JP2017012125A - Innate immune power level assessment method, and baker's yeast beta glucan-containing products for improvement of innate immune power level - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide methods for assessing a human innate immune power level, and to provide baker's yeast beta glucan-containing products for the improvement of innate immune level measured by the methods.SOLUTION: In view of the above-described subject, the present inventors have examined eagerly to independently find that a systemic innate immune power level can be assessed quantitatively by measuring/quantifying human herpesvirus 7 in saliva, and create a novel assessment method of an innate immune power level. Furthermore, we found that an innate immune power level against a reduced innate immune power level assessed by the human herpesvirus 7 in saliva can be increased to improve the innate immune power level, by orally ingesting baker's yeast beta glucan every day. As a result, the present invention has been completed.SELECTED DRAWING: None

Description

  The present invention relates to an innate immunity level evaluation method for evaluating the innate immunity level of a human and a baker's yeast beta-glucan-containing product for improving the innate immunity level.

Human immunity is an essential biological defense system for maintaining the health of people. In order to maintain health, it is important that the three systems of immunity, hormones, and central nervous system function normally, and each system is considered to function in relation to each other. The human immune system is roughly divided into an innate immune system and an acquired immune system, and these two immune systems cooperate with each other to carry human immunity.
In particular, the innate immune system is a biological defense system against external enemies that were originally provided in the body. The innate immune system involves complement, leukocytes, and other immune cells. Among them, macrophages and neutrophils, which constitute leukocytes, are responsible for the first defense against external enemies such as viruses and bacteria. Yes.

In an aging society with many stresses, the decline in innate immunity is becoming a problem due to aging and stress. Reduced resistance to infectious diseases, cancer and many other diseases are thought to be caused by reduced innate immunity.
By the way, 50% of Japanese people have cancer once in their lifetime, the most recent cause of death is about 30% for cancer, and the third cause of death is about 10% for pneumonia. 40% of these two causes of death are thought to be related to reduced innate immunity.

In other words, the level of innate immunity has decreased in people who are living in good health every day due to stress, aging and other causes, and the years have passed with such a decrease in immunity level. As cancer buds grow, cancer develops, or pneumonia caused by pathogens such as pneumococci, influenza, and other infections, resulting in death due to decreased immunity. It is thought that there is.
Even when it seems to be in a healthy state at first glance, the level of innate immunity is often decreasing, and it is important to take measures to increase the level of innate immunity and keep the innate immunity level high. Necessary for maintenance.

  In recent years, various compounds that are said to be useful for enhancing or enhancing immunity have been proposed and patent applications have been filed. Many of the compounds that act to enhance immunity, enhance immunity, increase immunity, etc. are based on NK activity, IFN-γ production ability, IgA production ability, and other specific immune-related markers and indicators. Therefore, it is claimed that there is an effect of strengthening, stimulating and enhancing immunity, but when administering these compounds, the immunity level of each person is grasped based on each immunity related marker and index beforehand. That has hardly been done.

Patent Document 1 presents an immunity evaluation method for evaluating immunity using an immune cell marker for immune cells contained in collected blood. Examples of immune cell markers include T cell count, T cell proliferation coefficient, CD4 T cell / CD8 T cell ratio, naive T cell count, naive T cell / memory T cell ratio, IL-2 cytokine production ability, IFN-γ cytokine production ability, At least two of IL-4 cytokine production ability, B cell count, and NK cell count are listed. In addition, an evaluation method using the CD3 re-expression amount is also described.
In the invention described in Patent Document 2, as an immunity evaluation method that can evaluate the overall immunity with high accuracy, the number of specific T cells that are CD8 positive and CD28 positive or negative in the collected blood is measured. T lymphocyte age is calculated from a regression equation based on age correlation.
Non-Patent Document 1 states that “the immune system is a granulocyte / macrophage mainly composed of pathogen phagocytosis and a B cell that produces antibodies that act specifically on the pathogen, a killer T cell that opposes the virus, etc. The innate immune system works regardless of the type of pathogen and begins to function immediately after the birth of a person. Does not show significant changes, ”explains that acquired immunity decreases with aging and aging.

On the other hand, various studies have been conducted on baker's yeast β-glucan.
A baker's yeast beta-glucan is a compound useful for enhancing innate immunity and is involved in the activation of macrophages and neutrophils in a paper published in NATURE, a prominent scientific journal (Non-patented) Reference 2).

In particular, baker's yeast beta-glucan is used practically all over the world as useful as a health food related to strengthening immunity. The mechanism by which innate immunity is enhanced has been confirmed in basic tests on infection protection and cancer therapeutic effects (see Non-Patent Documents 3 to 4).
Orally administered baker's yeast beta-glucan is taken into the body through the Peyer's patch of the small intestine and then swallowed by macrophages, which migrate to the spleen, lymph nodes, and bone marrow. The baker's yeast beta-glucan swallowed by macrophages in the bone marrow is digested and released as small soluble β-glucan fragments, adsorbed on the neutrophil CR3 receptor, and activates neutrophils. Activated neutrophils attack and kill foreign enemies such as viruses and bacteria and cancer cells covered with antibodies. This is the mechanism of action of the anti-cancer effect of baker's yeast beta-glucan with enhanced innate immunity and combined administration with an antibody anticancer agent.

  Food-grade baker's yeast beta-glucan raw materials are generally insoluble in water, but those that can be further processed and added to beverages and the like as water-soluble raw materials have been produced. US Biothera manufactures and sells Wellmune WGP F3005 as an insoluble baker's yeast beta-glucan raw material and Wellmune WGP F3020 as a water-soluble raw material. In addition, water-soluble baker's yeast beta-glucan, an injection for cancer treatment, Imprim PGG, is manufactured and used in combination with antibody anticancer agents as a cancer treatment for colorectal cancer, small cell lung cancer, and other tumors. Tests are being conducted overseas (see Non-Patent Documents 5 to 6).

