JP2017000015A - Viral vector capable of inducing expression of interest gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a viral vector enabling a gene expression at a desired timing without insertion into a genome of a vector sequence, in gene transfer using a viral vector.SOLUTION: A BDV vector containing a moiety or all of a Borna disease virus (BDV) genome is used, in which a ribozyme sequence is integrated into an untranslated region of any interest genes to be transferred. Specifically, a viral vector is used which contains (a) a cDNA of a recombinant virus in which any interest gene (A) is inserted into cDNA encoding BDV genome, (b) a cDNA encoding a ribozyme, and (c) a promoter sequence, in which (b) is arranged upstream and downstream of the (a), and (a) and (b) is arranged downstream of (c), and further a cDNA encoding ribozyme (R) and regulatory mechanism (R') of ribozyme (R) are arranged in an untranslated region of any interest gene (A) in (a).SELECTED DRAWING: Figure 3

Description

  The present invention relates to a viral vector capable of inducing expression of a target gene at a desired timing in a method for expressing the target gene by introducing a foreign target gene using a viral vector.

  As a means for transporting an arbitrary foreign target gene (hereinafter also simply referred to as “target gene”) to a living body or a cell, a method using a viral vector is known. A viral vector is obtained by removing a gene related to the pathogenicity of a virus and incorporating the gene of interest. About 50 types of adenoviruses that infect humans are known, but human adenovirus type 5 is mainly used as a viral vector. Human adenovirus type 5 is a type of virus that causes colds in children, and has approximately 36 kb of double-stranded linear DNA as its genome. Capsid is a virus that has an icosahedral structure of approximately 80 nm and has no envelope. The tip of the fiber protein protruding from the virus particle binds to and adheres to a cell surface receptor (CAR: coxackie-adeno receptor). Retroviruses are enveloped single-stranded RNA viruses that are reverse transcribed into double-stranded DNA in infected cells and then randomly integrated into the host genome. A lentiviral vector is a type of retroviral vector, but has a feature of a long incubation period. A typical example is human immunodeficiency virus, which has a more complex structure than ordinary retroviruses, including several modified genes and regulatory genes. A feature that differs greatly from other retroviruses is that lentiviruses can infect non-dividing cells and introduce viral DNA into the host genome. In addition, vectors using adeno-associated virus and Sendai virus have been developed as virus vectors.

  However, introduction into a stem cell by a retro or lentiviral vector has an adverse event in which the cell becomes tumorous when a vector-derived sequence is inserted into the genome (Non-patent Document 1: J Clin Invest. 2008 118: 1502, Patent Document 2: Science. 2003 17; 302). For example, there were side effects such as developing leukemia in patients who received gene therapy for X-linked severely combined immunodeficiency (X-linked Severe Combined Immunedeficiency; X-SCID). In addition, vectors related to adenovirus vectors or adeno-associated viruses are widely used. However, since they are DNA viruses, there is a possibility that vector-derived sequences may be inserted into the genome, and that virus vectors are transiently infected. Since it is a vector, it is difficult to carry out long-term gene alterations in rapidly proliferating cells that are not stably and continuously introduced. Furthermore, Sendai virus vector, which is an RNA virus that does not cause insertion into the genome, is not stably and continuously introduced, and Sendai virus cannot express small RNA because it grows in the cytoplasm (Non-patent Document 3: Exp Hematol). 2011 39:47).

  Borna disease virus (hereinafter also referred to as “BDV”) is a virus belonging to the order of the mononegavirus that has a non-segmented negative-strand, single-stranded RNA as a genome, and has a direction of infection to neurons. It has the characteristic of being. Furthermore, although BDV is a virus that replicates in the cell nucleus, its infection is non-cytotoxic and has a characteristic that it is persistently infected for a long period of time, and a host range that can be infected is extremely wide.

  As a technology for introducing any target gene using BDV into cells, a green fluorescent protein (GFP) expression cassette is inserted into the untranslated region at the 5 'end of the BDV genome, and this recombinant virus is inserted into a highly active polymerase. In addition, it was reported that the GFP gene was expressed in rat nerve cells when infected with rats (Non-patent Document 1).

  Furthermore, in the technique using BDV, a viral vector having a wide infectable host range, high safety and high efficiency of gene transfer, and good stability and durability has been developed. As a vector using BDV, for example, (a) cDNA of a recombinant virus in which the target gene is inserted into the translation region of the G gene of cDNA encoding BDV genome, (b) cDNA encoding ribozyme and (c) promoter sequence. In addition, there is disclosed a viral vector characterized in that (b) is arranged upstream and downstream of (a), and (a) and (b) are arranged downstream of (c) (patent) Literature 1: JP 2010-22338 A). The present inventors have created a BDV vector that stably expresses the target gene over a long period of 8 months or longer in the brain of mice and rats by utilizing the directional property of BDV to infection of neurons. A patent was acquired (Patent Document 2: Patent 5299879).

