JP2017216882A - Method of detecting the existence of osteopathy, osteopathy therapeutic agent, and method for screening osteopathy therapeutic agent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To analyze the mechanism of occurrence of osteopathy in detail to provide a method of detecting osteopathy, an osteopathy therapeutic agent, and a method for screening an osteopathy therapeutic agent.SOLUTION: The inventors have completed the invention by newly discovering that Mek/Erk5/Smurf2/Smad/Sox9 cascade plays an important role in controlling skeleton formation (cartilage formation).SELECTED DRAWING: None

Description

  The present invention relates to a method for detecting the presence of a bone disorder, a therapeutic agent for bone disorder and a screening method for a therapeutic agent for bone disorder.

(Bone formation)
Bone is formed during embryonic and postnatal skeletal formation by two different processes, intramembrane and endochondral ossification {Non-Patent Document 1: Annual review of cell and evelopmental biology 25, 629-648 (2009 ), Non-Patent Document 2: Cold Spring Harb Perspect Biol 5, a008334 (2013)}. Skull flat bone, clavicle and mandible are ossified by ossification in connective tissue containing mesenchymal stem cells that directly differentiate into osteoblasts forming bone {Non-patent Document 3: Molecular cell biology 13, 27 -38 (2012)}. Other bones such as long bones in the forelimbs (humerus, radius and ulna), hindlimbs (femur, tibia and radius), legs and hands (metatarsal, metacarpal and proximal phalanx) are endochondral ossification {Non-Patent Document 4: Cell 90, 631 979-990 (1997)}. In endochondral ossification, mesenchymal stem cells differentiate from cartilage templates to chondrocytes. Chondrocytes differentiate in the area of hypertrophic chondrocytes, around the central area of the trace organ, undergoing stages of quiescence, proliferation, hypertrophy and mineralization, causing cartilage matrix mineralization . After petrification, many hypertrophic chondrocytes undergo apoptosis and invade capillaries, osteoclasts, bone marrow cells and osteoblasts into the cartilage matrix to produce new bone {Non-Patent Document 5: Nature 423, 332-336 (2003), Non-Patent Document 6: Calcif Tissue Int 92, 307-323 (2013)}.

(Extracellular signal-regulated kinase 5)
Extracellular signal-regulated kinase 5 (Erk5) belongs to the mitogen-activated protein kinase (MAPK) family including Erk1 / 2, c-Jun amino terminal kinase and p38. Erk5 is specifically phosphorylated and activated by MAPK / Erk kinase-5 (Mek5). Erk1 and Erk2 have been reported to have isoform-specific effects (effects specific to Erk1 and Erk2, respectively), but show a high degree of similarity and are considered functionally equivalent { Non-Patent Document 7: Current Opinion in Cell Biology 9, 180-186 (1997)}.
Erk5 has a higher molecular weight (about twice that of Erk1 / 2) than other Erk enzymes due to the unique C-terminal extension encoding two proline-rich regions and one nuclear localization signal {non-patent literature 8: EMBO Rep 7, 782-786 (2006), Non-Patent Document 9: The Journal of biological chemistry 280, 2659-2667 (2005)}. Genetic studies of mice have shown that "Erk1 / 2 pathway plays an essential role in skeletal development by controlling the continuous stage of chondrocyte differentiation" {Non-Patent Document 10: Molecular and cellular biology 29, 5843-5857 (2009), Non-Patent Document 11: Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 30, 765-774 (2015), Non-Patent Document 12: Biochem Soc Trans 42, 1584-1589 (2014)}. In addition, mutations in signal molecules in the Erk1 / 2 MAPK pathway cause a number of human skeletal disorders (bone dysgenesis), including Noonan syndrome, Costello syndrome and cardio-facio-cutaneous syndrome. Clarified {Non-Patent Literature 13: Annu Rev Genomics Hum Genet 14, 355-369 (2013), Non-Patent Literature 14: Science 311, 1287-1290 (2006), Non-Patent Literature 15: Nature medicine 12, 283-285 (2006)}.
However, unlike Erk1 / 2, Erk5 is not known for its role in skeleton formation.

(Prior Patent Literature)
The following can be illustrated as prior patent documents of the present invention.
US Pat. No. 6,057,031 includes "determining the profile of BMP-1 isoforms in an individual's blood and comparing the profile to a standard blood profile of BMP-1 isoforms associated with various defects and disorders. , "A method for diagnosing a defect or disorder in an individual's bone or soft tissue".
Patent Document 2 states that “a method for diagnosing and / or detecting a bone or cartilage disorder, in which an expression level of a polypeptide in a test sample specifically binds to the polypeptide and the test sample. A method determined by contacting and measuring the binding of the pre-antibody to the pre-test sample.
Patent Document 3 is characterized by detecting a base substitution in at least one expression gene of an estrogen receptor expression gene, an LDL receptor-related protein 5 expression gene, and a type I collagen expression gene using a female nail as a specimen. , A method for diagnosing the onset risk of osteoporosis, osteogenesis imperfecta, or osteogenesis imperfecta.
However, Patent Documents 1 to 3 do not disclose or suggest each step of the method for detecting the presence of a bone disorder of the present invention.

Annual review of cell and evelopmental biology 25, 629-648 (2009) Cold Spring Harb Perspect Biol 5, a008334 (2013) Molecular cell biology 13, 27-38 (2012) Cell 90, 631 979-990 (1997) Nature 423, 332-336 (2003) Calcif Tissue Int 92, 307-323 (2013) Current Opinion in Cell Biology 9, 180-186 (1997) EMBO Rep 7, 782-786 (2006) The Journal of biological chemistry 280, 2659-2667 (2005) Molecular and cellular biology 29, 5843-5857 (2009) Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 30, 765-774 (2015) Biochem Soc Trans 42, 1584-1589 (2014) Annu Rev Genomics Hum Genet 14, 355-369 (2013) Science 311, 1287-1290 (2006) Nature medicine 12, 283-285 (2006)

Special table 2009-544286 Special table 2012-506551 JP 2010-246424

The mechanism that causes bone disorders has not been fully elucidated, and it is difficult to develop a method for detecting bone disorders and therapeutic agents for bone disorders.
Therefore, the present invention provides a method for detecting a bone disorder, a therapeutic agent for the bone disorder, and a screening method for the therapeutic agent for the bone disorder by elucidating the mechanism by which the bone disorder occurs.

As a result of studies to solve the above problems, the present inventors have completed the present invention based on the following findings.
(1) Erk5 has an important role in skeletal formation (especially the bone compartment, including metatarsal bone, metacarpal bone and proximal phalanx).
(2) Erk5 directly phosphorylates the 249th threonine (Thr249) of Smad-specific E3 ubiquitin ligase 2 (Smurf2), an E3 ubiquitin ligase, followed by the proteasome of the Smad protein Controls cartilage formation by accelerating degradation.
(3) Smad protein transcriptionally activates the expression of sex-determining region Y-type high-mobility group box protein 9 (Sox9), which is a major transcription factor for cartilage formation in mesenchymal cells.
(4) Sox9 is an important mediator of Erk5-dependent skeletal and cartilage formation in vivo and in vitro.
(5) From the above (1) to (4), the Mek / Erk5 / Smurf2 / Smad / Sox9 cascade has an important role in controlling skeletal formation (chondrogenesis) (see FIG. 6).