  In recent years, research has been conducted on the relationship between HHV-7 and HHV-6 and the degree of fatigue. For example, Patent Document 3 states that “when humans are fatigued, immunity is considered to decline, and one expression system for reducing human immunity is viral infection. However, human fatigue and viral infection It is described that the amount of virus in the saliva of HHV-6 and HHV-7 is useful as a method for evaluating the degree of fatigue. They are conducting research and development on the amount of virus in saliva as a method of assessing fatigue, not on the level of innate immunity. The measurement of HHV-7 in saliva was recognized as an evaluation index of fatigue level rather than immunity level.

Patent Document 4 is an invention relating to a fatigue level evaluation method characterized by evaluating the fatigue level of morbid fatigue of a subject.
According to Example 2 described in Patent Document 4, saliva samples were collected immediately after 7 days of normal work (of which 2 days were a holiday) and after 7 days of consecutive holidays for 20 healthy subjects, and HHV-6 , HHV-7, human cytomegalovirus, and Epstein-Barr virus, the viral load is determined. HHV-7 DNA was detected only in 20% of healthy subjects working at 50% and at rest 30% of subjects, and 92% in 24 CFS patients who received chronic fatigue syndrome (CFS) outpatients at another university hospital (22 persons) described that HHV-7 was detected, and the measurement results are shown in the patent specification. Certainly, HHV-7 is detected at a high rate in patients with chronic fatigue syndrome.

However, in 20 healthy subjects, the number of HHV-7 detectors was 10 after normal working hours and 6 after rest, and the number of HHV-7 detectors decreased by 4 due to rest. No changes in measurements were reported for individual cases. The amount of HHV-7 (unit: copies / ml) and the number of subjects detected as positive are as follows after normal working hours and after rest.
After regular work: 3 x 100: 2 people, 4 x 10: 3 people, 1.6 x 10: 5 people After rest: 1.4 x 1000: 1 person, 3 x 100: 3 people, 4 x 10 : 2 people In other words, 1 person after rest had a higher HHV-7 amount of 1400 copies / ml than any case after working, and 2 of the remaining 4 people had higher values than after the previous work; 300 copies / ml.

  As a result, after the rest, 3 positive subjects became higher than after work, and 4 cases were not detected. Moreover, in one of the positive subjects, the value after resting was about 8 times higher than the value after working. Therefore, it cannot be concluded that the value of HHV-7 improved as a group in healthy individuals. It was assumed that HHV-7 was no longer detected in a total of 14 new cases out of 20 cases after a week of rest, and the group was tired without taking into account the increase in the detected value of 6 cases in which HHV-7 was detected. The assessment that the number of people who recovered has increased is not valid. It is reasonable to make a fatigue evaluation method characterized by high HHV-7 value in patients with chronic fatigue syndrome and evaluating the fatigue level of morbid fatigue in such patients. A patent for which a claim is granted has been established. It was not accepted in patent examination as a method for evaluating the fatigue level of general healthy subjects.

  Non-Patent Document 7 publishes the test results of Examples described in Patent Document 4 as a general academic paper. The title of "Herpesvirus infection and fatigue" mainly discusses the relationship between HHV-6 and fatigue. It was unexpected that the amount of HHV-7 in saliva can be used as an index to evaluate the systemic innate immunity level. Although a decline in immunity can cause fatigue, it does not necessarily cause fatigue when immunity declines.

When this inventor measured the amount of HHV-7 in saliva, when the prior art regarding the measurement of HHV-7 was investigated, it turned out that there exists the following information.
According to Patent Document 5, although it is a microarray gene analysis method using an oligonucleotide against herpes virus, it is not suitable for quantitative measurement.
According to Patent Document 6, the sequence of HHV-7 DNA is identified and used for PCR reaction using various fragments of 193 base pairs. Qualitative and quantitative analysis of HHV-7 in blood and saliva of children with febrile illness, such as transplant patients and HIV infected persons.
According to Patent Document 7, biotinylated lectin is mixed with a saliva sample to bind HHV-7, and beads bound with biotin-binding protein are added to bind HHV-7 bound to biotinylated lectin to the beads. Then, HHV-7 is recovered from the beads and quantified by the PCR method.

  Q-probe PCR has been invented as a measurement method that can be detected and measured more quickly, easily and with higher sensitivity than conventional quantitative PCR methods (see Patent Documents 8 to 10).

Republished WO2007 / 145333 JP 2010-145205 A Japanese Patent No. 4812708 Japanese Patent No. 5542093 JP-T 2009-531048 Japanese National Patent Publication No. 11-509410 Republished WO2009 / 123347 Japanese Patent No. 3437816 Japanese Patent No. 3985959 Japanese Patent No. 4724380

Masaru Sasakawa “Go”, “Aging and Immunity”, Journal of the Japan Geriatrics Society, November 2003, Volume 40, No. 6, p. 543-552 Helen S. Goodridge et al., “Activation of the Innate Immunity Receptor Dectin-1 upon Formation of a 'Phaogotic Synthese'.” Nature, 2011, Vol. 472, p. 471-475 Feng Hong et al., “Mechanism by Which Originally Adopted β-1,3-Glucans Enhancing the Tumoric Activity of Anti-Tumor Monoanti. 797-806 Jun Yan et al., “Yeast Whol Glucan Particle β-Glucan in Junction with Anti-tumour Monoclonal Antibodies to Treat Cancer. No. 5, T. Opinion. 691-702. Richard D. Huh et al., “A Phase 3 Open-Label, Randomized, Multitudier Study of Imprim PGG in Combining with Cetuximab in Pattens with Cir. Nandita Bose et al., “A Phase (Ph) 1/2 Trial of Rituximab (RX), Imprime PGG (IP), and Elementemu Licum L (L) in the Early Treatment of Patties (Pt). , 2015 ASCO annual conference poster announcement Kazuhiro Kondo, “Herpesvirus Infection and Fatigue”, Virus, 2005, Vol. 55, No. 1, p. 9-18

  As mentioned earlier, innate immunity is known to decrease due to stress, aging and other causes, and strengthening innate immunity is important for maintaining health and preventing cancer and infections. Although it is said that there is a need for countermeasures, a practical method for easily determining whether each individual is in a state where the level of innate immunity is specifically reduced or high is still established. What is not done is a big problem.