  In the self-digesting ribozyme, there is a report on a gene-controlled switch platform for controlling cell functions by incorporating an aptamer capable of binding to ribozyme and theophylline (Non-patent Document 4).

  However, according to the gene introduction method using the BDV vector, there is a problem that it is difficult to induce expression of the introduced gene at an appropriate timing.

J Clin Invest. 2008 118: 1502 Science. 2003 17; 302 Exp Hematol. 2011 39:47 PNAS. 2007 14: 14283-14288

JP 2010-22338 Japanese Patent No. 5299879

  The present invention provides a viral vector capable of inducing expression of a target gene at a desired timing in a method for expressing the target gene by an operation for introducing an arbitrary target gene (foreign gene) using the viral vector. Is an issue.

  As a result of intensive studies, the present inventors have found that a BDV vector containing a part or all of the Borna disease virus (BDV) genome, wherein a self-digesting ribozyme sequence is incorporated into the untranslated region of the target gene to be introduced. According to the vector, it was found that the above problems can be solved, and the present invention has been completed.

That is, this invention consists of the following.
1. (a) a cDNA of a recombinant virus in which the gene of interest (A) is inserted into a cDNA encoding the Borna disease virus genome, (b) a cDNA encoding a ribozyme and (c) a promoter sequence, upstream of (a) and (B) is arranged downstream, and (a) and (b) are arranged downstream of (c), further comprising the gene of interest (A) in (a) A viral vector in which a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ′) are arranged in the untranslated region of.
2. The target gene (A) is inserted in the untranslated region between the P gene and M gene of the cDNA encoding the genome of (a) Borna disease virus, and in the untranslated region of the target gene (A), 2. The viral vector according to item 1 above, wherein cDNA encoding ribozyme (R) and ribozyme (R) control mechanism (R ′) are arranged.
3. The target gene (A) is inserted into the non-translated region linked to the downstream of the translated region of the P gene of the cDNA encoding the (a) Borna disease virus genome, and the untranslated region of the target gene (A) 2. The viral vector according to item 1 above, wherein cDNA encoding ribozyme (R) and ribozyme (R) control mechanism (R ′) are arranged.
4). 4. The viral vector according to any one of items 1 to 3, wherein the ribozyme (R) is a self-digesting ribozyme.
5). 5. The viral vector according to any one of 1 to 4 above, wherein the ribozyme (R) control mechanism (R ′) is an aptamer capable of binding to theophylline.
6). A cassette containing the ribozyme (R) -encoding cDNA and the ribozyme (R) control mechanism (R ') is defined as a ribozyme (R) control cassette, and the base sequence specifying the ribozyme (R) control cassette is defined as one unit. 6. The viral vector according to item 5 above, which comprises a base sequence in any repeating unit selected from 1 unit or 2 to 5 units.
7). 7. The viral vector according to item 6 above, wherein the ribozyme (R) control cassette is specified by the nucleotide sequence shown in SEQ ID NO: 3.
GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACGGAGGACGAAACAGC (SEQ ID NO: 3)
8). A method for controlling the expression of a target gene (A) contained in (a) using the viral vector according to any one of 1 to 7 above, wherein the ribozyme (R) is reversibly inactivated or activated. A method for controlling the expression of the target gene (A), comprising the step of controlling the expression of the target gene (A) contained in (a).
9. A method for controlling the expression of a target gene (A) contained in (a) using the viral vector according to any one of the preceding items 1 to 7, wherein the target is obtained by inactivating ribozyme (R). 9. The method of controlling expression of a target gene (A) according to item 8, wherein the expression of the gene (A) is promoted.
10. 10. The method for controlling expression of a target gene (A) according to item 8 or 9, wherein the inactivation of ribozyme (R) causes theophylline to act.

  (A) a cDNA of a recombinant virus obtained by inserting an arbitrary gene of interest (A) into a cDNA encoding the Borna disease virus genome of the present invention, (b) a cDNA encoding a ribozyme and (c) a promoter sequence, (b) is arranged upstream and downstream of a), and (a) and (b) are arranged downstream of (c), further comprising the virus vector of (a) According to the viral vector in which the cDNA encoding ribozyme (R) and the ribozyme (R) control mechanism (R ') are arranged in the untranslated region of the target gene (A), the control mechanism (R') By performing the operation, it becomes possible to induce the expression of the target gene (A) mounted on the BDV vector at a desired timing.

