JP2017160161A - Novel sugar chain library, production method thereof, and uses thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel sugar chain library, to provide a production method thereof, and to provide uses thereof.SOLUTION: The present invention provides a novel sugar chain library comprising a sugar chain elongated product having glycosaminoglycan (GAG) comprising iduronic acid sulfated at position 2 and N-acetyl galactosamine sulfated at position 4, and a production method thereof and uses thereof. The sugar chain library production method comprises administering a particular compound to NB1RGB cells in which uronyl 2-O-sulfotransferase; UST is forcibly expressed.SELECTED DRAWING: None

Description

  The present invention relates to a novel sugar chain library, a production method thereof and use thereof.

  Mucopolysaccharidosis (MPS) is a disease caused by a congenital deficiency of an enzyme that degrades glycosaminoglycan present in lysosomes, and corresponds to type I, type II, type III, type IV. , VI type and VII type are known. Since mucopolysaccharides that cannot be decomposed due to enzyme deficiency accumulate in the body and cause various symptoms, if the disease can be found in the newborn and treatment can be started, the progression of the disease can be stopped. However, the development of diagnostic agents that can be used for early diagnosis such as newborn mass screening has been delayed.

On the other hand, a method for synthesizing sugar chains in animal cells using a sugar primer method has been developed. In particular, chondroitin sulfate (CS) type glycosaminoglycan chains (GAG,-[4GlcAβ1-3GalNAc (6S) β1] _n- ) and heparan sulfate (HS) type (GAG, Primers for obtaining-[3GlcAβ1-4 GlcNAc (6S) α1] _n- ) have also been developed (see, for example, Patent Document 1). However, so far, by using the saccharide primer method, sugar chains that can be used as substrates for mucopolysaccharidosis type II and VI, which are common in many patients, that is, iduronic acid in which the 2-position is sulfated and 4-position are sulfated In addition, a sugar chain elongation product having glycosaminoglycan (GAG) containing N-acetylgalactosamine has not been obtained.

JP 2010-209048 A

  The present invention relates to a novel sugar chain library comprising a sugar chain elongation product having glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and N-acetylgalactosamine sulfated at the 4-position, and It aims at providing the manufacturing method and its use.

  In one embodiment according to the present invention, a compound represented by the following general formula (I) is added to a fibroblast in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed. It is a sugar chain library manufacturing method including the process to administer.

Formula (I); Xyl-Am-LRX
(In the formula, Am is an amino acid having a hydroxy group or an amino acid derivative in which a carboxy group in the amino acid is substituted with a carbamyl group;
L is —C (O) — or —NH—;
R is an alkyl group having 6 to 20 carbon atoms in the carbon main chain, or a part of —CH ₂ —CH ₂ — in the alkyl group is —S—S—, —NHCO—, or — An alkyl group derivative substituted with CH═CH—;
X is a group selected from the group consisting of —H, —N ₃ , —NH ₂ , —OH, —SH, —CO ₂ H, —OC (O) CH═CH ₂ , and —CH═CH _2. Because;
The Xyl-Am bond forms an acetal bond or an ether bond between the hydroxy group of Xyl and the hydroxy group of Am;
The Am-L bond forms an amide bond between the carboxy group of Am and -NH- of L, or between the amino group or carbamyl group of Am and -C (O)-of L. )
In the above method, the fibroblasts may be NB1RGB cells. The amino acid having a hydroxy group may be Ser or Thr. The Xyl-Am bond may form an acetal bond between the hydroxy group at the 1-position of Xyl and the hydroxy group of Am. The compound represented by the general formula (I) may be a compound selected from the following chemical formulas (II) to (V).

  The sugar chain library may include a sugar chain elongation product having a glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and / or N-acetylgalactosamine sulfated at the 4-position. .

  Another embodiment of the present invention is a sugar chain library produced by the above sugar chain library production method.

  A further embodiment of the present invention is a glycoprotein comprising iduronic acid 2 position sulfated and / or N-acetylgalactosamine sulfated position 4 partially or completely purified from said glycan library. It is a sugar chain elongation product having saminoglycan (GAG).