Granulocytes, which are the main players of innate immunity, especially neutrophils and macrophages, do not vary greatly with age, so it is thought that the innate immunity involved by these immunocompetent cells does not decrease with age. It was.
However, the inventor of the present invention believes that innate immunity is reduced by aging and stress. Decreased innate immunity is largely involved in aging and the decrease in defense against infection due to aging. The mechanism that enhances the phagocytic ability of neutrophils by baker's yeast beta-glucan has been clarified, and it has been confirmed that the infectious defense decreased by aging and stress is increased by ingestion of baker's yeast beta-glucan. That is, not the number of innate immune cells such as granulocytes and macrophages, but the innate immunity is reduced by a decrease in the infection defense function of each immunocompetent cell.

  If the present inventor can easily measure the immunity level of each individual, the immunity level is often lowered due to factors such as aging and stress even though it may seem healthy at first glance. It was possible to confirm this and thought that measures to keep the innate immunity level at a high level could be made.

  In view of the above circumstances, an object of the present invention is to provide an immunity level evaluation method for evaluating a human innate immunity level and a baker's yeast beta-glucan-containing product for improving the innate immunity level.

As a result of intensive studies in view of the above-mentioned problems, the present inventors have found that HHV-7 and HHV-6, which are the cause of sudden rashes, are persistently infected even after infection in early childhood, and then reactivated to enter saliva. It was thought that the large amount of excretion might be related to the decrease in the level of innate immunity. In addition, it was thought that HHV-7, which is characterized by a particularly large amount of virus in saliva compared to HHV-6, is suitable as a target for measurement and quantification. And, by measuring and quantifying the amount of HHV-7, which is characterized by a large amount of virus in saliva, we have uniquely found that it is possible to quantitatively evaluate the systemic innate immunity level, and a new evaluation of immunity level Invented the method.
Furthermore, the present inventor can increase the immunity level against a decrease in the immunity level evaluated by HHV-7 in saliva and improve the immunity level by orally ingesting baker's yeast beta-glucan daily. The present inventors have found that the present invention can be accomplished and have completed the present invention. As baker's yeast beta glucan, a test was conducted using a capsule preparation.

That is, the present invention relates to an innate immunity level evaluation method having the following characteristics and a baker's yeast beta-glucan-containing product for improving the innate immunity level.
(1) A method for evaluating innate immunity level, comprising evaluating the innate immunity level of a subject using the amount of human herpesvirus 7 in saliva as an index.
(2) When the amount of human herpesvirus 7 is large, it is determined that the level of innate immunity is low, and when the amount of human herpesvirus 7 is small, it is evaluated that the level of innate immunity is high. (1) The innate immunity level evaluation method according to (1).
(3) The amount of human herpesvirus 7 in the saliva is quantitatively determined by separating the DNA of the human herpesvirus 7 from the saliva and measuring the amount of DNA by a real-time PCR method, based on the results obtained. The amount of human herpesvirus 7 contained per amount of saliva is calculated and used as an index, and when the amount of human herpesvirus 7 is large, it is determined that the level of innate immunity is greatly reduced, and human herpesvirus 7. The innate immunity level evaluation method according to (2), wherein the innate immunity level is judged to be high when the amount of 7 is small.
(4) The innate immunity level evaluation method according to (3), wherein Q-probe PCR is used as the real-time PCR method.
(5) A baker's yeast beta-glucan-containing product characterized by being used for improving the immunity level evaluated by the innate immunity level evaluation method according to (1) to (4).
(6) The baker's yeast beta-glucan contains insoluble beta-glucan processed so as to contain particles having a particle diameter of 2 to 4 microns by a particle diameter adjusting operation in an extraction process from baker's yeast. (5) A product containing baker's yeast beta-glucan.
(7) An insoluble beta-glucan processed so as to contain particles having a particle diameter of 2 to 4 microns by a particle size adjusting operation in the extraction process from baker's yeast as baker's yeast beta-glucan, and the insoluble beta A product containing baker's yeast beta-glucan according to (5), which contains water-soluble beta-glucan obtained by further processing glucan.
(8) The beta-glucan-containing product according to (7), wherein the mass ratio of the insoluble beta-glucan and the water-soluble beta-glucan is in the range of 5: 1 to 1: 5.

  The method for evaluating the level of innate immunity according to the present invention can easily evaluate the level of innate immunity reduced by aging and stress in healthy and non-disease people. Can be provided. By knowing the level of innate immunity evaluated by the present invention, when a decrease in immunity level is observed, it is effective for ingestion of innate immunity-enhancing health foods such as baker's yeast beta-glucan and for enhancing immunity. Improving and strengthening immune health can be achieved by taking appropriate measures such as diets such as Mediterranean food, sleep, exercise, prebiotics and probiotics.

It is very important to raise the level of immunity for preventing cancer and preventing infections, and many people confirm their innate immunity level and increase their level. It seems to be useful for promoting national health and improving the economics of medical administration.

In order to disseminate the intake of baker's yeast beta-glucan, which seems to be the most effective in strengthening innate immunity, when the innate immunity level is evaluated according to the present invention and a decrease in immunity level is confirmed, It can be judged that it is desirable to start ingestion of yeast beta-glucan.

  Necessary to reduce the risk of suffering from cancer and pneumonia if a new immunity level based on innate immunity can be determined in addition to the conventional testing methods for determining health status in the current aging society And it becomes possible to take appropriate strengthening of systemic resistance.

The method for measuring and quantifying HHV-7 in saliva is to separate HHV-7 DNA from saliva, measure the amount of DNA by real-time PCR, and determine the amount of saliva per fixed amount of saliva based on the results obtained. By calculating the amount of HHV-7 virus contained, if the amount of HHV-7 is large, the innate immunity level is greatly reduced, and if it is low, the innate immunity level is judged to be high. is there.
The present inventor has noted that no one has yet performed the measurement of the amount of HHV-7 DNA in saliva by Q-probe PCR. As a result, it has been found that the Q-probe PCR is actually preferably used as the real-time PCR method used in the present invention.

