JP2016508967A - Indole carboxamide derivatives as P2X7 receptor antagonists - Google Patents

Abstract

The present invention relates to indole carboxamide derivatives of formula (I) wherein R1, R2, R3, R4, R5 and R6 are as defined in the specification, their preparation and pharmaceutically active compounds. As regards their use. [Chemical 1] [Selected figure] None

Description

The present invention relates to indole carboxamide derivatives of formula (I) and their use as medicaments. The present invention also relates to processes for the preparation of the present compounds relates to a related aspect includes the use thereof as pharmaceutical compositions and in particular P2X ₇ receptor antagonists for the compound containing one or more formula (I).

P2X ₇ receptor (P2RX7) belongs to P2X ionotropic receptors (ionotropic receptors) family, extracellular nucleotides, in particular activated by adenosine triphosphate (ATP). P2RX7 is distinguished from other P2X family members in that it requires high concentrations (in the mM range) of ATP for its activation and has the ability to form large pores by continuous or repeated stimulation ( North, RA, Physiol.Rev. 2002, 82 (4), 1013-67; Surprent, A., Rassendren, F. et al., Science 1996, 272 (5262), 735-8; MacKenzie, A. et al., J. Physiol., 1999, 519, 335-46). P2RX7 is present on many types of cells, particularly cells that are known to be involved in inflammatory and immune processes. This is reflected both in the periphery and in the CNS, when mononuclear cells and microglia are primed with Lipopolysaccharide S (LPS) and then stimulated with ATP, via a P2RX7-mediated mechanism, IL1β and It has been shown that local release and processing of other family members, including IL18, occurs. As further evidence for its role in this pathway, in fact, P2X7 receptor-deficient mice are unable to release IL1β after LPS priming and ATP stimulation (Sole, M., Labasi, J. et al., J. Biol. Chem). , 2001, 276 (1), 125-32). In addition, the release of L-selectin from mononuclear cells, macrophages and lymphocytes, degranulation in mast cells and apoptosis in lymphocytes are all associated with P2RX7 stimulation. P2RX7 is also expressed on epithelial cells and endothelial cells (Ferrari, D., Chiozzi, P. et al. Neuropharmacology 1997, 36 (9), 1295-301; Wiley, JS, Chen, J. et al. R. et al., Ciba Found Symp. 1996, 198, 149-60 and 160-5; North, RA, Physiol. Rev. 2002, 82 (4), 1013-67). In addition to its role in the periphery, P2RX7 may have an important function in neurotransmission in the CNS via activation on post-synaptic and / or presynaptic centers and peripheral neurons and glia (Deuchars). S.A., Atkinson, L. et al., J. Neurosci. 2001, 21 (18), 7143-52; Superlag, B., Kofalvi, A. et al., J. Neurochem. 2002, 81 (6), 1196. -211). Recent data revealed using in situ hybridization showed that P2X7 receptor mRNA is widely distributed throughout the rat brain. In particular, among the high expression sites of P2X7 mRNA, piriform cortex, hippocampus, pontine nuclei and pronucleus of spinal cord were prominent (Yu, Y., Ugawa, S. et al., Brain. Res. 2008). 1194, 45-55). Thus, there is a therapeutic rationale for using P2X7 ion channel blockers in the treatment of various disease states. These diseases include diseases associated with the central nervous system such as stroke or injury, meningitis, sleep disorders, mood and anxiety disorders, as well as Alzheimer's disease, Huntington's disease, epilepsy, amyotrophic lateral sclerosis, Including diseases associated with neurodegeneration and neuroinflammation such as acute spinal cord injury and chronic and neuropathic and inflammatory pain,
It is not limited to these. In addition, rheumatoid arthritis, osteoarthritis, psoriasis, allergic dermatitis, asthma, chronic obstructive pulmonary disease, airway hypersensitivity, septic shock, bronchitis, glomerulonephritis, irritable bowel syndrome, skin damage, emphysema, limbs Muscular dystrophy type 2B, fibrosis, synovitis, acne, pustular syndrome, atherosclerosis, burns, spinal cord injury, ossification osteomyelitis, Crohn's disease, ulcerative colitis, malignant cell proliferation and metastasis Peripheral inflammatory and autoimmune diseases such as myeloid leukemia, diabetes, trauma, meningitis, osteoporosis, burns, ischemic heart disease and varicose veins and trauma are all examples of P2X7 channel involvement However, it is not limited to these. In addition, recent reports suggest a relationship between P2RX7 and chronic, inflammatory and neuropathic pain (Chessell, IP, Hatcher, JP et al., Pain, 2005, 114 (3). 386-96). In general, these findings indicate the role of the P2X7 receptor in the process of neurosynaptic transmission and thus the potential role of P2X7 antagonists as a novel therapeutic tool for neuropathic pain.

  In view of the above findings, there is a substantial need for P2X7 antagonists that can be used effectively in the treatment of neuropathic pain, chronic inflammatory pain, inflammation and neurodegenerative symptoms.

Various indole carboxamide derivatives P2X ₇ are also receptor antagonists are disclosed in WO2009 / 023623, WO2009 / 108551 and WO2009 / 118175. P2X ₇ quinoline and isoquinoline derivatives which are also receptor antagonists are disclosed in WO2009 / 132000.

In the following, various aspects of the present invention are described.
1) The present invention relates to indole carboxamide derivatives of formula (I) and salts (particularly pharmaceutically acceptable salts) of such compounds.

式中、
Ｒ^１はヘテロアリール又はアリール基を表し、これらの基は独立に未置換であるか、１、２又は３個の置換基により置換され、当該置換基は、（Ｃ_１−Ｃ_４）アルキル、（Ｃ_３−Ｃ_６）シクロアルキル、（Ｃ_１−Ｃ_４）アルコキシ、（Ｃ_１−Ｃ_３）フルオロアルキル、（Ｃ_１−Ｃ_３）フルオロアルコキシ、ヒドロキシ、ハロゲン及びフェノキシからなる群より独立に選択され；
Ｒ^２は、
− ヘテロシクリルであって、未置換であるか又は１若しくは２個の置換基により置換され、当該置換基が、（Ｃ_１−Ｃ_４）アルキル、（Ｃ_１−Ｃ_４）アルキルカルボニル、（Ｃ_１−Ｃ_４）アルコキシカルボニル、（Ｃ_１−Ｃ_４）アルキルスルフォニル、及びハロゲンから独立に選択される、上記ヘテロシクリル；
− ヘテロシクリルオキシ；
− 未置換であるか又は１若しくは２個のハロゲンにより置換された（Ｃ_３−Ｃ_６）シクロアルキル；
− （Ｃ_３−Ｃ_６）シクロアルキルオキシ；
− Ｎ−（Ｃ_３−Ｃ_６）シクロアルキル−アミノ；
− Ｎ−（Ｃ_３−Ｃ_６）シクロアルキルメチル−アミノ；
− （Ｃ_３−Ｃ_６）アルキル；
− （Ｃ_２−Ｃ_６）アルコキシ；
− Ｎ−（Ｃ_１−Ｃ_４）アルキルアミノ；
− Ｎ，Ｎ−ジ−［（Ｃ_１−Ｃ_４）アルキル］−アミノ；又は
− Ｎ−アリールメチル−Ｎ−（Ｃ_１−Ｃ_４）アルキル−アミノ；
を表し；
Ｒ^３は、水素又はハロゲンを表し；
Ｒ^４は、水素、フルオロ、クロロ、（Ｃ_１−Ｃ_４）アルキル、（Ｃ_１−Ｃ_４）アルコキシ、（Ｃ_１−Ｃ_４）アルキル−カルボニル、ヒドロキシ−（Ｃ_１−Ｃ_４）アルキル、ヒドロキシ−（Ｃ_２−Ｃ_４）アルコキシ、（Ｃ_１−Ｃ_２）アルコキシ−（Ｃ_１−Ｃ_４）アルキル又は（Ｃ_１−Ｃ_４）アルコキシ−（Ｃ_２−Ｃ_４）アルコキシを表し；
Ｒ^５は、水素又は（Ｃ_１−Ｃ_４）アルキルを表し；
Ｒ^６は、フルオロ、クロロ、メチル、エチル又は（Ｃ_１−Ｃ_２）フルオロアルキルを表す。

Where
R ¹ represents a heteroaryl or aryl group, which groups are independently unsubstituted or substituted by 1, 2 or 3 substituents, the substituents being (C ₁ -C ₄ ) alkyl, _(C 3 -C _{6) cycloalkyl, (C} 1 -C _{4) alkoxy, (C} 1 -C _{3) fluoroalkyl, (C} 1 -C ₃₎ fluoroalkoxy, hydroxy, independently from the group consisting of halogen and phenoxy Selected;
R ² is
- a heterocyclyl, substituted by or is one or two substituents unsubstituted, the substituent _{is, (C} 1 -C _{4) alkyl, (C} 1 -C ₄₎ alkylcarbonyl, _{(C 1} -C _{4) alkoxycarbonyl,} are independently selected from _(C 1 -C ₄₎ alkylsulfonyl, and halogen, said heterocyclyl;
-Heterocyclyloxy;
- substituted by or one or two halogen or unsubstituted _(C 3 -C ₆₎ cycloalkyl;
- _(C 3 -C ₆₎ cycloalkyloxy;
- N- _(C 3 -C ₆₎ cycloalkyl - amino;
- N- _(C 3 -C ₆₎ cycloalkyl-methyl - amino;
- _(C 3 -C ₆₎ alkyl;
- _(C 2 -C ₆₎ alkoxy;
- N- _(C 1 -C ₄₎ alkyl-amino;
- N, N-di - _[(C 1 -C ₄₎ alkyl] - amino; or - N- arylmethyl -N- _(C 1 -C ₄₎ alkyl - amino;
Represents;
R ³ represents hydrogen or halogen;
R ⁴ is hydrogen, fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₄ ) alkyl-carbonyl, hydroxy- (C ₁ -C ₄ ) alkyl, hydroxy - represents _(C 2 -C ₄₎ alkoxy _(C 2 -C _{4) alkoxy, (C} 1 -C ₂₎ alkoxy - - _(C 1 -C ₄₎ alkyl or _(C 1 -C ₄₎ alkoxy;
R ⁵ represents hydrogen or (C ₁ -C ₄ ) alkyl;
R ⁶ represents fluoro, chloro, methyl, ethyl or (C ₁ -C ₂ ) fluoroalkyl.

  The compounds of formula (I) according to embodiment 1) may contain one or more chiral or asymmetric centers, such as one or more asymmetric carbon atoms. Double bond substituents may be present in the Z- or E-configuration unless otherwise stated. Thus, the compound of formula (I) may exist as a mixture of stereoisomers or preferably as a pure stereoisomer. Stereoisomeric mixtures may be separated by methods known to those skilled in the art.

Definition:
The following paragraphs define the various chemical moieties of the compounds of the present invention. Unless a specific definition provides a broader or narrower definition, that definition applies uniformly throughout the specification and claims.

The term “alkyl”, whether used alone or in combination, means a straight or branched alkyl group containing 1 to 6 carbon atoms. The term “(C _x -C _y ) alkyl” (x and y each being an integer) means an alkyl group as defined in the foregoing moiety containing x to y carbon atoms. For example, a (C ₁ -C ₄ ) alkyl group contains 1 to 4 carbon atoms. Representative examples of (C ₁ -C ₄ ) alkyl groups include methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl and tert-butyl. _(C 3 -C ₆₎ alkyl group contains 3-6 carbon atoms. Representative examples of (C ₃ -C ₆ ) alkyl groups include n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, tert-butyl, penta-1-yl, penta-2 -Yl, penta-3-yl, 2-methyl-but-1-yl, 3-methyl-but-1-yl, 2-methyl-but-2-yl, 3-methyl-but-2-yl, hexa -1-yl, hexa-2-yl, hexa-3-yl, 2-methyl-pent-2-yl, 3-methyl-pent-2-yl, 4-methyl-pent-2-yl, 2-methyl -Pent-3-yl, 3-methyl-pent-3-yl, 2,3-dimethyl-but-2-yl and 3,3-dimethyl-but-2-yl.