It is a figure which shows the structural example of the BDV genome which can be used for this invention. It is a schematic diagram which shows the self-digestion control mechanism by a ribozyme (R) control cassette. The result shows the structure of the BDV vector of the present invention including the ribozyme (R) control cassette, and further confirms the expression control of the target gene (A) luciferase (Gluc) when the ribozyme (R) control cassette is linked in tandem FIG. (Examples 1 and 2) It is a figure which shows the result of having confirmed the expression induction of the target gene (Gluc) when theophylline is added to the BDV vector containing a ribozyme (R) control cassette. (Example 3) It is the figure which confirmed that the BDV vector containing a ribozyme (R) control cassette infected the Vero cell. Example 4 It is the figure which confirmed on the protein level that the BDV vector containing a ribozyme (R) control cassette infected the Vero cell. Example 4 FIG. 3 is a view confirming that a BDV vector in which a ribozyme (R) control cassette is linked in tandem has infected Vero cells. Example 4 It is the figure which confirmed at the RNA level that the BDV vector which connected the ribozyme (R) control cassette in tandem infected the Vero cell. Example 4 It is a figure which shows the result of having confirmed the expression induction of the target gene (Gluc) when the theophylline of each concentration was added to the BDV vector containing a ribozyme (R) control cassette. (Example 5) It is a figure which shows that the BDV vector containing a ribozyme (R) control cassette can control the expression of a target gene (Gluc) reversibly. (Example 6)

  The present invention relates to a viral vector capable of inducing expression of a target gene at a desired timing when an operation for introducing an arbitrary target gene (foreign gene) is performed using the viral vector. More specifically, (a) the cDNA encoding the BDV genome contains a cDNA of a recombinant virus into which the gene of interest (A) is inserted, (b) a cDNA encoding a ribozyme and (c) a promoter sequence, a viral vector characterized in that (b) is arranged upstream and downstream of a), and (a) and (b) are arranged downstream of (c), further comprising the purpose of (a) The present invention relates to a viral vector in which a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ′) are arranged in the untranslated region of gene (A).

1. BDV genome The BDV genome in the present invention may be a gene belonging to Bornaviridae ( Bornaviridae ) or a mutant strain thereof. Examples of viruses belonging to the Bornaviridae family include virus strains such as He80, H1766, StrainV, and huP2br. Examples of the mutant strain include No / 98, Bo / 04w, HOT6, and the like. These genomic sequences are available, for example, from:

He80 ; GenBank Accession # L27077, Cubitt, B., Oldstone, C. and de la Torre, JC Sequence and genome organization of Borna disease virus. J. Virol. 68 (3), 1382-1396 (1994).

H1766;..... GenBank Accession # AJ311523, Pleschka, S, Staeheli, P, Kolodziejek, J, Richt, JA, Nowotny, N and Schwemmle, M Conservation of coding potential and terminal sequences in four different isolates of Borna disease virus J. Gen. Virol. 82 (PT 11), 2681-2690 (2001).

StrainV ; GenBank Accession # U04608, Briese, T., Schneemann, A., Lewis, AJ,
Park, YS, Kim, S., Ludwig, H. and Lipkin, WI Genomic organization of Borna disease virus.Proc. Natl. Acad. Sci. USA 91 (10), 4362-4366 (1994).

huP2br ； GenBank Accession # AB258389, Nakamura, Y., Takahashi, H., Shoya, Y., Nakaya, T., Watanabe, M., Tomonaga, K., Iwahashi, K., Ameno, K., Momiyama, N ., Taniyama, H., Sata, T., Kurata, T., de la Torre, JC, Ikuta, K. Isolation of Borna disease virus from human brain tissue, J. Virol 74 (2000) 4601-4611.

No / 98 ; GenBank Accession # AJ311524, Nowotny, N. and Kolodziejek, J. Isolation and characterization of a new subtype of Borna disease virus. J. Gen. Virol. 74, 5655-5658 (2000).

Bo / 04w ; GenBank Accession # AB246670, Watanabe, Y., Ibrahim, MS, Hagiwara, K., Okamoto, M., Kamitani, W., Yanai, H., Ohtaki, N., Hayashi, Y., Taniyama, H., Ikuta, K. And Tomonaga, K. Characterization of a Borna disease virus field isolate which shows efficient viral propagation and transmissibility.Microbes and Infection 9 (2007) 417-427.

  In addition, as long as the function as BDV is maintained, a part of these genome sequences may be replaced, deleted, or newly inserted with other bases, and a part of the base sequences may be rearranged. It may be. Any of these derivatives can be used in the present invention. The part may be 1 to several (1 to 5, preferably 1 to 3, more preferably 1 to 2), for example, in terms of amino acid residues. A cDNA encoding the BDV genome can be prepared based on the viral genome information. For example, cDNA can be prepared from an RNA genome using a sequence reversal enzyme. Moreover, based on the arrangement | sequence of RNA genome, it can also synthesize | combine chemically using a DNA synthesizer.

2. BDV vector containing all or part of the BDV genome The natural BDV genome contains at least six proteins: nuclear protein (N protein), X protein, phosphorylated protein (P protein), matrix protein (M protein), surface Glycoprotein (G protein) and RNA-dependent RNA polymerase (L protein) are encoded. In FIG. 1, N, X, P, M, G, and L schematically show the ORF of each gene. In the present specification, viral RNAs encoding G protein, M protein, N protein, P protein and L protein are referred to as G gene, M gene, N gene, P gene and L gene, respectively. For example, “G gene cDNA” means a cDNA encoding the G gene.