The background and basis for the present invention will be described below.
The result of having measured the quantity of HHV-7 in saliva by Q probe method PCR method is shown. Ten volunteers who are healthy in daily work, housewives, and students are recruited, and the capsule preparation of bread fermented beta-glucan is administered for 4 weeks every day and observed until 6 weeks later. Follow-up measurements.
Bread fermentation beta-glucan has been clarified from many literatures and results of practical application to enhance innate immunity. Ingestion of ingestion increases innate immunity, and HHV- in saliva This is because it was considered that how the content of 7 amounts changes was analyzed.
In addition, the reason that the administration period was once a day for 4 consecutive weeks was that the systemic innate immunity level would not be able to accurately capture changes in a short period of 1 week or 10 days. . He tried to capture it from a different perspective than Kazuhiro Kondo et al.

The test results of the amount of HHV-7 obtained by collecting 10 saliva samples before the start of administration are as shown in Table 1 described later.
The measured values of HHV-7 DNA (unit: copies / ml) are shown in the table in descending order of numerical value. It can be seen that the measured DNA of HHV-7 of 10 subjects is widely distributed from a high value of about 230,000 to a low value of 900. In individuals with reduced immunity levels, HHV-7 latently infected with salivary gland subcutaneous cells relapsed, resulting in an increase in the amount of HHV-7 in the saliva, and the immunity level originally possessed by each person. It is considered that in a person who maintains the high level, the reactivation of HHV-7 is suppressed and the amount of HHV-7 in saliva is reduced. Therefore, it has been clarified that the amount of HHV-7 in saliva is an optimal index for determining the level of immunity level of each person. None of the 10 test subjects felt tired, from those with high HHV-7 values to those with low values. There is no subject with morbidity such as chronic fatigue syndrome or overwork due to accumulation of physiologic fatigue that occurs in daily life, and general fatigue and HHV-7 levels are not related Suggests that.

Next, for 5 people randomly selected from 10 subjects, a capsule preparation of baker's yeast β-glucan containing 125 mg of an insoluble raw material (Wellmune WGP F3005) manufactured by Biothera USA (Fingal Link stock) Table 1 below shows HHV-7 DNA measurement values obtained by administering “Fermuen” manufactured by the company) once a day for 4 weeks and measuring every 1-2 weeks.
In all 5 cases, 1 week after the start of administration (1st week), all values were lower than the 0th week values. In the case where the value before the start of administration was the highest (229,000 copies / ml) (No. 1), the value once increased in the second week and then gradually decreased from the fourth week to the fifth week, followed by six weeks. The eye rose again and then decreased again at 8 weeks. Compared to the value before the start of administration, it was 61.6% at the 6th week, but further decreased to 41.0% at the 8th week.
In the case where the value before the start of administration was the second highest (219,000 copies / ml) (No. 2), it decreased to about half the value before the start of administration in the first week, and was below the detection limit in the second week. It became 0, and it was 0 until the 6th week. In the 3rd and 4th cases, it declined in the 1st week, then became a high value in the 2nd and 3rd weeks, and gradually decreased from the 5th to the 6th week. (5.4%, 61.2%).

  One of the 5 cases, the value before the start of administration was 1,270 copies / ml and the case with a low HHV-7 value (No. 5) became a low value of 521 copies / ml, which is less than half in the first week. I suffered from acute enterocolitis 3 days before the 2nd week and received fever at 38 ° C, the next day diarrhea and mild vomiting, 40 ° C fever, and the next day after the 2nd week. Is a case that returned to normal life. It rapidly increased to 739,000 copies / ml at the second week, continued at a very high value of 592,000 copies / ml at the fourth week, and decreased significantly after maintaining the high value. 300 copies / ml, decreased to 30,000 copies / ml in the sixth week. Apparently, the condition recovered, and even though it seemed to be healthy, the increased HHV-7 level remained at a high level for 2 weeks or more, and the innate immunity level was considered to have continued to be reduced. Later, the level of innate immunity increased, and the amount of HHV-7 decreased as it gradually recovered.

  It has been found that the amount of HHV-7 in saliva can rapidly increase after suffering from such a severe disease. Moreover, the amount of HHV-7 increased to nearly four times the maximum measured value on day 0 of 10 subjects, which is a surprising fact. However, once the amount of HHV-7 suddenly increased, but decreased to a relatively small amount after the 4th week, the decreased systemic innate immunity level suggested that improvement took time to improve. ing.

  When HHV-7 in saliva suffers from severe enteritis, the increase in the viral load to this extent is a valuable clinical result showing how the resistance, that is, the level of immunity is reduced. In cases where the amount of HHV-7 in saliva was originally low, the immunity level was high, suggesting that the original level of immunity is being restored by continuous ingestion of baker's yeast β-glucan.

  In conclusion, all four cases, except for those suffering from severe acute disease, had a lower amount of HHV-7 in saliva at 5 weeks than at 0 weeks. In patients with severe acute disease, the HHV-7 level increased rapidly immediately after the onset, and was high after 2 weeks after onset, but rapidly decreased to 3 weeks after the onset. .

  Next, in the other 5 subjects in the above 5 cases, the ratio of 2: 1 (mass ratio) of the availability raw material (Wellmune WGP F3020) to the insoluble raw material (Wellmune WGP F3005) of baker's yeast insoluble β-glucan Table 3 shows the measured HHV-7 DNA measured every 1 to 2 weeks by administering a capsule preparation containing 125 m of raw material (“Fermuen SD” manufactured by Fingallink Co., Ltd.) 1 day a day for 4 weeks. Show.