The term “alkoxy”, whether used alone or in combination, means an alkyl-O— group in which the alkyl group is as previously described. The term “(C _x -C _y ) alkoxy” (x and y each being an integer) means an alkoxy group as defined above containing x to y carbon atoms. For example, a (C ₁ -C ₄ ) alkoxy group contains 1 to 4 carbon atoms. Representative examples of (C ₁ -C ₄ ) alkoxy groups include methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-
Examples include butoxy, sec-butoxy and tert-butoxy. (C ₂ -C ₆ ) alkoxy groups contain 2 to 6 carbon atoms. Representative examples of (C ₂ -C ₆ ) alkoxy groups include ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, penta-1-yloxy, penta 2-yloxy, penta-3-yloxy, 2-methyl-but-1-yloxy, 3-methyl-but-1-yloxy, 2-methyl-but-2-yloxy, 3-methyl-but-2-yloxy Hexa-1-yloxy, hexa-2-yloxy, hexa-3-yloxy, 2-methyl-pent-2-yloxy, 3-methyl-pent-2-yloxy, 4-methyl-pent-2-yloxy, 2 -Methyl-pent-3-yloxy, 3-methyl-pent-3-yloxy, 2,3-dimethyl-but-2-yloxy and 3 , 3-dimethyl-but-2-yloxy.

The term “hydroxy- (C ₁ -C ₄ ) alkyl”, whether used alone or in combination, contains 1 to 4 carbon atoms and one hydrogen atom is hydroxy Means an alkyl group as defined herein, which is substituted with Examples of such groups are hydroxy-methyl, 1-hydroxy-ethyl, 2-hydroxy-ethyl, 1-hydroxy-prop-1-yl, 2-hydroxy-prop-1-yl, 3-hydroxy-prop-1- Yl, 1-hydroxy-prop-2-yl, 2-hydroxy-prop-2-yl, 1-hydroxy-but-1-yl, 2-hydroxy-but-1-yl, 3-hydroxy-but-1- Yl, 4-hydroxy-but-1-yl, 1-hydroxy-but-2-yl, 2-hydroxy-but-2-yl, 3-hydroxy-but-2-yl, 4-hydroxy-but-2-yl Yl, 1-hydroxy-2-methyl-prop-1-yl, 2-hydroxy-2-methyl-prop-1-yl, 3-hydroxy-2-methyl-prop-1-yl and 2-hydroxy-1 1-dimethyl - is ethyl-1-yl.

The term “hydroxy- (C ₂ -C ₄ ) alkoxy”, whether used alone or in combination, contains 2 to 4 carbon atoms and one hydrogen atom is hydroxy Means an alkoxy group as defined above, substituted with Examples of such groups are 2-hydroxy-ethoxy, 2-hydroxy-prop-1-yloxy, 3-hydroxy-prop-1-yloxy, 1-hydroxy-prop-2-yloxy, 2-hydroxy-but-1- Yloxy, 3-hydroxy-but-1-yloxy, 4-hydroxy-but-1-yloxy, 1-hydroxy-but-2-yloxy, 3-hydroxy-but-2-yloxy, 4-hydroxy-but-2-yl Iloxy, 2-hydroxy-2-methyl-prop-1-yloxy, 3-hydroxy-2-methyl-prop-1-yloxy and 2-hydroxy-1,1-dimethyl-eth-1-yloxy.

The term “(C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl”, whether used alone or in combination, represents a hydrogen atom as defined herein. Means an alkyl group as defined herein containing 1 to 4 carbon atoms, replaced by (C ₁ -C ₂ ) alkoxy as defined in Examples of such groups are methoxy-methyl, methoxy-ethyl, methoxy-propyl, methoxy-butyl, ethoxy-methyl, ethoxy-ethyl, ethoxy-propyl and ethoxy-butyl.

The term “(C ₁ -C ₄ ) alkoxy- (C ₂ -C ₄ ) alkoxy”, whether used alone or in combination, represents a hydrogen atom as defined herein. Means an alkoxy group as defined herein comprising 2 to 4 carbon atoms, replaced by (C ₁ -C ₄ ) alkoxy as defined in A preferred example of the group is 2-tert-butoxy-ethoxy.

The term “(C ₁ -C ₄ ) alkylcarbonyl”, whether used alone or in combination, is as defined herein for a (C ₁ -C ₄ ) alkyl group. Yes, means a (C ₁ -C ₄ ) alkyl-C (O) — group attached to the remainder of the molecule through a carbonyl carbon atom. Representative examples of (C ₁ -C ₄ ) alkylcarbonyl groups include methylcarbonyl, ethylcarbonyl, n-propylcarbonyl, iso-propylcarbonyl, n-butylcarbonyl, iso-butylcarbonyl, sec-butylcarbonyl and tert -Butylcarbonyl is mentioned.

The term “(C ₁ -C ₄ ) alkoxycarbonyl”, whether used alone or in combination, is as defined herein for a (C ₁ -C ₄ ) alkyl group. Yes, means a (C ₁ -C ₄ ) alkyl-O—C (O) — group attached to the remainder of the molecule through a carboxyl-C-atom. Representative examples of (C ₁ -C ₄ ) alkoxycarbonyl groups include methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, iso-propoxycarbonyl, n-butoxycarbonyl, iso-butoxycarbonyl, sec-butoxycarbonyl and tert -Butoxycarbonyl.

The term “(C ₁ -C ₄ ) alkylsulfonyl”, whether used alone or in combination, is attached to the remainder of the molecule via the —S— atom of the sulfonyl, (C ₁ -C ₄ ) means a (C ₁ -C ₄ ) alkyl-S (O) ₂ -group, wherein the alkyl group is as defined above. Representative examples of (C ₁ -C ₄ ) alkyl-sulfonyl groups include methylsulfonyl, ethylsulfonyl, n-propylsulfonyl, isopropylsulfonyl, n-butylsulfonyl, isobutylsulfonyl, sec-butylsulfonyl and tert-butylsulfonyl. Is mentioned.

The term “N— (C ₁ -C ₄ ) alkylamino”, whether used alone or in combination, means that one hydrogen atom is as defined in the above moiety (C ₁ -C ₄₎ has been replaced by an alkyl, it means an amino group (-NH _2). Representative examples of N- (C ₁ -C ₄ ) alkylamino groups include methylamino, ethylamino, n-propylamino, iso-propylamino, n-butylamino, iso-butylamino, sec-butylamino And tert-butylamino.

The term “N, N-di-[(C ₁ -C ₄ ) alkyl] -amino”, whether used alone or in combination, defines both hydrogen atoms as defined above. Means an amino group (—NH ₂ ) substituted by (C ₁ -C ₄ ) alkyl as defined (two alkyl groups may be the same or different). Representative examples of N, N-di-[(C ₁ -C ₄ ) alkyl] -amino groups include dimethylamino, methyl-ethylamino, methyl-n-propylamino, methyl-iso-propylamino, methyl -N-butylamino, methyl-iso-butylamino, methyl-sec-butylamino, methyl-tert-butylamino, diethylamino, ethyl-n-propylamino, ethyl-iso-propylamino, ethyl-n-butylamino, Examples include ethyl-iso-butylamino, ethyl-sec-butylamino and ethyl-tert-butylamino.

The term “N-arylmethyl-N— (C ₁ -C ₄ ) alkyl-amino”, whether used alone or in combination, defines one hydrogen atom as defined above for the moiety. Means an amino group (—NH ₂ ), replaced by a street (C ₁ -C ₄ ) alkyl and the other hydrogen atom is replaced by arylmethyl (the term aryl means phenyl or naphthyl). To do. Representative examples of N-arylmethyl-N- (C ₁ -C ₄ ) alkyl-amino groups include benzyl-methylamino, benzyl-ethylamino, benzyl-n-propylamino, benzyl-iso-propylamino, Benzyl-n-butylamino, benzyl-iso-butylamino, benzyl-sec-butylamino, benzyl-tert-butylamino, naphthylmethyl-methylamino, naphthylmethyl-ethylamino, naphthylmethyl-n-propylamino, naphthylmethyl -Iso-propylamino, naphthylmethyl-n-butylamino, naphthylmethyl-iso-butylamino, naphthylmethyl-sec-butylamino and naphthylmethyl-tert-butylamino.

The term “(C _x -C _y ) fluoroalkyl” (x and y are each integers) means that one or more (optionally all) hydrogen atoms are replaced by fluoro, means an alkyl group as defined in the above moiety containing y carbon atoms. For example, a (C ₁ -C ₃ ) fluoroalkyl group contains 1 to 3 carbon atoms, with 1 to 7 hydrogen atoms replaced with fluoro. Similarly, a (C ₁ -C ₂ ) fluoroalkyl group contains 1 or 2 carbon atoms, with 1 to 5 hydrogen atoms replaced with fluorine. Representative examples of such groups are difluoromethyl, trifluoromethyl, 2,2-difluoroethyl and 2,2,2-trifluoroethyl.

The term “(C _x -C _y ) fluoroalkoxy” (x and y are each integers) means that one or more (optionally all) hydrogen atoms are replaced by fluorine, x˜ It means an alkoxy group as defined in the above part containing y carbon atoms. For example, a (C ₁ -C ₃ ) fluoroalkoxy group contains 1 to 3 carbon atoms, with 1 to 7 hydrogen atoms replaced with fluorine. Representative examples of such groups are difluoromethoxy, trifluoromethoxy, 2,2-difluoroethoxy and 2,2,2-trifluoroethoxy.

The term “(C ₃ -C ₆ ) cycloalkyl”, whether used alone or in combination, means a cycloalkyl group having 3 to 6 carbon atoms. Examples of _(C 3 -C ₆₎ cycloalkyl groups are cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.

The term “(C ₃ -C ₆ ) cycloalkyloxy”, whether used alone or in combination, is as defined above for the moiety (C ₃ -C ₆ ) cycloalkyl. (C ₃ -C ₆ ) cycloalkyl-O— group of Examples of (C 3 _{-C 6)} cycloalkyl group are cyclopropyl, cyclobutyloxy, cyclopentyloxy and cyclohexyloxy.

The term “N— (C ₃ -C ₆ ) cycloalkyl-amino”, whether used alone or in combination, means that one hydrogen atom is as defined in the above moiety ( It means an amino group (—NH ₂ ) substituted by C ₃ -C ₆ ) cycloalkyl. Representative examples of N- (C ₃ -C ₆ ) cycloalkyl-amino groups include cyclopropyl-amino, cyclobutyl-amino, cyclopentyl-amino and cyclohexyl-amino.

The term “N— (C ₃ -C ₆ ) cycloalkylmethyl-amino”, whether used alone or in combination, means that one hydrogen atom is as defined in the above moiety. An amino group (—NH ₂ ) substituted with a (C ₃ -C ₆ ) cycloalkylmethyl group. Representative examples of amino group, cyclopropylmethyl _{- - N- (C 3 -C 6} ) cycloalkyl methylamino, cyclobutylmethyl - amino, cyclopentylmethyl - and amino - amino and cyclohexylmethyl.

  The term “halogen” means fluoro, chloro, bromo or iodo.

The term “aryl”, whether used alone or in combination, means a phenyl or naphthyl group. Aryl groups are unsubstituted or substituted as explicitly defined. Examples of unsubstituted or substituted aryl groups are 2-fluoro-phenyl, 3-fluoro-phenyl, 4-fluoro-phenyl, 2,4-difluoro-phenyl, 3,4-difluoro-phenyl, 3 , 5-difluoro-phenyl, 2,4,6-trifluoro-phenyl, 4-chloro-phenyl, 4-chloro-2-fluoro-phenyl, 2,4-dichloro-phenyl, 4-methyl-phenyl, 4- Methoxy-phenyl, 4-trifluoromethyl-phenyl, 4-trifluoromethoxy-phenyl and 4-phenoxy-phenyl.

