400-fold over a 1-90 day culture period, such as a δ1 T cell population, δ3 T cell population, or another γδ T cell subpopulation, etc. Of δ2 populations at such a high rate that the growth is over 500, 600, 700, 800, 900, 1,000, 10,000, 100,000, or 1,000,000. Can stimulate growth.

  In some embodiments, the disclosure provides for a γδ T cell population by an agent that stimulates the growth of the γδ T cell population at a rapid rate, such as a rate of about one cell division per hour or faster. Provides a population of γδ T cells in which the proliferation of is activated. In some cases, the agent selectively stimulates proliferation of either δ1, δ2, or δ3 T cells. The γδ T cell population can include an amount of unmodified γδ T cells and an amount of modified γδ T cells. In some cases, the γδ T cell population comprises different percentages of δ1, δ2, and δ3 T cells. A modified or unmodified γδ T cell population is, for example, less than 90% δ1T cells, less than 80% δ1T cells, less than 70% δ1T cells, less than 60% δ1T cells, less than 50% δ1T cells, less than 40% δ1T. Cells, less than 30% δ1T cells, less than 20% δ1T cells, less than 10% δ1T cells, or less than 5% δ1T cells. Alternatively, the modified or unmodified γδ T cell population is greater than 5% δ1T cells, greater than 10% δ1T cells, greater than 20% δ1T cells, greater than 30% δ1T cells, greater than 40% δ1T cells, greater than 50%. It can include δ1 T cells, more than 60% δ1 T cells, more than 70% δ1 T cells, more than 80% δ1 T cells, or more than 90% δ1 T cells.

  A modified or unmodified γδ T cell population is, for example, less than 90% δ2T cells, less than 80% δ2T cells, less than 70% δ2T cells, less than 60% δ2T cells, less than 50% δ2T cells, less than 40% δ2T. Cells, less than 30% δ2T cells, less than 20% δ2T cells, less than 10% δ2T cells, or less than 5% δ2T cells. Alternatively, a modified or unmodified γδT cell population is greater than 5% δ2T cells, greater than 10% δ2T cells, greater than 20% δ2T cells, greater than 30% δ2T cells, greater than 40% δ2T cells, greater than 50%. It can include δ2T cells, greater than 60% δ2T cells, greater than 70% δ2T cells, greater than 80% δ2T cells, or greater than 90% δ2T cells.

  A modified or unmodified γδ T cell population is, for example, less than 90% δ3T cells, less than 80% δ3T cells, less than 70% δ3T cells, less than 60% δ3T cells, less than 50% δ3T cells, less than 40% δ3T. Cells, less than 30% δ3T cells, less than 20% δ3T cells, less than 10% δ3T cells, or less than 5% δ3T cells. Alternatively, a modified or unmodified γδT cell population is greater than 5% δ3T cells, greater than 10% δ3T cells, greater than 20% δ3T cells, greater than 30% δ3T cells, greater than 40% δ3T cells, greater than 50%. It can comprise δ3T cells, greater than 60% δ3T cells, greater than 70% δ3T cells, greater than 80% δ3T cells, or greater than 90% δ3T cells.

  One or more activators can be contacted with the γδ T cells, and then the costimulatory molecule can be contacted with the γδ T cells to provide further stimulation and allow the γδ T cells to proliferate. In some embodiments, the activator and / or costimulatory agent can be a lectin of plant and non-plant origin, a monoclonal antibody that activates γδ T cells, and a non-lectin / non-antibody agent. In other cases, the plant lectin can be concanavalin A (ConA), but other plant lectins such as phytohemagglutinin (PHA) may be used. Other examples of lectins include the proteins peanut agglutinin (PNA), soy agglutinin (SBA), les culinaris agglutinin (LCA), psum sativum agglutinin (PSA), Helix pomatia agglutinin (HPA), and Vicia gramineGA lectin. Can be mentioned.

  Non-limiting examples of activators and costimulatory molecules include 5A6. Examples include antibodies such as E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, 11F2, or combinations thereof. Other examples of activators and costimulatory molecules include zoledronate, phorbol 12-myristate 13-acetate (TPA), mezerein, staphylococcal enterotoxin A (SEA), streptococcal protein A, or combinations thereof. .

  In other cases, the activator and / or costimulatory agent is αTCR, βTCR, γTCR, δTCR, CD277, CD28, CD46, CTLA4, ICOS, PD-1, CD30, NKG2D, NKG2A, HVEM, 4-1 BB (CD137), OX40 (CD134), CD70, CD80, CD86, DAP, CD122, GITR, FceRIg, CD1, CD16, CD161, DNAX, accessory molecule 1 (DNAM-1), SLAM, coxsackievirus and antibodies against adenovirus receptors Alternatively, it can be a ligand or a combination thereof.

Epitope Identification In one aspect, the present disclosure provides a method for identifying epitopes of agents that stimulate proliferation of modified and unmodified γδ T cells at a fast growth rate. The epitope comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids with a unique spatial structure Can do. An epitope can be formed from both contiguous amino acids or non-adjacent amino acids arranged by protein tertiary folding. Epitopes formed from adjacent amino acids can generally be maintained upon exposure to denaturing solvents, whereas epitopes formed by tertiary folding can generally be lost upon treatment with denaturing solvents.

  Epitope mapping is performed and the targeted activator, eg 5A6. Linear or non-linear discontinuous amino acid sequence (s) recognized by E9, B1, TS8.2, 15D, B6, B3, TS-1, 3.20, IMMU510, R9.12, 11F2, and 7A5, etc. Epitopes can be identified. A general approach for epitope mapping may require the expression of full-length polypeptide sequences recognized by the antibody or ligand of interest and various fragments, ie, truncated forms of the polypeptide sequences, generally in heterologous expression systems. These various recombinant polypeptide sequences or fragments thereof (eg, fusions with N-terminal proteins (eg, GFP)) are then used to bind the antibody or ligand of interest to one or more truncated forms of the polypeptide sequence. It can be determined whether it is possible. By generating a recombinant polypeptide sequence having a partially matching amino acid region using repeated cleavage, it is possible to identify a region of the polypeptide sequence that is recognized by the antibody of interest (eg, Epitope (See Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed (1996)). This method binds to a sequence reproduced from an agent, for example an antibody of interest, from an epitope library, such as a synthetic peptide array on a membrane support, an epitope library derived from a combinatorial phage display peptide library, etc. Depends on ability. Epitope libraries then provide a range of possibilities for screening for antibodies. In addition, site-directed mutagenesis targeting one or more residues of the epitope or random Ala scan can be performed to confirm the identity of the epitope.

  A library of epitopes can be generated by synthetically designing various possible γδ T cell receptor (γδ TCR) recombinants as cDNA constructs and expressing them in a suitable system. For example, a plurality of Vδ1 gene segments that differ in the Jδ region can be designed synthetically, including Jδ1, Jδ2, and Jδ3 gene segments. Alternatively, the Vδ2Jδ1 and Vδ3Jδ1 chains can be ordered as synthetic genes and cloned into a suitable vector. Synthetic design of a plurality of synthetically cloned δTCR chains such as Vδ1Jδ1, Vδ1Jδ2, Vδ1Jδ3, Vδ1Jδ4, Vδ2 and Vδ3, etc. It can be co-transfected into a host system along with gene segments and the like. In other cases, δTCR chains, such as Vδ1Jδ1, Vδ1Jδ2, Vδ1Jδ3, Vδ1Jδ4, Vδ2, and Vδ3 chains, can be amplified from total RNA extracted from human PBMC or γδ T cells isolated from human normal and malignant tissues.

  The host system can be any suitable expression system, such as 293 cells, insect cells, etc., or a suitable in vitro translation system. A number of different possible recombinations of synthetically designed γδ T cell segments transfected into the host system, for example 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, Alternatively, over 90 possible pair combinations of γδ TCRs can be obtained. The binding of the agent to one of the epitopes in the aforementioned library can be achieved by labeling antibodies such as TS-1, 5A6. It can be detected by contacting E9, B1, TS8.2, 15D, B6, B3, γ3.20, R9.12, 7A5, etc. with the epitope of the library and detecting the signal from the label.

  For epitope mapping, computational algorithms have also been developed and have been shown to map conformational discontinuous epitopes. A conformational epitope can be identified by determining the spatial structure of an amino acid by methods including, for example, X-ray crystal structure analysis and two-dimensional nuclear magnetic resonance. The atomic resolution of the epitope can be obtained by several epitope mapping methods, such as X-ray analysis of crystals of antigen: antibody complexes. In other cases, computational combinatorial methods for epitope mapping can be used to model potential epitopes based on sequences such as antibodies, eg, TS-1 antibody or TS8.2 antibody. In such cases, the antigen binding portion of the antibody is sequenced and a computational model is used to reconstruct and predict potential binding sites for the antibody.

  In some cases, the disclosure provides a method for determining epitopes of a γδ T cell receptor, the method comprising: (a) preparing a library of epitopes from the γδ T cell receptor; (b) treating the library of epitopes with an antibody And (b) identifying the amino acid sequence of at least one epitope bound by the antibody in the library of epitopes. In some cases, the antibody is 5A6. Selected from the group consisting of E9, B1, TS8.2, 15D, B6, B3, TS-1, R9.12, 11F2 and 7A5 antibodies. In some cases, the antibody is attached to a solid support. The library of epitopes can include sequences corresponding to continuous and discontinuous epitopes such as T cell receptors, eg, γTCR or δTCR. In some cases, the library of epitopes is a fragment from a γδ T cell receptor ranging from about 10 amino acids to about 30 amino acids, from about 10 amino acids to about 20 amino acids, or from about 5 amino acids to about 12 amino acids in length. including. In some cases, the antibody is labeled and the label is a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin.

Method of treatment
The pharmaceutical compositions containing the modified γδ T cells described herein can be administered for prophylactic and / or therapeutic treatments. In therapeutic applications, a subject already suffering from a disease or condition can be administered the composition in an amount sufficient to treat or at least partially reduce symptoms of the disease or condition. Modified γδ T cells can also be administered to reduce the likelihood of pathological onset, morbidity, or worsening. The amount of the modified γδ T cell population effective for therapeutic use is determined by the severity and course of the disease or condition, previous treatment, subject health, weight, and / or response to drugs, and / or treatment. It can change depending on the judgment of the doctor.

  The modified γδ T cells of the present disclosure can be used to treat a subject in need of treatment for a disease state. Examples of pathological conditions include cancer, infections, autoimmune disorders and sepsis. Subjects include humans, non-human primates such as chimpanzees, and other apes and monkey species; domestic animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs and cats; It can be a laboratory animal such as a rat, for example, a rat, a mouse and a guinea pig. The subject can be of any age. The subject can be, for example, an elderly person, an adult, an adolescent, a boy / girl, a child, an infant, or an infant.

  A method of treating a condition (eg, a disease) in a subject with γδ T cells can include administering to the subject a therapeutically effective amount of a modified γδ T cell. The γδ T cells of the present disclosure can be administered in a variety of regimens (eg, timing, concentration, dosage, treatment interval, and / or dosage form). Prior to giving the modified γδ T cells of the present disclosure, the subject can also be pretreated, eg, with chemotherapy, radiation, or a combination of both. As part of the treatment, the modified γδ T cells are administered to the subject in the first regimen, and the subject is monitored to determine whether treatment with the first regimen meets a given level of therapeutic efficacy. Can be done. In some cases, the same modified γδ T cell or another modified γδ T cell can be administered to the subject in the second regimen. FIG. 2 schematically shows a method for treating a subject. In the first treatment 201, at least one modified γδ T cell is administered to a subject having or suspected of having a given disease state (eg, cancer). The modified γδ T cells can be administered to the subject in the first regimen. In the second process 202, the subject may be monitored, for example, by a health care provider (eg, a treating physician or nurse). In some examples, the subject is monitored to determine or measure the effectiveness of the modified γδ T cells in treating the condition of the subject. In some cases, the subject may be monitored to determine in vivo expansion of the γδ T cell population in the subject. Next, in the third treatment 203, at least one other modified γδ T cell is administered to the subject in the second regimen. The second regimen may be the same as the first regimen or may be different from the first regimen. In some cases, for example, if it is found that administration of the modified γδ T cells in the first treatment 201 is effective (eg, a single administration may be sufficient to treat the disease state), the third treatment 203 is not performed. Because of its allogenic and universal donor characteristics, the population of modified γδ T cells can be administered to a variety of subjects with different MHC haplotypes. The modified γδ T cells can be frozen or cryopreserved before being administered to the subject.

  The population of modified γδ T cells can also be frozen or cryopreserved before being administered to the subject. The population of modified γδ T cells can include two or more cells that express the same tumor recognition portion, different tumor recognition portions, or a combination of the same and different tumor recognition portions. For example, a population of modified γδ T cells can include a plurality of different modified γδ T cells designed to recognize different antigens or different epitopes of the same antigen. For example, human cells suffering from melanoma can express the NY-ESO-1 oncogene. Infected cells in the human body can process the NY-ESO-1 oncoprotein into small fragments and present various portions of the NY-ESO-1 protein for antigen recognition. The population of modified γδ T cells can include various modified γδ T cells that express different tumor recognition moieties designed to recognize different portions of the NY-ESO-1 protein. FIG. 3 schematically illustrates a method for treating a subject with a population of modified γδ T cells that recognize different epitopes of the melanoma antigen NY-ESO-1. In the first process 301, a population of modified γδ T cells that recognize different epitopes of the same antigen is selected. For example, a population of modified γδ T cells can include two or more types of cells that express different tumor recognition portions that recognize different portions of the NY-ESO-1 protein. In a second treatment 302, a population of modified γδ T cells can be administered to a subject with a first regimen. In the second process 303, the subject can be monitored, for example, by a health care provider (eg, a treating physician or nurse).