  A further embodiment of the present invention is NB1RGB cells in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed.

  A further embodiment of the present invention is a diagnostic substrate for mucopolysaccharidosis containing the sugar chain library or the sugar chain extension product. The mucopolysaccharidosis may be type II and / or type VI.

  A further embodiment of the present invention is a method for assaying a sugar chain-synthesizing cell, which comprises producing a recombinant cell in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed. And a step of administering the compound represented by the above general formula (I) to the recombinant cell, and the recombinant cell to which the compound has been administered is sulfated iduronic acid at position 2 or sulfate at position 4. And a step of assaying whether or not a sugar chain elongation product having a glycosaminoglycan (GAG) containing N-acetylgalactosamine is synthesized.

  According to the present invention, a novel sugar chain library comprising a sugar chain elongation product having glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and N-acetylgalactosamine sulfated at the 4-position, and It has become possible to provide its manufacturing method and its use.

In one Example which concerns on this invention, it is the figure which showed the LC / MS result of the sugar chain | strand extension product obtained from the recombinant cell. The result shows that the more +, the greater the percentage and the-was not detected. In one Example according to the present invention, (A) results of disaccharide analysis when chondroitin sulfate B was treated with chondroitinase ABC, and (B) obtained by administering Xyl-Ser-C12 to NB1RGB cells It is the figure which showed the result of the disaccharide analysis at the time of processing a sugar chain extension product with chondroitinase ABC. In the figure, ΔHexA, HexNAc, and GalNAc represent unsaturated hexuronic acid, N-acetylhexosamine, and N-acetylgalactosamine, respectively. 2S, 4S and 6S represent 2-O-sulfuric acid, 4-O-sulfuric acid and 6-O-sulfuric acid. (A) It is the figure which showed structural formula of (DELTA) HexA2S-GalNAc4S (it is described also as (DELTA) CS-2S4S). (B) In one Example which concerns on this invention, it is the figure which showed the result of the disaccharide analysis at the time of processing the sugar chain | strand extension product obtained from the recombinant cell with chondroitinase ABC. In one Example which concerns on this invention, it is the figure which showed the result of the disaccharide analysis at the time of processing the sugar chain | strand extension product obtained from the recombinant cell with chondroitinase B.

  Hereinafter, embodiments of the present invention completed based on the above knowledge will be described in detail with reference to examples.

  In the case where there is no particular description in the embodiments and examples, a method described in a standard protocol collection, or a modified or modified method thereof is used. In addition, when using commercially available reagent kits and measuring devices, unless otherwise specified, in addition to the methods described in the standard protocol collection, or modified or modified methods thereof, the protocols attached to them are also included. Is used.

  The objects, features, advantages, and ideas of the present invention will be apparent to those skilled in the art from the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. it can. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention and are shown for illustration or explanation, and the present invention is not limited to them. It is not limited. It will be apparent to those skilled in the art that various modifications and variations can be made based on the description of the present specification within the spirit and scope of the present invention disclosed herein.

== Compound as a sugar chain primer ==
The sugar chain primer according to the present invention is a compound represented by the following general formula (I).

Formula (I); Xyl-Am-LRX
(In the formula, Am is an amino acid having a hydroxy group or an amino acid derivative in which a carboxy group in the amino acid is substituted with a carbamyl group;
L is —C (O) — or —NH—;
R is an alkyl group having 6 to 20 carbon atoms in the carbon main chain, or a part of —CH ₂ —CH ₂ — in the alkyl group is —S—S—, —NHCO—, or — An alkyl group derivative substituted with CH═CH—;
X is a group selected from the group consisting of —H, —N ₃ , —NH ₂ , —OH, —SH, —CO ₂ H, —OC (O) CH═CH ₂ , and —CH═CH _2. Because;
The Xyl-Am bond forms an acetal bond (—O—C—O—) or an ether bond (—O—) between the hydroxy group of Xyl and the hydroxy group of Am;
The Am-L bond is an amide bond (—NHCO— between the carboxy group of Am and —NH— of L, or between the amino group or carbamyl group of Am and —C (O) — of L. ). )
Xyl is D-xylose of the following formula.