  The term “heteroaryl”, whether used alone or in combination, includes 5-10 membered containing 1, 2 or 3 heteroatoms independently selected from oxygen, nitrogen and sulfur. Means a monocyclic or bicyclic aromatic ring. Examples of such heteroaryl groups are furanyl, oxazolyl, isoxazolyl, oxadiazolyl, thienyl, thiazolyl, isothiazolyl, thiadiazolyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, pyridyl, pyrimidyl, pyridazinyl, pyrazinyl, indolyl, isoindolyl, benzofuranyl, isobenzoyl Furanyl, benzothiophenyl, indazolyl, benzimidazolyl, benzoxazolyl, benzoiso-xazolyl, benzothiazolyl, benzisothiazolyl, benzotriazolyl, benzo [2,1,3] oxadiazolyl, benzo [2,1,3] Thiadiazolyl, benzo [1,2,3] thiadiazolyl, quinolinyl, isoquinolinyl, sinolinyl, quinazolinyl, quinoxalinyl and phthalazinylA heteroaryl group is unsubstituted or substituted as explicitly defined. Examples of such unsubstituted or substituted heteroaryl groups are 3,5-dimethyl-isoxazolyl (especially 3,5-dimethyl-isoxazol-4-yl), thiazolyl (especially thiazol-5-yl) , Isothiazolyl (especially isothiazol-5-yl), 1-methyl-pyrazolyl (especially 1-methyl-pyrazol-4-yl), pyridyl (especially pyridin-3-yl), 5-fluoro-pyridyl (especially 5-fluoro-pyridyl) -Pyridin-2-yl), 6-chloro-pyridyl (especially 6-chloro-pyridin-3-yl), 6-methyl-pyridyl (especially 6-methyl-pyridin-3-yl), 6-methoxy-pyridyl ( In particular 6-methoxy-pyridin-3-yl), 6-trifluoromethyl-pyridyl (especially 6-trifluoromethyl-pyridin-3-yl), -Hydroxy-pyridyl (especially 2-hydroxy-pyridin-4-yl), pyrimidyl (especially pyrimidin-5-yl), 2-methyl-pyrimidyl (especially 2-methyl-pyrimidin-5-yl), 2-cyclopropyl- Pyrimidyl (especially 2-cyclopropyl-pyrimidin-5-yl), 2-trifluoromethyl-pyrimidyl (especially 2-trifluoromethyl-pyrimidin-5-yl), pyridazinyl (especially pyridazin-3-yl) and 5-methyl -Pyrazinyl (especially 5-methyl-pyrazin-2-yl).

The term “5- or 6-membered monocyclic heteroaryl”, whether used alone or in combination, further includes one nitrogen atom and optionally one selected from oxygen, nitrogen and sulfur. Means a 5- or 6-membered monocyclic aromatic ring containing 1 heteroatom. Examples of such heteroaryl groups are oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidyl, pyridazinyl and pyrazinyl. A heteroaryl group is unsubstituted or substituted as explicitly defined. Examples of such unsubstituted or substituted heteroaryl groups are 3,5-dimethyl-isoxazolyl (especially 3,5-dimethyl-isoxazol-4-yl), thiazolyl (especially thiazol-5-yl) , Isothiazolyl (especially isothiazol-5-yl), 1-methyl-pyrazolyl (especially 1-methyl-pyrazol-4-yl), pyridyl (especially pyridin-3-yl), 5-fluoro-pyridyl (especially 5-fluoro-pyridyl) -Pyridin-2-yl), 6-chloro-pyridyl (especially 6-chloro-pyridin-3-yl), 6-methyl-pyridyl (especially 6-methyl-pyridin-3-yl), 6-methoxy-pyridyl ( In particular 6-methoxy-pyridin-3-yl), 6-trifluoromethyl-pyridyl (especially 6-trifluoromethyl-pyridin-3-yl), -Hydroxy-pyridyl (especially 2-hydroxy-pyridin-4-yl), pyrimidyl (especially pyrimidin-5-yl), 2-methyl-pyrimidyl (especially 2-methyl-pyrimidin-5-yl), 2-cyclopropyl- Pyrimidyl (especially 2-cyclopropyl-pyrimidin-5-yl), 2-trifluoromethyl-pyrimidyl (especially 2-trifluoromethyl-pyrimidin-5-yl), pyridazinyl (especially pyridazin-3-yl) and 5-methyl -Pyrazinyl (especially 5-methyl-pyrazin-2-yl).

  The term “heterocyclyl”, whether used alone or in combination, includes one heteroatom selected from nitrogen, oxygen and sulfur and optionally one additional nitrogen atom. Means a 4-8 membered saturated monocyclic or bicyclic group. The sulfur atom of the heterocyclyl group may be in an oxidized state, ie, a sulfoxide or sulfonyl state. Examples of such heterocyclyl groups are azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl, 1-oxo-thiomorpholinyl, 1,1-dioxo-thiomorpholinyl, azepanyl, 1,4-oxazepanyl, 6-oxa-3-azabicyclo [3.1.1] heptanyl and 2-oxa-5-azabicyclo [2.2.1] heptanyl. A heterocyclyl group is unsubstituted or substituted as explicitly defined. Examples of such unsubstituted or substituted heterocyclyl groups are azetidin-1-yl, pyrrolidin-1-yl, 3,3-difluoro-pyrrolidin-1-yl, piperidin-1-yl, 4- Fluoro-piperidin-1-yl, 3,3-difluoro-piperidin-1-yl, 4,4-difluoro-piperidin-1-yl, 2-methyl-piperidin-1-yl, 4-methyl-piperidin-1- Yl, 4- (tert-butoxy-carbonyl) -piperidin-1-yl, piperidin-4-yl, 1-methyl-piperidin-4-yl, 1-acetyl-piperidin-4-yl, 1- (tert-butoxy -Carbonyl) -piperidin-4-yl, 1-methylsulfonyl-piperidin-4-yl, 4- (tert-butoxy-carbonyl) -pipera N-1-yl, tetrahydropyran-4-yl, morpholin-4-yl, 2,6-dimethyl-morpholin-4-yl, 1,1-dioxo-thiomorpholin-4-yl, azepan-1 -Yl, 1,4-oxazepan-4-yl, 6-oxa-3-azabicyclo [3.1.1] heptan-3-yl and 2-oxa-5-azabicyclo [2.2.1] heptane-5 -Ile.

  The term “heterocyclyloxy”, whether used alone or in combination, means a heterocyclyl-O— group in which the heterocyclyl group is as previously described. An example of such a heterocyclyl group is tetrahydropyranoxy (especially tetrahydropyran-4-oxy).

In the following, further aspects of the invention are described:
1P) A further aspect of the invention is
R ¹ represents a heteroaryl or aryl group, which groups are independently unsubstituted or substituted by 1, 2 or 3 substituents, the substituents being (C ₁ -C ₄ ) alkyl , (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₃ ) fluoroalkyl, (C ₁ -C ₃ ) fluoroalkoxy, hydroxy, halogen and phenoxy. Is selected;
R ² is
- a heterocyclyl, substituted by or is one or two substituents unsubstituted, the substituent _{is, (C} 1 -C _{4) alkyl, (C} 1 -C ₄₎ alkylcarbonyl, _{(C 1} -C _{4) alkoxycarbonyl,} are independently selected from _(C 1 -C ₄₎ alkylsulfonyl, and halogen, said heterocyclyl;
-Heterocyclyloxy;
- substituted by or one or two halogen or unsubstituted _(C 3 -C ₆₎ cycloalkyl;
- _(C 3 -C ₆₎ cycloalkyloxy;
- N- _(C 3 -C ₆₎ cycloalkyl - amino;
- N- _(C 3 -C ₆₎ cycloalkyl-methyl - amino;
- _(C 3 -C ₆₎ alkyl;
- _(C 2 -C ₆₎ alkoxy;
- N- _(C 1 -C ₄₎ alkylamino;
- N, N-di - _[(C 1 -C ₄₎ alkyl] - amino; or - N- arylmethyl -N- _(C 1 -C ₄₎ alkyl - amino;
Represents;
R ³ represents hydrogen or halogen;
R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl;
R ⁵ represents hydrogen or (C ₁ -C ₄ ) alkyl;
R ⁶ represents chloro or methyl;
Relates to compounds according to embodiment 1) and salts of such compounds, in particular pharmaceutically acceptable salts.

2) A further aspect of the invention is:
R ¹ represents a 5- or 6-membered monocyclic heteroaryl or phenyl group, these groups are independently unsubstituted or substituted by 1 or 2 substituents, the substituents being methyl, Independently selected from the group consisting of cyclopropyl, methoxy, trifluoromethyl, trifluoromethoxy, hydroxy, fluoro, chloro and phenoxy;
R ² is
-Heterocyclyl, unsubstituted or substituted by 1 or 2 substituents, the substituents being independently selected from methyl, methylcarbonyl, tert-butoxy-carbonyl, methylsulfonyl and fluoro; Said heterocyclyl;
-Tetrahydropyran-4-oxy;
Cyclohexyl which is unsubstituted or substituted by 1 or 2 fluoro;
-Cyclopentyloxy; cyclohexyloxy;
-Cyclopentyl-amino;
-Cyclopentylmethyl-amino;
-Iso-butyl; penta-3-yl;
-Ethoxy; penta-3-yloxy;
-Iso-butylamino;
-Dimethylamino; diethylamino; methyl-iso-butylamino; or -N-benzyl-N-methyl-amino;
Represents;
R ³ represents hydrogen or chloro;
R ⁴ represents hydrogen, methyl, iso-butyl or 3-methoxy-prop-1-yl;
R ⁵ represents hydrogen or methyl;
R ⁶ represents chloro or methyl;
It relates to a compound according to any one of embodiments 1) or 1P) and salts (especially pharmaceutically acceptable salts) of such compounds.

3) A further aspect of the present invention provides:
R ¹ represents a heteroaryl or aryl group, these groups are independently unsubstituted or substituted by 1 or 2 substituents, the substituents being (C ₁ -C ₄ ) alkyl, ( C ₃ -C _{6) cycloalkyl,} is selected _(C 1 -C _{4) alkoxy,} independently from the group consisting of _(C 1 -C ₃₎ fluoroalkyl and halogen;
R ² is
Said heterocyclyl, which is heterocyclyl, unsubstituted or substituted by one or two substituents, wherein said substituents are independently selected from (C ₁ -C ₄ ) alkyl and halogen;
- substituted by unsubstituted as or one or two fluoro _(C 3 -C ₆₎ cycloalkyl;
-Cyclopentyloxy;
- _(C 3 -C ₆₎ alkyl; or - pent-3-yloxy;
Represents;
R ³ represents hydrogen;
R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl;
R ⁵ represents hydrogen;
R ⁶ represents chloro or methyl;
It relates to a compound according to any one of embodiments 1) or 1P) and salts (especially pharmaceutically acceptable salts) of such compounds.

4) A further aspect of the invention is:
R ¹ represents a 5- or 6-membered monocyclic heteroaryl group, the group is unsubstituted or substituted by 1 or 2 substituents, and the substituents are (C ₁ -C ₄ ) Independently selected from the group consisting of alkyl, (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₃ ) fluoroalkyl and halogen;
R ² is
-Heterocyclyl, which is unsubstituted or substituted by one or two substituents, the substituents being independently selected from methyl and fluoro; or-unsubstituted or 1 or substituted by two fluoro _(C 3 -C ₆₎ cycloalkyl;
Represents;
R ³ represents hydrogen;
R ⁴ represents hydrogen or (C ₁ -C ₄ ) alkyl;
R ⁵ represents hydrogen;
R ⁶ represents chloro or methyl;
It relates to a compound according to any one of embodiments 1) or 1P) and salts (especially pharmaceutically acceptable salts) of such compounds.

5) A further aspect of the invention is:
R ¹ represents a pyrimidyl or pyridyl group which is unsubstituted or substituted by one methyl, cyclopropyl, methoxy, trifluoromethyl or chloro;
R ² represents heterocyclyl, which is 3,3-difluoro-pyrrolidin-1-yl, piperidin-1-yl, 4-fluoro-piperidin-1-yl, 3,3-difluoro-piperidine-1- Yl, 4,4-difluoro-piperidin-1-yl, morpholin-4-yl, azepan-1-yl, 1,4-oxazepan-4-yl and 6-oxa-3-azabicyclo [3.1.1 Selected from heptan-3-yl,
R ³ represents hydrogen;
R ⁴ represents hydrogen or methyl;
R ⁵ represents hydrogen;
R ⁶ represents chloro or methyl;
It relates to a compound according to any one of embodiments 1) or 1P) and salts (especially pharmaceutically acceptable salts) of such compounds.