  The γδ T cells of the present disclosure can be used to treat a variety of conditions. In some cases, the modified γδ T cells of the present disclosure can be used to treat cancer, including solid tumors and hematological malignancies. Non-limiting examples of cancer include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical cancer, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, neuroblastoma, basal cell carcinoma , Cholangiocarcinoma, bladder cancer, bone cancer, brain tumors such as cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic nerve Breast cancer, bronchial adenoma, Burkitt lymphoma, cancer of unknown primary, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorder, Colorectal cancer, cutaneous T-cell lymphoma, fibrogenic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing sarcoma, germ cell tumor, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, glioma , Hairy cell leukemia Head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell cancer, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, Lung cancer, such as non-small cell and small cell lung cancer, lymphoma, leukemia, macroglobulinemia, bone malignant fibrous histiocytoma / osteosarcoma, medulloblastoma, melanoma, mesothelioma, metastatic squamous cell of unknown primary Cervical cancer, oral cancer, multiple endocrine tumor syndrome, myelodysplastic syndrome, myelogenous leukemia, nasal and sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, mouth Pharyngeal cancer, osteosarcoma / bone malignant fibrous histiocytoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, islet cell cancer, sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, brown Cytoma, pineal astrocytoma, pineal germinoma, pituitary adenoma, chest Pulmonary blastoma, plasma cell tumor, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureteral transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland carcinoma, sarcoma, skin cancer , Skin Merkel cell carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T cell lymphoma, throat cancer, thymoma, thymic cancer, thyroid cancer, trophoblastic tumor (gestation), cancer of unknown primary site, urethra Examples include cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms tumor.

  In some cases, the modified γδ T cells of the present disclosure can be used to treat infections. Infectious diseases can be caused, for example, by pathogenic bacteria or viruses. Various pathogenic proteins, nucleic acids, lipids, or fragments thereof can be expressed by diseased cells. Antigen presenting cells can internalize such pathogenic molecules, for example, by phagocytosis or receptor-mediated endocytosis and present fragments of antigen bound to the appropriate MHC molecule. For example, various 9-mer fragments of pathogenic proteins can be presented by APC. The modified γδ T cells of the present disclosure can be designed to recognize various antigens and antigen fragments of pathogenic bacteria or viruses. Non-limiting examples of pathogenic bacteria include: a) Bordetella genus, such as Bordetella pertussis species; b) Borrelia genus, such as Borrelia burgdorferi species; c) Brucellia genus, such as Brucella abortus, Brucella cerus d) Campylobacter species, such as Campylobacter jejuni species; e) Chlamydia and Chlamydophila species, such as Chlamydia pneumonia, Chlamydia trachomatis, and / or Chlamy species; tridium genus, for example Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani species such as; g) Corynebacterium genus, such as Corynebacterium diphtheria species; h) Enterococcus genus, for example Enterococcus faecalis, and / or Enterococcus faecium species like; i) Escherichia genus E) Escherichia coli species; j) Francisella genus, such as Francisella tularensis species; k) Haemophilus genus, such as Haemophilus influenza species; 1) Helicobacter species, such as Helicobacter pylori species; m) Legionella species, such as Legionella pneumophila species; n) Leptospira species, such as Leptospira species, such as Leptospira species; Mycobacterium genus, such as Mycobacterium leprae, Mycobacterium tuberculosis, and / or Mycobacterium ulcerans species; q) Mycoplasma genus, such as Mycoplasma pneumoniae species; Eg Neisseria gonorrhoeae and / or Neisseria meningitidia species; s) Pseudomonas species, eg Pseudomonas aeruginosa species, etc .; ) Shigella genus, such as Shigella sonnei species; w) Staphylococcus genus, eg Staphylococcus aureus, Staphylococcus epidermidis, and / or Staphylococcus sapr x) Streptococcus agalactiae, Streptococcus pneumonia, and / or Streptococcus pyogenes species; y) Treponema V, for example Treponema V. It can be found in the genus Yersinia, such as the Yersinia pestis species.

  In some cases, the modified γδ T cells of the present disclosure are used to treat an infection, which can be caused by a virus. Non-limiting examples of viruses can be found in the following families of viruses and exemplify representative species: a) Adenoviridae family, such as adenovirus species; b) Herpesviridae family, such as herpes simplex type 1, herpes simplex Type 2, varicella-zoster virus, Epstein-Barr virus, human cytomegalovirus, human herpesvirus type 8 and the like; c) Papillomaviridae family, such as human papilloma virus species; d) Polyomaviridae family, such as BK virus, JC virus E) Poxviridae family, such as smallpox species; f) Hepadnaviridae family, such as hepatitis B virus species; g) Parvoviridae family, such as human bocavirus, parvovirus B19 H) Astroviridae family, such as human astrovirus species; i) Caliciviridae family, such as Norwalk virus species; j) Flaviviridae family, such as hepatitis C virus (HCV), yellow fever virus, dengue virus, West Nile virus species K) Togaviridae family, such as rubella virus species; l) Hepeviridae family, such as hepatitis E virus species; m) Retroviridae family, such as human immunodeficiency virus (HIV) species; n) Orthomyxaviridaw family, such as influenza virus O) Arenaviridae family, such as Guanaritovirus, Junin virus, Lassa virus, Machupovirus, and / or Sabiwi P) Bunaviviridae family, such as Crimea-Congo hemorrhagic fever virus species; q) Filaviridae family, such as Ebola virus and / or Marburg virus species; Paramyxoviridae family, such as measles virus, mumps virus, parainfluenza virus, respiratory Organ syncytial virus, human metapneumovirus, Hendra virus and / or Nipah virus species; r) Rhabdoviridae genus, such as rabies virus species; s) Revividae family, such as rotavirus, orbivirus, cortivirus and / or vannavirus Seeds etc. In some cases, there are viruses that do not belong to the viridae family, such as hepatitis D.

  In some cases, the modified γδ T cells of the present disclosure can be used to treat immune diseases such as autoimmune diseases. Autoimmune diseases are also a classification of diseases associated with B cell disorders, including inflammatory diseases. Examples of immune diseases or conditions that can be treated with the modified γδ T cells disclosed herein include rheumatoid arthritis, rheumatic fever, multiple sclerosis, experimental autoimmune encephalomyelitis , Psoriasis, uveitis, diabetes mellitus, systemic lupus erythematosus (SLE), lupus nephritis, eczema, scleroderma, polymyositis / scleroderma, polymyositis / dermatomyositis, ulcerative proctitis, severe combined immunodeficiency Disease (SCID), DiGeorge syndrome, telangiectasia ataxia, seasonal allergy, perennial allergy, food allergy, anaphylaxis, mastocytosis, allergic rhinitis, atopic dermatitis, Parkinson's disease, Alzheimer's disease, spleen Hyperfunction, leukocyte adhesion deficiency, X-linked lymphoproliferative disorder, X-linked agammaglobulinemia, selective immunoglobulin A deficiency , High IgM syndrome, HIV, autoimmune lymphoproliferative syndrome, Wiscott-Aldrich syndrome, chronic granulomatosis, non-classifiable immunodeficiency (CVID), hyperimmunoglobulin E syndrome, Hashimoto's thyroiditis, acute idiopathic thrombocytopenia Purpura, Chronic idiopathic thrombocytopenic purpura, Dermatomyositis, Sydenham chorea, Myasthenia gravis, Polygonal syndrome, Bullous pemphigoid, Henoch-Schönlein purpura, Post-streptococcal nephritis, Nodule Erythema, polymorphic erythema, gA nephropathy, Takayasu arteritis, Addison's disease, sarcoidosis, ulcerative colitis, nodular polyarteritis, ankylosing spondylitis, Goodpasture syndrome, obstructive thromboangiitis, Sjogren Syndrome, primary biliary cirrhosis, Hashimoto thyroiditis, thyroid poisoning, chronic active hepatitis, polychondritis, pemphigus vulgaris, Wegener's granulomatosis, membranous nephropathy Amyotrophic lateral sclerosis, tabes dorsalis, giant cell arteritis / polymyalgia syndrome, pernicious anemia, rapidly progressive glomerulonephritis, psoriasis, fibrosing alveolitis, and cancer.

  Treatment with γδT cells of the present disclosure can be provided to the subject before, during, and after the clinical onset of the condition. Treatment can be provided to the subject one day, one week, six months, twelve months, or two years after the clinical onset of the disease. The treatment is one day, one week, one month, six months, twelve months, two years, three years, four years, five years, six years, seven years, eight years after the clinical onset of the disease, Can be provided to the subject for 9 years, 10 years or longer. Treatment can be provided to the subject for less than 1 day, 1 week, 1 month, 6 months, 12 months, or 2 years after the clinical onset of the disease. Treatment can also include treating a human in a clinical trial. Treatment can include administering to the subject a pharmaceutical composition comprising the modified γδ T cells of the present disclosure.

In some cases, administration of a modified γδ T cell of the present disclosure to a subject modulates the activity of endogenous lymphocytes in the subject's body. In some cases, administration of the modified γδ T cell (s) to the subject can confer an antigen to the endogenous T cells and enhance the immune response. In some cases, the memory T cell is a CD4 ⁺ T cell. In some cases, the memory T cell is a CD8 ⁺ T cell. In some cases, administration of the modified γδ T cell (s) to a subject activates the cytotoxicity of another immune cell. In some cases, this other immune cell is a CD8 + T cell. In some cases, this other immune cell is a natural killer T cell. In some cases, administration of the modified γδ T cell (s) to the subject suppresses regulatory T cells. In some cases, the regulatory T cells are Fox3 + Treg cells. In some cases, the regulatory T cells are Fox3-Treg cells. Non-limiting examples of cells whose activity can be modulated by the modified γδ T cells of the present disclosure include hematopoietic stem cells; B cells; CD4; CD8; erythrocytes; leukocytes; dendritic cells including dendritic antigen-presenting cells; Macrophages; memory B cells; memory T cells; monocytes; natural killer cells; neutrophils, helper T cells; and killer T cells.

  In most bone marrow transplants, a combination of cyclophosphamide and whole body radiation is conventionally used to prevent rejection of hematopoietic stem cells (HSC) in the transplanted tissue by the subject's immune system. In some cases, donor bone marrow is incubated with interleukin 2 (IL-2) ex vivo to enhance the production of killer lymphocytes in the donor bone marrow. Interleukin 2 (IL-2) is a cytokine required for the growth, proliferation and differentiation of wild type lymphocytes. Current studies of adoptive transfer of γδT cells to humans may require co-administration of γδT cells and interleukin-2. However, both low and high doses of IL-2 can have highly toxic side effects. IL-2 toxicity can manifest in multiple organs / systems, but is most pronounced in the heart, lungs, kidneys, and central nervous system. In some cases, the present disclosure provides a method of administering modified γδ T cells to a subject without co-administration of cytokines such as IL-2, IL-15, IL-12, IL-21, and the like. In some cases, modified γδ T cells can be administered to a subject without co-administration with IL-2. In some cases, the modified γδ T cells are administered to the subject during surgery, such as bone marrow transplantation, without co-administration with IL-2.

Method of Administration One or more modified γδ T cell (s) can be administered to a subject in any order or simultaneously. When simultaneously, the plurality of modified γδ T cell (s) are in a single integrated form, such as intravenous injection, or multiple forms, such as multiple intravenous infusions, s. c, can be provided as an injection or pill. The modified γδ T cell (s) can be packed together or separately in a single package or multiple packages. One or all modified γδ T cell (s) can be given in multiple doses. If not simultaneous, the timing between multiple doses varies and is about 1 week, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or about 1 year Can also be. In some cases, the modified γδ T cell (s) can be propagated in vivo in the subject after administration to the subject. The modified γδ T cell (s) can be frozen to prepare the same cell preparation for multiple treatment cells. The modified γδ T cell (s) of the present disclosure and pharmaceutical compositions comprising the same can be packaged as a kit. The kit can include instructions (eg, instructions) for use of the modified γδ T cell (s) and a composition comprising the same.

  In some cases, a method of treating cancer includes administering to a subject a therapeutically effective amount of modified γδ T cell (s), wherein the cancer is treated by administration. In some embodiments, the therapeutically effective amount of the modified γδ T cell (s) is at least about 10 seconds, 30 seconds, 1 minute, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours. 6 hours, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, Administer 5 months, 6 months, or 1 year. In some embodiments, the therapeutically effective amount of the modified γδ T cell (s) is administered for at least 1 week. In some embodiments, the therapeutically effective amount of the modified γδ T cell (s) is administered for at least 2 weeks.

  The modified γδ T cell (s) described herein can be administered before, during or after the onset of the disease or condition, and the timing of administering the pharmaceutical composition containing the modified γδ T cells varies. obtain. For example, modified γδT cells can be used as a prophylactic agent and can be continuously administered to a subject who is prone to have a disease state or disease in order to reduce the likelihood of developing the disease or disease state The cell (s) can be administered to the subject as soon as possible during or after the onset of symptoms. Administration of the modified γδ T cell (s) immediately during the onset of symptoms, within the first 3 hours of onset of symptoms, within the first 6 hours of onset of symptoms, within the first 24 hours of onset of symptoms, and 48 hours of onset of symptoms Or within any time from the onset of symptoms. The initial administration can be performed via any practical route using any of the formulation forms described herein, such as by any route described herein. In some examples, administration of the modified γδ T cells of the present disclosure is intravenous. One or more doses of modified γδ T cells may be administered as soon as practicable after the onset of cancer, infection, immune disease, sepsis, or in bone marrow transplantation and for a period of time required for treatment of the immune disease, eg, about 24 It can be administered for a period of time to about 48 hours, about 48 hours to about 1 week, about 1 week to about 2 weeks, about 2 weeks to about 1 month, about 1 month to about 3 months, and the like. For the treatment of cancer, one or more doses of modified γδ T cells can be administered several years after the onset of cancer before or after other treatments. In some examples, at least about 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, At least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months Modified for at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months, at least 1 year, at least 2 years, at least 3 years, at least 4 years, or at least 5 years γδ T cell (s) can be administered. The length of treatment can vary for each subject.

Dosage The modified γδ T cell (s) disclosed herein can be formulated into unit dosage forms suitable for single administration of precise dosages. In some cases, the unit dosage form contains another lymphocyte. In unit dosage form, the formulation is divided into unit doses containing appropriate quantities of one or more compound. The unit dosage can be in the form of a package containing the individual amounts of the formulation. Non-limiting examples are packaged tablets or capsules, and powders in vials or ampoules. The aqueous suspension composition can be placed in a single dose non-resealable container. Multiple dose resealable containers can be used, for example, with or without preservatives. In some examples, the pharmaceutical composition does not include a preservative. Formulations for parenteral injection can be provided in unit dosage forms, such as ampoules, or in multi-dose containers containing a preservative.