  The type of amino acid having a hydroxy group is not particularly limited, but is preferably an α-amino acid because it is easily available, and further, serine (Ser) or threonine (Thr), which is an amino acid constituting a protein in a living body. It is more preferable that

  The three-dimensional structure of the amino acid having a hydroxy group is not particularly limited, and may be L-form, D-form, or a mixture of these enantiomers, but is preferably L-form. An amino acid having a plurality of asymmetric points and having a hydroxy group may be L-form, D-form, diastereomer, or a mixture of these enantiomers, diastereomers. A mixture of mers or a mixture of enantiomers and diastereomers may be used, but the L form is preferred.

  For example, in the case of Ser, it may be L-Ser, D-Ser, or a mixture of L-Ser and D-Ser (for example, racemic Ser). L-Ser is preferred. In the case of Thr, whether it is L-Thr ((2S, 3R) -Thr) or D-Thr ((2R, 3S) -Thr), it is (2S, 3S) -Thr. (2R, 3R) -Thr, and even if it is a mixture of L-Thr and D-Thr (for example, racemic Thr), (2S, 3S) -Thr and (2R , 3R) -Thr or a mixture of L-Thr and / or D-Thr and (2S, 3S) -Thr and / or (2R, 3R) -Thr, L-Thr is preferable.

  The alkyl group having 6 to 20 carbon atoms in the carbon main chain is not particularly limited, and may be a linear alkyl group or a branched alkyl group. Further, the carbon number is not particularly limited as long as it is 6 to 20, but is preferably 8 to 16, and particularly preferably 10 to 14.

  The Xyl-Am bond may form an acetal bond or an ether bond between any of the hydroxyl groups of Xyl and the hydroxyl group of Am, but the hydroxyl group at the 1-position of Xyl and the hydroxyl group of Am It is preferable to form an acetal bond between them.

  The compound represented by the general formula (I) may be a compound selected from the following chemical formulas (II) to (V). Hereinafter, the compound represented by the chemical formula (II) is also referred to as Xyl-Ser-C12.

== Method for producing a compound to be a sugar chain primer ==
The above-mentioned compounds can be synthesized using techniques known to those skilled in the art.

  For example, Nα-lauryl-O- (β-D-xylopyranosyl) -L-serine-amide (hereinafter referred to as Xyl-Ser-C12) can be synthesized from D-xylose by the following method.

  First, D-xylose is converted to a tetraacetyl form by allowing acetic anhydride and sodium acetate to act. By allowing piperidine and acetic acid to act on the tetraacetyl compound, the hydroxyl group at the 1-position is selectively brought into a free state.

The thus-prepared 2,3,4-tri-O-acetyl-D-xylopyranose is converted to trichloroacetimidate by allowing trichloroacetonitrile to act on the free hydroxyl group at the 1-position. After allowing CbZ-L-Ser-NH ₂ and BF ₃ .Et ₂ O to act on trichloroacetimidate, Nα-benzyloxycarbonyl-O- (2,3,3) was subsequently treated with TMSOTf. 4-Tri-O-acetyl-β-D-xylopyranosyl) -L-serine-amide can be prepared. For example, instead of CbZ-L-Ser-NH ₂ , by using an amino acid having a hydroxy group or an amino acid derivative having a hydroxy group having a different structure or steric structure, Nα-benzyloxycarbonyl-O— (2 , 3,4-Tri-O-acetyl-β-D-xylopyranosyl) -amino acid or Nα-benzyloxycarbonyl-O- (2,3,4-tri-O-acetyl-β-D-xylopyranosyl)- Amino acid-amides can be prepared.