6) A further embodiment of the invention is that the term “(C ₁ -C ₄ ) alkyl” means methyl;
Aspect 1) relates to a compound according to any one of 1P), 3) or 4) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

7) A further aspect of the invention is that the term “(C ₃ -C ₆ ) alkyl” means iso-butyl or penta-3-yl;
Aspect 1) relates to a compound according to any one of 1P), 3) or 6) and a salt (particularly a pharmaceutically acceptable salt) of such a compound.

8) A further aspect of the invention is that the term “(C ₁ -C ₄ ) alkoxy” means methoxy;
Aspect 1), 1P), 3), 4), 6) or a compound according to any one of 7) and salts (especially pharmaceutically acceptable salts) of such compounds.

9) A further aspect of the invention refers to cyclopropyl when the term “(C ₃ -C ₆ ) cycloalkyl” represents a substituent to a heteroaryl or aryl group;
Aspect 1), 1P), 3), 4) or a compound according to any one of 6) to 8) and salts of such compounds (especially pharmaceutically acceptable salts).

10) A further aspect of the invention refers to cyclohexyl when the term “(C ₃ -C ₆ ) cycloalkyl” represents R ² ;
Aspect 1), 1P), 3), 4) or a compound according to any one of 6) to 9) and salts of such compounds (especially pharmaceutically acceptable salts).

11) A further aspect of the invention is that the terms “(C ₁ -C ₃ ) fluoroalkyl” and “(C ₁ -C ₂ ) fluoroalkyl” (when present) mean trifluoromethyl;
Aspect 1), 1P), 3), 4) or 6) to 10) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

12) A further aspect of the invention is that the term “(C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl” means 3-methoxy-prop-1-yl;
Aspect 1), 1P), 3) or a compound according to any one of 6) to 11) and salts (especially pharmaceutically acceptable salts) of such compounds.

13) In a further aspect of the invention, the term “halogen” means fluoro or chloro;
Aspect 1), 1P), 3), 4) or a compound according to any one of 6) to 12) and salts (especially pharmaceutically acceptable salts) of such compounds.

14) In a further aspect of the invention, the term “halogen” means fluoro;
Aspect 1), 1P), 3), 4) or a compound according to any one of 6) to 12) and salts (especially pharmaceutically acceptable salts) of such compounds.

15) A further aspect of the invention, the term “heteroaryl” means “5- or 6-membered monocyclic heteroaryl”;
Aspect 1), 1P), 3) or a compound according to any one of 6) to 14) and salts (especially pharmaceutically acceptable salts) of such compounds.

16) In a further aspect of the invention, the term “heteroaryl” or the term “5- or 6-membered monocyclic heteroaryl” means thiazolyl, isothiazolyl, pyridyl or pyrimidyl;
Aspects 1) -4) or 6) -14) according to any one of the compounds and salts of such compounds (especially pharmaceutically acceptable salts).

17) In a further aspect of the invention, the term “heteroaryl” or the term “5- or 6-membered monocyclic heteroaryl” means pyridyl or pyrimidyl;
Aspects 1) -4) or 6) -14) according to any one of the compounds and salts of such compounds (especially pharmaceutically acceptable salts).

18) In a further aspect of the invention, the term “aryl” means phenyl;
Embodiment 1) relates to a compound according to any one of 1P), 3) or 6) to 17) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

19) In a further aspect of the present invention, the term “heterocyclyl” refers to pyrrolidinyl, piperidinyl, tetrahydropyranyl, morpholinyl, azepanyl, 1,4-oxazepanyl or 6-oxa-3-azabicyclo [3.1.1] heptanyl. means;
Aspects 1) to 4) or 6) to 18) relate to compounds according to any one and salts (especially pharmaceutically acceptable salts) of such compounds.

20) In a further aspect of the invention, the term “heterocyclyl” is defined as piperidin-1-yl, morpholin-4-yl, azepan-1-yl, 1,4-oxazepan-4-yl or 6-oxa-3- Means azabicyclo [3.1.1] heptan-3-yl;
Aspects 1) to 4) or 6) to 18) relate to compounds according to any one and salts (especially pharmaceutically acceptable salts) of such compounds.

21) A further aspect of the present invention provides
R ¹ represents a 5- or 6-membered monocyclic heteroaryl or phenyl group, which groups are independently unsubstituted or substituted by 1 or 2 substituents, the substituents being (C ₁ -C _{4) alkyl, (C} 3 -C _{6) cycloalkyl,} are independently selected from the group consisting of _(C 1 -C ₃₎ fluoroalkyl and halogen;
Aspect 1), 1P), 3), 6) -14), 16), 17), 19) or a salt according to any one of the compounds and salts of such compounds (especially pharmaceutically acceptable salts) )

22) A further aspect of the present invention provides
5 or 6 wherein R ¹ is unsubstituted or substituted by one (C ₁ -C ₄ ) alkyl, (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₃ ) fluoroalkyl and halogen Represents a membered monocyclic heteroaryl group;
Aspect 1), 1P), 3), 4), 6) -14), 16), 17), 19) or a salt of such a compound (especially pharmaceutically acceptable) Salt).

23) A further aspect of the present invention provides
R ¹ represents a phenyl group, the group is unsubstituted or substituted by 1 or 2 substituents, and the substituents are (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy Independently selected from the group consisting of, (C ₁ -C ₃ ) fluoroalkyl and halogen;
Aspect 1), 1P), 3), 6) -14), 19) or a compound according to any one of 19) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

24) A further aspect of the present invention provides
R ² is
- Not or substituted with 1 or 2 heterocyclyl substituted by fluoro; or - Not or substituted with 1 or substituted by two fluoro (C 3 _{-C 6)} cycloalkyl;
Represents;
Aspect 1), 1P), 3), 6) or 8) to 23), and a salt (particularly a pharmaceutically acceptable salt) of such a compound.

25) A further aspect of the present invention provides
R ² represents heterocyclyl which is unsubstituted or substituted by 1 or 2 fluoro;
Aspects 1) to 4), 6), 8), 9) or 11) to 23) relate to compounds and salts (particularly pharmaceutically acceptable salts) of such compounds.

26) A further aspect of the present invention provides
R ² _{is, (C} 3 -C ₆₎ alkyl; represents or substituted by non-or substituted with one or two fluoro _(C 3 -C ₆₎ cycloalkyl;
Aspect 1), 1P), 3), 6) -18) or 21) -23) relates to a compound and a salt (especially a pharmaceutically acceptable salt) of such a compound.

27) A further aspect of the present invention provides
R ² represents (C ₃ -C ₆ ) cycloalkyloxy or (C ₂ -C ₆ ) alkoxy;
Aspect 1), 1P), 6), 8) -18) or 21) -23) relates to a compound and a salt (particularly a pharmaceutically acceptable salt) of such a compound.

28) A further aspect of the invention is:
R ³ represents hydrogen;
Aspect 1) 1P) 2) or a compound according to any one of 6) to 27) and salts (especially pharmaceutically acceptable salts) of such compounds.

29) A further aspect of the invention is
R ⁴ represents hydrogen or (C ₁ -C ₄ ) alkyl;
Aspect 1), 1P), 3), 6) -11) or 13) -28) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

30) A further aspect of the present invention provides:
R ⁴ represents (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl;
Embodiment 1) relates to a compound according to any one of 1P), 3) or 6) to 28) and a salt (especially a pharmaceutically acceptable salt) of such a compound.

31) A further aspect of the present invention provides
R ⁵ represents hydrogen;
Aspect 1), 1P), 2) or 6) -30) relates to a compound and a salt (especially a pharmaceutically acceptable salt) of such a compound.

32) A further aspect of the present invention provides:
R ⁶ represents chloro;
Aspects 1) to 31) relate to compounds according to any one and salts of such compounds, in particular pharmaceutically acceptable salts.

33) A further aspect of the present invention provides
R ⁶ represents methyl;
Aspects 1) to 31) relate to compounds according to any one and salts of such compounds, in particular pharmaceutically acceptable salts.

34) A further aspect of the invention is that the absolute configuration of the chiral center is represented by formula (I _St1 ):

態様１）〜３３）のいずれか１つに従う化合物及びそのような化合物の塩（特に薬学的に許容される塩）に関する。

Aspects 1) to 33) relate to compounds according to any one and salts of such compounds, in particular pharmaceutically acceptable salts.

35) A further aspect of the invention is that the absolute configuration of the chiral center is represented by formula (I _St2 ):

態様１）〜３３）のいずれか１つに従う化合物及びそのような化合物の塩（特に薬学的に許容される塩）に関する。

Aspects 1) to 33) relate to compounds according to any one and salts of such compounds, in particular pharmaceutically acceptable salts.

36) Preferred compounds of formula (I) as defined in embodiment 1) are selected from the group consisting of the following compounds:
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2- (4,4-difluoro-piperidin-1-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-1H-indole-5-carboxylic acid [(R) -2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl]- An amide;
4-chloro-1H-indole-5-carboxylic acid [(S) -2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl]- An amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-methyl-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-piperidin-1-yl) -2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-cyclopropyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (6-trifluoromethyl-pyridin-3-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-methoxy-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-dimethylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-azetidin-1-yl-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-pyrrolidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-diethylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4- {2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1-pyridin-3-yl-ethyl} -piperidine-1-carboxylic acid tert-butyl ester; 4-chloro-1H Indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-acetyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methanesulfonyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyrimidin-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyrimidin-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-1H-pyrazol-4-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-1H-pyrazol-4-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-piperidin-1-yl-2- (2,4,6-trifluoro-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-difluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-fluoro-pyridin-2-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2,4,6-trifluoro-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-fluoro-pyridin-2-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-chloro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-dichloro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-chloro-2-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-1H-indole-5-carboxylic acid [2- (cis-2,6-dimethyl-morpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide ;
4-Chloro-1H-indole-5-carboxylic acid [2- (trans-2,6-dimethyl-morpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide ;
4-chloro-1H-indole-5-carboxylic acid [2- (3-fluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-piperidin-1-yl-2- (4-trifluoromethyl-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,4-difluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-p-tolyl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-trifluoromethoxy-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-trifluoromethyl-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,4-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (tetrahydro-pyran-4-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclopentyloxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-dimethyl-isoxazol-4-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-dimethyl-isoxazol-4-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-p-tolyl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-phenoxy-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-phenoxy-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-methoxy-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-methyl-pyrazin-2-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-isothiazol-5-yl-2-piperidin-1-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-thiazol-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-methyl-pyrazin-2-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-thiazol-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-cyclohexyl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -4-methyl-pentyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-ethoxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (2-oxa-5-aza-bicyclo [2.2.1] hepta-5 Yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclohexyloxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (tetrahydro-pyran-4-yloxy) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-ethyl-propoxy) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-2-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyridazin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-hydroxypyridin-4-yl) -2-piperidin-1-yl-ethyl] -amide;
1- [2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1- (2-methyl-pyrimidin-5-yl) -ethyl] -piperidine-4-carboxylic acid tert-butyl ester ;
4-chloro-1H-indole-5-carboxylic acid [2- (4-methyl-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-fluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,3-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-azepan-1-yl-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- [1,4] oxazepan-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,3-difluoro-pyrrolidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclopentylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (cyclopentylmethyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-isobutylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (isobutyl-methyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (benzyl-methyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (3-ethyl-2-pyrimidin-5-yl-pentyl) -amide;
4- [2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1- (2-methyl-pyrimidin-5-yl) -ethyl] -piperazine-1-carboxylic acid tert-butyl ester ;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyridazin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2-hydroxypyridin-4-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1,1-dioxo-thiomorpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-cyclohexyl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4,6-dichloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (6-oxa-3-aza-bicyclo [3.1.1] hept-3- Yl) -ethyl] -amide;
4-chloro-7-methyl-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-methyl-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-isobutyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-7- (3-methoxy-propyl) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide And 4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
Or a salt of such a compound (especially a pharmaceutically acceptable salt).