The modified γδ T cells described herein are at least 5 cells, at least 10 cells, at least 20 cells, at least 30 cells, at least 40 cells, at least 50 cells, at least 60 cells, at least 70 cells, at least 80 cells, at least 90 cells. , At least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 700 cells, at least 800 cells, at least 900 cells, at least 1 × 10 ³ cells, at least 2 × 10 ³ cells At least 3 × 10 ³ cells, at least 4 × 10 ³ cells, at least 5 × 10 ³ cells, at least 6 × 10 ³ cells, at least 7 × 10 ³ cells, at least 8 × 10 ³ cells, at least 9 × 10 ³ cells, Small At least 1 × 10 ⁴ cells, at least 2 × 10 ⁴ cells, at least 3 × 10 ⁴ cells, at least 4 × 10 ⁴ cells, at least 5 × 10 ⁴ cells, at least 6 × 10 ⁴ cells, at least 7 × 10 ⁴ cells, At least 8 × 10 ⁴ cells, at least 9 × 10 ⁴ cells, at least 1 × 10 ⁵ cells, at least 2 × 10 ⁵ cells, at least 3 × 10 ⁵ cells, at least 4 × 10 ⁵ cells, at least 5 × 10 ⁵ cells, at least 6 × 10 ⁵ cells, at least 7 × 10 ⁵ cells, at least 8 × 10 ⁵ cells, at least 9 × 10 ⁵ cells, at least 1 × 10 ⁶ cells, at least 2 × 10 ⁶ cells, at least 3 × 10 ⁶ cells, at least 4 × 10 ⁶ cells, at least 5 × 10 ⁶ cells, at least 6 × 10 ⁶ cells, at least 7 × 10 ⁶ cells, at least 8 × 10 ⁶ Cells, at least 9 × 10 ⁶ cells, at least 1 × 10 ⁷ cells, at least 2 × 10 ⁷ cells, at least 3 × 10 ⁷ cells, at least 4 × 10 ⁷ cells, at least 5 × 10 ⁷ cells, at least 6 × 10 ⁷ cells At least 7 × 10 ⁷ cells, at least 8 × 10 ⁷ cells, at least 9 × 10 ⁷ cells, at least 1 × 10 ⁸ cells, at least 2 × 10 ⁸ cells, at least 3 × 10 ⁸ cells, at least 4 × 10 ⁸ cells, Composition in an amount of at least 5 × 10 ⁸ cells, at least 6 × 10 ⁸ cells, at least 7 × 10 ⁸ cells, at least 8 × 10 ⁸ cells, at least 9 × 10 ⁸ cells, at least 1 × 10 ⁹ cells, or more Can exist in.

The therapeutically effective amount of the modified γδ T cells of the present invention is about 1 cell to about 10 cells, about 1 cell to about 100 cells, about 1 cell to about 10 cells, about 1 cell to about 20 cells, about 1 cell to about 30. Cells, about 1 cell to about 40 cells, about 1 cell to about 50 cells, about 1 cell to about 60 cells, about 1 cell to about 70 cells, about 1 cell to about 80 cells, about 1 cell to about 90 cells, About 1 to about 100 cells, about 1 to about 1 × 10 ³ cells, about 1 to about 2 × 10 ³ cells, about 1 to about 3 × 10 ³ cells, about 1 to about 4 × 10 ³ Cells, about 1 cell to about 5 × 10 ³ cells, about 1 cell to about 6 × 10 ³ cells, about 1 cell to about 7 × 10 ³ cells, about 1 cell to about 8 × 10 ³ cells, about 1 cell to About 9 × 10 ³ cells, about 1 to about 1 × 10 ⁴ cells, about 1 to about 2 × 10 ⁴ cells, about 1 to about 3 × 10 ⁴ cells, about 1 to about 4 × 10 ⁴ cells About 1 cell to about 5 × 10 ⁴ cells, about 1 cell to about 6 × 10 ⁴ cells, about 1 cell to about 7 × 10 ⁴ cells, about 1 cell to about 8 × 10 ⁴ cells, about 1 cell to about 9 × 10 ⁴ cells, about 1 to about 1 × 10 ⁵ cells, about 1 to about 2 × 10 ⁵ cells, about 1 to about 3 × 10 ⁵ cells, about 1 to about 4 × 10 ⁵ cells, About 1 cell to about 5 × 10 ⁵ cells, about 1 cell to about 6 × 10 ⁵ cells, about 1 cell to about 7 × 10 ⁵ cells, about 1 cell to about 8 × 10 ⁵ cells, about 1 cell to about 9 × 10 ⁵ cells, about 1 to about 1 × 10 ⁶ cells, about 1 to about 2 × 10 ⁶ cells, about 1 to about 3 × 10 ⁶ cells, about 1 to about 4 × 10 ⁶ cells, about 1 to about 5 × 10 ⁶ cells, about 1 to about 6 × 10 ⁶ cells, about 1 to about 7 × 10 ⁶ cells, about 1 to about 8 × 10 ⁶ cells, about 1 to about 9 × 10 ⁶ cells, about 1 cell to about 1 × 10 Cells, about 1 cell to about 2 × 10 ⁷ cells, about 1 cell to about 3 × 10 ⁷ cells, about 1 cell to about 4 × 10 ⁷ cells, about 1 cell to about 5 × 10 ⁷ cells, about 1 cell- About 6 × 10 ⁷ cells, about 1 to about 7 × 10 ⁷ cells, about 1 to about 8 × 10 ⁷ cells, about 1 to about 9 × 10 ⁷ cells, about 1 to about 1 × 10 ⁸ cells About 1 cell to about 2 × 10 ⁸ cells, about 1 cell to about 3 × 10 ⁸ cells, about 1 cell to about 4 × 10 ⁸ cells, about 1 cell to about 5 × 10 ⁸ cells, about 1 cell to about 6 × 10 ⁸ cells, about 1 to about 7 × 10 ⁸ cells, about 1 to about 8 × 10 ⁸ cells, about 1 to about 9 × 10 ⁸ cells, or about 1 to about 1 × 10 ⁹ cells It can be.

In some cases, a therapeutically effective amount of a modified γδ T cell of the present invention is about 1 × 10 ³ cells to about 1 cell to about 2 × 10 ³ cells, about 1 × 10 ³ cells to about 3 × 10 ³ cells, about 1 × 10 ³ cells to about 4 × 10 ³ cells, about 1 × 10 ³ cells to about 5 × 10 ³ cells, about 1 × 10 ³ cells to about 6 × 10 ³ cells, about 1 × 10 ³ cells to about 7 × 10 ³ cells, about 1 × 10 ³ cells to about 8 × 10 ³ cells, about 1 × 10 ³ cells to about 9 × 10 ³ cells, about 1 × 10 ³ cells to about 1 × 10 ⁴ cells, about 1 × 10 ³ cells to about 2 × 10 ⁴ cells, about 1 × 10 ³ cells to about 3 × 10 ⁴ cells, about 1 × 10 ³ cells to about 4 × 10 ⁴ cells, about 1 × 10 ³ cells to about 5 × 10 ⁴ cells Cells, about 1 × 10 ³ cells to about 6 × 10 ⁴ cells, about 1 × 10 ³ cells to about 7 × 10 ⁴ cells, about 1 × 10 ³ cells to about 8 × 10 ⁴ cells, about 1 × 10 ³ cells ~ About 9 × 10 ⁴ cells, about 1 × 10 ³ cells to about 1 × 10 ⁵ cells, about 1 × 10 ³ cells to about 2 × 10 ⁵ cells, about 1 × 10 ³ cells to about 3 × 10 ⁵ cells, about 1 × 10 ³ Cells to about 4 × 10 ⁵ cells, about 1 × 10 ³ cells to about 5 × 10 ⁵ cells, about 1 × 10 ³ cells to about 6 × 10 ⁵ cells, about 1 × 10 ³ cells to about 7 × 10 ⁵ cells About 1 × 10 ³ cells to about 8 × 10 ⁵ cells, about 1 × 10 ³ cells to about 9 × 10 ⁵ cells, about 1 × 10 ³ cells to about 1 × 10 ⁶ cells, about 1 × 10 ³ cells About 2 × 10 ⁶ cells, about 1 × 10 ³ cells to about 3 × 10 ⁶ cells, about 1 × 10 ³ cells to about 4 × 10 ⁶ cells, about 1 × 10 ³ cells to about 5 × 10 ⁶ cells, about 1 × 10 ³ cells to about 6 × 10 ⁶ cells, about 1 × 10 ³ cells to about 7 × 10 ⁶ cells, about 1 × 10 ³ cells to about 8 × 10 ⁶ cells, about 1 × 10 ³ cells to about 9 × 10 ⁶ cells, about 1 × 10 Cells to about 1 × 10 ⁷ cells, about 1 × 10 ³ cells to about 2 × 10 ⁷ cells, about 1 × 10 ³ cells to about 3 × 10 ⁷ cells, about 1 × 10 ³ cells to about 4 × 10 ⁷ cells About 1 × 10 ³ cells to about 5 × 10 ⁷ cells, about 1 × 10 ³ cells to about 6 × 10 ⁷ cells, about 1 × 10 ³ cells to about 7 × 10 ⁷ cells, about 1 × 10 ³ cells About 8 × 10 ⁷ cells, about 1 × 10 ³ cells to about 9 × 10 ⁷ cells, about 1 × 10 ³ cells to about 1 × 10 ⁸ cells, about 1 × 10 ³ cells to about 2 × 10 ⁸ cells, about 1 × 10 ³ cells to about 3 × 10 ⁸ cells, about 1 × 10 ³ cells to about 4 × 10 ⁸ cells, about 1 × 10 ³ cells to about 5 × 10 ⁸ cells, about 1 × 10 ³ cells to about 6 × 10 ⁸ cells, about 1 × 10 ³ cells to about 7 × 10 ⁸ cells, about 1 × 10 ³ cells to about 8 × 10 ⁸ cells, about 1 × 10 ³ cells to about 9 × 10 ⁸ cells, or about 1 × 10 ³ cells to about 1 × 10 ⁹ cells.

In some embodiments, the γδ T cells are formulated in freezing medium and are at least about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years. Can be placed in a cryopreservation device, such as a liquid nitrogen refrigeration device (-195 ° C) or a cryogenic refrigeration device (-65 ° C, -80 ° C or -120 ° C) for long-term storage for 3 years or at least 5 years . The freezing medium contains about 6.0 to dimethyl sulfoxide (DMSO) and / or sodium chloride (NaCl) and / or dextrose and / or dextran sulfate and / or hydroethyl starch (HES). To maintain a pH of about 6.5, about 6.5 to about 7.0, about 7.0 to about 7.5, about 7.5 to about 8.0, or about 6.5 to about 7.5. In combination with other physiological pH buffering agents. Cryopreserved γδ T cells can be thawed and further processed by stimulation with the antibodies, proteins, peptides, and / or cytokines described herein. Cryopreserved γδT cells can be thawed and genetically modified by viral vectors (including retroviruses and lentiviral vectors) or non-viral means (including RNA, DNA and proteins) as described herein. The modified γδ T cells are further cryopreserved and at least about 10 ¹ , 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , or at least about 10 ¹⁰ cells per mL in freezing medium. A cell bank of at least about 1, 5, 10, 100, 150, 200, 500 vials can be made. A cryopreserved cell bank can retain its function and can be thawed for further stimulation and growth. In some embodiments, thawed cells can be stimulated and grown in a suitable sealed container, such as a cell culture bag and / or bioreactor, to produce an amount of cells as an allogenic cell product. Cryopreserved γδT cells are at least about 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 15 months, 18 Its biological function can be maintained for months, 20 months, 24 months, 30 months, 36 months, 40 months, 50 months, or at least about 60 months. In some embodiments, no preservative is used in the formulation. Cryopreserved γδ T cells can be thawed as an allogenic universal cell product and injected into multiple patients.

  The invention may be better understood by reference to the following examples, which are not intended to limit the scope of the claims.

Example 1. Primary cell isolation Primary human peripheral blood mononuclear cells (PBMC) are collected from healthy donors using an apheresis instrument. PBMC are purified on a Ficoll-Paque ™ PLUS (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) system or similar system. The cells are then resuspended in an appropriate growth medium.

  Alternatively, primary human cells are collected from peripheral blood, umbilical cord blood, bone marrow, healthy tissue, or diseased tissue such as cancer tissue.

Example 2 Healthy Donor-Derived Tissue Fresh donor-derived tissue is obtained from the Cooperative Human Tissue Network (CHTN) and transported to the laboratory in RPMI-1640 medium. Cut the tissue into 1-3 mm ³ pieces with a scalpel. 24 wells of 2-5 fragments / well in 2 mL RPMI-1640 supplemented with GlutaMAX, 25 mM HEPES pH 7.2, 100 U / ml penicillin, 100 U / ml streptomycin and 10% human AB serum and 100 IU / ml rhIL-2 Place in plate (Costar) or digest as described below. Plates are incubated in a humidified incubator at 37 ° C., 5% CO ₂ in air. The culture is examined every other day to monitor lymphocyte proliferation. Change medium half in all wells every 7 days after start of culture. Lymphocytes are collected when a dense lymphocyte carpet covers the fragments or when the lymphocyte population from the digested tissue reaches an appropriate concentration as described below.

Example 3 FIG. Enzymatic digestion of tissue Fresh tissue samples from healthy donors were obtained from Cooperative Human Tissue Network (CHTN) and transported to the laboratory in RPMI-1640 medium. Two enzymes, Liberase ™ DL Research Grade (Sigma Aldrich Co., St. Louis, MO), or Liberase ™ TM Research Grade (Sigma Aldrich Co., St. Louis, MO). Spheres were isolated by enzymatic digestion. The tissue was cut into 2-3 mm ³ pieces and digested for 1 hour at 37 ° C., 5% CO 2. The digested cell suspension was passed through a 40 μm filter, spun down and washed with RPMI-1640 medium. Cells were counted and resuspended in RPMI medium (GIBCO BRL) supplemented with 10% human AB serum (Corning) and 100 IU / ml rhIL-2. Collected cell populations were seeded in 24-well tissue culture plates at 0.5-1 × 10 ⁶ cells / ml. When the cells exceeded a concentration of 1.5 × 10 ⁶ cells / ml, the cells were split into RPMI-IL2 containing media.