The Cbz group of the obtained Nα-benzyloxycarbonyl-O- (2,3,4-tri-O-acetyl-β-D-xylopyranosyl) -L-serine-amide was deprotected by hydrogenation and then released. In the presence of TEA, EDC, and HOBt, lauric acid is allowed to act on the amino group in the state of. Finally, Xyl-Ser-C12 can be synthesized by acting sodium methoxide to deprotect the acetyl group. For example, instead of lauric acid, a saturated fatty acid having a different number of carbon atoms, or —CH ₂ —CH ₂ —, which is part of the saturated fatty acid, is —SS—, —NHCO—, or —CH═CH—. Or a saturated fatty acid derivative substituted with a —H at the terminal opposite to the carboxy group of the saturated fatty acid or saturated fatty acid derivative is —N ₃ , —NH ₂ , —OH, —SH, —CO ₂ By acting a derivative substituted with a group selected from the group consisting of H, —OC (O) CH═CH ₂ , and —CH═CH ₂ , Xyl-Ser-saturated fatty acid, Xyl-Ser— Saturated fatty acid derivatives or the above-mentioned derivatives of Xyl-Ser-saturated fatty acids or saturated fatty acid derivatives can be synthesized.

== Glycosylated cells used in the sugar primer method ==
The sugar chain-synthesizing cells used in the sugar chain primer method according to the present invention forcibly express uronyl 2-O-sulfotransferase (UST) (EC: 2.8.2.-). Fibroblasts. The expression level for forced expression is not particularly limited as long as it is an effective amount capable of synthesizing a sugar chain library.

  The animal from which the fibroblasts are derived is not particularly limited, such as humans, monkeys, rats, mice, but is preferably a human. The tissue from which the fibroblasts are derived is also not particularly limited, such as a fetal or adult connective tissue, but is preferably skin. The fibroblasts are preferably cultured cells, and may be primary cultured cells or established established cultured cells, but are preferably NB1RGB cells that are normal human skin fibroblasts. .

  Uronyl 2-O-sulfotransferase is an enzyme that transfers a sulfate group to the 2-position of iduronic acid of dermatan sulfate. The animal from which this enzyme is derived is not particularly limited, such as humans, monkeys, rats, and mice, but humans are preferred. The forced expression method in fibroblasts of the gene encoding the uronyl 2-O-sulfotransferase (UST gene) is not particularly limited, and methods well known to those skilled in the art may be used. Although the animal from which the UST gene is derived is not particularly limited, such as humans, monkeys, rats, and mice, it is preferably a human (Gene ID: 10090).

== Method of synthesizing sugar chains ==
Glycosaminoglycan (GAG) containing iduronic acid sulphated at the 2-position and N-acetylgalactosamine sulphated at the 4-position by administering the compound serving as a glycan primer to the glycan synthesizing cell It is possible to efficiently synthesize a wide variety of sugar chain elongation products including sugar chain elongation products having.

  The method for administering the compound serving as the sugar chain primer to the sugar chain synthetic cell is not particularly limited. For example, in order to culture the sugar chain synthetic cell with the compound serving as the sugar chain primer dissolved in a small amount of a solvent such as DMSO. It may be administered by adding to the above medium.

  The sugar chain primer added in this way is taken into the sugar chain-synthesizing cell while culturing the sugar chain-synthesizing cell. A sugar having glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and N-acetylgalactosamine sulfated at the 4-position by adding a sugar to the incorporated sugar chain primer Many types of sugar chains including chain extension products are produced in the culture solution. A variety of synthesized sugar chains can be used as a sugar chain library.

  A sugar chain elongation product having glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and N-acetylgalactosamine sulfated at the 4-position produced in the culture solution is, for example, column chromatography. It can be partially or completely purified and / or isolated using graphic methods or solid phase extraction methods.

== Diagnostic substrate for mucopolysaccharidosis ==
Iduronic acid sulphated at position 2 and N-acetylgalactosamine sulphated at position 4 are Iduronate-2-sulfatase and N-Acetylgalactosamine-4, which are deficient in mucopolysaccharidosis type II and IV, respectively. -Sulfurase is a structure that acts, so by using a glycan library containing glycosaminoglycan (GAG) containing these structures as a diagnostic substrate, mucopolysaccharidosis type II and type IV Can be inspected. A sugar chain elongation product obtained by partially and completely purifying and / or isolating this sugar chain library can also be used as a diagnostic substrate.