That is, the present invention is as follows.
1. Any one or more of the following in a subject-derived biological sample is detected: A method for detecting the presence of a bone disorder.
(1) Phosphorylation of Smurf2 (2) Ubiquitin E3 ligase activity of Smurf2 (3) Smad1, Smad2 and / or Smad3 expression level (4) Kinase activity of Mek5 (5) Kinase activity of Erk5 2. The detection method according to item 1, wherein the biological sample is a mesenchymal cell.
3. 3. The detection method according to item 1 or 2, wherein the detection of phosphorylation of Smurf2 is lower than that of control.
4). 3. The detection method according to item 1 or 2, wherein the detection of phosphorylation of Smurf2 is to detect whether the 249th serine from the N-terminal of Smurf2 is phosphorylated.
5). The bone disorder is osteogenesis imperfecta, tanatofolic dysplasia, osteoporosis, osteopenia, osteomalacia, bone myeloma, bone dysplasia, Paget's disease, osteosclerosis, aplastic bone disorder, body fluid Any one of the preceding clauses 1 to 4 which are multiple hypercalcemic myeloma, multiple myeloma, Kurzon syndrome, opcismo dysplasia (mature delayed osteodysplasia), concentrated dysplasia, or marble bone disease The detection method described.
6). 6. The detection method according to any one of 1 to 5 above, wherein the bone disorder is caused by Mek / Erk5 / Smurf2 / Smad / Sox9 cascade failure.
7). An agent for treating bone disorders comprising any one of the following (1) to (4) as an active ingredient.
(1) Smurf2 gene or Smurf2 protein (2) Anti-Smad1 antibody, anti-Smad2 antibody and / or anti-Smad3 antibody (3) siRNA or shRNA that suppresses the expression of Smad1, Smad2 and / or Smad3
(4) Compounds that suppress the expression of Smad1, Smad2 and / or Smad3 A screening method for a bone disorder therapeutic agent selected from any one of the following (1) to (3).
(1) Select a test compound that promotes phosphorylation of Smurf2 (2) Select a test compound that promotes ubiquitin E3 ligase activity of Smurf2 (3) Select a test compound that reduces the expression level of Smad1, Smad2, and / or Smad3 select

  The present invention can provide a novel method for detecting the presence of a bone disorder, a therapeutic agent for bone disorder, and a screening method for a therapeutic agent for bone disorder.

Results showing that Erk5 is important for skeletal and cartilage formation in vivo and in vitro. (A) Erk5 ^{fl / fl} and Prx1-Cre of E18.5; whole and part (a to h) of the skeleton of Erk5 ^{fl / fl} embryo and 3-week-old Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} ΜCT 3D image of male mouse leg (i, j). Embryos were double stained with alizarin red and alcian blue. Bar = 10 mm (a, b) and bar = 1 mm (c to h). (B) Histological analysis and in situ hybridization analysis of the metatarsal bones of Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} embryos of E18.5. The metatarsals were stained with H & E (a, b), safranin O (c, d) and von Kossa (e, f). MRNA expression of Col2a1 (g, h), Col10a1 (i, j) and Mmp13 (k, l) in metatarsals. Bar = 150 μm. Shown are skeletal specimens from 3 or more mice from different parents and representative images of histological analysis. Micromass culture of isolated mesenchymal cells of E12.5 Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} embryos, followed by (C) Day 6 Alcian blue staining (a, b) On day 12, alizarin red staining (c, d) (n = 5), (D and E) mRNA expression analysis (n = 5) and (F) protein expression analysis (n = 3) were performed. Bar = 500 μm. (G) Erk5 ^{fl / fl} and Prx1-Cre; early mesenchymal cells derived from Erk5 ^{fl / fl} embryos were retrovirally introduced with Erk5 (WT) or Erk5 (DN) expression vector, followed by micromass culture, followed On the 6th day, Alcian blue staining (af) was performed, and on the 12th day alizarin red staining (gl) (n = 5) was performed. Bar = 500 μm. ** P <0.01 means significantly different from the value obtained in control cells. Statistical significance was determined using two-tailed and unpaired Student's t-test (D and E). Results showing that Erk5 regulates ubiquitin-dependent degradation of Smad protein. (A) Early mesenchymal cells derived from Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} embryos transiently introduced various luciferase vectors to determine luciferase activity (n = 5). Erk5 ^{fl / fl} and Prx1-Cre; Micromass culture of isolated mesenchymal cells of Erk5 ^{fl / fl} embryos, (B) Determination of mRNA expression by qPCR (n = 5) and (C and D) immunoblotting And the determination of protein expression by immunocytochemistry (n = 3). Bar = 10 μm. (E) Early mesenchymal cells of Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} embryos were treated with 50 μg / mL cycloheximide for 2 and 4 hours and then analyzed by immunoblotting (n = Four). (F) HEK293 cells are introduced with HA-Ub and Flag-Smad in the presence or absence of Mek5D or Erk5 (WT) expression vector, followed by immunoprecipitation with anti-Flag antibody, followed by anti-HA antibody And immunoblotting (n = 4). ** P <0.01 means significantly different from the value obtained in control cells. Statistical significance was determined using two-tailed and unpaired Student's t-test (A and B). Results showing that the Thr249 residue on Smurf2 is essential for the control of Erk5-mediated degradation of the Smad protein and chondrogenesis. (A) HEK293 cells were transiently transfected with various expression vectors, followed by immunoprecipitation with anti-Flag antibody, followed by immunoblotting with anti-HA antibody (n = 3). (B) Early mesenchymal cells were immunoprecipitated with anti-Erk5 antibody, followed by immunoblotting with anti-Smurf2 antibody (n = 3). (C) Schematic diagram of Smurf2 protein structure showing predicted phosphorylation sites and conserved regions between vertebrates. (D) In vitro kinase assay. Recombinant Smuf2 protein was incubated with recombinant active or inactive Erk5, followed by Phos-tag SDS-PAGE followed by immunoblotting (n = 4). (E) In vitro ubiquitination assay. Recombinant Smuf2 and Smad proteins were incubated with recombinant active Erk5 in the presence of E1 and UbcH5c and subsequently analyzed by SDS-PAGE (n = 4). (F) Early mesenchymal cells derived from Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} embryos were transfected with Smurf2 (WT), Smurf2 (T249A) or Smurf2 (T249E) vector by retrovirus, Mass culture was followed by Alcian blue staining on day 6 (n = 5). Bar = 500 μm. (G) Early mesenchymal cells were transiently co-introduced with BRE-luc vector and Smurf2 (WT), Smurf2 (T249A) or Smurf2 (T249E) expression vector, and then luciferase activity was measured (n = 5 ). ** P <0.01 means that it is significantly different from the value obtained in the empty vector-introduced cells. ^# P <0.05 means that it is significantly different from the value obtained in the Smurf2 (WT) vector-introduced cells. Statistical significance was determined using one way analysis of variance with Bonferroni post-hoc test (G). Results show that Smad protein directly activates Sox9 expression in mesenchymal cells. Early mesenchymal cells from WT embryos were transiently introduced with various Smad expression vectors, followed by (A) determination of protein expression (n = 3) and (B) determination of mRNA expression of Sox9 (n = 5) was performed. (C) Schematic representation of the alignment of mouse and human Sox9 promoter regions with putative BRE and SBE in addition to the primers (ad) used in the ChIP assay. (D) WT embryo-derived early mesenchymal cells transiently co-introduced Sox9-luc and various Smad expression vectors, and subsequently determined luciferase activity (n = 5). Erk5 ^{fl / fl} and Prx1-Cre; early mesenchymal cells derived from Erk5 ^{fl / fl} embryos showed specific primers for recognizing the Sox9 promoter containing (E) BRE and (F) SBE shown in (C) ( In addition to a to d), analysis was performed by ChIP assay using anti-Smad1, anti-Smad2 and anti-Smad3 antibodies. * P <0.05 and ** P <0.01 mean significantly different from the values obtained in empty vector-introduced cells (B and D). * P <0.05 means significantly different from values obtained in control cells (E and F). Statistical significance was determined using two-tailed and unpaired Student's t-tests (B and DF). Results showing that Erk5 regulates skeletal and cartilage formation via Sox9 in vivo and in vitro. (A) Erk5 ^{fl / fl} of E18.5, Prx1-Cre; Erk5 ^{fl / fl} , Prx1-Cre; Erk5 ^{fl / fl} ; Sox9 ^{fl / +} , Prx1-Cre; Sox9 ^{fl / +} whole and part of embryo skeleton (Ap) and μCT 3D images (q-t) of the legs of 3 week old mutant mice. Embryos were double stained with alizarin red and alcian blue. Bar = 10 mm (ad) and bar = 1 mm (ep). Representative images of skeletal specimens from 3 or more mice from different parents are shown. E12.5 Erk5 ^{fl / fl} , Prx1-Cre; Erk5 ^{fl / fl} , Prx1-Cre; Erk5 ^{fl / fl} ; Sox9 ^{fl / +} , Prx1-Cre; Sox9 ^{fl / +} isolated trace amount of mesenchymal cells Mass culture was performed, followed by (B and C) Alcian blue staining (a to d) on day 6 and (B and D) alizarin red staining (e to h) on day 12 (n = Five). Bar = 500 μm. ** P <0.01 means significantly different from the value obtained in control cells. ^## P <0.01 means significantly different from the value obtained in Erk5-deficient cells. Statistical significance was determined using one way analysis ofvariance with Bonferroni post-hoc test (C and D). The schematic diagram of the Mek / Erk5 / Smurf2 / Smad / Sox9 cascade involved in the skeleton formation obtained from this example.