Example 4 Tumor Specimen Culture Fresh tumor specimens from patients with primary and metastatic cancer, including those of the colon, breast, kidney, head and neck, oral cavity, pancreas and liver, are obtained from Cooperative Human Tissue Network (CHTN) and placed in RPMI medium And transported to the laboratory. The tumor specimen was cut into 1-3 mm ³ fragments with a scalpel. 24 wells 2-5 fragments / well in 2 ml RPMI-1640 supplemented with GlutaMAX, 25 mM HEPES pH 7.2, 100 U / ml penicillin, 100 U / ml streptomycin and 10% human AB serum and 100 IU / ml rhIL-2 Placed in a plate (Costar). Plates were incubated in a humidified incubator at 37 ° C., 5% CO ₂ in air. The cultures were examined every other day to monitor lymphocyte proliferation. Every 7 days after the start of the culture, half of the medium was changed in all wells. Lymphocytes were collected when a dense lymphocyte carpet covered the fragments.

Example 5 FIG. Enzymatic digestion of fresh tumor specimens Fresh tumor specimens from patients with primary and metastatic cancers, including those of the colon, breast, kidney, head and neck, oral cavity, pancreas and liver, were obtained from Cooperative Human Tissue Network (CHTN) and RPMI Placed in medium and transported to laboratory. Two enzymes, Liberase ™ DL Research Grade (Sigma Aldrich Co., St. Louis, MO), or Liberase ™ TM Research Grade (Sigma Aldrich Co., St. Louis, MO). Spheres were isolated by enzymatic digestion. The tissue was cut into 2-3 mm ³ pieces and digested for 1 hour at 37 ° C. with 5% CO ₂ in air. The digested cell suspension was passed through a 40 μm filter, spun down and washed with RPMI-1640 medium. Cells were counted and resuspended in RPMI medium (GIBCO BRL) supplemented with 10% human AB serum (Corning) and 100 IU / ml rhIL-2. Collected cell populations were seeded in 24-well tissue culture plates at 0.5-1 × 10 ⁶ cells / ml. When the cells exceeded a concentration of 1.5 × 10 ⁶ cells / ml, the cells were split into RPMI-IL2 containing media.

Example 6 Primary Cell Culture in Exemplary Serum-supplemented Medium PBMC populations were obtained by separating from buffy coats derived from healthy donors using Ficoll-Paque ™ PLUS (GE Healthcare Bio-Sciences PA, USA) . RPMI-1640 (Corning CellGro) supplemented with 10% fetal calf serum (Gibco), 2 mmol / L L-glutamine, 100 U / mL penicillin, 100 U / mL streptomycin, and 100 rhIL-2 / ml in 24-well tissue culture plates The PBMCs were cultured at 1 × 10 ⁶ cells / mL.

  Similar culture conditions can be used to grow primary cells collected from peripheral blood, umbilical cord blood, bone marrow, healthy tissue, or diseased tissue, such as the cancerous tissue described above.

Example 7 Cultivation of primary cells in exemplary serum-free medium PBMC populations were obtained by separating from buffy coats derived from healthy donors using Ficoll-Paque ™ PLUS (GE Healthcare Bio-Sciences PA, USA) . PBMC were cultured at 1 × 10 ⁶ cells / mL in CTS serum-free medium containing CTS-OpTmizer supplement in 24-well tissue culture plates.

  Similar culture conditions can be used to grow primary cells collected from peripheral blood, umbilical cord blood, bone marrow, healthy tissue, or diseased tissue, such as the cancerous tissue described above.

Example 8: Removal of adherent monocytes and macrophages PMBCs are collected by the apheresis method described above and erythrocytes are removed by density separation using hypotonic treatment or Ficoll gradient centrifugation. Erythrocyte-free PBMCs are incubated in large scale tissue culture vessels, such as 10 stacks or 40 stacks Cell Factory (Nunc), roller bottles (Nunc), and the like. Adherent populations including macrophages and monocytes generally remain attached to the surface of the cell culture vessel. The cell population grown in the suspension population is rich in γδ T cells. Approximately 10 ⁸ , 10 ⁹ or 10 ¹⁰ PBMC are incubated with iron-containing microbeads (eg, Miltenyi Biotech microbeads) coated with CD4 and CD8. When the incubated cell population is passed through a magnetic field, CD4 ⁺ and CD8 ⁺ T cells remain there. The “flow-through” cell population is rich in γδT cells.

Example 9: Removal of monocytes and macrophages PMBCs are collected by the apheresis method described above and erythrocytes are removed by density separation using hypotonic treatment or Ficoll gradient centrifugation. Erythrocyte-free PBMCs are incubated in large scale tissue culture vessels, such as 10 stacks or 40 stacks Cell Factory (Nunc), roller bottles (Nunc), and the like. Monocytes and macrophages are removed by running Erythrocyte Depleted PBMC through a glass wool packed column. The “flow-through” cell population is rich in γδ T cells for further processing.

Example 10: Enrichment of γδ T cells PMBCs are collected by the apheresis method described above and red blood cells are removed by density separation using hypotonic treatment or Ficoll gradient centrifugation. Erythrocyte-free PBMCs are incubated in large scale tissue culture vessels, such as 10 stacks or 40 stacks Cell Factory (Nunc), roller bottles (Nunc), and the like. Monocytes and macrophages are removed by either of the methods described in Example 8 or Example 9. Approximately 10 ⁸ , 10 ⁹ or 10 ¹⁰ PBMC are incubated with iron-containing microbeads (eg, Miltenyi Biotech microbeads) coated with CD4 and CD8. When the incubated cell population is passed through a magnetic field, CD4 ⁺ and CD8 ⁺ T cells remain there. The “flow-through” cell population is rich in γδT cells. Unnecessary cells, such as NK, γδT cells, B cells, monocytes and macrophages, are removed by immunomagnetic bead separation (eg, Miltenyi Biotech AutoMACS system) using a cocktail of antibodies directed against unwanted cell types.

  Alternatively, unwanted cell types are removed by using tetrameric antibody conjugates or bispecific antibodies directed against surface receptors on NK, abT cells, B cells, monocytes and macrophages.

Example 11 Isolation of γδT cells from primary cells by antibodies In one example, primary cultures in flow cytometry sorting based on positive (ie, γδTCR) or negative (ie, αβTCR, CD4, CD8, CD56) expression of cell surface markers. Natural γδ T cells are isolated from.

Example 12 Isolation of γδ T cells from primary tumors Freshly collected tumor specimens were obtained from the NCI Cooperative Human Tissue Network (CHTN). Liver metastatic colon adenocarcinoma (TIL1) and kidney tumor (TIL2) were transported in RPMI-1640 medium. The tumor tissue was shredded into 2 mm ³ sized pieces using a flat blade and then described with 2 mL of Liberase enzyme cocktail (Sigma Chemical Co., St. Louis, MO) in RPMI and 3000 units of DNase. Digested into. After digestion, the tumor was filtered through sterile gauze 40 μm nylon mesh and washed twice with RPMI-1640. Cells were counted and cultured in 24-well plates as 1 × 10 ⁶ / ml in RPMI-1640 containing 10% human AB serum supplemented with L-glutamine and 100 U / mL rhIL-2. Tumor infiltrating lymphocytes were collected after 6 days in culture. The presence of γδT lymphocytes was analyzed by flow cytometry anti-δ1TCR (FITC-conjugated anti-Vδ1TS8.2 (Thermo Fisher) and anti-Vδ2 B6 (Biolegend). Data were analyzed with FlowJo software.

  FIG. 4 shows a graph illustrating the growth of γδ1 and γδ2 lymphocytes isolated from liver metastatic colon adenocarcinoma (TIL1) and kidney tumor (TIL2). These lymphocytes are known to express CCR4 and CCR7. As shown in FIG. 4, the Vδ1 subset was the main population isolated from both types of tumors.

Example 13 Stimulation and proliferation of γδ T cells Cytokines (IL-2, IL-4, IL-7, IL-15, IL-12, IL-21, IL-23 or IL-33), growth factors (insulin and transferrin, insulin-like) Contains growth factors), albumin, lipids (cholesterol, lipid solutions, lipid precursors), vitamins, copper, iron, selenium, protein hydrolysates, essential amino acids, non-essential amino acids, and shear protectants (Pluronic F-68) Γδ T cells are stimulated to grow in a serum-free medium such as Ex-Vivo10, Ex-Vivo15, Ex-Vivo20, AIMV medium, Optimizer CTS and the like.

In order to maintain the biological function of γδ T cells while at the same time assisting the growth of γδ T cells with a high cell density of 10 ⁵ to 2 × 10 ⁷ cells / mL in suspension culture (eg WAVE bioreactor). Additives can be added to the serum-free medium described in.

Example 14 Additives that provide robust γδ T cell growth in serum-free media Additional additives that provide robust γδ T cell growth include calcium chloride, anhydrous, calcium nitrate, cupric sulfate, pentahydrate, citric acid Ferric, ferric nitrate, ferrous sulfate, zinc sulfate, and / or putrescine were included.

  Trace metals were added to the serum-free medium to provide low-concentration elemental components in place of serum, including ammonium paramolybdate, vanadium, manganese, nickel, sodium selenite, sodium metasilicate, nine Hydrate, stannous chloride, aluminum chloride, barium acetate, cadmium chloride, chromic chloride, cobalt, germanium dioxide, potassium bromide, potassium iodide, rubidium chloride, silver nitrate, sodium fluoride, and / or zirconyl chloride Is included.

  Other components added to the cell culture medium that assist in the robust growth of γδ T cells are adenosine, guanosine, cytidine, uridine, betainterurine, folinic acid, ethanolamine, linoleic acid, hydrocortisone oleate, pyruvate, Plant hydrolysates, yeast hydrolysates, and / or beta-mercaptoethanol.

  Vitamins added to promote robust γδ T cell growth include biotin (B7), D-calcium pantothenate (B5), choline chloride, cyanocobalamin (B12), folic acid (B9), i-inositol (myo-inositol). ), Niacinamide (B3), pyridoxal, monohydrochloride, pyridoxine, monohydrochloride (B6), riboflavin (B2), thiamine, and / or monohydrochloride (B1).

Example 15: Identification of proliferated γδ T cells: immunophenotype T cell populations proliferated by FACS staining for cell surface markers that distinguish different populations are identified. Cells were washed once in HEPES buffered saline (HBSS) containing 2% fetal bovine serum, incubated with an appropriate amount of MAb for 30 minutes at 4 ° C. and washed again with HBSS. Briefly, CD2, CD3 (BioLegend, clone OKT3), CD4 (BioLegend, clone OKT4), CD7, CD8 (BioLegend, clone RPAT8), CD11a, CD16, CD18, CD19, CD27, CD28, CD38, CD45RA, CD56 CD57, CD69, CD71, CD95, CD107, ICAM-1, MICA / B, NKG2D DR5, CCR1, CCR2, CCR3, CCR4, CCR5 CCR6, CCR7, CCR10, CXCR1, CXCR2, CXCR3, CXCR5, CXCR5, CXCR6, CXCR6 , IL-2R, IL-7R, Ki67, L-selectin, VLA-4, JAML, PD1, PDL1, CTLA-4, Ox40, TCR Vδ1 ( a 100 ul amount of FACS staining medium (FSM) containing fluoroisothiocyanate (FITC) or phycoerythrin (PE) -conjugated MAbs directed against the hemoFisher Scientific, clone TS8.2), or TCR Vδ2 (BioLegend, clone B6); Stain 1 × 10 ⁶ cells in HBSS containing 2% fetal calf serum).

  In addition to surface markers, cytokine secretion, intracellular cytokines and / or membrane-bound cytokines are identified, including TNF-α IFN-γ, GM-CSF, IL-1, IL-2, IL-4, IL -6, IL-7, IL-10, IL-17, or IL-21 are included.

  Zombie violet (BioLegend) Viable cells were determined by the absence or low uptake of amine staining dye. A fluorescent minus one (FMO) control is used to define the positive and negative gate boundaries of the surface representation of each antigen. Stained cells are collected on a Sony SH800 cytometer and the data analyzed using FlowJo v10.1. Visualize flow cytometry data as a dot plot.

Example 16 Δ2 T cell proliferation in serum-containing and serum-free media Growth and proliferation rates of different δ2 T cells were evaluated in serum-containing media (R2: RPMI + 10% FBS) and serum-free media (AIMV + bovine albumin; CTS serum-free supplement). FIG. 5 shows a graph illustrating the growth of δ2 T cells. All media used in this experiment contained 100 IU / mL IL-2, 2 mM glutamine and 1 × penicillin / streptomycin. In addition, cells were stimulated on day 0 with 1, 5 and 20 μM zoledronic acid. The medium was replenished every 2-3 days without further addition of zoledronic acid. The total number of δ2 T cells grown from 10 ⁶ PBMC of each treatment after the 13 day period and the proliferation fold are shown in FIG.

Example 17. Anti-γδTCR Antibody Blocking and Competition Assay FIGS. 6 and 7 show graphs illustrating anti-γδTCR antibody blocking experiments, and FIGS. 8 and 9 show antibody competition assays. FIGS. 6 and 7 show the results of the blocking experiment, in which PBMC was treated with various antibodies, namely 5A6. Preincubated with E9, B1, TS8.2, 15D, B3, B6, TS-1, γ3.20, IMMU510, or 11F2. The cells were then washed and stained with secondary TS8.2-FITC (δ1 specific) or B6-PE (δ2 specific) antibody. PBMC samples were analyzed by flow cytometry. The degree of blockage was evaluated using the reduction in geometric mean fluorescence intensity (gMFI). The level of inhibition is shown against TS8.2-FITC (Figure 6) and B6-PE (Figure 7).