  Specifically, for example, blood is collected from a diagnostic object and brought into contact with a diagnostic substrate that is a sugar chain elongation product. Then, the enzyme in the blood and the diagnostic substrate are reacted under appropriate reaction conditions to check whether the amount of the diagnostic substrate decreases and / or whether the amount of degradation products increases. For example, the amount of diagnostic substrate and the amount of degradation products can be examined by LC-MS or the like.

  Specifically, for example, diagnosis can be performed as follows. (1) When a sugar chain elongation product having GAG in which 2-position of iduronic acid is sulfated and 4-position of N-acetylgalactosamine is not sulfated is used as a diagnostic substrate, 2-position of iduronic acid is sulfated , N-acetylgalactosamine is healthy for type II of mucopolysaccharidosis if (1-1) the sugar chain having GAG that is not sulfated at position 4 is reduced; (1-2) Suffers from type II of saccharosis Further, (2) When a sugar chain elongation product having GAG in which the 2-position of iduronic acid is not sulfated and the 4-position of N-acetylgalactosamine is sulfated is used as a diagnostic substrate, 4 of N-acetylgalactosamine If the sugar chain having GAG that is sulfated at the position is (2-1) decreased, mucopolysaccharidosis type VI is healthy, and (2-2) if it is not decreased, it is affected by mucopolysaccharidosis type VI doing. When (3) a sugar chain elongation product having a GAG in which both the 2-position of iduronic acid and the 4-position of N-acetylgalactosamine are sulfated is used as a diagnostic substrate, (3-1) 2 of iduronic acid In addition to the decrease in the sugar chain having GAG in which both the position and the 4-position of N-acetylgalactosamine are sulfated, the 2-position of (3-1-1) iduronic acid is sulfated, and the N-acetylgalactosamine If the number of sugar chains having GAG that is not sulfated at position 4 increases, it is affected by mucopolysaccharidosis type II, but type VI is healthy, and (3-1-2) iduronic acid 2 If the sugar chain with GAG in which the position is not sulfated and the 4-position of N-acetylgalactosamine is sulfated increases, mucopolysaccharidosis type II is healthy and suffers from type VI, (3-1-3) The 2-position of iduronic acid is sulfuric acid N-acetylgalactosamine sugar chain with GAG that is not sulfated at position 4 also has GAG that is not sulfated at position 2 of iduronic acid and sulfated at position 4 of N-acetylgalactosamine If the sugar chain also decreases, both type II and type VI of mucopolysaccharidosis are healthy. (3-2) GAG in which both position 2 of iduronic acid and position 4 of N-acetylgalactosamine are sulfated If the sugar chain with a decrease does not decrease, both mucopolysaccharidosis type II and type VI are afflicted.

  Mucopolysaccharidosis causes various symptoms due to accumulation of mucopolysaccharides that can no longer be decomposed due to the enzyme deficiency in the body. Treatment can be started and the progression of the disease can be stopped.

== Method of assaying sugar chain-synthesized cells ==
The method for assaying a sugar chain synthesizing cell according to the present invention comprises a step of administering the sugar chain primer to a recombinant cultured cell in which uronyl 2-O-sulfotransferase is forcibly expressed, and a group in which the sugar chain primer is administered. Testing whether the replacement cell has synthesized a glycosylated glycan (GAG) containing a glycosaminoglycan (GAG) containing iduronic acid sulfated at position 2 or N-acetylgalactosamine sulfated at position 4; ,including. The method for producing recombinant cultured cells is the same as that described above for producing glycosylated cells using fibroblasts, but in this assay method, uronyl 2-O-sulfotransferase is forcibly expressed. As cultured cells to be used, NB1RGB cells may be used, cells other than NB1RGB cells may be used, and cells other than fibroblasts may be used. The method for testing whether or not the target sugar chain elongation product has been synthesized is not particularly limited, and for example, LC-MS can be used.

  By this method, recombinant cultured cells in which uronyl 2-O-sulfotransferase is forcibly expressed are converted to iduronic acid sulfated at position 2 or N-acetyl sulfated at position 4 by the sugar chain primer method. It can be tested whether a sugar chain elongation product having a glycosaminoglycan (GAG) containing galactosamine can be synthesized.