(Subject of the present invention)
The subject of the present invention relates to a method for detecting the presence of a bone disorder, a therapeutic agent for bone disorder, and a screening method for a therapeutic agent for bone disorder.

(Method for detecting the presence of bone disorders)
The “method for detecting the presence of bone disorder” of the present invention is not particularly limited as long as it can detect any one or more of the following in a subject-derived biological sample.
(1) Smurf2 phosphorylation (2) Smurf2 ubiquitin E3 ligase activity (3) Smad1, Smad2 and / or Smad3 expression level (4) Mek5 kinase activity (5) Erk5 kinase activity

(Bone disorders)
In the present invention, “bone disorder” means a disease in which skeletal formation is impaired due to Mek / Erk5 / Smurf2 / Smad / Sox9 cascade failure.
For example, osteogenesis imperfecta, tanatofolic osteodysplasia, osteoporosis, osteopenia, osteomalacia, bone myeloma, bone dysplasia, Paget's disease, osteosclerosis, aplastic bone disorder, humoral high calcium Include myeloma, multiple myeloma, Kurzon syndrome, opcismo dysplasia (mature delayed osteodysplasia), concentrated dysplasia, marble bone disease and the like.
Bone dysplasia, in particular, is a fragility of bones and has symptoms that cause bone deformation during the healing process of fractures, mainly osteogenesis dysplasia type 1, osteogenesis dysfunction type 2, and bone dysplasia type 3 And classified as osteogenesis imperfecta type 4.

(Mek / Erk5 / Smurf2 / Smad / Sox9 cascade failure)
In the present invention, “Mek / Erk5 / Smurf2 / Smad / Sox9 cascade insufficiency” means a new finding “Mek / Erk5 / Smurf2 / Smad / Sox9 cascade in the following examples because skeletal formation (cartilage formation) is controlled. ”(See: FIG. 6)” means that in each step of the cascade, the normal process does not proceed for some reason (or is slower than the normal process, weak or strong). .
In the case of Mek / Erk5 / Smurf2 / Smad / Sox9 cascade insufficiency, one or more of the following is not functioning normally, and the above-mentioned bone disorders are considered to develop.
(1) Smurf2 phosphorylation (2) Smurf2 ubiquitin E3 ligase activity (3) Smad1, Smad2 and / or Smad3 expression level (4) Mek5 kinase activity (5) Erk5 kinase activity

(Smurf2 phosphorylation and measurement method)
In the present invention, “detection of phosphorylation of Smurf2” is an index that is lower than that of the control. More specifically, the index is that the 249th serine from the N-terminus of Smurf2 is not phosphorylated (or is lower than the control).
As a method for measuring phosphorylation of Smurf2, a method known per se (commercially available measurement kit) can be used. Examples thereof include phosphate affinity electrophoresis (Phos-tag SDS-PAGE), ELISA method, Western blot method and the like for separating and detecting differences in the phosphorylation state of proteins.

(Ubiquitin E3 ligase activity of Smurf2 and its measurement method)
In the present invention, “detection of the ubiquitin E3 ligase activity of Smurf2” is an index that is lower than that of the control.
As a method for measuring the ubiquitin E3 ligase activity of Smurf2, a method known per se (commercially available measurement kit) can be used. For example, a sandwich ELISA method, a fluorescence method and the like can be exemplified.

(Smad1, Smad2 and / or Smad3 expression levels and methods for measuring them)
In the present invention, “the expression level of Smad1, Smad2 and / or Smad3” is an index higher than that of the control. The expression level of Smad1, Smad2 and / or Smad3 may be any of gene expression level (particularly mRNA expression level) and protein expression level, but preferably protein expression level is detected.
As a method for measuring the gene expression level (in particular, mRNA expression level), a method known per se can be used. For example, a method of directly detecting a Smads gene present in a biological sample derived from a subject, a method of indirectly detecting a gene composed of a complementary sequence of these genes, and the like can be mentioned.
As a method for measuring the protein expression level, a method known per se can be used. For example, a method of detecting a protein of Smads present in a subject-derived biological sample with an antibody (particularly, a fluorescently labeled antibody) and the like can be mentioned.

(Mek5 kinase activity and assay method)
In the present invention, “detection of kinase activity of Mek5” is an index that is lower than that of the control.
As a method for measuring the kinase activity of Mek5, a method known per se (a commercially available measurement kit) can be used. For example, SDS-PAGE, ELISA method, Western blot method and the like can be exemplified.

(Erk5 kinase activity and assay method)
In the present invention, “detection of kinase activity of Erk5” is an index that is lower than that of the control.
As a method for measuring the kinase activity of Erk5, a method known per se (a commercially available measurement kit) can be used. For example, SDS-PAGE, ELISA method, Western blot method and the like can be exemplified.

(Subject-derived biological sample)
In the present invention, the subject includes all mammals (including humans, cats, dogs, and horses), and further includes healthy persons, patients with bone disorders, persons suspected of the disorders, and persons who will develop the disorders in the future. Including.
The biological sample is not particularly limited as long as it contains the genes and / or proteins of Smurf2, Smad1, Smad2, Smad3, Mek5, Erk5, but mesenchymal cells, stem cells, biopsy samples, iPS cells, primary cultured cells, blood , Blood components (serum, plasma, blood cells, etc.), saliva, urine, spinal fluid, tears, sweat, hair, tissue-derived components.
Mesenchymal cells are defined as cells that have the ability to differentiate into cells belonging to the mesenchymal system (bone cells, cardiomyocytes, chondrocytes, tendon cells, fat cells, etc.) and have the ability to self-replicate. The In addition, as a method for obtaining mesenchymal cells, a method known per se can be used, and it can be obtained from a subject's bone marrow, adipose tissue, placenta tissue, umbilical cord tissue, dental pulp, and other tissues.

(index)
The “indicator” of the present invention refers to phosphorylation of Smurf2 in a subject-derived biological sample for distinguishing between a bone disorder patient and a person who is not a bone disorder patient (healthy person), Smurf2 ubiquitin E3 ligase activity, Smads expression level (Smad1, Smad2 and / or Smad3 expression level), Mek5 kinase activity, Erk5 kinase activity.
For example, in a subject-derived biological sample, if it is less than or equal to the preset “Smurf2 phosphorylation value”, the bone disorder will develop in the future, is currently onset or has progressed (may be) Can be judged.
For example, in a subject-derived biological sample, if it is less than or equal to the preset “value of ubiquitin E3 ligase activity of Smurf2,” bone disorder will develop in the future, is currently developing or has progressed (may be ) Can be determined.
For example, in a subject-derived biological sample, when the expression level is higher than a preset “Smad1, Smad2, and / or Smad3 expression level”, bone disorders will develop in the future, may be presenting, or have progressed (may be Can be determined.
For example, in a subject-derived biological sample, if it is less than or equal to the preset “value of kinase activity of Mek5”, the bone disorder will develop in the future, is currently onset or has progressed (may be) Can be judged.
For example, in a subject-derived biological sample, if the value is equal to or less than the preset “value of kinase activity of Erk5”, the bone disorder will develop in the future, is currently onset or has progressed (may be) Can be judged.

The method for setting the cut off value is the average value of the phosphorylation value of Smurf2 in the biological sample derived from a person who has no bone disorder (healthy person), and the average value of the ubiquitin E3 ligase activity value of Smurf2. The value is calculated from the average value of the expression level of Smads, the average value of the kinase activity of Mek5, and the average value of the kinase activity of Erk5. Usually 90% or more (or 90% or less) of the standard deviation of the predetermined cut-off value, preferably 80% or more (or 80% or less), more preferably 70% or more (or 70% or less), more preferably When it is 60% or more (or 60% or less), most preferably 50% or more (or 50% or less), it can be determined that the bone disorder is present.
Another method for setting the cut-off value is to create a ROC (Receiver Operating Characteristic) curve using commercially available statistical analysis software based on each value of the biological sample derived from the subject in subjects without a history of bone disorders. Find optimal sensitivity and specificity. For example, it is possible to set a cutoff value that gives priority to a higher sensitivity for the purpose of primary screening or the like and has a higher specificity for the purpose of detailed examination.