1, 2 or 10 μg of unlabeled competing antibody (IgG1, 5A6.E9, B1, TS8.2, TS-1, R9.12, IMMU510, or 11F2) and 0.2 μg of FITC-conjugated anti-Vδ1 TCR clone TS8.2 ( MAb TS-1 and TS8.2 for binding on the γδ1 TCR expressing cell line BE13 by incubating 1 × 10 ⁵ cells on ice for 30 minutes simultaneously with anti-Vδ1 TCR clone TS-1 (FIG. 9). And antibody 5A6. Competition studies with E9, B1, IMMU510, R9.12-2, or 11F2 were performed. The percent competition was calculated by the change in geometric mean fluorescence divided by the maximum change in geometric mean fluorescence. As shown in FIG. 9, the TS-1 antibody competed with TS8.2 for binding to cells as effectively as the TS8.2 antibody itself. None of the other antibodies could compete with TS8.2 binding. The TS8.2 antibody competed with the binding of TS-1 to cells, but was not as effective as the TS-1 antibody itself. Some competition with TS-1 binding was also observed for the 11F2 antibody. These results indicate that both TS-1 and TS8.2 antibodies bind to γδ1, but are probably not the same epitope.

Example 18 Enzymatic digestion of tumor specimens and γδ T cell proliferation with antibodies against specific γδ epitopes 24-well plates were coated with 0.5-1 μg of anti-γδ TCR antibody. Cells isolated from digested tumor tissue as described in Example 10 were counted and 0.5-1 × 10 ⁶ cells in RPMI 1640 medium supplemented with 10% human AB serum and rhIL-2 (100 IU / mL). Wells coated with antibody at / ml were inoculated. Cultures were incubated for 74-21 days at 37 ° C., 5% CO ₂ .

Example 19. Enzymatic digestion of tumor specimens and γδ T cell proliferation with antibodies to specific γδ epitopes Cells isolated from tumor tissue digested as described in Example 5 were counted and 10% human AB serum and rhIL-2 (100 IU / 100 wells coated with antibodies from 3D cell culture plates (Corning® Costar® ultra-low adhesion multiwell plates) at 0.5-1 × 10 ⁶ cells / ml in RPMI 1640 medium supplemented with mL) Inoculated. Cultures were incubated for 74-21 days at 37 ° C., 5% CO ₂ .

Example 20. Activation and proliferation of PBMC-derived γδ T cells Activators were tested as either soluble agents or agents immobilized in culture wells. Soluble antigens and antibodies were added at a final concentration of 0.1-5 μg / ml to human PBMCs cultured in 24-well plates at a cell density of 1 × 10 ⁶ cells / ml. Alternatively, anti-γδTCR antibody was immobilized by coating the wells of a 24-well culture plate. Anti-γδTCR antibody was added at a concentration of 0.1 to 10 μg / ml. Wells were washed twice with PBS, after which PBMCs were transferred to plates and cultured in either RPMI-1640, AIM-V or CTS-OpTmizer media as described above. The culture medium was supplemented with 100 IU / mL rhIL-2.

Example 21. Activation and proliferation of PBMC-derived γδT cells One million PBMC from donor B3 were stimulated on day 0 with various antibodies immobilized at 0.5, 1, and 2 μg per well in a 24-well plate. The antibodies tested were mouse IgG1 isotype control clone MG1-45 (Bio Legend), UCHT-1, 5A6. E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, and zoledronate. FIGS. 10 and 11 show graphs illustrating the activation and proliferation of PBMC-derived δ1 and δ2 T cells, respectively. Cells were activated and grown in media containing RPMI with 10% FBS, 100 IU / mL rhIL-2, glutamine and 1 × penicillin streptomycin. Seven days after the initial stimulation, the cells were passaged into fresh medium and placed in a 24-well plate freshly coated with the same antibody at the same concentration. The medium of restimulated cultures was replenished every 2-3 days until day 13 and analyzed by flow cytometry.

  FIG. 12 shows the total number of δ1 T cells after 13 days of growth and proliferation, and FIG. 13 shows the total number of δ2 T cells after 13 days of growth and proliferation. The total number of γδT cells is calculated by multiplying the percentage of δ1 and δ2 T cells (determined by flow cytometry using TS8.2-FITC and B6-PE, respectively) by the total viable cell count, and by non-specific mouse IgG MG1-45. Calculations were made by subtracting negative control values from activated δ1 and δ2 T cells.

  Activation for cell growth is obtained only when the antibodies are immobilized on a culture plate, and when these antibodies are added to the culture in soluble form, proliferation is detected, including in the entire PBMC cell population. (Data not shown). Pan-γδ TCR MAb 5A6. E9 and B1 activated the growth of both δ1 and δ2 cell populations. MAbs 15D and B6 induced selective growth of the δ2 cell population. MAbs TS8.2 and TS-1 induced selective growth of the δ1 cell population. Interestingly, despite the MAbs TS-1 and TS8.2 competing with each other for binding to the cell surface TCR, TS-1-induced proliferation was three times higher. Similarly, different degrees of δ2 cell population growth induction are induced by antibodies B1, 5A6. Detected between E9, 15D, B6, and B3. This data indicates that a unique epitope is required to induce specific and robust growth of the γδ cell population.

Example 22. Epitope mapping of activated γδTCR MAb

  Specific activation epitopes on the γδ TCR are identified for TS-1 MAbs as described below. Similar steps are performed to identify activated epitopes of other γδ activating antibodies described herein.

  First, specific γδ recombination recognized by TS-1 is identified. TS-1 antibody (Thermo Fisher Scientific) was generated by immunization of mice with human T cell acute lymphoblastic leukemia γδ cell line MOLT-13 (Brenner et al., US005260223A). We sequenced the MOLT-13 γδTCR chain and identified a specific δ chain rearrangement consisting of the Vδ1Dδ3Jδ1 gene segment. To determine if TS-1 binding specificity is for the variable region of Vδ1 or whether the binding site spans the TCR CDR3 region containing the Vδ1-Jδ1 junction and evaluate the role of the γ chain in epitope recognition For this purpose, an extensive set of γ and δ chains is cloned into the pCI expression vector (Promega). Different designs of γ and δ TCR chains were ordered from IDT as synthetic gBlocks. The synthetic gene digested with NheI-NotI is cloned into the pCI-neo vector. The sequence of plasmid DNA from individual bacterial colonies is confirmed by sequencing.

  Three Vδ1 gene segments that differ in the Jδ region are designed (Jδ1, Jδ2, and Jδ3). Furthermore, Vδ2Jδ1 and Vδ3Jδ1 chains were ordered as synthetic genes and cloned in the same manner. Five δTCR chains (Vδ1Jδ1, Vδ1Jδ2, Vδ1Jδ3, Vδ2 and Vδ3) cotransfected with γTCR chains using Vγ2, Vγ3, Vγ4, Vγ5, Vγ8, Vγ9 and Vγ10 gene segments. Thirty-five possible pair combinations of γδTCR are transfected and expressed on the surface of 293 transfected cells. Using Lipofectamine 2000 (Invitrogen), 293 cells are transiently transfected with a pCI vector encoding the γδ chain. Transfected 293 cells are identified for γδTCR expression by flow cytometry using a set of anti-γδTCR antibodies of various specificities. FACS analysis is performed on a FACSCanto flow cytometer (BD Biosciences) and analyzed using FlowJo software (Tree Star). Once the specific γδ TCR chain pair recognized by the TS-1 mAb is identified, it is characterized whether the specific binding epitope is linear or conformational epitope.

  The ability of the antibody to bind to denatured or native TCR is confirmed by Western blot analysis. Cell lysates of cells expressing TCR are prepared by homogenization in ice-cold modified RIPA lysis buffer (Sigma) containing a cocktail of protease inhibitors. Protein concentration is measured by Bradford assay (Bio-Rad protein assay, microplate standard assay). Cell lysate for 5 minutes in 1 × SDS loading buffer (50 mM Tris-HCl pH 6.8, 12.5% glycerol, 1% sodium dodecyl sulfate, 0.01% bromophenol blue) containing 5% b-mercaptoethanol Boil and perform polyacrylamide gel electrophoresis (PAGE). After electrophoresis, the separated molecules are transferred onto a PVDF membrane. The membrane is then blocked and incubated with the antibody. A secondary fluorescently labeled antibody is used for detection by a fluorescence imaging system.

  If binding to the δ chain is detected by Western blot analysis, a series of partially matched peptides bound to the synthetic membrane derived from the polypeptide sequence of the reaction chain is used. (JPT peptide technology GmbH Germany). The peptide array consists of partially matching 12-mer peptides that are offset by one residue and cover the entire Vδ1 sequence. Spot scan analysis is performed as follows. Wash the membrane 3 times with TBS and block overnight with blocking buffer (5% low fat milk in TBST (0.05% Tween 20 in TBS)). Wash membrane with TBS and incubate with TCS-1 MAb diluted to 1 μg / ml in blocking buffer for 3 hours at room temperature.

  After washing the membrane 3 times with TBS, MAb bound with HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) diluted in blocking buffer is detected for 2 hours at room temperature. Finally, the membrane is washed 3 times with TBS and incubated with signal generating solution. The color reaction is allowed to occur for 10-40 minutes at room temperature. The binding site is represented by the sequence of positive peptide spots.

Example 23. Epitope mapping of conformational epitopes Epitopes that require the formation of disulfide bonds for proper folding / assembly of antibody binding epitopes are known as conformational epitopes. Identification of important binding residues can be done by site-directed mutagenesis of the reactive Vdelta chain. Mutant chains are tested for loss of reactivity to specific antibodies. Residues encompassed by the binding site can be identified when TS-1 antibody binding is restored by mutagenesis of key residues in the otherwise non-reactive chain.

  Random Ala scans of reactive TCR chains can be used to assess changes in binding affinity, loss of recognition, or increased affinity due to TS-1 mAb.

Example 24. Epitope mapping of novel regulators of γδ T cell activation and proliferation CD2 epitope:

  The CD2 molecule consists of two extracellular immunoglobulin superfamily domains, Ig-like V-type and Ig-like C-type domains, for which three major immunogenic regions have been described (Davis et al., Immunol). Today 1996; 17: 177-187). Regions 1 and 2 are located in the first domain, and region 3 is located in the second domain. A monoclonal antibody (MAb) that recognizes region 1 binds to both resting and activated T cells and can strongly inhibit CD58 binding to CD2. Monoclonal antibodies that recognize region 2 have similar binding properties, but are not effective in blocking CD58 binding. Monoclonal antibodies that recognize region 3 recognize only CD2 on activated T cells and do not block CD58 binding.

  Mapping of the binding epitope of the CD2 agonist MAb is performed by competition and activation assays for CD58, the natural ligand for CD2. In addition, site-directed mutagenesis of key CD2 binding residues leading to loss of CD58 binding is tested for MAb binding. Examples of mutations include mutagenesis at position 67 (K to R), position 70 (Q to K), position 110 (Y to D) and position 111 (D to H) of the CD2 sequence. To design constructs for binding epitope mapping, sequence alignment of human and mouse CD2 is performed using VectorNTI (Thermo Fisher). The alignment shows 50% sequence homology between human and mouse. MAbs that bind to the extracellular domain of human CD2 are not expected to cross-react with mouse CD2. In order to identify binding epitopes, we generate domain swapping of mouse / human chimeric CD2 constructs. In such a construct, the human N-terminal Ig-like V-type domain (residues 25-128) is replaced with mouse residues (23-121) in an expression vector that expresses the extracellular domain of CD2. The chimeric cDNA species is transiently transfected into CHO or 293 cells. Human wild type CD2 and human mouse chimeric constructs are expressed on the surface of CHO cells. Chimeric CD2 cell surface expression is analyzed by FACScanto. Binding or loss of binding to the chimeric molecule is detected by flow cytometry and confirmed by an activation assay.

  NKG2D epitope:

  Epitope mapping of activated MAb to NKG2D is known to block anti-hNKG2D antibody ability to reduce or block NKG2D interaction with one or more of its ligands (MICA / MICB) or to block hNKG2D ligand interaction Test by competing with existing antibodies. Agonist MAbs are identified by their ability to reduce NKG2D-mediated activation of NK or T cells. This can be assessed by a typical cytotoxicity assay, the addition of a ligand blocking antibody, or a dose dependent block of γδ T cell mediated killing of MICA expressing tumor cells.

  CD27 epitope:

  Epitope mapping of agonist antibodies to CD27 is performed by functional assays and the ability to block the interaction between human CD27 and its natural ligand, human CD70. CD27 expressing cells are incubated with 5 μg MAb for 30 minutes at 4 ° C., after which 1 μg biotinylated CD70 is added to the tube. The mixture is incubated for an additional 15 minutes at 4 ° C. and then washed. The cells are then incubated for 30 minutes with a mixture of streptavidin-PE (for detection of CD70 ligand binding) followed by multiple washing steps and analysis using FACS. Blocking CD70 binding indicates that MAb and CD70 share the same epitope.

Example 25: Identification of TCR Vδ repertoire of expanded γδ T cell population The clonal diversity of expanded γδ T cells from individual donors is assessed by polymerase chain reaction (PCR). Clone of cultures in which clonal diversity of freshly isolated PBMC from healthy donors was stimulated for 7 and 13 days with different activators described herein including anti-TCR specific antibodies, ligands, and lectins Compare with diversity.

  The above-mentioned γδT cell-derived RNA is extracted, reverse transcribed into cDNA, and amplified by PCR using Vδ1, Vδ2, and Vδ3 specific primer pairs. Vδ1 forward primer (5′ATGCTGTTCTCCAGCCTGCTGTGTGTATTTT3 ′; SEQ ID NO: 1), Vδ2 forward primer (5′ATGCAGAGGATCTCCTCCCTCATCCATCT3 ′; SEQ ID NO: 2) and Vδ3 forward primer (5′ATGATCTCTGCTTGTGTCTGCTTGTGTGTCTTTGCT Used in combination with SEQ ID NO: 4) to amplify a 500 bp DNA fragment.