  The case where the DNA value of saliva HHV-7 at 0 weeks was the largest at 88,400 copies / ml (No. 6) was significantly decreased at 1 week and then increased from 2 to 4 weeks The values at the 5th and 6th weeks decreased, and the values at the 6th and 8th weeks decreased to 32.5% and 34.4%, respectively, compared with the 0th week. In the case of the next highest value (No. 7), after repeating the increase and decrease from the 1st week to the 5th week, 49.1% and 49.2 compared with the 0th week in the 6th and 8th weeks. %. In the remaining 3 cases, the value at 0th week is also small as 6,090, 2,170, 912 copies / ml, and it is below the detection standard at 2-4th week, that is, 0, and is 0 or low until 6th week thereafter. It changed in value.

  In conclusion, in all 5 cases, the value of DNA amount was significantly reduced from the 5th week to the 6th week compared with the value before the start of administration. In cases where the amount of DNA at 0 weeks was small, it remained at 0 or low at 6 weeks. Cases with large values at week 0 also decreased to about 30% to 50% at weeks 6 and 8. That is, it is considered that the case where the immunity level was high maintained a high state, and the case where the immunity level was lowered could be increased.

  Furthermore, in order to achieve a reduction in the amount of HHV-7 DNA, it is desirable to continuously ingest baker's yeast β-glucan. Moreover, even if the amount of DNA is once reduced to a low value or 0, it is considered desirable to continue to take baker's yeast beta-glucan and maintain the low value.

The baker's yeast beta-glucan used in this test was a raw material powder manufactured by Biothera of the United States, and the raw material Wellmune processed so that the number of particles having a particle diameter of 2 to 4 μm was increased by a patent manufacturing method. It is a capsule preparation containing a blend of WGP F3005 and a water-soluble raw material Wellmune F5030 and Wellmune F3005 produced by further processing water-insoluble Wellmune WGP F3005.
The capsule preparation used was a capsule containing 125 g of Wellmune WGP, an excipient, and crystalline cellulose as a stabilizer.

As a result of verifying the effect of daily administration for 4 weeks using two kinds of supplements of baker's yeast β-glucan, the results of comparing the amount of HHV-7 in saliva at 0 weeks and 6 weeks, that is, the amount of DNA measured, are shown in Table 4. Street.
However, the data are shown except for one case suffering from a serious acute disease during the test period.
In all nine cases, the amount of HHV-7 DNA in saliva was drastically reduced by the sixth week after administration of baker's yeast β-glucan for 4 weeks every day, or became 0 below the detection standard.

  Daily administration for 4 weeks of baker's yeast β-glucan, which has the effect of enhancing innate immunity, increased the decreased immunity level, but the amount of HHV-7 was large and the immunity level significantly decreased. In the case considered to be, the amount of HHV-7 could not be completely reduced to zero or extremely low, so baker's yeast β-glucan was administered again for 4 weeks or more, It is considered useful to further reduce the amount of HHV-7 and enhance the effect of improving the innate immunity level.

  In addition, in subjects suffering from a serious acute disease on the way, after maintaining a high value for a while after the HHV-7 amount significantly increased, it decreased to a low value, but has not decreased to the original low value, In addition, it may be desirable to re-administer baker's yeast β-glucan. Conventionally, after a major illness or major surgery, it has been said that it is necessary to rest so as not to suffer from pneumonia or other infectious diseases because immunity is reduced for 1 to 2 months. The current data suggests that daily intake of baker's yeast β-glucan is effective in restoring the level of innate immunity, and the enhancement of innate immunity level is achieved early.

In the method for evaluating the level of innate immunity of the present invention, the method for collecting saliva is not particularly limited, and a commercially available collection device such as a salivet, Saliva collection aid, or a drinking water straw is used. Can do.
In terms of time, it is considered that variation in the HHV-7 content due to the collection time is reduced by sampling at the same time zone each time. In this study, samples were collected mainly in the morning and in the afternoon in the afternoon.

  Extraction and separation of HHV-7 DNA from saliva was performed by solubilizing HHV-7 in saliva with proteinase and purifying the DNA using magnetic beads. The separation method is not particularly limited, and various improved methods can be used.

  A real-time PCR method can be used to measure the amount of HHV-7 using the amount of separated HHV-7 DNA as an index. The inventor quantified the amount of DNA by real-time PCR using the Quenching Probe (Q probe) method. The present inventor has not known that anyone has used the Q-probe method PCR to measure HHV-7 DNA, and as a result of the first test, the inventor has found that the measurement method is more suitable for the present invention than expected. I found it.

In the calibration curve generation by Q probe method PCR, GenBank accession no. The 84,201-84,400 bp region (full length: 200 bases) of the HHV-7 genomic sequence registered as U43400 was artificially synthesized and PCR amplified with the universal primers of the vectors of SEQ ID NO: 1 and SEQ ID NO: 2, Standard DNA is produced.
(SEQ ID NO: 1 forward primer; HHV7_Fw): GTAAAACGACGGGCCAGTG (18 bases)
(SEQ ID NO: 2 reverse primer; HHV7_Rv): GGAAACAGCTATGACCATG (19 bases)

  Calculation of the amount of HHV-7 DNA in saliva was calculated by subtracting the weight of the collected saliva from the weight of the kit after collection of the saliva, and based on the percentage of saliva in the solution used for the measurement. The amount of DNA per ml of saliva is calculated.

  Regarding the relationship between the amount of HHV-7 and the innate immunity level, when the innate immunity level is reduced, it is considered that the ability to suppress reactivation of HHV-7 is reduced. Judging from the DNA amount of each subject measured this time, it is considered that the innate immunity level is considerably reduced at 50,000 to 250,000 copies / ml. However, in a subject suffering from one acute infection, the DNA amount increased rapidly to about 800,000 copies / ml several days after the occurrence of serious symptoms, which was reported in patients with chronic fatigue syndrome. This is considered to be equivalent to the high price level. In other words, at 250,000 to 800,000 copies / ml, it is considered that the value is considerably high, and the innate immunity level is considered to be very low. A low value level is considered at 10,000 to 50,000 copies / ml, and a low value level is considered at 0 to 10,000 copies / ml. Thus, when the amount of DNA of HHV-7 is small, it is considered that the original high innate immunity level is maintained.