  Further, by assaying with a plurality of types of recombinant cultured cells, a glycosaminoglycan containing iduronic acid sulfated at the 2-position and N-acetylgalactosamine sulfated at the 4-position was selected from these cells. Cells capable of synthesizing a sugar chain elongation product having (GAG) can be screened.

[Example 1] Production of retroviral vector In this example, a retroviral vector for forced expression of uronyl 2-O-sulfotransferase was produced.

  First, total RNA was extracted from NB1RGB cells using RNeasy Plus Mini Kit (QIAGEN). Next, cDNA was synthesized from 1 μg of total RNA using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). PCR was performed using the following primers to amplify a fragment of cDNA encoding uronyl 2-O-sulfotransferase (note that the underline in the primer is NotI (single underline) and Xho I (two underline)) Shows the recognition sequence.) PCR was performed using PrimeSTAR GXL DNA Polymerase (TAKARA) for 35 cycles of 98 ° C. for 10 seconds, 62 ° C. for 5 seconds, and 68 ° C. for 2 minutes.

Forward: ATAAGAAT GCGGCCG ATGAAGAAGAAGCAGCAGCATCCC (SEQ ID NO: 1)
Reverse: CCG CTCGAG TCACCTCTTATAAATATCTTCCAGCCACTTTTC (SEQ ID NO : 2)
Purification of the PCR product (1245 bp, of which coding region 1221 bp (SEQ ID NO: 3)) was carried out using Wizard SV Gel and PCR Clean-Up System (# A9282, Promega). Cloned into the pCS-B-amp-kan vector using Cloning Kit (Agilent Technologies) (hereinafter, the prepared vector is referred to as pUST.) The target sequence has been cloned with the restriction enzyme EcoRI. The cloning site was excised with, and confirmed by analyzing the gene sequence, and the coding region of the gene encoding uronyl 2-O-sulfotransferase was excised with NotI / XhoI and the retroviral vector pGCDNsam-IRES. / EGFP was inserted into the same restriction enzyme site (hereinafter, the prepared expression vector was referred to as pGCDNsam-UST-IRES / EGFP).

[Example 2] Preparation of retrovirus and transformation of NB1RGB cells First, 10 µg of pGCDNsam-UST-IRES / EGFP was lipofected into 293 gp2 cells using Lipofectamine LTX with PLUS Reagent (Life Technologies). After 48 hours and 72 hours, 10 mL of the culture supernatant was collected, and contaminants were removed using a Millex-HV filter (0.45 μm, SLHV033RB, Millipore), followed by centrifugation at 4 ° C. and 6000 × g overnight. Precipitated. Thereafter, the supernatant was removed, 300 μL of serum-free DMEM was added to the pellet and shaken at 4 ° C., and the pellet was dissolved again.

Next, NB1RGB cells were seeded on a 6-well plate at 1 × 10 ⁵ cells / well and allowed to adhere to the bottom of the plate, and 40 μL of the obtained retrovirus was added thereto, and 0.8 mg / mL polybrene was further added. (SIGMA) 20 μL and 1 MHEPES (Gibco) 40 μL were added. Cells were infected with virus by centrifugation at 1000 xg for 60 minutes at 32 ° C. Thereafter, the supernatant was removed, a new medium was added, and the cells were cultured for 3 days. Cells 3 days after virus infection were analyzed by FACS (Fluorescence activated cell sorting), and only EGFP positive cells were collected by sorting.

  It was confirmed by real-time RT-PCR and Western blotting using Light Cycler 480 (Roche) that the obtained EGFP positive cells express uronyl 2-O-sulfotransferase.

[Example 3] Sugar chain synthesis by sugar primer method
After washing cells with serum-free RPMI 1640 (Phenol Red (-), 11835-030, Gibco, Lot 1171662) supplemented with 1% Insulin-Transferrin-Selenium-A (ITSA) (51300-044, GIBCO) 2 × 10 ⁶ cells were resuspended in 5 mL of RPMI 1640 medium containing 25 μM Xyl-Ser-C12 primer, seeded in a 10 cm dish, and cultured for 48 hours. After washing with PBS (−), the cells were collected with PMI1640 medium, and the cell suspension was centrifuged at 1000 rpm at 4 ° C. for 5 minutes, and the supernatant containing the sugar chain elongation product was collected. From this supernatant, a sugar chain elongation product was isolated with 10 mL of methanol using Sep-pak C18, and then neutral sugar and acidic sugar were separated using an amino column.