  Gamma chain separates Vγ2, Vγ3, Vγ4, and Vγ5 (5'GGTGCTTCTAGCTTTTCCTGTTCCCCTGC3 '), Vγ8 (5'ATGCTGTTGCTCTCTAGCTCTCTTCTACACTG' to use PCR) Amplified by reaction. The Vγ primer is paired with a Cγ reverse primer (5'GGAAGAAAAATATGTGGGCTTGGGGAA3 '). The γ reverse primer was based on the Cγ1 and Cγ2 consensus sequences. The PCR fragment is cloned to obtain the nucleotide sequence of 80 independent Vγ inserts. Vδ, Dδ and Jδ junction sequences are analyzed along with CDR3 sequence alignments.

Example 26: MAbs and related targeting constructs for the modification of γδ T cells The human CD20 gene is obtained from a cDNA clone (Origene Technologies, Inc., 6 Taft Court, Suite 100, Rockville, Md. 20850). The CD20 gene is amplified using a forward primer (5 ′ ATGACAACACCCAGAAATTCAGTAAATGG3 ′) and a reverse primer (5′TCAAGGAGAGCTGCATTTTTCTATTGGTG3 ′). The amplified CD20 cDNA is incorporated into pCDNA3.4 (Thermo Fisher Scientific) as a high expression vector for mammalian cells and transfected into CHO cells as host cells. Recombinant CHO cells that express CD20 molecules at high levels on the cell surface (CD20 / CHO cells) are identified by FACS analysis.

  CD20 / CHO cells were used in Jakobovits and Bornstein (Jakobovits Curr. Opin. Biotechnol. 1995 6: 561-6; Bornstein et al., Invest New Drugs. 2010, fully described in Humans 28: 561). BALB / C mice or transgenic mice that have been modified to produce are immunized. Antibodies with high affinity and specificity for human CD20 are screened by FACS assay. Mouse antibodies are humanized by CDR grafting (Kim and Hong Methods Mol Biol. 2012; 907: 237-45). Human single domain CD20 antibodies are also generated from mice or rats that have been modified to produce human heavy chain single domain antibodies (Janssens et al., PNAS 2006 vol. 103: 15130).

  The gene encoding the above high affinity / specificity CD20 antibody is cloned into the MSGV1 retroviral vector backbone or pCAG lentiviral vector. VH and VL domains are cloned from either mouse hybridomas or humanized antibody chains expressing the selected MAb. ΓδT cells are modified with the CD20 MAbs described herein.

Example 27: TCR construct for modification of γδ T cells A construct expressing a TCR comprising a highly reactive αβ TCR chain sequence from a T lymphocyte expressing a NY-ESO-1-MHC specific peptide complex. Isolate. NY-ESO-1-MHC specific peptide conjugates induce potent in vitro and in vivo anti-tumor activity against various NYESO-1-expressing tumors.

  Highly reactive αβTCR chains are isolated from mice with melanoma, sarcoma patients, or patient-derived xenografts obtained from human melanoma or sarcoma. Alternatively, the TCR is obtained from a mouse that has been modified to have a humanized immune system that expresses the NY-ESO-1 peptide or NYESO-1 peptide complex (Gonzales et al., Immunol Res. 2013 57: 326-334; Bucherma et al., J Immuno. 2013. 191; 583-593; Liang-PingL. Et al., Nature Med. 2010, 16: 1029-1035). T cells that recognize an epitope of NY-ESO-1 in the context of a dominant class I allele HLA-A * 02 (eg, peptide SLLMWITCQC residues 157-167) and a dominant HLA-A * 01 related peptide are identified.

  TCRα and TCRβ transcript sequences are generated by reverse transcription polymerase chain reaction (RT-PCR) using a one-step RT-PCR kit (Qiagen Hilden Germany) according to the manufacturer's recommendations. First strand cDNA is generated from RNA isolated from reactive T cells. Total RNA is extracted from CTL clones with TRIzol total RNA isolation reagent (Invitrogen Life Technologies). It can bind to highly conserved regions of TCRα and β chain V regions centered on tryptophan-tyrosine residues at amino acids 34 and 35 (Kabat numbering), and α and β constant region reverse primers (Mononka and Loh Journal of TCRα and β chain amplification is performed with a series of degenerate primers used in conjunction with Immunological Methods 169 (1994) 41-51). Amplified PCR fragments are gel purified and sequenced directly. The sequence information is used to design PCR primers suitable for the cloning of individual full-length cDNAs.

  The TCR gene is cloned and inserted into an MSGV-based retroviral vector to amplify full length cDNA from selected T cells. A retroviral vector is constructed that encodes both the α and β chains of wild-type NY-ESO-1-reactive human TCR using the MSGV1 backbone. Linking the TCRα and TCRβ chains through an internal ribosome entry site (IRES) element in one construct or by separation using a cleavable picorovirus peptide sequence.

  Encode each MSGV1 TCR vector and endogenous virus retrovirus envelope protein into 293 cells stably expressing MMLV gag and pol proteins using the aforementioned Lipofectamine 2000 (Invitrogen) or by electroporation using Nucleofector (Lonza). A retroviral supernatant is generated by co-transfecting the vector to be transfected. Supernatants were collected on days 2 and 3 after transfection and diluted 1: 1 with fresh DMEM containing 10% FCS. Without any further manipulation, the modified γδ T cells can express genes encoding TCRα and β chains.

Example 28. Modification of γδ T cells with αβ TCR constructs Polynucleotides containing αβ TCRs (tumor recognition moieties) are cloned from T cells that are specific for the desired antigen using standard techniques. Prior to infection with a retrovirus or lentivirus containing an expression cassette encoding a tumor recognition portion, isolated endogenous wild type γδ T cells are grown to at least 6 × 10 ⁶ cells as described in the previous examples. Vector systems can be introduced into wild type γδ T cells using standard procedures for viral infection. Cells that have been successfully transfected are selected using expression of the selectable marker.

  The expression of modified αβTCR can be assessed by flow cytometry and / or quantitative QRT-PCR and functional assays for cytotoxicity and cytokine secretion in target cells. The expression of modified activation domains can also be assessed by flow cytometry and / or quantitative qRT-PCR. The number of modified γδ T cells expressing the cell surface marker of interest is measured by flow cytometry. Further modification of the modified γδ T cells with suitable methods described herein, such as CRISPR-Cas, talen, meganuclease, zinc finger, or sleeping beauty transposon technology to lack exons associated with HLA or β2M genes. To lose.

Example 29: Modification of γδ T cells with CAR and TCR constructs Retro or expressing a targeting moiety capable of inducing modified γδ T cells to specifically recognize and activate tumor cells and kill them Lentiviral based vectors are transduced into γδT cells. The targeting moiety to be transduced includes MAbs directed against tumor-specific surface proteins or tumor-specific intracellular peptides. γδT cells are also modified by a high affinity TCR directed at peptide-MHC complexes.

  Alternatively, cells can be modified by transduction with non-viral vectors.

Example 30: Modification of isolated γδ T cells with targeting moiety CAR construct design includes different major functional domains, targeting moiety recognizing protein of interest or MHC binding peptide posted on tumor cells, extracellular receptor There is a short spacer that links the body-targeting element to the transmembrane domain, which traverses the cell membrane and connects to the intracellular activation signaling domain.

  Target partial receptors expressed on the surface of γδ T cells are designed to specifically bind to target proteins expressed on cancer cells. Tumor recognition moieties include CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), CEACAM5 CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP-1, Includes STEAP-2, mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, and SLTRK6 It is designed for Chibyo target.

  The target partial receptor can be derived from a portion of an antibody specific for a tumor glycoprotein expressed on the surface of a tumor cell, or alternatively, the modified receptor can be a TCR with a known specificity. Receptor or gp100, MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGEA family gene (eg MAGE3A, MAGE4A etc.), KKLC1, mutant ras, βraf, p53, MHC class I chain related Specific peptides derived from intracellular tumor-specific antigens presented on the surface in conjunction with MHC complexes, including molecule A (MICA), MHC class I chain related molecule B (MICB), HPV, or CMV It can be derived from an antibody that recognizes the sequence. Such high affinity T cell receptors, such as tumor recognition moieties, will recognize peptide-MHC complexes with a high degree of specificity.

Example 31: Targeting moiety constructs with spacers and transmembrane domains In order to optimize the efficacy of modified T cells against cancer cells, various spacers will be modified in the tumor recognition moiety construct. The size of each spacer will vary depending on the size of the target protein, the epitope recognized by the receptor, the size of the modified tumor recognition moiety and the affinity of the receptor. Spacers that can accommodate conformational changes include sequences of human IgG, CD8a and CD4 hinge regions.

  The spacer to be tested consists of Gly, Ser, and Thr amino acids used at different lengths (19-9 residues) to provide improved binding affinity for the chimeric receptor. The hinge and transmembrane portion of each construct is derived from the human IgG1 hinge-Fc cDNA with the CD8a sequence (residues 117-178 of human CD8a), or alternatively, the CD28 transmembrane domain (residues 153-179). .

Example 32: Targeting moiety constructs with costimulatory domains Various costimulatory domains will be modified into constructs containing tumor recognition moieties. Co-stimulatory or CD100 co-stimulatory signaling domains including CD28, 4-1BB, CD2, CD27, NKG2D, CD161, CD30, JAML, CD244 are modified in γδ T cells to amplify activation through chimeric receptors Mimics the "secondary signal" that results in a more robust signal that proliferates and kills cancer cells.

  The cytoplasmic regions are CD28 (residues 180-220), CD137 (residues 214-225), ICOS (residues 165-199), CD27 (residues 213-260), NKG2D (residues 1-51), JAML (Residues 297-394), CD2 (residues 236-351), CD30 (residues 408-595), OX40 (residues 1-23), HVEM (residues 224-283), or αβ including CD46 molecules And / or derived from the endodomain of a γδ T cell costimulatory molecule. The optimal construct is selected based on the degree of activation of the modified γδ T cell population in inducing cytotoxicity and the degree of cytokine secretion in vitro and in vivo.

Example 33: Targeting moiety comprising CD3ζ activation domain Three ITAM domains (ITAM1: APAYQQGQNQLYNELNLGRREEYDVLDKR, (SEQ ID NO: 5); ITAM2: PQRRKNPQEGLYNELKKDKMEAEYSEIGM, (QGST), TGQ Intracellular CD3ζ (residues 52-164) was cloned.

  The intracellular domain of TCRζ was amplified using the primer 5 'AGAGTGAAGTTCAGCAGGAGGCGCA-3' (SEQ ID NO: 8) and the reverse primer 5 'CTCGAGTGGCTGTAGCCAGA-3' (SEQ ID NO: 9).

  CAR constructs are generated by multi-step overlap extension PCR. The overlap extension polymerase chain reaction protocol was used to fuse the product in a separate PCR reaction induced by primers conjugated with Platinum Taq DNA polymerase high fidelity kit (Invitrogen). DNA encoding the full-length construct was ligated into the MSGV1 retroviral vector. This construct yields a CAR targeting moiety that includes a CD3ζ activation domain.

Example 34: Modification of γδ T cells with two or more recognition moieties Transfecting γδ T cells with two or more constructs containing tumor recognition moieties including TCR and MAb directed to the same intracellular tumor-specific protein Introduce. Select each construct to recognize specific peptides in the context of different MHC haplotypes such as A2 and A1, etc., antibodies directed against different targets expressed on the same tumor cell or different epitopes on the same target It is an antibody directed to.

Example 35. In vitro proliferation of modified γδ T cells The modified γδ T cells are grown and expanded in a suitable tissue culture medium, such as the tissue culture medium described in the previous examples. Modified γδ T cells are grown exponentially to about 1 × 10 ⁶ at 37 ° C. in a 5% CO ₂ incubator with or without stimulation with external antigen and without co-culture with APC or aminophosphate.

Example 36: Functional characterization of cytokines released by activated modified and unmodified γδ T cells IFN-γ, TNF-α (R & D Systems), IL-1β, IL-2, (Biosource International), IL Expression of -12 (Diaclone Research) and IL-18 is measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit. Enzyme-linked immunosorbent assays are performed according to the manufacturer's instructions. Cytokine amounts were determined at different time points (24x24) in polystyrene 96-well plates (Maxisorb, Nunc) coated with monoclonal mouse IgG1 against human cytokines at 4 ° C overnight at a concentration of 1 μg / ml in 0.05 M sodium bicarbonate buffer. ~ 72 hours). After washing with PBS containing Tween 20, the plates are blocked with 3% bovine serum albumin (BSA, weight / volume, Sigma) in PBST for 1 hour at 37 ° C. Standards (recombinant human cytokines available from R & D) and supernatants from γδ culture samples are added and the plates are incubated for 2 hours at room temperature. Detection with corresponding antibody pair against recombinant human cytokine standard.

Example 37. Identification of Costimulators Various co-stimulatory agents that aid in activation, proliferation and viability of modified and unmodified γδ T cells by adding costimulators to the total PBMC or enriched modified and unmodified γδ T cell population. Test ability. Co-stimulants are added in soluble or immobilized form to various activators including anti-γδ TCR specific MAbs. Lymphocytes isolated from human PBMC or tissue purified from buffy coats of healthy donors as described in the previous examples, 1 mL of complete RPMI supplemented with 100 IU / mL rhI1-2 in 24-well flat bottom tissue. Soluble or immobilized agonist antibody to CD2, CD27, CD28, CD30, CD137, ICOS, CD161, CD122, CD244, and NKG2D, or 2 x 10 ⁶ in 1640 medium with 2-10 μg anti-γδTCR antibody, or CD70 -Presence or absence of stimulating ligands including FC (ligand for CD27), MICA, MICB and ULBP (ligand for NKG2D), 4-1BB (ligand for CD137), and Pilar9 (ligand for CD161) Incubate under.

Example 38. Cytokine Assisted Activation The ability of various cytokines to support the activation, proliferation and viability of modified and unmodified γδ T cells is tested by adding the cytokine to the total PBMC or enriched modified and unmodified γδ T cell population. To test for cytokine activation aid, various cytokines are added individually to separate cell cultures at 100 IU / mL every 3 days. The cytokines tested include IL-2, IL-7, IL-12, IL-15, IL-33, IL-21, IL-18, IL-19, IL-4, IL-9, IL-23, and IL1β is included. At the end of the selected period, a sample of cells is taken and the composition of the cell population, ie the percentage of γδT cells, αβT cells, B cells, and NK cells, is determined by flow cytometry.