Details of the Q-probe PCR performed for the measurement and evaluation of the amount of HHV-7 in the saliva in the series leading to the present invention will be described.
<Collecting saliva samples>
The saliva was placed in a screw cap tube (1.5 ml capacity, manufactured by Ina Optica, No. T334-4) to which 750 μl of swab existing solution (manufactured by Nippon Steel & Sumikin Environment Co., Ltd.) was added, and Saliva Collection Aid <SCA> (SalivaBio) ) Was collected so that the total liquid volume with the swab stock solution was approximately 1,000 μl. The amount of saliva collected was determined by measuring the weight of the tube containing the swab preservation solution before and after collecting saliva and calculating the difference.
The collected saliva samples were stored refrigerated or frozen until DNA extraction was performed.

<DNA extraction>
A 600 μl sample was collected from the swab containing the swab stock solution from which the saliva was collected, and DNA extraction was performed on this sample. For DNA extraction, 100 μl of proteinase K was added to a swab stock solution-containing tube from which saliva was collected using an Extra Buccal Sab DNA Kit (product code: 214-001) manufactured by Nippon Steel & Sumikin Environment.
Next, it was heated for 10 minutes in a 55 ° C. heat block (or water bath). 600 μL of the supernatant was collected and transferred to a 1.5 ml tube, and 50 μl of MBs Solution and 400 μl of Binding Solution were added.
Next, the tube was mixed by inversion for about 2 minutes and stirred well.
After collecting the magnet by setting the tube on a magnetic stand, the supernatant was removed using a micropipette.
400 μl of a 70% ethanol solution was added, and the mixture was sufficiently stirred with a vortex mixer (low speed).
After collecting with a magnetic stand, ethanol was removed using a micropipette.
Again, 400 μl of 70% ethanol solution was added, and the mixture was sufficiently stirred with a vortex mixer (low speed), collected with a magnetic stand, and then ethanol was removed using a micropipette.
With the tube lid open, the magnetic particles were air-dried at room temperature for about 10 minutes.
Next, after adding 100 μl of eluate (TE buffer, sterilized water, etc.), the mixture was sufficiently stirred with a vortex mixer (low speed).
While stirring several times in the middle, the mixture was heated with a heat block (or water bath) at 65 ° C. for 5 to 10 minutes.
After collecting the magnet by setting the tube on the magnetic stand, the eluate was transferred to a new tube.

<Preparation of standard DNA for HHV-7 calibration curve>
The standard DNA for HHV-7 standard curve is GenBank accession no. The 84,201-84,400 bp region (full length: 200 bases) of the HHV-7 genomic sequence registered as U43400 was artificially synthesized. PCR amplification was performed with universal primers of the vectors of SEQ ID NO: 1 and SEQ ID NO: 2 to prepare standard DNA.
(SEQ ID NO: 1 forward primer; HHV7_Fw): GTAAAACGACGGGCCAGTG (18 bases)
(SEQ ID NO: 2 reverse primer; HHV7_Rv): GGAAACAGCTATGACCATG (19 bases)
PCR products obtained by the above PCR was used as the quantified using Agilent 2100 BioAnalyzer (Agilent Technologies) was diluted to its quantitative results from 10 to 10 ⁶ copies / [mu] l as the standard DNA .

<Quantitative HHV-7>
Real-time PCR using Quenching Probe (hereinafter, QProbe) was performed for the purpose of quantifying the amount of HHV-7 in saliva. When HHV-7 quantification of a saliva sample is performed, the total amount of the PCR reaction solution is 20 μl, and TITANIUM Taq DNA Polymerase (× 50) (manufactured by Takara Bio Inc.) as a DNA polymerase is 0.4 μl / PCR tube, TITANIUM Taq PCR Buffer (× 10) (Takara Bio Inc.) 2 μl / PCR tube, Uracil DNA Glycosylate (Roche Life Science) 0.2 μl / PCR tube (final concentration: 0.01 units / μl) PCR nucleotide mix PLUS (Roche Life Science) 0.4 μl / PCR tube (final concentration 0.2 mM), 10 μM forward primer (SEQ ID NO: 3) solution 1.0 μl / PCR tube (final concentration) 0.5 μM), 10 μM reverse primer (SEQ ID NO: 4) solution in 0.3 μl / PCR tube (final concentration 0.15 μM), 5 ′ end fluorescent dye, 3 ′ end labeled with QP Probe-GP (phosphate group) 0.1 μl / PCR tube (final concentration 0.05 μM) of 10 μM solution of SEQ ID NO: 5, manufactured by Nippon Steel & Sumikin Environmental Co., Ltd., 10.6 μl / PCR tube of PCR grade water (Roche Life Science), and template After preparing a PCR reaction solution containing about 5 μl / PCR tube of saliva sample-derived DNA as DNA, it was subjected to HHV-7 quantification by real-time PCR. When PCR inhibition was confirmed when the stock solution of extracted DNA was used, 5 μl of extracted DNA diluted 10-fold was used. The 10-fold dilution was performed by collecting 5 μl of extracted DNA and 45 μl of 0.2 × TE buffer and mixing them in a 1.5 ml Eppendorf tube.
When preparing a standard curve using standard DNA, the PCR reaction solution is 13.6 μl / PCR tube for PCR grade water, and 2 μl of standard DNA solution is used as template DNA. The same as the PCR reaction solution.

When preparing a calibration curve, after adjusting 6 dilution series of 10 copies / μl, 10 ² copies / μl, 10 ³ copies / μl, 10 ⁴ copies / μl, 10 ⁵ copies / μl, 10 ⁶ copies / μl Six PCR tubes were prepared by adding each dilution series solution in 2 μl / PCR tube, and these PCR tubes were used for preparing a calibration curve. The quantity line was created each time the analysis was conducted.