  The BDV vector containing all or part of the BDV genome in the present specification includes (a) a recombinant virus cDNA in which the gene of interest (A) is inserted into the cDNA of the BDV genome (see FIG. 1), and (b) A ribozyme-encoding cDNA and (c) a promoter sequence, (b) located upstream and downstream of (a), and (a) and (b) located downstream of (c), A ribozyme (R) cDNA and a ribozyme (R) control mechanism (R ′) are arranged in the untranslated region of the target gene (A).

  Specific examples of the recombinant virus in which the target gene (A) is inserted into the cDNA (a) of the BDV genome include the following embodiments, but are not limited thereto.

(1) One aspect of the recombinant virus of the present invention includes N gene, X gene, P gene, M gene, G gene, and L gene cDNAs in the cDNA of BDV genome (a). Recombinant virus cDNA with the target gene (A) inserted between the gene and the untranslated region of the target gene (A), the ribozyme (R) cDNA and the ribozyme (R) regulatory mechanism (R ') Is arranged.

(2) In another aspect of the recombinant virus of the present invention, the BDV genome (a) cDNA is a G gene-deficient type, and each of the N gene, X gene, P gene, M gene and L gene cDNAs Including a recombinant virus cDNA in which the target gene (A) is inserted between the P gene and the M gene, and the ribozyme (R) cDNA and ribozyme (R) in the untranslated region of the target gene (A). ) Control mechanism (R ′) is arranged.

(3) Still another embodiment of the recombinant virus of the present invention is a gene deficient type of M gene and G gene in the cDNA of BDV genome (a), N gene, X gene, P gene, and Recombinant virus cDNA containing the cDNA of the target gene (A) inserted into the untranslated region linked to the downstream of the translated region of the P gene. The ribozyme (R) cDNA and the ribozyme (R) control mechanism (R ′) are arranged.

  In the present specification, the type and length of the target gene (A) inserted into the cDNA of the BDV genome (a) are not particularly limited, and a desired gene can be used depending on the purpose. For example, cDNA of a gene encoding a protein or peptide, siRNA, short hairpin RNA (shRNA), cDNA encoding microRNA (miRNA), cDNA encoding RNA aptamer, or the like can be used. For example, it is preferable that a consensus sequence is further arranged between the 3 ′ end of the cDNA of the target gene and the splice donor site of the G gene. Thereby, the expression efficiency of the target gene becomes higher. The consensus sequence may be appropriately determined according to the cell and the target gene to be introduced.

  In the BDV vector of the present invention, a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ′) are arranged in the untranslated region of the target gene (A). The ribozyme (R) that can be used in the present specification is a self-digesting ribozyme, for example, a hammerhead ribozyme. Examples of the ribozyme (R) control mechanism (R ′) include aptamers that can bind to theophylline. Ribozyme (R) can control the activity of ribozyme (R) by binding theophylline to the aptamer.

  In the present specification, a ribozyme (R) and a cassette containing a ribozyme (R) control mechanism (R ′) may be referred to as a “ribozyme (R) control cassette”. When the base sequence specifying the ribozyme (R) control cassette is defined as 1 unit, the BDV vector of the present invention includes a base sequence in an arbitrary repeating unit selected from 1 unit or 2 to 5 units. Can do. As the ribozyme (R) control cassette, for example, L2bulge9 (L2b9), which is a gene control switch platform shown in Non-Patent Document 4, can be used.

  Specifically, the base sequence of cDNA encoding ribozyme (R) can be represented by SEQ ID NO: 1, for example. The base sequence of the control mechanism (R ′) can be represented by SEQ ID NO: 2, for example. The base sequence specifying the ribozyme (R) control cassette combining these can be represented by SEQ ID NO: 3, for example. In addition, each base sequence shown in the following SEQ ID NOs: 1 to 3 may be one in which 1 to a plurality of nucleotides are substituted, deleted, and added within a range in which the object of the present invention can be achieved. In addition, the base sequences shown in SEQ ID NOs: 1 to 3 are exemplifications, and the base sequences specifying the cDNA encoding ribozyme (R), the control mechanism (R ′) and the ribozyme (R) control cassette are as follows. It may be a sequence different from each base sequence specified by SEQ ID NOs: 1 to 3 within the range that can achieve the object of the invention.

Ribozyme (R) (sTRSV hammerhead ribozyme): GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGC (SEQ ID NO: 1)
Control mechanism (R '): TGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACG (SEQ ID NO: 2)
Ribozyme (R) control cassette: GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGT TGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACG GAGGACGAAACAGC (SEQ ID NO: 3)
In the base sequence shown in SEQ ID NO: 3, the underlined site is the same as the base sequence shown in SEQ ID NO: 2 (control mechanism (R ′)).