(Bone disorder treatment)
The “bone disorder therapeutic agent” of the present invention has an important role for the new finding “Mek / Erk5 / Smurf2 / Smad / Sox9 cascade in the following Examples to control skeletal formation (chondrogenesis) (see: It is a drug utilizing a novel mechanism (mechanism) based on FIG. The therapeutic agent for bone disorders of the present invention (particularly, a therapeutic agent for disorder of skeleton formation by the Mek / Erk5 / Smurf2 / Smad / Sox9 cascade) contains at least one of the following as an active ingredient.
(1) Smurf2 gene or Smurf2 protein (SEQ ID NO: 1: http://www.uniprot.org/uniprot/Q9HAU4)
(2) Anti-Smad1 antibody, anti-Smad2 antibody and / or anti-Smad3 antibody (3) siRNA or shRNA that suppresses the expression of Smad1, Smad2 and / or Smad3
(4) Compounds that suppress the expression of Smad1, Smad2 and / or Smad3

(Smurf2 protein)
In addition, the Smurf2 protein of the present invention includes the following embodiments.
(1) Protected derivative, sugar chain modified product, acylated derivative, or acetylated derivative of the amino acid sequence described in SEQ ID NO: 1 (2) 90% (or 92%, 94) of the amino acid sequence described in SEQ ID NO: 1 %, 96%, 98%, 99%) and an amino acid sequence having a ubiquitin E3 ligase activity that is substantially the same as the Smurf2 protein (3) In the amino acid sequence described in SEQ ID NO: 1, -10, 50-30, 40-20, 10-5, 5-1 amino acid substitutions, deletions, insertions and / or additions, and ubiquitin E3 ligase substantially homogenous with Smurf2 protein Amino acid sequence with activity

(Smurf2 gene)
The Smurf2 gene of the present invention also includes the following embodiments.
(1) Gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 (2) In the amino acid sequence set forth in SEQ ID NO: 1, 1-20 (or 1-15, 1-10, 1-7, A polypeptide having 1-5, 1-3) amino acid substitutions, deletions, insertions and / or additions and having substantially the same quality of ubiquitin E3 ligase activity as the amino acid sequence shown in SEQ ID NO: 1 (3) 90% (or 92%, 94%, 96%, 98%, 99%) homology with the amino acid sequence described in SEQ ID NO: 1 and the amino acid described in SEQ ID NO: 1 A gene encoding a polypeptide having a ubiquitin E3 ligase activity substantially the same as the sequence

(Anti-Smads antibody)
As the anti-Smad1 antibody, anti-Smad2 antibody and / or anti-Smad3 antibody of the present invention, commercially available antibodies (eg, products from abcam, Santa Cruz Biotechnology, etc.) can be used, but naturally occurring antibodies are known per se. You may produce by the method of this. In particular, agonist antibodies are preferred.

(SiRNA or shRNA that suppresses Smads expression)
The siRNA that suppresses the expression of Smad1, Smad2 and / or Smad3 has the effect of reducing or eliminating the expression of Smad1, Smad2 and / or Smad3 by means of RNA interference. siRNA is a short double-stranded RNA that degrades the target gene mRNA and suppresses its expression.
siRNA consists of RNA consisting of a partial sequence of the Smad1, Smad2 and / or Smad3 gene (sense strand) and RNA consisting of a base sequence complementary to the base sequence of the RNA (antisense strand), and the sequence of the mRNA of the gene Designed based on the above, synthesized by chemical synthesis, and can be produced by annealing both RNAs obtained. The sense RNA and antisense RNA constituting the siRNA are each preferably composed of 15 to 35 nucleotides. Moreover, it is preferable to bind a nucleotide called an overhang sequence to each 3 ′ end. The overhang sequence has the effect of protecting RNA from nucleases.
The shRNA that suppresses the expression of Smad1, Smad2 and / or Smad3 is a short double-stranded RNA having a hairpin structure, and suppresses gene expression by RNA interference, similar to siRNA.
shRNA has a hairpin-like structure because sense RNA and antisense RNA are linked by, for example, an oligonucleotide, and the sense RNA-derived portion and the antisense RNA-derived portion form a double strand. shRNA can be produced by designing RNA containing oligonucleotides that link these two RNAs and form a loop structure in addition to sense RNA and antisense RNA based on the nucleotide sequence of smads mRNA. Preferably, the 3 ′ end of the sense RNA is linked to the 5 ′ end of the oligonucleotide forming the loop structure, and the 3 ′ end of the oligonucleotide forming the loop structure is further linked to the 5 ′ end of the antisense RNA. It is an oligonucleotide. The oligonucleotide that forms a loop structure means an oligonucleotide that exists between a sense RNA and an antisense RNA and that can link both RNAs and itself forms a loop structure. A duplex having a hairpin structure can be formed by annealing a sense RNA-derived portion and an antisense RNA-derived portion.

(Compound that suppresses the expression of Smad1, Smad2 and / or Smad3)
The “compound that suppresses the expression of Smad1, Smad2 and / or Smad3” of the present invention is not particularly limited as long as it can suppress the expression of Smad1, Smad2 and / or Smad3 (DNA → mRNA → protein). Examples include synthesis inhibitors (particularly cycloheximide).

  The dose or intake of the bone disorder therapeutic agent of the present invention is not particularly limited as long as the effect of the present invention can be obtained. Type, the nature of the subject (weight, age, medical condition, presence or absence of use of other medicines, etc.), the judgment of the doctor in charge, and the like. The therapeutic agent for bone disorders of the present invention can be administered or ingested in 1 to several times a day, and may be intermittently administered or ingested once every several days or weeks.

(Screening method for therapeutic agent for bone disorder of the present invention)
The screening method for the therapeutic agent for bone disorders of the present invention targets the following three.
(A) A test compound that promotes phosphorylation of Smurf2 (particularly, the 249th serine from the N-terminus of Smurf2) is selected.
(B) A test compound that promotes the ubiquitin E3 ligase activity of Smurf2 is selected.
(C) A test compound that reduces the expression level of Smad1, Smad2, and / or Smad3 is selected.

The screening method for the bone disorder therapeutic agent (A) of the present invention comprises at least the following steps.
(1) Step of adding a test compound to a system containing Erk5 and Smurf2 (2) Step of measuring phosphorylation of Smurf2 “System” may be either in vivo or in vitro. Cells or cell-derived extracts are preferred.
Furthermore, if the amount of phosphorylation is higher than that of the control (system to which no test compound is added), the test compound can be determined as an active ingredient of the bone disorder therapeutic agent.

The screening method for the bone disorder therapeutic agent (B) of the present invention comprises at least the following steps.
(1) A step of adding a test compound to a system containing Smurf2 and Smad1, Smad2 and / or Smad3 (2) A step of measuring the amount of ubiquitin E3 ligase activity of Smurf2 The amount of ubiquitin E3 ligase activity is controlled (adding a test compound) The test compound can be determined as an active ingredient of a bone disorder therapeutic agent.

The screening method for the bone disorder therapeutic agent (C) of the present invention comprises at least the following steps.
(1) A step of adding a test compound to a system containing Smad1, Smad2 and / or Smad3 (2) A step of measuring the expression level of Smad1, Smad2 and / or Smad3 The expression amount (gene amount and / or protein amount) is The test compound can be determined as an active ingredient of the bone disorder therapeutic agent if it is low compared to the control (system in which no test compound is added).

In addition, in the above screening method, the following measurement methods can be used, but are not particularly limited.
1) RT-PCR method 2) Immunoblotting method 3) SAGE
4) Immunoprecipitation method using antibody 5) Pull-down method 6) ELISA
7) Western blot 8) Hybridization 9) Flow cytometry 10) Specific gravity centrifugation 11) Stained specimen of cells 12) Stained specimen of tissue

(Test compound)
Any substance can be used as the “test compound” used in the present invention. The type of the test compound is not particularly limited, and may be a known therapeutic agent, an individual small molecule synthetic compound (particularly siRNA), a compound present in a natural product extract, or a synthetic peptide.
Alternatively, the test compound may be a compound library, a phage display library, or a combinatorial library. The test compound is preferably a low molecular compound, and a compound library of low molecular compounds is preferable. The construction of a compound library is known to those skilled in the art, and a commercially available compound library can also be used.