  Cell culture is continued and the growth of the selected population on days 14 and 21 is examined.

Example 39: In vitro modified and unmodified γδ T cell in vitro cytotoxicity assay Modified or unmodified γδ-T cell in vitro cytotoxicity assay consists of four different cytotoxicity assays: 1) tumor cell lysis; 2 Measured by :) cytokine release by activated T cells; 3) LDH assay; and 4) activation of CD107a expression. Various human tumor cell lines or human tumor-derived cells (patient-derived xenograft tumor lines) derived from colon, breast, ovary, kidney, head and neck, oral cavity, pancreas and liver cancer are used as target cells without limitation. Normal human mammary epithelial cells (HMEC) are used as a negative control. Briefly, target cells to be grown are seeded in 96 well plates at 1 × 10 ⁴ cells per well. After 24 hours, the medium was removed and activated T cells in RPMI medium (RPMI-1640 available from Corning, 10% Hyclone fetal calf serum, 2 mmol / L L-glutamine, 100 U / mL penicillin, 100 U / mL streptomycin). In an effector-to-target ratio of 20: 1 or 40: 1 and incubate for 5 hours at 37 ° C. in a humidified atmosphere of 5% CO ₂ . Cytokines released by modified and unmodified γδ-T cells are collected after this incubation by co-culture supernatants and IFN-γ, IL2, TNFα, IL-6 and IL-6 using a commercially available ELISA kit (BioLegend). It is measured by quantifying the secretion of cytokines including IL1β. The LDH assay is performed using the LDH cytotoxicity detection kit (Roche) according to the manufacturer's instructions. Finally, after addition of γδ-T cells to target cells, CD107a expression is measured by adding 5 ul of CD107a antibody conjugated to Cy7PE (BioLegend). Centrifuge the plate briefly and incubate for 1 hour at 37 ° C. in a humidified atmosphere of 5% CO ₂ , then add 8.5 μL of 1:50 dilution of Golgi stop BD Biosciences (BD). Incubate cells for an additional 2 hours at 37 ° C. in a humidified atmosphere of 5% CO ₂ . Following this incubation, cells are harvested on ice, washed once with cold HBSS, and stained with 1 ul of zombie aqua (BioLegend) amine staining dye to determine the viable cell population in 100 ul of HBSS. Cells were washed with FACS staining medium (FSM; HBSS containing 2% fetal calf serum), Vδ1 antibody conjugated to FITC (clone TS8.2 available from ThermoFisher) and Vδ2 antibody conjugated to PE (available from BioLegend) Resuspend in 100 ul FSM containing a saturating amount of antibody, including clone B6). The antibody is incubated with the cells for 30 minutes on ice and then washed with an excess of HBSS. Stained populations are collected with BD FACSCanto II and analyzed using FlowJo v10.1 software.

Example 40 Antitumor Activity of Proliferated γδ T Cells In Vitro Cytotoxic activity against various tumor cell lines and primary tumor cells is tested at an effector-to-target ratio of 1: 1 to 40: 1. By detecting the release of lactate dehydrogenase, an intracellular enzyme, lysis of tumor cell lines and primary tumor cells is measured. The percentage of γδ T cells expressing the modified tumor recognition moiety in the culture is measured by flow cytometry, ELISA and / or ELISPOT assay.

Example 41: In vivo anti-tumor activity In cohorts of immunodeficient mice transplanted with human tumor xenografts, or huPBMC-NOG (Taconic) mice, or mice with the aforementioned humanized immune system, colon, breast, kidney, head Cells from patient-derived tumors or tumor cell lines including cancer of the cervix, prostate, bladder, oral cavity, pancreas and liver are injected subcutaneously or in situ to reach an average size of 100 mm ³ . Either enriched or isolated naïve or modified γδ-T cells are injected intravenously into a range of doses or directly into the tumor. Tumor regression is defined as a decrease in tumor volume after γδ-T cell administration compared to untreated and standard treatments for specific indications. In some experiments, naïve or modified γδ T cells are labeled with GFP or luciferase and injected into tumor-bearing mice to follow their persistence and homing. At the end of the study, tumors were harvested and analyzed for GFP positive cells by flow cytometry and immunohistochemistry.

Example 42. Cryopreservation of γδT cells in freezing medium to create a cell bank for further processing Unmodified γδT cells are formulated in freezing medium for long-term storage and stored in a cryopreservation device such as a liquid nitrogen freezer (-195 ° C) or an ultra-low temperature refrigeration apparatus (-65 ° C, -80 ° C or -120 ° C). Freezing medium contains dimethyl sulfoxide (DMSO), sodium chloride (NaCl), dextrose, dextran sulfate or hydroethyl starch (HES) with a physiological pH buffer in the range of 6.5-7.5. Will do.

Cryopreserved γδ T cells are thawed and further processed by stimulation with antibodies, proteins, peptides, and cytokines. Cryopreserved γδT cells are thawed and genetically modified as described above in this application. The modified γδ T cells are further cryopreserved to produce cell banks of 10, 100, 200 vials with 10 ⁶ to 10 ⁸ cells per mL in freezing medium.

Example 43. Alternative cryopreservation of γδ T cells in freezing medium to create a cell bank for further processing Other cryoprotectants are added to the cryopreservation carrier described in the previous examples to maintain nutrition and freeze and thaw processes Provides biophysical cellular protection against lysis of These include D-glucose, mannitol, sucrose, adenine, guanosine, recombinant human albumin, citrate, anticoagulant, benzonase, DNase, propylene glycol, ethylene glycol, 2-methyl-2,4-pentanediol. . Additional additives intended to provide buffering capacity for high cell density frozen products include inorganic phosphate, sodium bicarbonate and HEPES.

Example 44. Cryopreservation of γδ T cells in freezing medium to create a cell bank for further processing A machine with a rate-controlled refrigeration device (eg CryoMed control rate freezer) or a suitably insulated racking system that provides the desired freezing rate Using the formula-70 ° C freezer, the first freeze of γδ T cells is performed with a temperature controlled ramp intended to achieve a freezing rate of -0.1 ° C to -0.5 ° C per minute. Place frozen cells in -70 ° C freezer for short-term storage up to 30-60 days. Liquid N ₂ storage for long term storage at 12, 24, 36 and 48 months up to γδT cell count and cell function without degradation when measured by the method described in the previous section Place frozen cells in tank.

  The cryopreserved cells described in this example are thawed and further stimulated and grown in a suitable closed container, such as a cell culture bag and / or bioreactor, to provide an amount of modified γδT suitable for administration to a subject Generate cells.

Example 45. Formulation of γδ T cells for direct infusion into a patient Modified γδ T cells to 5 × 10 ⁶ cells / mL to 10 ⁸ cells / mL in physiological buffer containing cryoprotective additive by centrifugation and / or membrane diafiltration. Concentrate and place in a cryopreservation device such as liquid nitrogen, or a cryogenic refrigeration device for long-term storage.

Example 46. Treatment of a human subject suffering from cancer Fresh or frozen modified γδ T cells are thawed at the bedside and injected intravenously into a human subject. About 1 cell / kg to about 1 × 10 ¹⁰ cells / kg of modified γδ T cells are infused into a human subject over 30-60 minutes. Modified γδ T cells are administered with or without the aid of costimulatory cytokine IL-2 or other cytokines. Optionally, the treatment is repeated. In vivo proliferation of γδ T cells in the subject is measured by flow cytometry.

  While preferred embodiments of the present invention have been presented and described herein, it will be apparent to those skilled in the art that such embodiments are provided for purposes of illustration only. Those skilled in the art will now readily be able to conceive numerous variations, modifications and substitutions without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. The following claims are intended to define the scope of the invention, which is intended to cover the methods and constructions within the scope of these claims and their equivalents.

Claims (164)