  In the present specification, the ribozyme indicated by (b) may be any ribozyme capable of cleaving BDV genomic RNA transcribed from cDNA of recombinant BDV genome (a). The ribozyme (b) contained in the BDV vector of the present invention is different from the above-mentioned ribozyme (R) in the position of the cDNA of the BDV genome (a). The ribozyme cDNA shown in (b) may be a ribozyme such as hepatitis D virus ribozyme (HDVRz), hairpin ribozyme, artificial ribozyme, or hammerhead ribozyme (HamRz). Moreover, as long as it has ribozyme activity, the cDNA of the above modified ribozyme modified ribozyme can also be used. Specifically, the ribozyme cDNA shown in Patent Document 2 can be applied.

  In the present specification, the promoter sequence contained in the BDV vector represented by (c) includes an RNA polymerase II promoter sequence, an RNA polymerase I promoter sequence, and a T7 polymerase promoter sequence. These promoter sequences are preferred. Examples of the RNA polymerase II promoter include CMV promoter and CAGGS promoter. Of these, the CAGGS promoter is particularly suitable. Specifically, the promoter shown in Patent Document 2 can be applied.

  The BDV vector used in the present invention may contain a viral G gene cDNA. Thereby, the recombinant BDV for gene transfer produced from the BDV vector can be a self-replicating (persistent infection) BDV. The self-replicating type includes the full-length viral G gene cDNA in the genome of the BDV vector, so that the recombinant virus for gene transfer produced from the BDV vector is expressed as a complete viral particle with the ability to propagate, The type that can spread infection by itself.

  The viral G gene in the present invention may be any gene that encodes a protein that functions as an envelope virus G protein. Examples thereof include G genes of BDV and G genes of viruses other than BDV. As the G gene of viruses other than BDV, the G gene of the Rhabdoviridae Vesicular Stomatitis Virus (VSV) virus is preferable. Specifically, the viral G gene shown in Patent Document 2 can be applied.

(e) Other base sequences The BDV vector used in the present invention can contain, for example, a part or all of the SV40 viral replication origin / promoter region sequence. When the BDV vector contains a part or all of the SV40 virus replication origin / promoter region sequence, the sequence may be located downstream of (a), (b) and (c). preferable. As a part of the SV40 viral DNA replication origin / promoter region sequence, a fragment consisting of 113 bases on the 5 ′ side in the SV40 replication origin / promoter region is suitable. The SV40 virus replication origin / promoter region sequence is described in, for example, DA Dean, BS Dean, S. Muller, LC Smith, Sequence requirements for plasmid nuclear import, Exp. Cell. Res. 253 (1999) 713-722. ing.

  As long as the BDV vector used in the present invention exhibits the effects of the present invention, the BDV vector further includes one or more factors advantageous for protein expression, such as enhancers, activators (eg, trans-acting factors), chaperones, and processing proteases. One or more nucleic acid sequences encoding may also be included. Moreover, the BDV vector used in the method of the present invention may have any factor that is functional in the selected cell.

  The BDV vector used in the present invention may be linear DNA or circular DNA, but is preferably circular when introduced into cells. Examples of the circular BDV vector include those arranged in a commercially available plasmid vector. A commercially available plasmid vector may be any plasmid vector as long as it is capable of self-replication in a cell into which a viral vector is introduced. Examples thereof include pBluescript SKII (−), pCAGGS, pCXN2, and pCDNA3.1. Specifically, Patent Document 2 can be referred to.

2. Method for Producing BDV Vector The method for producing the BDV vector used in the present invention is not particularly limited, and a genetic engineering technique known per se can be used. For example, in the method described in 2.2 Plasmid construction of "Materials and methods" of Yanai et al., Microbes and Infection (2006), 8 1522-1529, the CAT gene is replaced with the genomic sequence of the G gene-deficient BDV, A circular viral vector (transient infection type) can be prepared by incorporating the target gene into the PM intergenic region. In addition, in this transiently infected viral vector, a cDNA encoding the BDV or VSV G gene is inserted downstream of the region encoding the L gene using a restriction enzyme, thereby allowing self-replication (sustained) Infectious virus vectors can also be prepared. More specifically, the method described in Patent Document 2 can be referred to.

3. Recombinant BDV for gene transfer
The recombinant BDV for gene transfer used in the method of the present invention includes the above-described BDV vector described herein. The method described in Patent Document 2 can be referred to for a method for producing a recombinant BDV for gene introduction.

4). Method of introducing target gene into cells By infecting cells with the above-described recombinant BDV for gene transfer, the target gene incorporated into the BDV can be introduced into cells. Infection of cells with the recombinant BDV for gene transfer is achieved by adding a culture solution containing the recombinant BDV for gene transfer obtained by purification to the cell culture system. More specifically, the method described in Patent Document 2 can be referred to.