  EXAMPLES The present invention will be described below with reference to examples, but the present invention is not limited to these examples. All examples met the guidelines of the Japanese Pharmacological Society and were approved by the Committee for Ethical Use of Experimental Animals at Kanazawa University.

(Method and material)
The methods and materials used in each example are described below.

(mouse)
Erk5 ^{fl / fl} and Sox9 ^{fl / fl} mice were crossed with either Prx1-Cre or Col2a1-Cre. These mutant mice were backcrossed to C57BL / 6J for 5 generations or more. Mice were housed in a free feeding and free drinking, 12 hour light / dark cycle, 23 ± 1 ° C. and 55% humidity. Genotyping was performed by PCR using tail genomic DNA. Statistical methods for predicting sample size were not used. The experiment was not randomized. In this example, feeding and treatment results evaluation during the experiment are not blinded.

(Skeletal specimen, histological analysis and in situ hybridization analysis)
Embryos were withdrawn from the intestines, skin removed, and then fixed overnight with 95% ethanol. The embryos were then immersed overnight in Alcian blue solution, further transferred to 2% KOH solution, and subsequently stained overnight with alizarin red solution. Finally, the bone was washed with 1% KOH / 20% glycerol and then stored in 50% ethanol / 50% glycerol. The μCT 3D image of the leg was obtained as described in the literature The Journal of experimental medicine 208, 841-851 (2011) using a VivaCT 40 mCT system (Scanco Medical).
Mouse tibia, femur and leg were fixed with 10% formalin neutral buffer, embedded in paraffin and then sectioned at 5 μm thickness. Sections were stained with hematoxylin-eosin (H & E), safranin O and von Kossa.
In situ hybridization was performed as described in the literature British journal of pharmacology 146, 732-743 (2005). In summary, metatarsal bones were cut in a cryostat and 10 μm thick frozen sections were obtained. Sections mounted on glass slides were fixed in 4% paraformaldehyde and successively treated with 0.2 M hydrochloric acid and 10 μg / ml proteinase K. Sections were acetylated in 0.1 M triethanolamine containing 0.25% acetic anhydride. The sections were hybridized with a digoxigenin-labeled cRNA probe at 65 ° C. for 16 hours after prehybridization. Sections were then washed and treated with 4 μg / ml RNase A. In addition, the sections were incubated with anti-digoxigenin-ALP Fab fragments for 16 hours. After washing, the sections were treated with nitro blue tetrazolium chloride / 5-bromo-4-chloro-3-indolyl phosphate for different periods of time. Plasmid vectors for generating cRNA probes were provided by Dr. Nishimura of Osaka University and Dr. Ducy of Columbia University.

(Production and infection of retroviral vectors)
In order to construct Smurf2 mutant constructs (pMX-Smurf2 (T249A) and pMX-Smurf2 (T249E)), PrimeSTAR (Japan registered trademark) Max Mutagenesis Basal Kit (Takara Bio Inc.) and a specific primer {Smurf2 T249A Site-specific mutation was performed using Forward primer: TTACATGCTCCTCCAGACCTACCAGAA (SEQ ID NO: 2), Reverse primer: TGGAGGAGCATGTAAATGTGTTCTGCT (SEQ ID NO: 3)}. The pMX-Erk5 (WT) and pMX-Erk5 (DN) vectors are obtained by subcloning from the pcDNA3-Erk5 (WT) and pcDNA3-Erk5AEF vectors provided by Dr. Jiing-Dwan Lee, respectively, to the pMX vector. Produced. These vectors were then transfected into PLAT-E cells using the calcium carbonate method. Forty-eight hours after gene transfer, the virus supernatant was collected. Cells were then infected with the viral supernatant in the presence of 4 μg / ml polybrene for 8 hours.

(Trace mass culture system)
Limb bud mesenchymal cells from E12.5 were treated with 0.1% collagenase, 1.5 hours at 37 ° C with 0.1% dispase, followed by 1.5 x 10 ⁷ cells / ml in DMEM / F12 medium containing 10% FBS It was suspended in. Droplets were placed in each well of a 4-well plate. The cells were allowed to adhere for 1.5 hours at 37 ° C. and skeletal formation medium (DMEM / F12 medium containing 10% FBS and 50 μg / ml ascorbic acid) was added. The medium was changed every 2 days, and Alcian blue staining and Alizarin red staining were performed on the 6th and 12th days, respectively.

(Real-time quantitative PCR)
Total RNA was extracted from the cells, followed by cDNA synthesis using reverse transcriptase and oligo dT primers. Thereafter, the cDNA samples were used as templates for real-time PCR analysis using MX3005P qPCR system (Agilent Technology Co., Ltd.) and primers specific to each gene (see: Table 1 below). The expression level of the genes examined was normalized for each sample using Actb expression as an internal standard.

(Immunoblotting analysis)
Cells were solubilized with lysis buffer containing 1% nonidet P-40. Samples were transferred to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by polyvinylidene fluoride membrane (PVDF) and immunoblotting. The main antibodies used were anti-Runx2, anti-Erk5, anti-Smad1, anti-Smad2, anti-Smad3, anti-phospho-Smad1 / 5/8 and anti-phospho-Smad2 / 3 (Cell Signaling Technologies) ), Anti-β-actin, anti-Smad5, anti-Smad8, and anti-Smurf2 (Santa Cruz Biotechnology), anti-Sox9 (EMD Millipore), and anti-Osx (Abcam).

(Luciferase assay)
Plasmids BRE-luc (# 45126) and SBE4-luc (# 16495) were obtained from Addgene and plasmids Runx2-luc and 6xOSE2-luc were provided by Dr. Ducy at Columbia University. Plasmid 4x48-luc was provided by Dr. Crombrugghe at the University of Texas. For the luciferase assay, the cells are genetically engineered with the reporter vector using the lipofection method described in the literature Journal of bone and mineral research: the official journal of the American Society for Bone and Mineral Research 27, 938-949 (2012). The luc activity was then measured using a specific substrate in a luminometer (Ato Inc.). Gene transfer efficiency was normalized by determining LacZ activity.

(Chromatin immunoprecipitation (ChIP) assay)
The ChIP experiment was performed according to the protocol provided by ChIP assay kit (EMD Millipore). Cells were treated with formaldehyde to crosslink, followed by sonication in lysis buffer. Immunoprecipitation is performed using anti-Smad1, anti-Smad2 or anti-Smad3 antibody, followed by specific primer {Forward primer of Sox9 promoter BRE (ab): CCAGCTCCGCTTTGACGAGC (SEQ ID NO: 32), Reverse primer: CACTTTTCGATGCTGTCTCCGTGG (sequence) No. 33), PCR using Sox9 promoter SBE (cd) Forward primer: ACCACGGAGACAGCATCGAAAAGT (SEQ ID NO: 34), Reverse primer: TTCACACGGAGACCGTTCCAAAACTG (SEQ ID NO: 35)}.

(Immunoprecipitation assay)
Plasmids Flag-Smad1 (# 14044), Flag-Smad2 (# 14042), Flag-Smad3 (# 14052), Flag-Smad4 (# 14039), Smad5 (# 11744), Flag-Smad6 (# 14961), Smad7-HA (# 11733), Myc-Smad8 (# 11745), Flag-Smurf1 (# 11752), Flag-Smurf2 (# 11746) and HA-Erk5 (# 31817) were obtained from Addgene. HEK293 cells are transiently transfected with an expression vector using the calcium phosphate transfection method, and the cells are further solubilized in 1% nonidet P-40 containing lysis buffer followed by antibody. Incubated for 1 hour at 4 ° C. and then immunoprecipitated with protein G sepharose. The immunoprecipitate was washed 3 times with lysis buffer and boiled in SDS sample buffer. Samples were separated by SDS-PAGE, subsequently transferred to PVDF membrane, and then immunoblotted as described in the document Biochim Biophys Acta 1832, 732 1117-1128 (2013).