The sequences of the primer and QProbe are shown below. The sequence is written such that the 5 ′ end is the left end.
(SEQ ID NO: 3 forward primer; QP Probe_Fw): CCCAACTATTTACAGTAGGGTTGGTG (26 bases)
(SEQ ID NO: 4 reverse primer; QP Probe_Rv): TTTAGTTCCAGCACTGCAATCG (22 bases)
(SEQ ID NO: 5 QProbe_GP): F-CATTTTTCGGTCTTTCCAATGCACCA-P (27 bases)
(F represents fluorescent dye, P represents phosphoric acid)

The reaction solution was subjected to the following PCR reaction using Rotor-Gene Q (Qiagen) which is a real-time PCR apparatus.
(1) Hot start step: 95 ° C., 120 seconds (2) Thermal denaturation step: 95 ° C., 15 seconds (3) Annealing / elongation step: 60 ° C., 60 seconds after (1) heat denaturation step, step (2 ) And (3) were repeated 50 cycles.

Fluorescence measurement was performed after the heat denaturation step of (2) and after the annealing / extension step of (3), and the fluorescence value of (3) was changed to the fluorescence value of (2) on the software attached to Rotor-Gene Q. After normalization (calculation by dividing the fluorescence value in (3) by the fluorescence value in (2)), using the normalized corrected fluorescence intensity data, a calibration curve was created and the HHV-7 was quantified in the Quantitation analysis mode. Analysis was performed.
The quantitative value obtained by real-time PCR was finally converted into the amount of HHV-7 in 1 ml of saliva, and the obtained converted quantitative value was used for evaluation of the results.

  Surprisingly, as a result of putting saliva in the preservation solution immediately after collection, increasing the dilution ratio to 10 times or more, and devising the device by Q-probe PCR, it was quantified with high sensitivity and good reproducibility. From the results quantified by the above-mentioned Q probe method PCR, it can be seen that this method can measure HHV-7 DNA more accurately than the real-time PCR reported and carried out conventionally. It has been found that it is simple and inexpensive, and is optimal as a method for quantifying the amount of DNA of the present invention.

  As a capsule preparation of baker's yeast beta-glucan, not only a preparation using an insoluble raw material that has been put to practical use until now, but also a preparation that newly blended a water-soluble raw material with an insoluble raw material was used. In both cases, the amount of HHV-7 in saliva was similarly reduced to increase the level of innate immunity (Nandita Bose et al., “Differential Reg. Blood Mononuclear Cells ", Glycobiology, 2014, Vol. 24, p. 379-391).

It has also been reported that the water-soluble baker's yeast beta-glucan raw material is different from the insoluble baker's yeast beta-glucan raw material in the mechanism of binding and activating the neutrophil receptor.
Insoluble baker's yeast beta-glucan is phagocytosed by macrophages, then digested and released into smaller water-soluble fragments, and then adsorbed to neutrophil CR3 receptor to activate neutrophils. On the other hand, it is considered that water-soluble baker's yeast beta-glucan can be adsorbed to neutrophils immediately after being absorbed into the body from Peyer's patch of the small intestine.

  By combining both, it is thought that the activation of neutrophils with different mechanisms of action is also absorbed by water-soluble baker's yeast beta-glucan via the Peyer's patch of the small intestine and absorbed earlier in the body. It was. Usually, it is not easily devised to incorporate a raw material that has been developed for a beverage that does not cause precipitation and is expensive, into an insoluble raw material. The present inventors have devised an improvement in the innate immunity level of baker's yeast beta-glucan so that the effect is quicker and more durable. It seems like a simple idea, but no one has ever devised such a baker's yeast beta-glucan formulation. From the results of the present inventors' clinical trials, it was confirmed that the product containing the composition of the present invention has an effect of increasing the immunity level using the amount of HHV-7 in saliva as an index.

  According to the present invention, it has been difficult to determine a decrease in systemic innate immunity level until now, but a method for simple measurement and determination has been established. If the amount of HHV-7 virus in the saliva is large, it is judged that the immunity of each individual is reduced, and if it is small, it is judged that the immunity is high. By taking baker's yeast beta-glucan, which has the effect of increasing the level of innate immunity, the immunity level of each individual is improved, and as a result, the amount of HHV-7 virus in saliva is reduced and the body's resistance is reduced. Maintaining a high state, the risk of developing cancer and infectious diseases will be reduced, and it will be possible to maintain comfortable health.

  In the case of viremia, such as influenza virus infection, in which the amount of virus in the blood increases, activated neutrophil cells attack the virus and quickly kill it, so it reacts in correlation with the blood concentration of the virus The fever caused by the interferon reaction quickly returns to normal heat when the virus is reduced. HHV-7 is latently infected in the salivary gland epithelial cells, and reactivation occurs in response to a decrease in the level of immunity, resulting in virus production. Therefore, even if the phagocytic ability of neutrophils in the blood is increased It is considered that the virus in the saliva is not directly attacked to reduce the amount of the virus, but the reactivation of the virus in the salivary gland epithelial cells is suppressed by enhancing systemic innate immunity.

  That is, it is considered that the amount of HHV-7 in saliva increases due to a decrease in innate immunity level, and conversely decreases as the innate immunity level increases. In people who have a large amount of HHV-7 in saliva and the innate immunity level is significantly reduced, the amount of HHV-7 produced increases once and then increases again by ingesting baker's yeast beta-glucan. As the level of innate immunity increases, it gradually decreases.

  A person with high immunity level suffers from an infectious disease and is physically exhausted, the level of innate immunity level is lowered and HHV-7 is temporarily reactivated, resulting in an increase in the amount of HHV-7. In such cases, ingestion of baker's yeast beta-glucan enhances innate immunity, and as a result, production due to reactivation of HHV-7 is suppressed, and the amount of HHV-7 in saliva is gradually reduced. .