5). Method for controlling expression of target gene The present invention extends to a method for controlling the induction of expression of an arbitrary target gene (A) by using the BDV vector of the present invention. The expression control of the target gene (A) is achieved by reversibly inactivating or activating the ribozyme (R) by the above-described ribozyme (R) control mechanism (R ′). As described above, L2bulge9 (L2b9), which is a gene control switch platform shown in Non-Patent Document 4, is an example of a control mechanism (R ′) that can reversibly inactivate or activate ribozyme (R). Can be mentioned. L2b9 contains an aptamer that can bind to theophylline, and ribozyme (R) can be inactivated by allowing theophylline to act on the aptamer. Ribozyme (R) can be reversibly activated by removing theophylline from the culture system. By using this mechanism, the viral vector of the present invention is in a state where ribozyme (R) is activated when theophylline is not acting, and expression of the target gene (A) contained in (a) above. Is suppressed. On the other hand, when theophylline is acted on, activation of the ribozyme (R) is suppressed by the control mechanism (R ′). As a result, the target gene (A) can be expressed without being suppressed by the ribozyme (R).

  Hereinafter, although an example explains the present invention in detail, these examples are examples of the present invention and the present invention is not limited to these.

(Example 1) Construction of virus vector In this example, a BDV vector containing a target gene (A) and a ribozyme (R) control cassette was prepared (see Fig. 3). As the target gene (A), a cDNA encoding a reporter protein luciferase (Gaussoa Luciferase: Gluc) was used. The ribozyme (R) control cassette comprises an aptamer capable of binding to the ribozyme (R) cDNA (sTRSV hammerhead ribozyme) consisting of the base sequence shown in SEQ ID NO: 1 and theophylline consisting of the base sequence shown in SEQ ID NO: 2. Contains cDNA (regulatory mechanism (R ')). The ribozyme (R) control cassette is specified by the base sequence shown in SEQ ID NO: 3.

  In this example, a BDV vector comprising a cassette in which the base sequence represented by SEQ ID NO: 3 was used as one unit of ribozyme (R) control cassette and 1 to 3 units of ribozyme (R) control cassette was connected in series was constructed. One unit of the ribozyme (R) control cassette was Gluc-L2b9 × 1, 2 units were Gluc-L2b9 × 2, and 3 units were Gluc-L2b9 × 3. Specifically, Gluc-L2b9 × 1 includes one sequence of SEQ ID NO: 3, and Gluc-L2b9 × 3 includes three sequences of SEQ ID NO: 3 in tandem. The cDNA encoding luciferase (Gluc) used in this example is specified by SEQ ID NO: 4. As a ribozyme (R) control cassette in this example, L2b9 shown in Non-Patent Document 4 was applied.

Ribozyme (R): GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGC (SEQ ID NO: 1)
Control mechanism (R '): TGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACG (SEQ ID NO: 2)
Ribozyme (R) control cassette (Ribozyme (R) + control mechanism (R ') = L2b9: GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACGGAGGACGAAACAGC (SEQ ID NO: 3)
Luciferase (Gluc): (SEQ ID NO: 4)

  As the BDV vector, a recombinant BDV (rBDV P / M-Gluc) in which the Gluc gene and L2b9 were incorporated in the cistron region between the P gene and the M gene of the BDV genome was used. rBDV P / M-Gluc was grown in Vero cells (derived from African green monkey / kidney epithelial cells). Collect BDV (rBDV P / M-Gluc) grown from 100% confluent BDV-producing cells in a 6 x 10 cm dish, and suspend the cells in DMEM medium containing 1.2 ml FCS 4 times for 30 seconds each And then centrifuged at 1,200 g for 25 minutes at 4 ° C. The supernatant containing rBDV P / M-Gluc was collected and used as cell-free BDV (rBDV P / M-Gluc). Cell-free BDV (rBDV P / M-Gluc) was stored at -80 ° C.

(Example 2) Confirmation of luciferase (Gluc) expression control In this example, the BDV vector prepared in Example 1 was used to confirm the action of a ribozyme (R) control cassette on the expression of the reporter protein Gluc. .

In this example, Gero-L2b9 × 1, Gluc-L2b9 × 2 and Gluc-L2b9 × 3 BDV vectors prepared in Example 1 were persistently infected with Vero cells and contained 2% FCS (bovine calf serum). The cells were cultured in a DMEM (Dulbecco's modified Eagle's medium) medium for 24 hours at 37 ° C., and the expression level of Gluc was measured for each vector. Accordance with the ^{NEW ENGLAND Biolabs Biolux (R) Gaussia} Luciferase Assay Kit protocol was carried out Gluc activity test (Gluc assay). To 1 μl of BioLux GLuc Substrate, 100 μl of BioLux GLuc assay buffer (Assay Buffer) was added and mixed well to obtain a GLuc assay solution (assay solution). Collect 1 μl of the culture supernatant of rBDV Gluc-L2b9x1, rBDV Gluc-L2b9 × 2 and rBDVGluc-L2b9 × 3 infected Vero cells after 24 hours of culture, and dilute into 1000 μl of DMEM containing 2% FCS. did. Gluc activity test solution (Gluc assay solution) 10μl and sample 10μl were mixed in a test tube, and fluorescence intensity was measured using a luminescence photometer (Berthold Technologies Lumat LB 9507 Single Tube Luminometer) to confirm the expression level of Gluc. .