(Preparation of recombinant protein)
Human Smurf2 (WT), Smurf2 (T249A) and Smurf2 (T249E) cDNA were inserted into a pCold II vector (Takara Bio Inc.) having an N-terminal GST tag. The GST-Smurf2 vector was expressed in E. coli strain BL21 cultured with 50 μM isopropyl-β-D-thiogalactopyranoside at 15 ° C. for 24 hours. E. coli cells were centrifuged and the supernatant was removed. E. coli precipitation was freeze / thawed 3 times, and then 1 mg / ml lysozyme-containing lysis buffer (50 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 1% TritonX-100, pH 8.0 at 4 ° C). ) For 30 minutes followed by sonication. GST-Smurf2 of the supernatant fraction was purified by a column packed with Glutathione Sepharose 4 Fast Flow (GE healthcare). The GST-Smurf2 protein was eluted with a buffer (100 mM Tris-HCl, 20 mM glutathione, pH 8.0 at 4 ° C.). The eluted protein was dialyzed for 24 hours at 4 ° C. against dialysis buffer (10 mM Tris-HCl, pH 7.5), which was exchanged repeatedly.

(In vitro kinase assay)
Recombinant full-length Erk5 active (Sigma-Aldrich) or recombinant Erk5 inactive (Carna Biosciences) (0.3 μM) is 30 minutes at 30 ° C., 30 mL kinase buffer (2.5 mM MOPS, pH 7.2, 2.5 mM MgCl ₂ , Incubated with GST-Smurf2 or GST-Smurf2 (T249A) (1 μM) and 0.5 mM ATP in 1.25 mM glycerol 2-phosphate, 0.25 mM DTT, 0.05% BSA). The reaction was stopped by adding SDS sample buffer. Phosphorylated protein was analyzed by Phos-tag PAGE. For Phos-tag immunoblotting of Smurf2, 0.05 mM Phos-tag and 0.1 mM MnCl ₂ were added to a conventional SDS polyacrylamide gel according to the manufacturer's protocol.

(In vitro ubiquitination assay)
Recombinant GST tag labeled human Smad1, Smad2 and Smad3 proteins were purchased from Sigma-Aldrich. In vitro ubiquitination assay was performed using E2-Ubiquitin Conjugation Kit (Abcam) according to the manufacturer's recommended protocol. GST-Smad1, GST-Smad2 or GST-Smad3 (1 μM) can be obtained in 1 x Ubiqutinylation buffer (0.1 μM E1, 0.5 μM UbcH5c (E2) and 5 mM Mg-ATP, 1 mM DTT, Incubated with GST-Smurf2 (0.1 μM) and GST-Erk5 (0.05 μM) in 2.5 μM biotinylated ubiquitin). The reaction was stopped by the addition of 2x Non-reducing gel loading buffer. Ubiquitinated proteins were analyzed by SDS-PAGE and horseradish peroxidase conjugated Streptavidin detection system.

(Immunocytochemical analysis)
For immunocytochemical analysis, cells were mounted on chamber slides coated with poly-L-lysine. Cultured cells were fixed with PBS-lysed 4% PFA, subsequently washed, and then treated with normal goat serum in PBS containing 0.1% Triton X-100. The cells were then incubated with primary antibody diluted in normal goat serum and PBS containing 0.3% Triton X-100. Finally, the cells were reacted with the corresponding secondary antibody and the chamber slides were mounted using FluorSave ^™ (EMD Millipore).

(Data analysis)
All results are shown as mean ± standard error of the mean, and statistical significance is one-way ANOVA (two-tailed Student's t-test, unpaired Student's t-test or Bonferroni post-hoc test) analysis of variance).

(Confirmation of abnormal development of long bones and skulls shown by mesenchymal-specific Erk5 knockout mice)
Erk5 knockout has been shown to be embryonic lethal in mice due to multiple developmental abnormalities {Non-patent literature: Proceedings of the National Academy of Sciences of the United 615 States of America 99, 9248-9253 (2002 ); BMC Dev Biol 3, 11 (2003)}.
In this example, the in vivo physiological role of Erk5 in skeletal development was confirmed.

Mesenchymal-specific Erk5 knockout mice were generated using the Prx1-Cre transgene {Reference: Genesis (New York, NY: 2000) 33, 77-80 (2002)}. Prx1-Cre; Erk5 ^{fl / fl} mice were able to recover at the predicted Mendel's law frequency (data not shown). Staining of skeletal specimens from embryos 18.5 days after mating with Alcian Blue and Alizarin Red (E18.5) shows long bones in the forelimbs (humerus, ribs and ulna) and hindlimbs (femur, tibia and ribs) Prx1-Cre; thickened in Erk5 ^{fl / fl} embryos (FIGS. 1A a-d) and larger voids could be identified in the Koizumi gate (the space between the body cavity wall and the parietal bone) (FIGS. 1Ae- f). Furthermore, in particular, metatarsal, metacarpal, and metaphyseal ossification failures can be observed in Prx1-Cre; Erk5 ^{fl / fl} E18.5 embryos (FIGS. 1A g to h). Including leg bone malformations could also be observed in 3 week old mutant mice (FIG. 1A i-j). Both thicker long bones (not shown) and metatarsal fossils (not shown) were both observed in E16.5 Prx1-Cre; Erk5 ^{fl / fl} embryos.

Considering that the most notable phenotype was observed in the metatarsal bones of E18.5 Prx1-Cre; Erk5 ^{fl / fl} embryos, further histological investigations of these embryos were performed. Prx1-Cre; Erk5 ^{fl / fl} Almost all chondrocytes in the metatarsals of embryos express collagen type II α1 (Col2a1), a marker of nonhypertrophic chondrocytes, while metatarsals in control embryos The middle part of was lacking Col2a1 (FIG. 1B g-h). Furthermore, the expression of collagen type X α1 (Col10a1), a marker of hypertrophic chondrocytes, was significantly reduced in Prx1-Cre; Erk5 ^{fl / fl} embryos compared to control mice (FIG. 1B i-j).
Abnormalities in cartilage differentiation in these metatarsals were further confirmed by H & E staining and safranin O staining (FIGS. 1B a-d). Matrix metalloproteinase-13 (Mmp13) expression was reduced in Prx1-Cre; Erk5 ^{fl / fl} embryos, consistent with delayed cartilage hypertrophy, petrification and calcification, as determined by von Kossa staining (FIG. 1B). e, f, k, l). Histological analysis revealed increased width of long bones (femur and tibia) in E18.5 Prx1-Cre; Erk5 ^{fl / fl} embryos (not shown).

To further investigate the physiological role of Erk5 in skeletal development in vivo, a cartilage-specific Erk5 knockout mouse using the Col2a1-Cre transgene was created. Col2a1-Cre; Erk5 ^{fl / fl} mice were able to recover at the predicted Mendel's law frequency (data not shown). Skeletal specimens and histological analysis showed that E18.5 showed Col2a1-Cre; Erk5 ^{fl / fl} embryos in Prx1-Cre; Erk5 ^{fl / fl} embryos There was no abnormality in petrification of the hand bones and proximal phalanx. However, they reproduced the phenotype of the Prx1-Cre; Erk5 ^{fl / fl} embryo for thicker long bones in the forelimbs and hindlimbs (not shown).

As described above, the thicker long bones in the phenotypic changes of Erk5-deficient mice created by two different Cre driver mice (Prx1-Cre; Erk5 ^{fl / fl} mice and Col2a1-Cre; Erk5 ^{fl / fl} mice) Is a common phenotype associated with Erk5 deletion by both driver mice, while phenotypic changes for both the larger gaps in the Koizumi-mon and the metatarsal, metacarpal, and metaphyseal calcification disorders are A specific phenotype associated with Erk5 deletion in mesenchymal cells.

(Confirmation of accelerated differentiation in vitro and inhibition of chondrocyte maturation by ERK5 deletion)
In this example, in order to clarify whether the skeletal abnormalities related to Erk5 deletion in mesenchymal cells originated from abnormalities in chondrogenesis, we confirmed the effect of Erk5 inactivation on in vitro cartilage formation did.

Micromass cultures of limb blasts prepared from Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} mice were performed for 6 days for differentiation and 12 days for maturation, followed by Alcian blue and alizarin Red staining was performed. A significant increase in the Alcian blue positive area was observed in Erk5-deficient cells on day 6, while alizarin red intensity in the area was significantly reduced in Erk5-deficient cells on day 12 (Fig. 1C). These show increased differentiation and decreased maturation in chondrocytes due to Erk5 deletion. In Erk5-deficient cells, a significant increase in Col2a1, Aggrecan and Sox9 mRNA expression was observed (FIG. 1D), while Col10a1 and Mmp13 expression was significantly reduced (FIG. 1E). Furthermore, Sox9 protein expression was markedly increased in Erk5-deficient cells despite no change in Runx2 and Osterix expression (FIG. 1F).