[Example 4] Structural analysis by LC-MS In this example, NB1RGB cells forcibly expressing UST (referred to as NB1-UST), and NB1RGB cells forcibly expressing Kusabira-Orange as control cells (NB1- NB) and NB1RGB cells (referred to as NB1-EGFP) in which only the green fluorescent protein EGFP was forcibly expressed were used.

  For the resulting sugar chain elongation product, chondroitinase ABC (500 mU) in 50 mM ammonium acetate (pH 8.0) and 37 h at 37 ° C., heparitinase (2 mU) and 37 in 50 mM ammonium acetate (pH 7.0). Enzymatic degradation was performed by reacting with chondroitinase B (2 mU) at 37 ° C. for 24 h at 24 ° C. or in 50 mM Tris-HCl (pH 7.0).

  LC-MS measurement of the enzymatically decomposed sugar chain elongation product was performed with a quadrupole mass device (LC-MS8030 and LC-MS8040, Shimadzu) connected with Nexera UHPLC System (Shimadzu). For separation by LC, Hypercarb (particle size 3 μm, 2.1 × 150 mm, Thermo) was used. As the mobile phase, 10 mM ammonium bicarbonate (pH 10) (solvent A) and 100% acetonitrile (solvent B) were used. The measurement sample was equilibrated with water and eluted with the following gradient: Solvent B: 0 min, 5%; 9 min, 18%; 10.5 min, 18%; 11 min, 70%; 11.5 min, 70%; 12 min, 5%; 23 min, 5%; elution rate 0.15 ml / min; DL temperature 250 ° C; nebulizer gas rate 3 L / min; heat block temperature 400 ° C; drying gas rate 15 L / min The measurement mode is positive / negative ion mode. Detection was performed in multiple reaction monitoring (MRM) mode. Data analysis was performed at Labsolutions (Shimadzu). In FIG. 1, the analysis result of LC-MS is shown. In addition, the ratio of each product was calculated as a ratio of the peak area to the total area (n = 3) (hereinafter, when there are numerical values, it is expressed as an average value ± SD).

  In the two types of control cells, the difference in the tendency of the obtained sugar chain elongation product was not so much. However, when NB1-UST was used, the types and amounts of sulfated sugar chain elongation products such as 7-1, 9-2, 12b, 14, and 15 increased.

[Example 5] Disaccharide analysis of sugar chain elongation product As a structural analysis of the sugar chain elongation product obtained in Example 4, a disaccharide analysis was performed.

  FIG. 2 (A) shows the results when chondroitin sulfate B was treated with chondroitinase ABC as a sample. FIG. 2 (B) shows the result of structural analysis of the sugar chain elongation product obtained by administering Xyl-Ser-C12 to NB1RGB cells based on this analysis result. As shown in the table, the ratio of ΔCS-2S4S was about 0.3%. Note that a structural formula of ΔCS-2S4S is illustrated in FIG.

  Next, disaccharide analysis of the sugar chain elongation product obtained from the recombinant cells was performed. As shown in FIG. 3B, the ratio of ΔCS-2S4S was increased to about 6% in NB1-UST when the other cells were about 1% or less.

[Example 6] Disaccharide analysis of sugar chain elongation product In this example, the sugar chain elongation product obtained in Example 4 (when NB1-UST and NB1-EGFP were used as sugar chain synthesis cells). As a result of the analysis of the sugar chain elongation, the glycan extension products were treated with chondroitinase B that selectively cleaves dermatan sulfate and produces dermatan sulfate-type disaccharides. ΔCS-0S, ΔCS-6S, ΔCS-2S4S 3 types of disaccharides were detected.

  Therefore, the amount of ΔCS-0S, ΔCS-6S, and ΔCS-2S4S obtained with NB1-EGFP was set to 1, and the amount of each obtained disaccharide was expressed as a relative value. As a result, as shown in FIG. 4, NB1-UST yielded significantly more ΔCS-2S4S than control cells, and it was confirmed that dermatan sulfate-type disaccharide was synthesized.