For any of the above compounds, it is understood that chiral centers not specifically assigned may be in the absolute (R) configuration or in the absolute (S) configuration; in particular, R ¹ and The chiral center of the carbon atom bonded to R ² may be in the absolute (R) configuration or in the absolute (S) configuration. For example, the compound described as 4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide is 4-chloro-1H-indole-5-carboxylic acid [(S) -2-morpholin-4-yl-2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide, Is 4-chloro-1H-indole-5-carboxylic acid [(R) -2-morpholin-4-yl-2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide. Or any mixture thereof.

  In this specification, the phrase “according to any one of embodiments 1) to X)” (where “X” represents an integer between 2 and 36) means that all embodiments between 1) and X) It is understood that it is an option, and the mode 1P) is also included as one of the options; for example, the phrase “according to any one of modes 1) to 4)” is referred to as “mode 1) or 1P) Or 2) or 3) or 4).

式中、
Ａは、Ｎ又はＣＨを表し；
Ｂは、Ｎ又はＣＨを表し；
Ｒ^２は、未置換であるか又は１若しくは２個のフルオロにより置換されたヘテロシクリルを表し、当該ヘテロシクリルは、ピロリジニル、ピペリジニル、テトラヒドロピラニル、モルフォリニル、アゼパニル、１，４−オキサゼパニル及び６−オキサ−３−アザビシクロ［３．１．１］ヘプタニルから選択されるか；又は
Ｒ^２は、未置換であるか又は１若しくは２個のフルオロにより置換されたシクロヘキシルを表し；
Ｒ^４は、水素、フルオロ、クロロ、（Ｃ_１−Ｃ_４）アルキル、（Ｃ_１−Ｃ_４）アルコキシ、ヒドロキシ−（Ｃ_２−Ｃ_４）アルコキシ又は（Ｃ_１−Ｃ_２）アルコキシ−（Ｃ_１−Ｃ_４）アルキルを表し；
Ｒ^６は、フルオロ、クロロ、メチル、エチル又は（Ｃ_１−Ｃ_２）フルオロアルキルを表し；
Ｒ^７は、水素、ハロゲン、（Ｃ_１−Ｃ_４）アルキル、（Ｃ_３−Ｃ_６）シクロアルキル、（Ｃ_１−Ｃ_４）アルコキシ又は（Ｃ_１−Ｃ_３）フルオロアルキルを表す；
態様１）、３４）又は３５）のいずれか１つに従う化合物及びそのような化合物の塩（特に薬学的に許容される塩）に関する。 37) A further aspect of the invention is also a compound of formula (I _Ar ),

Where
A represents N or CH;
B represents N or CH;
R ² represents a heterocyclyl which is unsubstituted or substituted by 1 or 2 fluoro, said heterocyclyl being pyrrolidinyl, piperidinyl, tetrahydropyranyl, morpholinyl, azepanyl, 1,4-oxazepanyl and 6-oxa- Selected from 3-azabicyclo [3.1.1] heptanyl; or R ² represents cyclohexyl which is unsubstituted or substituted by 1 or 2 fluoro;
R ⁴ is hydrogen, fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, hydroxy- (C ₂ -C ₄ ) alkoxy or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄₎ alkyl;
R ⁶ represents fluoro, chloro, methyl, ethyl or (C ₁ -C ₂ ) fluoroalkyl;
R ⁷ represents hydrogen, halogen, (C ₁ -C ₄ ) alkyl, (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₄ ) alkoxy or (C ₁ -C ₃ ) fluoroalkyl;
Aspect 1), 34) or a compound according to any one of 35) and salts (especially pharmaceutically acceptable salts) of such compounds.

38) A further aspect of the present invention provides
A represents N or CH;
B represents N or CH;
R ² represents a heterocyclyl which is unsubstituted or substituted by 1 or 2 fluoro, said heterocyclyl being pyrrolidinyl, piperidinyl, tetrahydropyranyl, morpholinyl, azepanyl, 1,4-oxazepanyl and 6-oxa-3 -Selected from azabicyclo [3.1.1] heptanyl; or R ² represents cyclohexyl which is unsubstituted or substituted by two fluoro;
R ⁴ represents hydrogen, chloro, methyl, ethyl, n-propyl, iso-butyl, methoxy, ethoxy, 2-hydroxy-ethoxy or 3-methoxy-prop-1-yl;
R ⁶ represents fluoro, chloro, methyl, ethyl or trifluoromethyl;
R ⁷ represents hydrogen, fluoro, chloro, methyl, cyclopropyl, methoxy or trifluoromethyl;
Relates to compounds according to embodiment 37) and salts (especially pharmaceutically acceptable salts) of such compounds.

39) A further aspect of the present invention provides
A and B represent N and R ⁷ represents hydrogen, (C ₁ -C ₄ ) alkyl, (C ₃ -C ₆ ) cycloalkyl or (C ₁ -C ₃ ) fluoroalkyl; or A Represents N, B represents CH, and R ⁷ represents hydrogen, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy or (C ₁ -C ₃ ) fluoroalkyl. Or A and B represent CH and R ⁷ represents fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy or (C ₁ -C ₃ ) fluoroalkyl. Representation;
Pyrrolidinyl, R ² is unsubstituted or substituted by 2 fluoro; piperidinyl, unsubstituted or substituted by 1 or 2 fluoro; tetrahydropyranyl; morpholinyl; azepanyl; 1,4- Represents oxazepanyl; 6-oxa-3-azabicyclo [3.1.1] heptanyl; or cyclohexyl which is unsubstituted or substituted by two fluoro;
R ⁴ is hydrogen, fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, hydroxy- (C ₂ -C ₄ ) alkoxy or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄₎ alkyl;
R ⁶ represents fluoro, chloro, methyl, ethyl or (C ₁ -C ₂ ) fluoroalkyl;
Relates to compounds according to embodiment 37) and salts (especially pharmaceutically acceptable salts) of such compounds.

40) A further aspect of the present invention provides
A and B represent N and R ⁷ represents hydrogen, methyl, cyclopropyl or trifluoromethyl; or A represents N, B represents CH and R ⁷ represents chloro, Represents methyl, methoxy or trifluoromethyl; or A and B represent CH and R ⁷ represents fluoro or chloro;
R ² is 3,3-difluoro-pyrrolidin-1-yl, piperidin-1-yl, 4-fluoro-piperidin-1-yl, 3,3-difluoro-piperidin-1-yl, 4,4-difluoro- Piperidin-1-yl, tetrahydropyran-4-yl, morpholin-4-yl, azepan-1-yl, 1,4-oxazepan-4-yl, or 6-oxa-3-azabicyclo [3.1.1 Represents heptan-3-yl;
R ⁴ represents hydrogen, chloro, methyl, ethyl, n-propyl, iso-butyl, methoxy, ethoxy, 2-hydroxy-ethoxy or 3-methoxy-prop-1-yl;
R ⁶ represents fluoro, chloro, methyl, ethyl or trifluoromethyl;
Relates to compounds according to embodiment 37) and salts (especially pharmaceutically acceptable salts) of such compounds.

41) A further aspect of the present invention provides
A and B represent N;
Aspects 37) to 40) relate to compounds according to any one and salts of such compounds, in particular pharmaceutically acceptable salts.

42) A further aspect of the present invention provides:
R ² represents piperidin-1-yl, 4-fluoro-piperidin-1-yl, 3,3-difluoro-piperidin-1-yl or 4,4-difluoro-piperidin-1-yl;
Aspects 37) -41) according to any one of the compounds and salts of such compounds (especially pharmaceutically acceptable salts).

43) A further aspect of the present invention provides:
R ² represents morpholin-4-yl;
Aspects 37) -41) according to any one of the compounds and salts of such compounds (especially pharmaceutically acceptable salts).

44) A further aspect of the invention provides:
R ² represents 4,4-difluoro-cyclohexyl;
Aspects 37) to 39) or 41) according to any one of the compounds and salts (especially pharmaceutically acceptable salts) of such compounds.

45) Further preferred compounds of formula (I) as defined in embodiment 1) are selected from the group consisting of the following compounds:
4-ethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-acetyl-4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-methyl-4-trifluoromethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide; 4,7 -Dimethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-methyl-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-methyl-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-ethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-chloro-4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-methoxy-4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-ethoxy-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-propyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7- (2-tert-Butoxy-ethoxy) -4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] An amide;
4-Chloro-7- (2-hydroxy-ethoxy) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide ;
4-chloro-7-methoxy-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-methoxy-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7- (1-hydroxy-1-methyl-ethyl) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl- Ethyl] -amide;
4,7-difluoro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide; and 4-fluoro-7- Methoxy-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
Or a salt of such a compound (especially a pharmaceutically acceptable salt).

For any of the above compounds, it is understood that chiral centers not specifically assigned may be in the absolute (R) configuration or in the absolute (S) configuration; in particular, R ¹ and The chiral center of the carbon atom bonded to R ² may be in the absolute (R) configuration or in the absolute (S) configuration. For example, 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide is described. The compound is 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl]- Even if it is an amide, 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl- Ethyl] -amide, or any mixture thereof.