Next, it was confirmed whether the Mek5 / Erk5 pathway controls cartilage formation in vitro.
Alcian blue and alizarin red staining was markedly inhibited in control and Erk5-deficient cells by introduction of Erk5 (WT) retrovirus (FIGS. 1G a-d, g-j). In contrast, retroviral transduction of Erk5 (DN), a dominant negative form of Erk5 that lacks two phosphorylation sites for Mek5 and cannot phosphorylate the target gene, as observed in Erk5-deficient cells, In the control cells, the Alcian blue positive area was significantly increased, and the arizan red intensity in the area was significantly reduced (FIG. 1G a, e, g, k). On the other hand, when Erk5 (DN) was introduced into Erk5-deficient cells, no further changes in chondrocyte differentiation and maturation were observed (FIG. 1Gb, f, h, l). Furthermore, introduction of Mek5D, a substantial active form of Mek5, inhibited the differentiation and maturation of control cells, but did not inhibit the differentiation and maturation of Erk5-deficient cells (not shown).
Thus, these results indicate that the Mek5 / Erk5 pathway controls chondrocyte differentiation and maturation and regulates Sox9 expression.

(Confirmation of regulation of ubiquitin-dependent degradation of Smad by Mek5 / Erk5 pathway)
In this Example, the substances responsible for the control (modification) of chondrogenesis and up-regulation of Sox9 in Erk5-deficient cells were identified.

  Several reporter luciferase activities in Erk5-deficient cells were monitored. Among the reporters tested, the luciferase activity of BRE-luc (Smad1 / 5/8 dependent) and SBE4-luc (Smad2 / 3 dependent) is significantly increased in Erk5-deficient cells compared to their control activity (Fig. 2A). Consistent with the up-regulation of Sox9 expression in Erk5-deficient cells (Figure 1F), Sox9 promoter activity (Sox9-luc) and Sox9-dependent transcriptional activity (4x48-luc) are significantly increased in Erk5-deficient cells On the other hand, no significant change was observed in either Runx2 promoter activity (Runx2-luc) or Runx2-dependent transcriptional activity (6xOSE2-luc) (FIG. 2A).

Next, we tried to elucidate the mechanism underlying the induction of Smad1 / 5 / 8- and Smad2 / 3-dependent transcriptional activity in Erk5-deficient cells. Smad expression was comparable between Erk5 deletion at the mRNA level and control cells (FIG. 2B). On the other hand, protein expression of Smad1, Smad2 and Smad3 but not Smad5 and Smad8 was significantly up-regulated in Erk5-deficient cells (FIG. 2C). Furthermore, phosphorylation of Smad1 / 5/8 and Smad2 / 3 was upregulated in Erk5-deficient cells (FIG. 2C), consistent with the results of the luciferase assay (FIG. 2A). Consistent with this confirmation, we observed that Smad1, Smad2 and Smad3 expression, with up-regulation of Sox9 expression, was significantly enhanced in the nucleus of Erk5-deficient cells (FIG. 2D).
These results indicate that Erk5 selectively regulates the expression of specific Smads at the protein level rather than at the mRNA level.

  Next, we tried to elucidate whether Erk5 selectively controls Smad degradation. Erk5-deficient cells were treated with a protein synthesis inhibitor, cycloheximide (CHX), and Smad1, Smad2 and Smad3 expression was evaluated. In control cells, Smad1, Smad2 and Smad3 protein expression decreased rapidly after 2 hours of CHX treatment, while the expression levels of these proteins were maintained in Erk5-deficient cells (FIG. 2E).

Next, it was confirmed whether the Mek5 / Erk5 pathway enhances Smad1, Smad2 and Smad3 turnover through the action of promoting ubiquitination. HA tag-labeled ubiquitin and Flag tag-labeled Smad1, Smad2 or Smad3 were co-introduced in the presence or absence of Mek5D and Erk5 (WT) in HEK293 cells. In the absence of Mek5D and Erk5 (WT), all Smads examined could not be observed. In contrast, high molecular weight ubiquitin-coupled Smad products could be observed for Smad1, Smad2 and Smad3 in the presence of Mek5D and Erk5 (FIG. 2F).
These results suggest that the Mek5 / Erk5 pathway favors Smad1, Smad2 and Smad3 for ubiquitination and proteasome-mediated degradation to control Smad1 / 5 / 8- and Smad2 / 3-dependent transcriptional activity To target.

(Erk5 confirms the direct phosphorylation of threonine (Thr249) of Smurf2 that activates Smad ubiquitination and suppression of chondrocyte differentiation)
In this example, the mechanism by which Mek5 / Erk5 signal promotes Smad ubiquitination and proteasome-mediated degradation was investigated.

We confirmed whether Erk5 can directly interact with Smads. Erk5 did not interact directly with Smads other than Smad8 (Figure 3A), but Erk5 is the cause of ubiquitin-dependent degradation of Smad in HEK293 (Figure 3A) and early mesenchymal cells (Figure 3B). It interacted with Smurf2, an E3 ligase, but not with Smurf1.
This indicated that Erk5 physically interacts with Smurf2 in vivo.

One potential Erk5 phosphorylation site was obtained in Thr249 of mouse Smurf2 among four candidate serine / threonine sites conserved between different species by computer alignment with the optimal Erk5 substrate motif (Fig. 3C).
Furthermore, Erk1 / 2 did not appear to phosphorylate Smurf2 with Thr249 (not shown). To elucidate the role of potential phosphorylation sites in Smad degradation and chondrocyte differentiation, we created a site-specific mutation construct, Smurf2 (T249A), in which threonine was replaced with alanine to prevent phosphorylation. . In vitro kinase assays show that recombinant Smurf2 (WT) expressed by bacteria is phosphorylated by Erk5 (active) but not by Erk5 (inactive), whereas Srkf2 phosphorylation by Erk5 is (T249A) confirmed complete stoppage (FIG. 3D). These results indicate that Erk5 directly phosphorylates Thr249 of Smurf2.

To confirm the role of Smurf2 phosphorylation at Thr249 in Smad degradation, recombinant Smurf2 (WT), recombinant Smurf2 (T249A) and threonine to mimic the phosphorylated state similar to Erk5 (active) and Smad An in vitro ubiquitination assay was performed using recombinant Smurf2 (T249E) in which is substituted with glutamic acid.
Incubation of Smurf2 (WT) with ubiquitin, E1 and UbcH5c showed a weak ubiquitination signal in the absence of Erk5, but in the presence of Erk5 caused Smad protein ubiquitination. The reaction with Smurf2 (T249A) produced a slight ubiquitination signal in the presence of Smad1, Smad2 and Smad3, regardless of the presence of Erk5, whereas Smad, in the absence of Erk5, Smurf2 (T249E) A strong (serious) ubiquitination was observed when incubated with. That is, the addition of Erk5 did not increase ubiquitination (FIG. 3E).

Finally, we confirmed whether phosphorylation of Smurf2 Thr249 is necessary for the control of Erk5-dependent cartilage formation. Smurf2 (WT) and Smurf2 (T249E) retroviral infection reduced chondrocyte differentiation in control and Erk5-deficient cells (FIG. 3F a, b, d, e, f, h), whereas Smurf2 (T249A) increased control cell differentiation but not Erk5-deficient cell differentiation (FIG. 3F a, c, e, g). According to these results, BRE-luc activity decreased in cells transfected with Smurf2 (WT), as opposed to upregulation of activity by Smurf2 (T249A) gene transfer, and further decreased by Smurf2 (T249E) gene transfer (Figure 3G).
These results suggest that the Mek5 / Erk5 pathway regulates chondrogenesis by regulating Smad1, Smad2 and Smad3 stability by enhancing Smurf2's ubiquitin E3 ligase activity through direct phosphorylation of Thr249 It shows that

(Confirmation that Smad directly activates Sox9 expression)
In this example, Erk5 deletion induces Sox9 mRNA expression, and Erk5 activates Smad proteasome degradation by Smurf2, suggesting that Smads can activate Sox9 expression at the transcriptional level in mesenchymal cells confirmed.