  The present inventor conducted a test using not only an insoluble raw material generally used conventionally as baker's yeast beta-glucan but also a capsule preparation produced by newly mixing a water-soluble raw material. The combined use of baker's yeast beta-glucan raw materials having different mechanisms of action after being taken into the body is an invention first carried out by the present inventors. It was confirmed that the product of this combination is useful for improving and improving the decreased immunity level. The blending ratio of the insoluble raw material and the water-soluble raw material is not particularly limited, but can be appropriately blended between 5: 1 and 1: 5.

  According to the present invention, the usefulness of a baker's yeast beta-glucan-containing product for improving the innate immunity level using the amount of HHV-7 in saliva as an index has been confirmed. As baker's yeast beta-glucan, insoluble baker's yeast beta-glucan processed so that many particle diameters are 2 to 4 μm, and water-soluble baker's yeast beta-glucan obtained by further processing the insoluble raw material Is preferably used.

  In the following, examples of clinical trials actually conducted are described.

The amount of HHV-7 in saliva was measured by DNA measurement for 10 volunteers living daily and socially. 7 males, 3 females, average age: 48.2 ± 14.99 years old, average body weight: 65.6 ± 10.73 kg. Previous medical history included hypertension, diabetes, hay fever and allergic rhinitis. Saliva was collected on the day before or on the day before the start of daily intake of a capsule preparation of baker's yeast beta-glucan in principle.
The amount of HHV-7 DNA (unit: copies / ml) in saliva obtained by the real-time PCR method by the method described above was as shown in Table 1 above.

In 5 cases randomly grouped out of 10 cases, capsule preparation containing 125 mg of insoluble type raw material of bakers' yeast glucan (Wellmune WGP3005) (“Fuel Mün” manufactured by Fingallink Co., Ltd.) 1 capsule per day, daily for 4 weeks I was asked to. Intake of saliva sample after 1 week (1 week), 2 weeks (2 weeks), 4 weeks (4 weeks), 5 weeks (5 weeks), 6 weeks (6 weeks) Samples were collected in the same manner as before (week 0), and the amount of HHV-7 DNA in saliva was measured. Further, in one case, a saliva sample was also collected 8 weeks later (8th week), and the amount of HHV-7 DNA was measured.
The measurement results are as shown in Table 2.

For another 5 cases, a capsule preparation containing 125 mg of a 2: 1 ratio of a baker's yeast beta-glucan insoluble type material (Wellmune WGP F3005) and a water-soluble material (Wellmune WGP F3020). One capsule per day was taken for 4 weeks every day. After 1 week (1st week), 2 weeks (2nd week), 4 weeks (4th week), 5 weeks (5th week), 6 weeks (6th week) saliva samples in principle The samples were collected on an empty stomach and the amount of HHV-7 DNA in saliva was measured. In two cases, a saliva sample was also collected 8 weeks later (8th week), and the amount of HHV-7 DNA was measured.
The measurement results are as shown in Table 3.

Nine cases excluding one case suffering from severe acute enterocolitis during this period are shown in Table 4 in comparison with the values at 0 and 6 weeks. Nine cases were statistically processed by comparing the quantitative values of HHV-7 DNA on day 0 and week 6. The mean ± SD was 87,408 ± 91242 and 25,343 ± 45,344, and P = 0.038236 by T test. Significantly, the amount of HHV-7 DNA at 6 weeks decreased.
As a result of ingesting baker's yeast beta-glucan for 1 week (containing 125 mg) for 4 weeks in all cases except for one case suffering from the above acute enteritis, the amount of HHV-7 DNA in saliva before ingestion In the 6th week, it was less. 3 cases were 0, and the remaining 5 cases were 5.4%, 32.5%, 49.1%, 52.5%, 61.2%, 61.6% compared to day 0 .
That is, when the effect of daily administration of baker's yeast beta glucan for 4 weeks was judged at 6 weeks, the amount of HHV-7 DNA was reduced to an average of 26.4%. Some cases decreased to 0, and some cases decreased to 61-62%, and the degree of the effect was different among individuals.

  The present invention can be used in a wide range of fields related to immunity such as the medical industry, pharmaceutical industry, health food industry, and health equipment industry.

Claims (8)

  A method for evaluating innate immunity level, comprising evaluating the innate immunity level of a subject using the amount of human herpesvirus 7 in saliva as an index.   When the amount of the human herpesvirus 7 is large, it is judged that the level of innate immunity is at a low level, and when the amount of the human herpesvirus 7 is small, it is evaluated that the level of innate immunity is at a high level. The innate immunity level evaluation method according to claim 1, wherein   The amount of human herpesvirus 7 in the saliva is determined by separating the DNA of the human herpesvirus 7 from the saliva, measuring the amount of DNA by a real-time PCR method, and determining a certain amount of saliva based on the results obtained. The amount of human herpesvirus 7 contained in the hit is calculated and used as an index. When the amount of human herpesvirus 7 is large, it is determined that the level of innate immunity is greatly reduced, and the amount of human herpesvirus 7 3. The method for evaluating an innate immunity level according to claim 2, wherein the innate immunity level is judged to be high when there is a small amount.   The innate immunity level evaluation method according to claim 3, wherein Q-probe PCR is used as the real-time PCR method.   A baker's yeast beta-glucan-containing product, which is used for improving the immunity level evaluated by the innate immunity level evaluation method according to claim 1.   The baker's yeast beta glucan contains insoluble beta glucan processed so as to contain particles having a particle diameter of 2 to 4 micrometers by a particle diameter adjusting operation in an extraction process from baker's yeast. Item 6. A product containing baker's yeast beta-glucan according to Item 5.   As baker's yeast beta-glucan, insoluble beta-glucan processed so as to contain particles having a particle diameter of 2 to 4 μm by a particle size adjusting operation in the extraction process from baker's yeast, and the insoluble beta-glucan further 6. A baker's yeast beta-glucan-containing product according to claim 5, comprising a water-soluble beta-glucan obtained by processing.   The beta-glucan-containing product according to claim 7, wherein the mass ratio of the insoluble beta-glucan and the water-soluble beta-glucan is in the range of 5: 1 to 1: 5.