Naturally, the present invention relates to embodiment 1), which is according to embodiment 1); or which is limited by the features of the embodiment dependent on embodiment 1); It relates to a compound according to the form) of aspect 3) "dependent on aspect 2) dependent on aspect 1). Where an aspect is dependent on more than one other aspect, each combination is understood to be specifically disclosed. Also, if an aspect is dependent on more than one other aspect and one or more of the other aspects are dependent on one or more further aspects, the given Each of the combinations is specifically disclosed as long as it is possible in the dependency relation and the multiple dependency relation. In particular, aspects resulting from a sequence of more than three aspects that are subordinate to each other may be construed based on a given dependency and multiple dependency, and are therefore intended to be specifically disclosed. Yes. Representative examples of possible embodiments, i.e. intended and based on the dependent relationships of aspects 1) to 45) disclosed above, are specifically disclosed herein as individual forms:
1, 1P + 1, 2 + 1P + 1, 3 + 1P + 1, 4 + 1P + 1, 5 + 1P + 1, 6 + 1P + 1, Y10, Y9, Y8, Y7, 7 + Y10, 7 + Y9, Y6, Y5, 8 + Y10, 8 + Y9, 8 + Y8, 8 + Y7, 8 + 7 + Y10, 8 + 7 + Y9, Y4, Y3, 9+ 9 + Y6,9 + Y5,9 + 8 + Y10,9 + + 8 + Y9,9 + 8 + Y8,9 + 8 + Y7,9 + 8 + 7 + Y10,9 + 8 + 7 + Y9,10 + 3 + 1P + 1,10 + 6 1P + 1,10 + Y10,10 + Y9,10 + Y4,10 + Y3,10 + 9 + Y10,10 + 9 + Y9,10 + 9 + Y6,10 + 9 + Y5,10 + 9 + 8 + Y10,10 + 9 + 8 + Y9,10 + 9 + 8 + Y8,10 + 9 + 8 + Y7,10 + 9 + 8 + 7 + Y10,10 + 9 + 8 + 7 + Y9,11 + 3 + 1 + 1,11 + 6 + 1P + 1,11 + Y10,11 + Y9,11 + 10 + 3 + 1P + 1,11 + 10 + 6 + 1P + 1,11 + 10 + Y10,11 + 1
0 + Y9, Y2 + 3 + 1P + 1, Y2 + 6 + 1P + 1, Y2 + Y10, Y2 + Y9, Y2 + Y6, Y2 + Y5, Y2 + 8 + Y10, Y2 + 8 + Y9, Y2 + 8 + Y8, Y2 + 8 + Y7, Y2 + 8 + 7 + Y10, Y2 + 8 + 7 + Y9
12 + 3 + 1P + 1,12 + 6 + 1P + 1,12 + Y10,12 + Y9,12 + Y6,12 + Y5,12 + 8 + Y10,12 + 8 + Y9,12 + 8 + Y8,12 + 8 + Y7,12 + 8 + 7 + Y10,12 + 8 + 7 + Y9,12 + 11 + 3 + 1P + 1,12 + 11 + 6 + 1P + 1,12 + 11 + Y10,12 + 11 + Y9, Y1 + 3 + 1P + 1, Y1 + 6 + 1P + 1, Y1 + Y10, Y1 + Y9, Y1 + Y4, Y1 + Y3, Y1 + 9 + Y10, Y1 + 9 + Y9, Y1 + 9 + Y6, Y1 + 9 + Y5, Y1 + 9 + 8 + Y10, Y1 + 9 + 8 + Y9, Y1 + 9 + 8 + Y8, Y1 + 9 + 8 + Y7, Y1 + 9 + 8 + 7 + Y10, Y1 + 9 + 8 + 7 + Y9, 13 + 3 + 1P + 1, 13 + 6 + 1P + 1, 13 + Y10, 13 + Y3, +1 13 + 11 + 6 + 1P + 1,13 + 11 + Y10,13 + 11 + Y9,13 + 11 + 10 + 3 + 1P + 1,13 + 11 + 10 + 6 + 1P + 1,13 + 11 + 10 + Y10,13 + 11 + 10 + Y9,13 + Y2 + 3 + 1P + 1,13 + Y2 + 6 + 1P + 1,13 + Y2 + Y10,13 + Y2 + Y9,13 + Y2 + Y6,13 + Y2 + Y5,13 + Y2 + 8 + Y10,13 + Y2 + 8 + Y9,13 + Y2 + 8 + Y8,13 + Y2 + 8 + Y7,13 + Y2 + 8 + 7 + Y10,13 + Y2 + 8 + 7 + Y9,13 + 12 + 3 + 1P + 1,13 + 12 + 6 + 1P + 1,13 + 12 + Y10,13 + 12 + Y9,13 + 12 + Y6,13 + 12 + Y5, 13 + 12 + 8 + Y10, 13 + 12 + 8 + Y9, 13 + 12 + 8 + Y8, 13 + 12 + 8 + Y7, 3 + 12 + 8 + 7 + Y10,13 + 12 + 8 + 7 + Y9,13 + 12 + 11 + 3 + 1P + 1,13 + 12 + 11 + 6 + 1P + 1,13 + 12 + 11 + Y10,13 + 12 + 11 + Y9,13 + Y1 + 3 + 1P + 1,13 + Y1 + 6 + 1P + 1,13 + Y1 + Y10,13 + Y1 + Y9,13 + Y1 + Y4,13 + Y1 + Y3,13 + Y1 + 9 + Y10,13 + Y1 + 9 + Y9,13 + Y1 + 9 + Y6,13 + Y1 + 9 + Y5,13 + Y1 + 9 + 8 + Y10,13 + Y1 + 9 + 8 + Y9,13 + Y1 + 9 + 8 + Y8,13 + Y1 + 9 + 8 + Y7,13 + Y1 + 9 + 8 + 7 + Y10,13 + Y1 + 9 + 8 + 7 + Y9,
14 + 3 + 1P + 1,14 + 6 + 1P + 1,14 + Y10,14 + Y9,14 + 12 + 3 + 1P + 1,14 + 12 + 6 + 1P + 1,14 + 12 + Y10,14 + 12 + Y9,14 + 12 + Y6,14 + 12 + Y5,14 + 12 + 8 + Y10,14 + 12 + 8 + Y9,14 + 12 + 8 + Y8,14 + 12 + 8 + Y7,14 + 12 + 8 + 7 + Y10,14 + 12 + 8 + 7 + Y9,14 + 12 + 11 + 3 + 1P + 1,14 + 12 + 11 + 6 + 1P + 1,14 + 12 + 11 + Y10,14 + 12 + 11 + Y9,14 + Y1 + 3 + 1P + 1,14 + Y1 + 6 + 1P + 1,14 + Y1 + Y10,14 + Y1 + Y9,14 + Y1 + Y4, 14 + Y1 + Y3, 14 + Y1 + 9 + Y10, 14 + Y1 + 9 + Y9, 14 + Y1 + 9 + Y6, 14 + Y1 + 9 + Y5, 4 + Y1 + 9 + 8 + Y10,14 + Y1 + 9 + 8 + Y9,14 + Y1 + 9 + 8 + Y8,14 + Y1 + 9 + 8 + Y7,14 + Y1 + 9 + 8 + 7 + Y10,14 + Y1 + 9 + 8 + 7 + Y9,15 + 13 + 3 + 1P + 1,15 + 13 + 6 + 1P + 1,15 + 13 + Y10,15 + 13 + Y9,15 + 13 + 11 + 3 + 1P + 1,15 + 13 + 11 + 6 + 1P + 1,15 + 13 + 11 + Y10,15 + 13 + 11 + Y9,15 + 13 + 11 + 10 + 3 + 1P + 1,15 + 13 + 11 + 10 + 6 + 1P + 1,15 + 13 + 11 + 10 + Y10,15 + 13 + 11 + 10 + Y9,15 + 13 + Y2 + 3 + 1P + 1,15 + 13 + Y2 + 6 + 1P + 1,15 + 13 + Y2 + Y10,15 + 13 + Y2 + Y9,15 + 13 + Y2 + Y6,15 + 13 + Y2 + 5,15 + 13 + Y2 + 8 + Y10,15 + 13 + Y2 + 8 + Y9,15 + 13 + Y2 + 8 + Y8,15 + 13 + Y2 + 8 + Y7,15 + 13 + Y2 + 8 + 7 + Y10,15 + 13 + Y2 + 8 + 7 + Y9,
Z8 + 3 + 1P + 1, Z8 + 6 + 1P + 1, Z8 + Y10, Z8 + Y9, Z8 + Y6, Z8 + Y5, Z8 + 8 + Y10, Z8 + 8 + Y9, Z8 + 8 + Y8, Z8 + 8 + Y7, Z8 + 8 + 7 + Y10, + 1 + 3 ++ 1 + 3 ++ 1 + 9 +
15 + 13 + Y1 + 6 + 1P + 1,15 + 13 + Y1 + Y10,15 + 13 + Y1 + Y9,15 + 13 + Y1 + Y4,15 + 13 + Y1 + Y3,15 + 13 + Y1 + 9 + Y10,15 + 13 + Y1 + 9 + Y9,15 + 13 + Y1 + 9 + Y6,15 + 13 + Y1 + 9 + Y5,15 + 13 + Y1 + 9 + 8 + Y10,15 + 13 + Y1 + 9 + 8 + Y9,15 + 13 + Y1 + 9 + 8 + Y8,15 + 13 + Y1 + 9 + 8 + Y7,15 + 13 + Y1 + 9 + 8 + 7 + Y10,15 + 13 + Y1 + 9 + 8 + 7 + Y9,16 + 13 + 3 + 1P + 1,16 + 13 + 6 + 1P + 1,16 + 13 + Y10,16 + 13 + Y9,16 + 13 + 11 + 3 + 1P + 1,16 + 13 + 11 + 6 + 1P + 1,16 + 13 + 11 + Y10,16 + 13 + 11 + Y9,16 + 13 + 1 + 10 + 3 + 1P + 1,16 + 13 + 11 + 10 + 6 + 1P + 1,16 + 13 + 11 + 10 + Y10,16 + 13 + 11 + 10 + Y9,16 + 13 + Y2 + 3 + 1P + 1,16 + 13 + Y2 + 6 + 1P + 1,16 + 13 + Y2 + Y10,16 + 13 + Y2 + Y9,16 + 13 + Y2 + Y6,16 + 13 + Y2 + Y5,16 + 13 + Y2 + 8 + Y10,16 + 13 + Y2 + 8 + Y9,16 + 13 + Y2 + 8 + Y8,16 + 13 + Y2 + 8 + Y7,16 + 13 + Y2 + 8 + 7 + Y10,16 + 13 + Y2 + 8 + 7 + Y9,16 + 13 + 12 + 3 + 1P + 1,16 + 13 + 12 + 6 + 1P + 1,16 + 13 + 12 + Y10,16 + 13 + 12 + Y9,16 + 13 + 12 + Y6,16 + 13 + 12 + Y5,16 + 13 + 12 + 8 + Y10,16 + 1 + 12 + 8 + Y9,16 + 13 + 12 + 8 + Y8,16 + 13 + 12 + 8 + Y7,16 + 13 + 12 + 8 + 7 + Y10,16 + 13 + 12 + 8 + 7 + Y9,16 + 13 + 12 + 11 + 3 + 1P + 1,16 + 13 + 12 + 11 + 6 + 1P + 1,16 + 13 + 12 + 11 + Y10,16 + 13 + 12 + 11 + Y9,16 + 13 + Y1 + 3 + 1P + 1,16 + 13 + Y1 + 6 + 1P + 1,16 + 13 + Y1 + Y10,16 + 13 + Y1 + Y9,16 + 13 + Y1 + Y4,16 + 13 + Y1 + Y3,16 + 13 + Y1 + 9 + Y10,16 + 13 + Y1 + 9 + Y9,16 + 13 + Y1 + 9 + Y6,16 + 13 + Y1 + 9 + Y5,16 + 13 + Y1 + 9 + 8 + Y10,16 + 13 + Y1 + 9 + 8 + Y9,16 + 13 + Y1 + 9 + 8 + Y8,16 + 13 + Y 1 + 9 + 8 + Y7, 16 + 13 + Y1 + 9 + 8 + 7 + Y10, 16 + 13 + Y1 + 9 + 8 + 7 + Y9,