Induction of Smad1 / Smad4, Smad2 / Smad4 and Smad3 / Smad4 significantly up-regulated Sox9 expression at the protein level (FIG. 4A) and mRNA level (FIG. 4B). Computational analysis of 5'-flanking regions of mouse Sox9 and human Sox9, and at least one putative bone morphogenetic protein response element in the 5'-flanking region that is highly conserved between mouse Sox9 and human Sox9 (Bone morphogenic protein responsive element; BRE) and one putative Smad-binding element (SBE) were identified (FIG. 4C). A reporter assay performed using early mesenchymal cells revealed that introduction of Smad1 / Smad4, Smad2 / Smad4 and Smad3 / Smad4 markedly activated Sox9 promoter activity (FIG. 4D). Furthermore, chromatin immunoprecipitation analysis showed that Smad1 recruitment to the Sox9 promoter region, including BRE, was significantly enhanced in Erk5-deficient cells and Smad2 and Smad3 recruitment were not significantly altered compared to control cells. (Figure 4E). In contrast, recruitment of Smad2 and Smad3 to the Sox9 promoter region encompassing SBE was significantly enhanced in Erk5-deficient cells, unlike Smad1 recruitment (FIG. 4F).
Thus, these results indicate that Smad directly activates Sox9 expression at the transcriptional level in mesenchymal cells and provides evidence for preferential up-regulation of Sox9 expression in Erk5-deficient cells. is there.

(Confirmation that Erk5 regulates skeletal and cartilage formation via Sox9)
The results of the above examples show that Erk5 deletion affects skeletal and cartilage formation through activation of Sox9 expression in vivo and in vitro. In this example, Erk5 ^{− / −} embryos were generated in which one allele of Sox9 in mesenchymal cells was deleted (Sox9 ^{fl / +} ) for genetic verification in vivo. Prx1-Cre; Erk5 ^{fl / fl} ; Sox9 ^{fl / +} embryos and mice, metatarsal and proximal phalanxification failure at E18.5 (FIG. 5A m-p) and skeletal formation in the leg at 3 weeks of age Normalization of malformations (Figure 5A q-t) was shown. In addition, heterozygous deletion of Sox9 rescues the larger Koizumi gate identified in Prx1-Cre; Erk5 ^{fl / fl} embryos (FIG. 5A i-l), while the width of the long bones in the forelimbs and hindlimbs is Prx1- Sox9 dependence in the Mek5 / Erk5 pathway in these bones because it was comparable between Cre; Erk5 ^{fl / fl} and Prx1-Cre; Erk5 ^{fl / fl} ; Sox9 ^{fl / +} embryos (FIGS. 5A e-h) It indicates the existence of sex mechanism.
Furthermore, in Erk5-deficient cells, differentiation defined by the Alcian blue positive region (FIGS. 5B a-d and 5C), and maturation defined by alizarin red intensity in the region (FIGS. 5B e-h and 5D). Abnormalities were markedly rescued in vitro by heterozygous deletion of Sox9 in mesenchymal cells.
Thus, these results showed genetic evidence that Erk5 regulates skeletal and cartilage formation through the ability to inhibit Sox9 expression and function in mesenchymal cells.

(Confirmation of the role of Mek5 / Erk5 / Smurf2 / Smad cascade in cancer cells)
Smurf2 mutants (Smurf2 T249A and Smurf2 T249E) have been introduced into human glioma (brain tumor) cells, and then transplanted into nude mice to confirm the onset and progression of cancer (brain tumor). If a mutant of Smurf2 T249A or Smurf2 T249E suppresses the onset / progress of cancer (brain tumor), it can be said that the Mek5 / Erk5 / Smurf2 / Smad cascade plays an important role in the growth of cancer cells.
Therefore, cancer can be detected by detecting the activity level of each step of the Mek5 / Erk5 / Smurf2 / Smad cascade.

(General)
The following knowledge was acquired by the present Example.
(1) Erk5 has a physiological role in skeletal development.
(2) The Mek5 / Erk5 pathway regulates chondrocyte differentiation and maturation and regulates Sox9 expression.
(3) Mek5 / Erk5 pathway preferentially targets Smad1, Smad2 and Smad3 for ubiquitination and proteasome-mediated degradation to control Smad1 / 5 / 8- and Smad2 / 3-dependent transcriptional activity about.
(4) The Mek5 / Erk5 pathway regulates cartilage formation by regulating Smad1, Smad2 and Smad3 stability by enhancing Smurf2 ubiquitin E3 ligase activity through direct phosphorylation of Thr249.
(5) Smad directly activates Sox9 expression at the transcriptional level in mesenchymal cells.
(6) Control skeletal and cartilage formation through the ability of Erk5 to inhibit Sox9 expression and function in mesenchymal cells.
(7) Erk5 deletion in mesenchymal cells showed abnormal skeletal and cartilage formation in vivo and in vitro, but abnormal formation could be rescued by heterodeletion of Sox9.

Thus, the Mek / Erk5 / Smurf2 / Smad / Sox9 cascade in mesenchymal cells as shown in FIG. 6 is thought to control cartilage formation. More specifically, (1) Mek / Erk5 signal directly phosphorylates Smurf2, and (2) phosphorylated Smurf2 promotes proteasomal degradation of Smads (Smad1, Smad2 and Smad3) and subsequently inhibits cartilage differentiation. (3) Smads (Smad1 / Smad4, Smad2 / Smad4 and Smad3 / Smad4) regulate Sox9 expression at the transcriptional level.
More specifically, Smurf2's 249th threonine (Thr249) is essential for ubiquitin E3 ligase activity, and Smurf2 is an important protein that controls cartilage formation.
In addition, Smads (Smad1 / Smad4, Smad2 / Smad4 and Smad3 / Smad4) activate Sox9 expression in mesenchymal cells at the transcriptional level. Thus, Erk5-dependent up-regulated Smad induces expression of cartilage-specific genes including Col2a1 and Aggrecan containing Sox9 binding sites in the promoter by binding to Sox9 and / or directly induces Sox9 transcription it seems to do.
Based on the above findings, it is considered that bone disorder develops in the case of Mek / Erk5 / Smurf2 / Smad / Sox9 cascade failure.

  ADVANTAGE OF THE INVENTION According to this invention, the novel detection method of the presence of a bone disorder, the bone disorder therapeutic agent, and the screening method of a bone disorder therapeutic agent can be provided.

Claims (8)

Any one or more of the following in a subject-derived biological sample is detected: A method for detecting the presence of a bone disorder.
(1) Phosphorylation of Smurf2 (2) Ubiquitin E3 ligase activity of Smurf2 (3) Smad1, Smad2 and / or Smad3 expression level (4) Kinase activity of Mek5 (5) Kinase activity of Erk5
The detection method according to claim 1, wherein the biological sample is a mesenchymal cell.
The detection method according to claim 1 or 2, wherein the detection of phosphorylation of Smurf2 is lower than that of control.
The detection method according to claim 1 or 2, wherein the detection of phosphorylation of Smurf2 is to detect whether or not the 249th serine from the N-terminus of Smurf2 is phosphorylated.
The bone disorder is osteogenesis imperfecta, tanatofolic dysplasia, osteoporosis, osteopenia, osteomalacia, bone myeloma, bone dysplasia, Paget's disease, osteosclerosis, aplastic bone disorder, body fluid Any one of claims 1 to 4, which is a hypercalcemic myeloma, multiple myeloma, Cruzon syndrome, opcismo dysplasia (mature delayed osteodysplasia), concentrated dysplasia, or marble bone disease. The detection method according to.
The detection method according to claim 1, wherein the bone disorder is due to Mek / Erk5 / Smurf2 / Smad / Sox9 cascade failure.
An agent for treating bone disorders comprising any one of the following (1) to (4) as an active ingredient.
(1) Smurf2 gene or Smurf2 protein (2) Anti-Smad1 antibody, anti-Smad2 antibody and / or anti-Smad3 antibody (3) siRNA or shRNA that suppresses the expression of Smad1, Smad2 and / or Smad3
(4) Compounds that suppress the expression of Smad1, Smad2 and / or Smad3
A screening method for a bone disorder therapeutic agent selected from any one of the following (1) to (3).
(1) Select a test compound that promotes phosphorylation of Smurf2 (2) Select a test compound that promotes ubiquitin E3 ligase activity of Smurf2 (3) Select a test compound that reduces the expression level of Smad1, Smad2, and / or Smad3 select