  The relative expression level when the Gluc expression level is 1 when the ribozyme (R) control cassette is 1 unit is shown in FIG. As a result, when the unit of the ribozyme (R) control cassette was increased, a tendency to suppress the expression of Gluc was observed (FIG. 3). The ribozyme (R) control cassette includes a ribozyme (R) and a control mechanism (R ′) as described above. The control mechanism (R ′) contained in the ribozyme (R) control cassette contains an aptamer cDNA capable of binding to theophylline, and when theophylline is not allowed to act on the control mechanism (R ′), the ribozyme (R) ribozyme activity is Maintained. Therefore, when theophylline was not added, the tendency was that the expression of Gluc was suppressed by ribozyme (R) as the number of linked ribozyme (R) control cassettes increased.

(Example 3) Confirmation of luciferase (Gluc) expression control by theophylline 1
In this example, the expression of Gluc when theophylline 10 mM was allowed to act was examined.

  Theophylline 10 mM was allowed to act on each of the Gluc-L2b9 × 1, Gluc-L2b9 × 2 and Gluc-L2b9 × 3 BDV vectors prepared in Example 1 and a BDV vector not containing Gluc-L2b9. For each vector, the value obtained by dividing the Glu expression level when theophylline 10 mM was applied by the Glu expression level when theophylline 0 mM was applied was calculated as the ON / OFF ratio and shown in FIG. It was confirmed that the larger the number of linked ribozyme (R) control cassettes, the higher the expression level of Gluc.

(Example 4) Effect on cells when a BDV vector was allowed to act In this example, the effect on cells when a BDV vector of the present invention was allowed to act on Vero cells was confirmed. rBDV Gluc-L2b9 × 1 infected Vero cells were seeded in an 8 well chamber slide at a concentration of 2 × 10 ⁴ cells / well and cultured at 37 ° C. until 90-100% confluent. Cell nuclei, BDV N protein, and BDV M protein were stained by immunostaining, and fluorescence was observed with a confocal laser microscope. It was confirmed that rBDV Gluc-L2b9 × 1 was infected in Vero cells (FIG. 5).

Vero cells, rBDV Gluc-L2b9 × 1, and rBDV GFP-infected Vero cells were seeded at a concentration of 4 × 10 ⁴ cells / well in a 24-well plate and cultured at 37 ° C. After 24 hours, each cell was dissolved in 100 μl of 1 × sample buffer and used as a specimen. After subjecting the specimen to SDS-PAGE, Western blotting was performed using an anti-BDV nucleoprotein antibody, an anti-GFP antibody and an anti-Tubulin antibody. Indeed, it was confirmed at the protein level that rBDV Gluc-L2b9 × 1 was infected in Vero cells (FIG. 6).

Vero cells and rBDV Gluc-L2b9 × 1, × 2, × 3 infected Vero cells are seeded in 8-well chamber slides at a concentration of 2 × 10 ⁴ cells / well until 90-100% confluent Cultured at 37 ° C. BDV M protein was stained by immunostaining and fluorescence was observed with a confocal laser microscope. As a result, it was confirmed that rBDV Gluc-L2b9 × 1, × 2, and × 3 were infected in Vero cells (FIG. 7).

  Total RNA was extracted from Vero cells and infected Vero cells of each of the BDV vectors of Gluc-L2b9 × 1, Gluc-L2b9 × 2, and Gluc-L2b9 × 3, and cDNA was prepared using reverse transcription reaction. BDV-P / M was amplified using cDNA as a template and primers having the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the size of the PCR product was confirmed by agarose gel electrophoresis. The expected PCR product sizes are GFP: about 1000 bp, rBDV Gluc-L2b9 × 1: about 1000 bp, rBDV Gluc-L2b9 × 2: about 1150 bp, rBDV Gluc-L2b9 × 3: about 1300 bp.

BDV_P_F2: GACCTCCTCTACGCATCAAC (SEQ ID NO: 5)
BDV_M_R2: CATCCAGGGACGATTACCTT (SEQ ID NO: 6)
As a result, BDV vectors of Gluc-L2b9 × 1, Gluc-L2b9 × 2 and Gluc-L2b9 × 3 could be detected respectively (FIG. 8).

(Example 5) Induction of a reporter gene by theophylline In this example, for the Gluc-L2b9 × 1 BDV vector prepared in Example 1, the reporter gene induction effect when theophylline was allowed to act was confirmed. The control was a BDV vector without Gluc-L2b9. RBDV Gluc-infected Vero cells and rBDV Gluc-L2b9 × 1-infected Vero cells were seeded at a concentration of 4 × 10 ⁴ cells / well in a 48-well plate and cultured at 37 ° C. Three hours later, after confirming that the cells adhered to the bottom of the well, the medium was changed to DMEM medium containing 2% FCS supplemented with theophylline (0, 1, 3, 10 mM), and cultured at 37 ° C. After 24 hours, 1 μl of each culture supernatant was collected, diluted in DMEM containing 1000 μl of 2% FCS, and subjected to the Gluc activity test.