17 + 13 + 3 + 1P + 1,17 + 13 + 6 + 1P + 1,17 + 13 + Y10,17 + 13 + Y9, Z7 + 3 + 1P + 1, Z7 + 6 + 1P + 1, Z7 + Y10, Z7 + Y9, Z7 + 10 + 3 + 1P + 1, Z7 + 10 + 6 + 1P + 1, Z7 + 10 + Y10, Z7 + 10 + Y9,17 + 13 + Y2 + 3 + 1P + 1,17 + 13 + Y2 + 6 + 1P + 1,17 + 13 + Y2 + Y10,17 + 13 + Y2 + Y9,17 + 13 + Y2 + Y6,17 + 13 + Y2 + Y5,17 + 13 + Y2 + 8 + Y10,17 + 13 + Y2 + 8 + Y9,17 + 13 + Y2 + 8 + Y8,17 + 13 + Y2 + 8 + Y7,17 + 13 + Y2 + 8 + 7 + Y10,17 + 13 + Y2 + 8 + 7 + Y9, Z6 + 3 + 1P + 1, Z6 + 6 + 1P + 1, Z6 + Y10, Z6 + Y9, Z6 + Y6, 6 + Y5, Z6 + 8 + Y10, Z6 + 8 + Y9, Z6 + 8 + Y8, Z6 + 8 + Y7, Z6 + 8 + 7 + Y10, Z6 + 8 + 7 + Y9, Z6 + 11 + 3 + 1P + 1, Z6 + 11 + 6 + 1P + 1, Z6 + 11 + Y10, Z6 + 11 + Y9,17 + 13 + Y1 + 3 + 1P + 1,17 + 13 + Y1 + 6 + 1P + 1,17 + 13 + Y1 + Y10,17 + 13 + Y1 + Y9,17 + 13 + Y1 + Y4,17 + 13 + Y1 + Y3,17 + 13 + Y1 + 9 + Y10,17 + 13 + Y1 + 9 + Y9,17 + 13 + Y1 + 9 + Y6,17 + 13 + Y1 + 9 + Y5,17 + 13 + Y1 + 9 + 8 + Y10,17 + 13 + Y1 + 9 + 8 + Y9,17 + 13 + Y1 + 9 + 8 + Y8,17 + 13 + Y1 + 9 + 8 + Y7, 17 + 13 + Y1 + 9 + 8 + 7 + Y10, 17 + 13 + 1 + 9 + 8 + 7 + Y9,
Z5 + 3 + 1P + 1, Z5 + 6 + 1P + 1, Z5 + Y10, Z5 + Y9, Z5 + 11 + 3 + 1P + 1, Z5 + 11 + 6 + 1P + 1, Z5 + 11 + Y10, Z5 + 11 + Y9, Z5 + 11 + 10 + 3 + 1P + 1, Z5 + 11 + 10 + 6 + 1P + 1, Z5 + 11 + 10 + Y10, Z5 + 11 + 10 + Y9, Z5 + Y2 + 3 + 1P + 1, Z5 + Y2 + 6 + 1P + 1, Z5 + Y2 + Y10, Z5 + Y2 + Y9, Z5 + Y2 + Y6, Z5 + Y2 + Y5, Z5 + Y2 + 8 + Y10, Z5 + Y2 + 8 + Y9, Z5 + Y2 + 8 + Y8, Z5 + Y2 + 8 +
Y7, Z5 + Y2 + 8 + 7 + Y10, Z5 + Y2 + 8 + 7 + Y9, Z5 + 12 + 3 + 1P + 1, Z5 + 12 + 6 + 1P + 1, Z5 + 12 + Y10, Z5 + 12 + Y9, Z5 + 12 + Y6, Z5 + 12 + Y5, Z5 + 12 + 8 + Y10, Z5 + 12 + 8 + Y9, Z5 + 12 + 8 + Y8, Z5 + 12 + 8 + Y7, Z5 + 12 + 8 + 7 + Y10, Z5 + 12 + 8 + 7 + Y9, Z5 + 12 + 11 + 3 + 1P + 1, Z5 + 12 + 11 + 6 + 1P + 1, Z5 + 12 + 11 + Y10, Z5 + 12 + 11 + Y9, Z5 + Y1 + 3 + 1P + 1, Z5 + Y1 + 6 + 1P + 1, Z5 + Y1 + Y10, Z5 + Y1 + Y9, Z5 + Y1 + Y4, Z5 + Y1 + Y3, Z5 + Y1 + 9 + Y10, Z5 + Y1 + 9 + Y9, Z5 + Y1 + 9 + Y6, Z5 + Y1 + 9 + Y5, Z5 + 1 + 9 + 8 + Y10, Z5 + Y1 + 9 + 8 + Y9, Z5 + Y1 + 9 + 8 + Y8, Z5 + Y1 + 9 + 8 + Y7, Z5 + Y1 + 9 + 8 + 7 + Y10, Z5 + Y1 + 9 + 8 + 7 + Y9,
18 + 17 + 13 + 3 + 1P + 1,18 + 17 + 13 + 6 + 1P + 1,18 + 17 + 13 + Y10,18 + 17 + 13 + Y9,18 + Z7 + 3 + 1P + 1,18 + Z7 + 6 + 1P + 1,18 + Z7 + Y10,18 + Z7 + Y9,18 + Z7 + 10 + 3 + 1P + 1,18 + Z7 + 10 + 6 + 1P + 1,18 + Z7 + 10 + Y10,18 + Z7 + 10 + Y9,18 + 17 + 13 + Y2 + 3 + 1P + 1,18 + 17 + 13 + Y2 + 6 + 1P + 1,18 + 17 + 13 + Y2 + Y10,18 + 17 + 13 + Y2 + Y9,18 + 17 + 13 + Y2 + Y6,18 + 17 + 13 + Y2 + Y5,18 + 17 + 13 + Y2 + 8 + Y10,18 + 17 + 13 + Y2 + 8 + Y9,18 + 17 + 13 + Y2 + 8 + Y8,18 + 17 + 13 + Y2 + 8 + Y7,18 + 17 + 3 + Y2 + 8 + 7 + Y10,18 + 17 + 13 + Y2 + 8 + 7 + Y9,18 + Z6 + 3 + 1P + 1,18 + Z6 + 6 + 1P + 1,18 + Z6 + Y10,18 + Z6 + Y9,18 + Z6 + Y6,18 + Z6 + Y5,18 + Z6 + 8 + Y10,18 + Z6 + 8 + Y9,18 + Z6 + 8 + Y8,18 + Z6 + 8 + Y7,18 + Z6 + 8 + 7 + Y10,18 + Z6 + 8 + 7 + Y9,18 + Z6 + 11 + 3 + 1P + 1,18 + Z6 + 11 + 6 + 1P + 1,18 + Z6 + 11 + Y10,18 + Z6 + 11 + Y9,18 + 17 + 13 + Y1 + 3 + 1P + 1,18 + 17 + 13 + Y1 + 6 + 1P + 1,18 + 17 + 13 + Y1 + Y10,18 + 17 + 13 + Y1 + Y9,18 + 17 + 13 + Y1 + Y4,18 + 17 + 13 + Y1 + Y3,18 + 17 + 13 + 1 + 9 + Y10,18 + 17 + 13 + Y1 + 9 + Y9,18 + 17 + 13 + Y1 + 9 + Y6,18 + 17 + 13 + Y1 + 9 + Y5,18 + 17 + 13 + Y1 + 9 + 8 + Y10,18 + 17 + 13 + Y1 + 9 + 8 + Y9,18 + 17 + 13 + Y1 + 9 + 8 + Y8,18 + 17 + 13 + Y1 + 9 + 8 + Y7,18 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,18 + 17 + 13 + Y1 + 9 + 8 + 7 + Y9,
Z4 + 3 + 1P + 1, Z4 + 6 + 1P + 1, Z4 + Y10, Z4 + Y9, Z4 + 11 + 3 + 1P + 1, Z4 + 11 + 6 + 1P + 1, Z4 + 11 + Y10, Z4 + 11 + Y9, Z4 + 11 + 10 + 3 + 1P + 1, Z4 + 11 + 10 + 6 + 1P + 1, Z4 + 11 + 10 + Y10, Z4 + 11 + 10 + Y9, Z4 + Y2 + 3 + 1P + 1, Z4 + Y2 + 6 + 1P + 1, Z4 + Y2 + Y10, Z4 + Y2 + Y9, Z4 + Y2 + Y6, Z4 + Y2 + Y5, Z4 + Y2 + 8 + Y10, Z4 + Y2 + 8 + Y9, Z4 + Y2 + 8 + Y8, Z4 + Y2 + 8 + Y7, Z4 + Y2 + 8 + 7 + Y10, Z4 + Y2 + 8 + 7 + Y9, Z4 + 12 + 3 + 1P + 1, Z4 + 12 + 6 + 1P + 1, Z4 + 12 + Y10, Z4 + 12 + Y9, Z4 + 12 + Y6, Z4 + 12 + Y5, 4 + 12 + 8 + Y10, Z4 + 12 + 8 + Y9, Z4 + 12 + 8 + Y8, Z4 + 12 + 8 + Y7, Z4 + 12 + 8 + 7 + Y10, Z4 + 12 + 8 + 7 + Y9, Z4 + 12 + 11 + 3 + 1P + 1, Z4 + 12 + 11 + 6 + 1P + 1, Z4 + 12 + 11 + Y10, Z4 + 12 + 11 + Y9, Z4 + Y1 + 3 + 1P + 1, Z4 + Y1 + 6 + 1P + 1, Z4 + Y1 + Y10, Z4 + Y1 + Y9, Z4 + Y1 + Y4, Z4 + Y1 + Y3, Z4 + Y1 + 9 + Y10, Z4 + Y1 + 9 + Y9, Z4 + Y1 + 9 + Y6, Z4 + Y1 + 9 + Y5, Z4 + Y1 + 9 + 8 + Y10, Z4 + Y1 + 9 + 8 + Y9, Z4 + Y1 + 9 + 8 + Y8, Z4 + Y1 + 9 + 8 + Y7, Z4 + Y1 + 9 + 8 + 7 + Y10, Z4 + Y1 + 9 + 8 + 7 + Y9,
Z3 + 3 + 1P + 1, Z3 + 6 + 1P + 1, Z3 + Y10, Z3 + Y9, Z3 + 11 + 3 + 1P + 1, Z3 + 11 + 6 + 1P + 1, Z3 + 11 + Y10, Z3 + 11 + Y9, Z3 + 11 + 10 + 3 + 1P + 1, Z3 + 11 + 10 + 6 + 1P + 1, Z3 + 11 + 10 + Y10, Z3 + 11 + 10 + Y9, Z3 + Y2 + 3 + 1P + 1, Z3 + Y2 + 6 + 1P + 1, Z3 + Y2 + Y10, Z3 + Y2 + Y9, Z3 + Y2 + Y6, Z3 + Y2 + Y5, Z3 + Y2 + 8 + Y10, Z3 + Y2 + 8 + Y9, Z3 + Y2 + 8 + Y8, Z3 + Y2 + 8 + Y7, Z3 + Y2 + 8 + 7 + Y10, Z3 + Y2 + 8 + 7 + Y9, Z3 + 12 + 3 + 1P + 1, Z3 + 12 + 6 + 1P + 1, Z3 + 12 + Y10, Z3 + 12 + Y9, Z3 + 12 + Y6, Z3 + 12 + Y5, 3 + 12 + 8 + Y10, Z3 + 12 + 8 + Y9, Z3 + 12 + 8 + Y8, Z3 + 12 + 8 + Y7, Z3 + 12 + 8 + 7 + Y10, Z3 + 12 + 8 + 7 + Y9, Z3 + 12 + 11 + 3 + 1P + 1, Z3 + 12 + 11 + 6 + 1P + 1, Z3 + 12 + 11 + Y10, Z3 + 12 + 11 + Y9, Z3 + Y1 + 3 + 1P + 1, Z3 + Y1 + 6 + 1P + 1, Z3 + Y1 + Y10, Z3 + Y1 + Y9, Z3 + Y1 + Y4, Z3 + Y1 + Y3, Z3 + Y1 + 9 + Y10, Z3 + Y1 + 9 + Y9, Z3 + Y1 + 9 + Y6, Z3 + Y1 + 9 + Y5, Z3 + Y1 + 9 + 8 + Y10, Z3 + Y1 + 9 + 8 + Y9, Z3 + Y1 + 9 + 8 + Y8, Z3 + Y1 + 9 + 8 + Y7, Z3 + Y1 + 9 + 8 + 7 + Y10, Z3 + Y1 + 9 + 8 + 7 + Y9,