  The γδ T cell population, wherein the proliferation of the γδ T cell population is activated by an agent that stimulates the proliferation of the γδ T cell population at an average rate of cell division once in less than 24 hours.   The γδ T cell population of claim 2, wherein the average rate is one cell division in less than 8 hours.   2. The γδ T cell population of claim 1, wherein the expanded γδ T cell population comprises a percentage of δ1 T cells.   4. The γδ T cell population of claim 3, wherein the percentage of δ1 T cells in the expanded γδ T cell population is greater than 5%.   The γδ T cell population of claim 1, wherein the expanded γδ T cell population comprises a percentage of δ2 T cells.   6. The γδ T cell population of claim 5, wherein the percentage of expanded δ2 T cells in the γδ T cell population is greater than 5%.   2. The γδ T cell population of claim 1, wherein the expanded γδ T cell population comprises a percentage of δ3 T cells.   8. The γδ T cell population of claim 7, wherein the percentage of expanded δ3 T cells in the γδ T cell population is greater than 5%.   2. The γδ T cell population of claim 1, further comprising an amount of modified γδ T cells.   10. The γδ T cell population of claim 9, wherein the modified γδ T cells are modified to express a tumor recognition moiety.   10. The γδ T cell population of claim 9, wherein the modified γδ T cell lacks a human HLA locus.   2. The γδ T cell population of claim 1, wherein the agent is an antibody.   The γδ T cell population according to claim 12, wherein the antibody is immobilized on a surface.   The antibody is 5A6. 13. The γδ T cell population of claim 12, selected from the group consisting of E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, and 11F2 antibodies. .   The γδ T cell population of claim 1, wherein the agent is a ligand.   The ligand is αTCR, βTCR, γTCR, δTCR, CD277, CD28, CD46, CTLA4, ICOS, PD-1, CD30, NKG2D, NKG2A, HVEM, 4-1BB (CD137), OX40 (CD134), CD70, CD80, The γδ T cell population of claim 15, which binds to a molecule selected from the group consisting of CD86, DAP, CD122, GITR, FceRIg, CD1, CD16, CD161, DNAX, accessory molecule 1 (DNAM-1), and SLAM. .   An activated epitope of γδ T cells that stimulates the growth of a γδ T cell population with an average rate of cell division once in less than 24 hours.   18. The activated epitope of claim 17, wherein the average rate is 1 cell division in less than 8 hours.   The activated epitope of claim 17, which is the amino acid sequence of δTCR.   20. The activated epitope of claim 19, which is the amino acid sequence of δ1, δ2, or δ3 TCR.   5A6. Bound by any one of the antibodies selected from the group consisting of E9, B1, TS8.2, 15D, B6, B3, TS-1, γ3.20, 7A5, IMMU510, R9.12, and 11F2 antibodies The activated epitope of claim 17, which is an epitope.   18. The activated epitope of claim 17, comprising an amino sequence from the Vδ1 gene segment and an amino sequence selected from the group consisting of Jδ1, Jδ2, Jδ3, and Jδ4 gene segments.   The activated epitope of claim 17, which is a conformational epitope.   The activated epitope of claim 17, which is a linear epitope.   Modified γδ T cells that have been modified to express a tumor recognition portion that recognizes a tumor antigen and proliferate at an average rate of one cell division within about 2 to about 20 hours.   The modified γδ T cell according to claim 25, which is a universal donor cell.   A method for treating cancer in a subject in need, using the modified γδ T cell according to claim 25.   The modified γδT cell according to claim 25, which is a tumor-specific allogenic γδT cell.   26. The modified [gamma] [delta] T cell of claim 25 that has been modified to express two or more tumor recognition moieties.   30. The modified γδ T cell of claim 29, wherein the two or more tumor recognitions are different and each different tumor recognition moiety has been modified to recognize a different epitope of the same antigen.   30. The modified γδ T cell of claim 29, wherein the two or more tumor recognition portions are different and each different tumor recognition portion has been modified to recognize a different epitope of a different antigen.   26. The modified γδ T cell according to claim 25, wherein the tumor recognition portion is derived from a tumor infiltrating lymphocyte.   26. The modified γδ T cell according to claim 25, wherein the tumor recognition moiety is cloned from a T cell.   26. The modified γδ T cell of claim 25, wherein the tumor recognition moiety has been synthetically modified.   26. The modified γδ T cell of claim 25, wherein the tumor recognition portion is derived from a library of tumor recognition portions.   26. The modified γδ T cell according to claim 25, wherein the tumor recognition moiety is a modified T cell receptor.   37. The modified γδ T cell of claim 36, wherein the modified T cell receptor is derived from a human T cell receptor.   37. The modified γδ T cell of claim 36, wherein the modified T cell receptor is derived from a mouse T cell receptor.   37. The modified γδ T cell of claim 36, wherein the modified T cell receptor is a chimeric T cell receptor and the chimeric receptor comprises a polynucleotide from one or more species.   37. The modified γδ T cell according to claim 36, wherein the modified T cell receptor is a modified αβ TCR.   37. The modified γδ T cell of claim 36, wherein the modified T cell receptor is a modified γδ TCR.   26. The modified γδ T cell of claim 25, wherein the tumor recognition moiety is a single domain antibody.   26. The modified γδ T cell according to claim 25, wherein the tumor recognition moiety is Fab.   26. The modified γδ T cell according to claim 25, wherein the tumor recognition moiety is an antibody, antibody fragment, or antigen-binding fragment thereof that recognizes a tumor antigen.   45. The modified γδ T cell of claim 44, wherein the tumor recognition moiety is derived from a camel B cell or a llama B cell.   45. The modified γδ T cell of claim 44, wherein the tumor recognition moiety is derived from a human B cell.   45. The modified γδ T cell of claim 44, wherein the tumor recognition moiety is derived from a mouse or rat B cell.   The tumor antigen is lymphoma antigen, leukemia antigen, multiple myeloma antigen, breast cancer antigen, prostate cancer antigen, bladder cancer antigen, colon and rectal cancer antigen, brain cancer antigen, stomach cancer antigen, head and neck cancer antigen, kidney cancer antigen, lung cancer 26. The modified γδ T cell according to claim 25, which is an antigen, pancreatic cancer antigen, sarcoma antigen, mesothelioma antigen, ovarian antigen, or melanoma antigen.   26. The modified γδ T cell according to claim 25, wherein the tumor antigen is a peptide-MHC complex and the tumor recognition moiety recognizes the peptide-MHC complex.   26. The modified γδ T cell according to claim 25, wherein the antigen is a homing receptor.   The modified γδ T cell according to claim 25, wherein the antigen is an immunoreceptor.   26. The modified γδ T cell according to claim 25, wherein the antigen is an activated immune receptor.   26. The modified γδ T cell according to claim 25, wherein the antigen is an inactivated immune receptor.   26. The modified γδ T cell according to claim 25, wherein the tumor antigen is expressed extracellularly as a peptide-MHC complex.   The tumor antigen is CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), CEACAM5 CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP-1, STEAP-2, mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK6, gp10 , MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGEA family gene (for example, MAGE3A and MAGE4A), KKLC1, mutant ras, βraf, p53, MHC class I chain-related molecule A (MICA) 26. The modified γδ T cell of claim 25, selected from the group consisting of: MHC class I chain associated molecule B (MICB), HPV, or CMV.   The modified γδ T cell according to claim 25, which expresses a modified activation domain derived from αβ T cell.   The modified γδ T cell according to claim 25, which expresses a modified activation domain derived from γδ T cell.   A modified activation domain derived from a CD28, CD2, CTLA-4, ICOS, JAMAL, PD-1, 41-BB, CD27, CD30, OX40, NKG2D, HVEM, CD46, or CD3ζ gene is expressed in claim 25. Modified γδ T cells as described.   26. The modified [gamma] [delta] T cell of claim 25 that lacks a human HLA locus.   60. The modified γδ T cell of claim 59, wherein the HLA locus is selected from the group consisting of HLA-A, HLA-B, and HLA-C.   60. The modified γδ T cell of claim 59, wherein the HLA locus is selected from the group consisting of HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.   60. The modified γδ T cell of claim 59 that has been modified to lack expression from two or more HLA loci.   The modified γδT cell according to claim 25, which is a tumor infiltrating lymphocyte. 26. The modified γδ T cell according to claim 25, which is derived from a Vδ1 ⁺ T cell. 26. The modified γδ T cell according to claim 25, which is derived from a Vδ2 ⁺ T cell. 26. The modified γδ T cell according to claim 25, which is derived from a Vδ3 ⁺ T cell. 26. The modified γδ T cell of claim 25, derived from a mixture of Vδ1 ⁺ , Vδ2 ⁺ , and Vδ3 ⁺ T cells. The modified γδ T cell according to claim 25, which is derived from a CD3 ⁺ T cell. CD3 ^- derived T cells, modified γδT cells according to claim 25.   26. The modified γδ T cell of claim 25, further modified to express a homing molecule.   72. The modified γδ T cell of claim 70, wherein the homing molecule adheres and infiltrates a solid tumor.   26. The modified γδ T cell of claim 25, further modified to lack at least one immune checkpoint gene.   The modified γδ T cell according to claim 72, wherein the immune checkpoint gene is a CTLA-4 gene.   The modified γδ T cell according to claim 72, wherein the immune checkpoint gene is a PD-1 gene.   26. The modified γδ T cell of claim 25, wherein the average rate is one cell division in less than 8 hours.   Modified γδ T cells that have been modified to express an antigen recognition moiety that recognizes an antigen associated with an autoimmune disease.   77. The modified γδ T cell of claim 76 that has been modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing the same or different autoimmune antigen.   77. The modified γδ T cell of claim 76, which has been modified to express an antigen recognition moiety that recognizes a pathogenic antigen.   77. The modified γδ T cell of claim 76, wherein the modified γδ T cell is modified to express two or more antigen recognition portions, each antigen recognition portion recognizing a different epitope of the same pathogenic antigen.   77. The modified γδ T cell of claim 76 that has been modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing a different pathogenic antigen.   77. The modified γδ T cell of claim 76, wherein the pathogenic antigen is a bacterial protein.   77. The modified γδ T cell of claim 76, wherein the pathogenic antigen is a viral protein.   A method of treating a subject in need, comprising administering to the subject at least one modified γδ T cell, wherein the at least one γδ T cell is modified to express a tumor recognition portion. And the tumor recognition part recognizes a tumor antigen.   84. The method of claim 83, wherein the modified γδT cell is a universal donor cell.   84. The method of claim 83, wherein the at least one modified γδ T cell is modified to express two or more tumor recognition moieties.   86. The method of claim 85, wherein the two or more tumor recognition portions are different, each different tumor recognition portion being modified to recognize a different epitope of the same antigen.   86. The method of claim 85, wherein the two or more tumor recognition portions are different and each different tumor recognition portion has been modified to recognize a different antigen.   84. The method of claim 83, wherein the at least one modified γδ T cell is a tumor infiltrating lymphocyte.   84. The method of claim 83, wherein the tumor recognition moiety is cloned from T cells.   84. The method of claim 83, wherein the tumor recognition moiety has been synthetically modified.   84. The method of claim 83, wherein the tumor recognition portion is derived from a library of tumor recognition portions.   84. The method of claim 83, wherein the tumor recognition moiety is a modified T cell receptor.   94. The method of claim 92, wherein the modified T cell receptor is derived from a human T cell receptor.   94. The method of claim 92, wherein the modified T cell receptor is derived from a mouse T cell receptor.   94. The method of claim 92, wherein the modified T cell receptor is a chimeric T cell receptor, and the chimeric receptor comprises a polynucleotide from one or more species.   94. The method of claim 92, wherein the modified T cell receptor is a modified [alpha] [beta] TCR.   94. The method of claim 92, wherein the modified T cell receptor is a modified γδ TCR.   84. The method of claim 83, wherein the tumor recognition moiety is a single domain antibody.   84. The method of claim 83, wherein the tumor recognition moiety is a Fab.   84. The method of claim 83, wherein the tumor recognition moiety is an antibody, antibody fragment, or antigen-binding fragment thereof that recognizes a tumor antigen.   101. The method of claim 100, wherein the tumor recognition moiety is derived from camel B cells or llama B cells.   101. The method of claim 100, wherein the tumor recognition moiety is derived from human B cells.   101. The method of claim 100, wherein the tumor recognition moiety is derived from mouse or rat B cells.   The tumor antigen is lymphoma antigen, leukemia antigen, multiple myeloma antigen, breast cancer antigen, prostate cancer antigen, bladder cancer antigen, colon and rectal cancer antigen, brain cancer antigen, stomach cancer antigen, head and neck cancer antigen, kidney cancer antigen, lung cancer 84. The method of claim 83, wherein the method is an antigen, pancreatic cancer antigen, sarcoma antigen, mesothelioma antigen, ovarian antigen, or melanoma antigen.   84. The method of claim 83, wherein the tumor antigen is a peptide-MHC complex and the tumor recognition moiety recognizes the peptide-MHC complex.   84. The method of claim 83, wherein the antigen is a homing receptor.   84. The method of claim 83, wherein the antigen is an immunoreceptor.   84. The method of claim 83, wherein the antigen is an activated immune receptor.   84. The method of claim 83, wherein the antigen is an inactivated immune receptor.   84. The method of claim 83, wherein the tumor antigen is expressed extracellularly as a peptide-MHC complex.   The tumor antigen is CD19, CD30, CD22, CD37, CD38, CD56, CD33, CD30, CD138, CD123, CD79b, CD70, CD75, CA6, GD2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), CEACAM5 CA-125, MUC-16, 5T4, NaPi2b, ROR1, ROR2, 5T4, PLIF, Her2 / Neu, EGFRvIII, GPMNB, LIV-1, glycolipid F77, fibroblast activation protein, PSMA, STEAP-1, STEAP-2, mesothelin, c-met, CSPG4, Nectin 4, VEGFR2, PSCA, folate binding protein / receptor, SLC44A4, crypto, CTAG1B, AXL, IL-13R, IL-3R, SLTRK6, gp10 , MART1, tyrosinase, SSX2, SSX4, NYESO-1, epithelial tumor antigen (ETA), MAGEA family gene (eg MAGE3A, MAGE4A, etc.), KKLC1, mutant ras, raf, p53, MHC class I chain related molecule A (MICA) 84. The method of claim 83, wherein the method is selected from the group consisting of: MHC class I chain associated molecule B (MICB), HPV, or CMV.   84. The method of claim 83, wherein the modified γδ T cell expresses a modified activation domain, and the modified activation domain is derived from an αβ T cell.   84. The method of claim 83, wherein the modified γδ T cell expresses a modified activation domain, and the modified activation domain is derived from a γδ T cell.   84. The activation domain of claim 83, wherein the activation domain is derived from a CD28, CD2, CTLA-4, ICOS, JAMAL, PD-1, 41-BB, CD27, CD30, OX40, NKG2D, HVEM, CD46, or CD3ζ gene. Method.   84. The method of claim 83, wherein the modified γδ T cell lacks a human HLA locus.   116. The method of claim 115, wherein the HLA locus is selected from the group consisting of HLA-A, HLA-B, and HLA-C.   116. The method of claim 115, wherein the HLA locus is selected from the group consisting of HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.   116. The method of claim 115, wherein the modified γδ T cell has been modified to lack expression from more than one HLA locus.   84. The method of claim 83, wherein the at least one modified γδ T cell is a tumor infiltrating lymphocyte. 84. The method of claim 83, wherein the at least one modified γδ T cell is derived from a Vδ1 ⁺ T cell. 84. The method of claim 83, wherein the at least one modified γδ T cell is derived from a Vδ2 ⁺ T cell. 84. The method of claim 83, wherein the at least one modified γδ T cell is derived from a Vδ3 ⁺ T cell. 84. The method of claim 83, wherein the two or more γδ T cells administered to the subject are Vδ1 ⁺ , Vδ2 ⁺ , Vδ3 ⁺ T cells, or any combination thereof. 84. The method of claim 83, wherein the at least one modified γδ T cell is derived from a CD3 ⁺ T cell. 84. The method of claim 83, wherein the at least one modified γδ T cell is derived from a CD3 ^- T cell.   84. The method of claim 83, wherein the modified γδ T cell is further modified to express a homing molecule.   127. The method of claim 126, wherein the homing molecule adheres and infiltrates a solid tumor.   84. The method of claim 83, wherein the modified γδ T cell is further modified to lack at least one immune checkpoint gene.   129. The method of claim 128, wherein the immune checkpoint gene is a CTLA-4 gene.   129. The method of claim 128, wherein the immune checkpoint gene is a PD-1 gene.   84. Administer the at least one modified γδ T cell to the subject in a first regimen and administer at least one other modified γδ T cell to the subject in the modified regimen after the monitoring. The method described in 1.   84. The method of claim 83, wherein the at least one modified γδ T cell grows in vitro at an average rate of one cell division within about 2 to about 20 hours.   A method of treating a subject in need, comprising administering to the subject at least one modified γδ T cell, wherein the at least one modified γδ T cell expresses an antigen recognition portion. The method of treatment, wherein the antigen recognition portion recognizes an antigen associated with an autoimmune disease.   134. The method of claim 133, wherein the modified γδ T cells are modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing a different epitope or a different antigen of the same autoimmune antigen.   134. The method of claim 133, wherein the modified γδ T cells are modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing a different epitope or a different antigen of the same autoimmune antigen.   134. The method of claim 133, wherein the modified γδ T cells are modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing a different epitope or a different antigen of the same pathogenic antigen.   134. The method of claim 133, wherein the modified γδ T cells are modified to express two or more antigen recognition moieties, each antigen recognition moiety recognizing two different pathogenic antigens.   143. The method of claim 133, wherein the pathogenic antigen is a bacterial protein.   143. The method of claim 133, wherein the pathogenic antigen is a viral protein. A method for determining an epitope of a γδ T cell receptor comprising:
(A) preparing a library of epitopes from the γδ T cell receptor;
(B) contacting the library of epitopes with an antibody; and (c) identifying the amino acid sequence of at least one epitope bound by the antibody in the library of epitopes;
Including said method.   The antibody is 5A6. 141. The method of claim 140, selected from the group consisting of E9, B1, TS8.2, 15D, B6, B3, TS-1, IMMU510, R9.12, 11F2, and 7A5 antibodies.   142. The method of claim 141, wherein the antibody is a TS-1 antibody.   142. The method of claim 141, wherein the antibody is a TS-8.2 antibody.   142. The method of claim 141, wherein the antibody is a B1 antibody.   142. The method of claim 141, wherein the antibody is a 15D antibody.   142. The method of claim 141, wherein the antibody is a B6 antibody.   142. The method of claim 141, wherein the antibody is a B3 antibody.   142. The method of claim 141, wherein the antibody is an IMMU510 antibody.   142. The method of claim 141, wherein the antibody is a 9.12 antibody.   142. The method of claim 141, wherein the antibody is an 11F2 antibody.   142. The method of claim 141, wherein the antibody is attached to a solid support.   141. The method of claim 140, wherein the epitope of the T cell receptor corresponds to a contiguous sequence of amino acids in the T cell receptor.   141. The method of claim 140, wherein the epitope of the T cell receptor corresponds to a discontinuous sequence of amino acids in the T cell receptor.   141. The method of claim 140, wherein the library of epitopes comprises fragments ranging from about 10 amino acids to about 30 amino acids in length from the γδ T cell receptor.   141. The method of claim 140, wherein the library of epitopes comprises fragments ranging from about 10 amino acids to about 20 amino acids in length from the γδ T cell receptor.   141. The method of claim 140, wherein the library of epitopes comprises fragments ranging from about 5 amino acids to about 12 amino acids in length from the γδ T cell receptor.   142. The method of claim 140, wherein the antibody is labeled.   141. The method of claim 140, wherein the label is a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin.   145. The method of claim 140, wherein said library of epitopes comprises peptides translated from synthetically designed cDNA.   160. The method of claim 159, wherein the synthetically designed cDNA comprises a plurality of synthetically designed γTCRs and a plurality of synthetically designed δTCR segments.   169. The method of claim 160, wherein the library comprises a plurality of Vδ1 gene segments that differ in their Jδ regions.   163. The method of claim 160, wherein the library comprises a plurality of Vδ2 gene segments that differ in their Jδ regions.   163. The method of claim 160, wherein the library comprises a plurality of Vδ3 gene segments that differ in their Jδ regions.   169. The method of claim 160, wherein the library comprises a plurality of Vγ2, Vγ3, Vγ4, Vγ5, Vγ8, Vγ9, Vγ10, δ1, δ2, and δ3 gene segments.

Images