  As a result, it was shown that the amount of Glu expression increases as the theophylline addition amount increases. In particular, when 10 mM of theophylline was added, Glu was expressed to the same extent in the vector in which the ribozyme (R) control cassette of the present invention was not inserted (FIG. 9).

(Example 6) Reversible reaction of reporter gene induced by theophylline In this example, for the Gluc-L2b9 × 1 BDV vector prepared in Example 1, the reversible reaction of the reporter gene induction effect when theophylline was allowed to act. It was confirmed.

RBDV Gluc-L2b9 × 1 infected Vero cells were seeded at a concentration of 4 × 10 ⁴ cells / well in a 48-well plate and cultured at 37 ° C. Three hours later, after confirming that the cells adhered to the bottom of the well, the medium was replaced with 2% FCS DMEM supplemented with theophylline (0, 3 mM) and cultured at 37 ° C. After 24 hours, 1 μl of each culture supernatant was collected, diluted in 1000 μl of 2% FCS DMEM, and subjected to the Gluc activity test (Day 1). Thereafter, the medium was replaced with 2% FCS DMEM without theophylline and cultured at 37 ° C. After 24 hours, 1 μl of each culture supernatant was collected, diluted in 1000 μl of 2% FCS DMEM, and subjected to the Gluc activity test (Day 2). Similarly, the medium was replaced with 2% FCS DMEM without theophylline and cultured at 37 ° C. After 24 hours, 1 μl of each medium supernatant was collected, diluted in 1000 μl of 2% FCS DMEM, and subjected to the Gluc activity test (Day 3).

  As a result, after inducing luciferase expression in a medium supplemented with theophylline 3 mM, and then culturing in a medium without theophylline, the expression is suppressed to the same level as when luciferase expression is not induced, and the expression of the target gene is reversible. It was found that it was controllable (FIG. 10).

  As described in detail above, according to the viral vector in which the control mechanism (R ′) of the ribozyme (R) of the present invention is arranged, the purpose of loading the BDV vector by operating the control mechanism (R ′) It becomes possible to induce the expression of the gene (A) at a desired timing.

  The gene introduced into the cell by the BDV vector is stably expressed over several months because the virus is persistently infected in the cell. Thus, by using the BDV vector of the present invention, it is possible to reversibly induce expression of a gene that has been stably maintained for several months at a desired timing. Thus, in gene therapy, desired gene therapy can be stably performed over a long period of time without causing contamination due to insertion of a gene in the genome of the recipient.

Claims (10)

(a) a cDNA of a recombinant virus in which the gene of interest (A) is inserted into a cDNA encoding the Borna disease virus genome, (b) a cDNA encoding a ribozyme and (c) a promoter sequence, upstream of (a) and (B) is arranged downstream, and (a) and (b) are arranged downstream of (c), further comprising the gene of interest (A) in (a) A viral vector in which a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ′) are arranged in the untranslated region of. The target gene (A) is inserted in the untranslated region between the P gene and M gene of the cDNA encoding the genome of (a) Borna disease virus, and in the untranslated region of the target gene (A), The viral vector according to claim 1, wherein a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ') are arranged. The target gene (A) is inserted into the non-translated region linked to the downstream of the translated region of the P gene of the cDNA encoding the (a) Borna disease virus genome, and the untranslated region of the target gene (A) The viral vector according to claim 1, wherein a cDNA encoding ribozyme (R) and a ribozyme (R) control mechanism (R ′) are arranged. The viral vector according to any one of claims 1 to 3, wherein the ribozyme (R) is an autodigestive ribozyme. The viral vector according to any one of claims 1 to 4, wherein the ribozyme (R) control mechanism (R ') is an aptamer capable of binding to theophylline. A cassette containing the ribozyme (R) -encoding cDNA and the ribozyme (R) control mechanism (R ') is defined as a ribozyme (R) control cassette, and the base sequence specifying the ribozyme (R) control cassette is defined as one unit. The viral vector according to claim 5, which comprises a base sequence in an arbitrary repeating unit selected from one unit or 2 to 5 units. The viral vector according to claim 6, wherein the ribozyme (R) control cassette is specified by the nucleotide sequence shown in SEQ ID NO: 3.
GCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTTGTCCAATACCAGCATCGTCTTGATGCCCTTGGCAGTGGATGGGGACGGAGGACGAAACAGC (SEQ ID NO: 3) A method for controlling expression of a target gene (A) contained in (a) using the viral vector according to any one of claims 1 to 7, comprising reversibly inactivating ribozyme (R) or A method for controlling the expression of a target gene (A), comprising a step of controlling the expression of the target gene (A) contained in (a) by being activated. A method for controlling the expression of a target gene (A) contained in (a) using the viral vector according to any one of claims 1 to 7, wherein the ribozyme (R) is inactivated. The method for controlling expression of a target gene (A) according to claim 8, wherein the expression of the target gene (A) is promoted. The method for controlling the expression of a target gene (A) according to claim 8 or 9, wherein the inactivation of ribozyme (R) is caused by allowing theophylline to act.