Claims (12)

A sugar chain live comprising a step of administering a compound represented by the following general formula (I) to a fibroblast in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed. Rally manufacturing method.
Formula (I); Xyl-Am-LRX
(In the formula, Am is an amino acid having a hydroxy group or an amino acid derivative in which a carboxy group in the amino acid is substituted with a carbamyl group;
L is —C (O) — or —NH—;
R is an alkyl group having 6 to 20 carbon atoms in the carbon main chain, or a part of —CH ₂ —CH ₂ — in the alkyl group is —S—S—, —NHCO—, or — An alkyl group derivative substituted with CH═CH—;
X is a group selected from the group consisting of —H, —N ₃ , —NH ₂ , —OH, —SH, —CO ₂ H, —OC (O) CH═CH ₂ , and —CH═CH _2. Because;
The Xyl-Am bond forms an acetal bond or an ether bond between the hydroxy group of Xyl and the hydroxy group of Am;
The Am-L bond forms an amide bond between the carboxy group of Am and -NH- of L, or between the amino group or carbamyl group of Am and -C (O)-of L. )   The method for producing a sugar chain library according to claim 1, wherein the fibroblasts are NB1RGB cells.   The method for producing a sugar chain library according to claim 1 or 2, wherein the amino acid having a hydroxy group is Ser or Thr.   The sugar chain library production method according to any one of claims 1 to 3, wherein the Xyl-Am bond forms an acetal bond between the hydroxy group at position 1 of Xyl and the hydroxy group of Am. . The method for producing a sugar chain library according to any one of claims 1 to 4, wherein the compound represented by the general formula (I) is a compound selected from the following chemical formulas (II) to (V).
  The sugar chain library includes a sugar chain elongation product having a glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position and / or N-acetylgalactosamine sulfated at the 4-position. Item 6. The method for producing a sugar chain library according to any one of Items 1 to 5.   The sugar chain library manufactured by the sugar chain library manufacturing method of any one of Claims 1-6.   A glycosaminoglycan comprising iduronic acid sulfated at position 2 and / or N-acetylgalactosamine sulfated at position 4 partially or completely purified from the sugar chain library according to claim 7 A sugar chain elongation product having (GAG).   NB1RGB cells in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed.   A diagnostic substrate for mucopolysaccharidosis containing the sugar chain library according to claim 7 or the sugar chain elongation product according to claim 8.   The diagnostic substrate for mucopolysaccharidosis according to claim 10, wherein the mucopolysaccharidosis is type II and / or type VI. A method for assaying a glycosynthetic cell comprising:
Producing a recombinant cell in which uronyl 2-O-sulfotransferase (UST) is forcibly expressed;
Administering a compound represented by the following general formula (I) to the recombinant cells;
Formula (I); Xyl-Am-LRX
(In the formula, Am is an amino acid having a hydroxy group or an amino acid derivative in which a carboxy group in the amino acid is substituted with a carbamyl group;
L is —C (O) — or —NH—;
R is an alkyl group having 6 to 20 carbon atoms in the carbon main chain, or a part of —CH ₂ —CH ₂ — in the alkyl group is —S—S—, —NHCO—, or — An alkyl group derivative substituted with CH═CH—;
X is a group selected from the group consisting of —H, —N ₃ , —NH ₂ , —OH, —SH, —CO ₂ H, —OC (O) CH═CH ₂ , and —CH═CH _2. Because;
The Xyl-Am bond forms an acetal bond or an ether bond between the hydroxy group of Xyl and the hydroxy group of Am;
The Am-L bond forms an amide bond between the carboxy group of Am and -NH- of L, or between the amino group or carbamyl group of Am and -C (O)-of L. )
The recombinant cell to which the compound is administered has a sugar chain elongation product having a glycosaminoglycan (GAG) containing iduronic acid sulfated at the 2-position or N-acetylgalactosamine sulfated at the 4-position. A test method comprising: testing for synthesis.