Z2 + 3 + 1P + 1, Z2 + 6 + 1P + 1, Z2 + Y10, Z2 + Y9, Z2 + 11 + 3 + 1P + 1, Z2 + 11 + 6 + 1P + 1, Z2 + 11 + Y10, Z2 + 11 + Y9, Z2 + 11 + 10 + 3 + 1P + 1, Z2 + 11 + 10 + 6 + 1P + 1, Z2 + 11 + 10 + Y10, Z2 + 11 + 10 + Y9, Z2 + Y2 + 3 + 1P + 1, Z2 + Y2 + 6 + 1P + 1, Z2 + Y2 + Y10, Z2 + Y2 + Y9, Z2 + Y2 + Y6, Z2 + Y2 + Y5, Z2 + Y2 + 8 + Y10, Z2 + Y2 + 8 + Y9, Z2 + Y2 + 8 + Y8, Z2 + Y2 + 8 + Y7, Z2 + Y2 + 8 + 7 + Y10, Z2 + Y2 + 8 + 7 + Y9, Z2 + 12 + 3 + 1P + 1, Z2 + 12 + 6 + 1P + 1, Z2 + 12 + Y10, Z2 + 12 + Y9, Z2 + 12 + Y6, Z2 + 12 + Y5, 2 + 12 + 8 + Y10, Z2 + 12 + 8 + Y9, Z2 + 12 + 8 + Y8, Z2 + 12 + 8 + Y7, Z2 + 12 + 8 + 7 + Y10, Z2 + 12 + 8 + 7 + Y9, Z2 + 12 + 11 + 3 + 1P + 1, Z2 + 12 + 11 + 6 + 1P + 1, Z2 + 12 + 11 + Y10, Z2 + 12 + 11 + Y9, Z2 + Y1 + 3 + 1P + 1, Z2 + Y1 + 6 + 1P + 1, Z2 + Y1 + Y10, Z2 + Y1 + Y9, Z2 + Y1 + Y4, Z2 + Y1 + Y3, Z2 + Y1 + 9 + Y10, Z2 + Y1 + 9 + Y9, Z2 + Y1 + 9 + Y6, Z2 + Y1 + 9 + Y5, Z2 + Y1 + 9 + 8 + Y10, Z2 + Y1 + 9 + 8 + Y9, Z2 + Y1 + 9 + 8 + Y8, Z2 + Y1 + 9 + 8 + Y7, Z2 + Y1 + 9 + 8 + 7 + Y10, Z2 + Y1 + 9 + 8 + 7 + Y9,
Z1 + 3 + 1P + 1, Z1 + 6 + 1P + 1, Z1 + Y10, Z1 + Y9, Z1 + 11 + 3 + 1P + 1, Z1 + 11 + 6 + 1P + 1, Z1 + 11 + Y10, Z1 + 11 + Y9, Z1 + 11 + 10 + 3 + 1P + 1, Z1 + 11 + 10 + 6 + 1P + 1, Z1 + 11 + 10 + Y10, Z1 + 11 + 10 + Y9, Z1 + Y2 + 3 + 1P + 1, Z1 + Y2 + 6 + 1P + 1, Z1 + Y2 + Y10, Z1 + Y2 + Y9, Z1 + Y2 + Y6, Z1 + Y2 + Y5, Z1 + Y2 + 8 + Y10, Z1 + Y2 + 8 + Y9, Z1 + Y2 + 8 + Y8, Z1 + Y2 + 8 + Y7, Z1 + Y2 + 8 + 7 + Y10, Z1 + Y2 + 8 + 7 + Y9, Z1 + 12 + 3 + 1P + 1, Z1 + 12 + 6 + 1P + 1, Z1 + 12 + Y10, Z1 + 12 + Y9, Z1 + 12 + Y6, Z1 + 12 + Y5, 1 + 12 + 8 + Y10, Z1 + 12 + 8 + Y9, Z1 + 12 + 8 + Y8, Z1 + 12 + 8 + Y7, Z1 + 12 + 8 + 7 + Y10, Z1 + 12 + 8 + 7 + Y9, Z1 + 12 + 11 + 3 + 1P + 1, Z1 + 12 + 11 + 6 + 1P + 1, Z1 + 12 + 11 + Y10, Z1 + 12 + 11 + Y9, Z1 + Y1 + 3 + 1P + 1, Z1 + Y1 + 6 + 1P + 1, Z1 + Y1 + Y10, Z1 + Y1 + Y9, Z1 + Y1 + Y4, Z1 + Y1 + Y3, Z1 + Y1 + 9 + Y10, Z1 + Y1 + 9 + Y9, Z1 + Y1 + 9 + Y6, Z1 + Y1 + 9 + Y5, Z1 + Y1 + 9 + 8 + Y10, Z1 + Y1 + 9 + 8 + Y9, Z1 + Y1 + 9 + 8 + Y8, Z1 + Y1 + 9 + 8 + Y7, Z1 + Y1 + 9 + 8 + 7 + Y10, Z
1 + Y1 + 9 + 8 + 7 + Y9,
20 + 17 + 13 + 3 + 1P + 1,20 + 17 + 13 + 6 + 1P + 1,20 + 17 + 13 + Y10,20 + 17 + 13 + Y9,20 + Z7 + 3 + 1P + 1,20 + Z7 + 6 + 1P + 1,20 + Z7 + Y10,20 + Z7 + Y9,20 + Z7 + 10 + 3 + 1P + 1,20 + Z7 + 10 + 6 + 1P + 1,20 + Z7 + 10 + Y10,20 + Z7 + 10 + Y9,20 + 17 + 13 + Y2 + 3 + 1P + 1,20 + 17 + 13 + Y2 + 6 + 1P + 1,20 + 17 + 13 + Y2 + Y10,20 + 17 + 13 + Y2 + Y9,20 + 17 + 13 + Y2 + Y6,20 + 17 + 13 + Y2 + Y5,20 + 17 + 13 + Y2 + 8 + Y10,20 + 17 + 13 + Y2 + 8 + Y9,20 + 17 + 13 + Y2 + 8 + Y8,20 + 17 + 13 + Y2 + 8 + Y7,20 + 17 + 3 + Y2 + 8 + 7 + Y10,20 + 17 + 13 + Y2 + 8 + 7 + Y9,20 + Z6 + 3 + 1P + 1,20 + Z6 + 6 + 1P + 1,20 + Z6 + Y10,20 + Z6 + Y9,20 + Z6 + Y6,20 + Z6 + Y5,20 + Z6 + 8 + Y10,20 + Z6 + 8 + Y9,20 + Z6 + 8 + Y8,20 + Z6 + 8 + Y7,20 + Z6 + 8 + 7 + Y10,20 + Z6 + 8 + 7 + Y9,20 + Z6 + 11 + 3 + 1P + 1,20 + Z6 + 11 + 6 + 1P + 1,20 + Z6 + 11 + Y10,20 + Z6 + 11 + Y9,20 + 17 + 13 + Y1 + 3 + 1P + 1,20 + 17 + 13 + Y1 + 6 + 1P + 1,20 + 17 + 13 + Y1 + Y10,20 + 17 + 13 + Y1 + Y9,20 + 17 + 13 + Y1 + Y4,20 + 17 + 13 + Y1 + Y3,20 + 17 + 13 + 1 + 9 + Y10,20 + 17 + 13 + Y1 + 9 + Y9,20 + 17 + 13 + Y1 + 9 + Y6,20 + 17 + 13 + Y1 + 9 + Y5,20 + 17 + 13 + Y1 + 9 + 8 + Y10,20 + 17 + 13 + Y1 + 9 + 8 + Y9,20 + 17 + 13 + Y1 + 9 + 8 + Y8,20 + 17 + 13 + Y1 + 9 + 8 + Y7,20 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,20 + 17 + 13 + Y1 + 9 + 8 + 7 + Y9,
20 + Z5 + 3 + 1P + 1,20 + Z5 + 6 + 1P + 1,20 + Z5 + Y10,20 + Z5 + Y9,20 + Z5 + 11 + 3 + 1P + 1,20 + Z5 + 11 + 6 + 1P + 1,20 + Z5 + 11 + Y10,20 + Z5 + 11 + Y9,20 + Z5 + 11 + 10 + 3 + 1P + 1,20 + Z5 + 11 + 10 + 6 + 1P + 1,20 + Z5 + 11 + 10 + Y10,20 + Z5 + 11 + 10 + Y9,20 + Z5 + Y2 + 3 + 1P + 1,20 + Z5 + Y2 + 6 + 1P + 1,20 + Z5 + Y2 + Y10,20 + Z5 + Y2 + Y9,20 + Z5 + Y2 + Y6,20 + Z5 + Y2 + Y5,20 + Z5 + Y2 + 8 + Y10,20 + Z5 + Y2 + 8 + Y9,20 + Z5 + Y2 + 8 + Y8,20 + Z5 + Y2 + 8 + Y7,20 + Z5 + Y2 + 8 + 7 + Y10,20 + Z5 + Y + 8 + 7 + Y9,20 + Z5 + 12 + 3 + 1P + 1,20 + Z5 + 12 + 6 + 1P + 1,20 + Z5 + 12 + Y10,20 + Z5 + 12 + Y9,20 + Z5 + 12 + Y6,20 + Z5 + 12 + Y5,20 + Z5 + 12 + 8 + Y10,20 + Z5 + 12 + 8 + Y9,20 + Z5 + 12 + 8 + Y8,20 + Z5 + 12 + 8 + Y7,20 + Z5 + 12 + 8 + 7 + Y10,20 + Z5 + 12 + 8 + 7 + Y9,20 + Z5 + 12 + 11 + 3 + 1P + 1,20 + Z5 + 12 + 11 + 6 + 1P + 1,20 + Z5 + 12 + 11 + Y10,20 + Z5 + 12 + 11 + Y9,20 + Z5 + Y1 + 3 + 1P + 1,20 + Z5 + Y1 + 6 + 1P + 1,20 + Z5 + Y1 + Y10,20 + Z5 + Y1 + Y9,20 + Z5 + Y1 + Y4,20 + Z5 + Y1 + Y3,20 + 5 + Y1 + 9 + Y10,20 + Z5 + Y1 + 9 + Y9,20 + Z5 + Y1 + 9 + Y6,20 + Z5 + Y1 + 9 + Y5,20 + Z5 + Y1 + 9 + 8 + Y10,20 + Z5 + Y1 + 9 + 8 + Y9,20 + Z5 + Y1 + 9 + 8 + Y8,20 + Z5 + Y1 + 9 + 8 + Y7,20 + Z5 + Y1 + 9 + 8 + 7 + Y10,20 + Z5 + Y1 + 9 + 8 + 7 + Y9,
20 + 18 + 17 + 13 + 3 + 1P + 1,20 + 18 + 17 + 13 + 6 + 1P + 1,20 + 18 + 17 + 13 + Y10,20 + 18 + 17 + 13 + Y9,20 + 18 + Z7 + 3 + 1P + 1,20 + 18 + Z7 + 6 + 1P + 1,20 + 18 + Z7 + Y10,20 + 18 + Z7 + Y9,20 + 18 + Z7 + 10 + 3 + 1P + 1,20 + 18 + Z7 + 10 + 6 + 1P + 1,20 + 18 + Z7 + 10 + Y10,20 + 18 + Z7 + 10 + Y9,20 + 18 + 17 + 13 + Y2 + 3 + 1P + 1,20 + 18 + 17 + 13 + Y2 + 6 + 1P + 1,2
0 + 18 + 17 + 13 + Y2 + Y10,20 + 18 + 17 + 13 + Y2 + Y9,20 + 18 + 17 + 13 + Y2 + Y6,20 + 18 + 17 + 13 + Y2 + Y5,20 + 18 + 17 + 13 + Y2 + 8 + Y10,20 + 18 + 17 + 13 + Y2 + 8 + Y9,20 + 18 + 17 + 13 + Y2 + 8 + Y8,20 + 18 + 17 + 13 + Y2 + 8 + Y7,20 + 18 + 17 + 13 + Y2 + 8 + 7 + Y10,20 + 18 + 17 + 13 + Y2 + 8 + 7 + Y9,20 + 18 + Z6 + 3 + 1P + 1,20 + 18 + Z6 + 6 + 1P + 1,20 + 18 + Z6 + Y10,20 + 18 + Z6 + Y9,20 + 18 + Z6 + Y6,20 + 18 + Z6 + Y5,20 + 18 + Z6 + 8 + Y10,20 + 18 + Z6 + 8 + Y9,20 + 18 + Z6 + 8 + Y8,20 + 18 + Z6 + 8 + 7,20 + 18 + Z6 + 8 + 7 + Y10,20 + 18 + Z6 + 8 + 7 + Y9,20 + 18 + Z6 + 11 + 3 + 1P + 1,20 + 18 + Z6 + 11 + 6 + 1P + 1,20 + 18 + Z6 + 11 + Y10,20 + 18 + Z6 + 11 + Y9,
20 + 18 + 17 + 13 + Y1 + 3 + 1P + 1,20 + 18 + 17 + 13 + Y1 + 6 + 1P + 1,20 + 18 + 17 + 13 + Y1 + Y10,20 + 18 + 17 + 13 + Y1 + Y9,20 + 18 + 17 + 13 + Y1 + Y4,20 + 18 + 17 + 13 + Y1 + Y3,20 + 18 + 17 + 13 + Y1 + 9 + Y10,20 + 18 + 17 + 13 + Y1 + 9 + Y9,20 + 18 + 17 + 13 + Y1 + 9 + Y6,20 + 18 + 17 + 13 + Y1 + 9 + Y5,20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y10,20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y9,20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y8,20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y7,20 + 18 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,20 + 18 + 17 + 13 + Y1 + 9 + 8 + 7 + 9,
22 + 13 + 3 + 1P + 1,22 + 13 + 6 + 1P + 1,22 + 13 + Y10,22 + 13 + Y9,22 + 13 + 11 + 3 + 1P + 1,22 + 13 + 11 + 6 + 1P + 1,22 + 13 + 11 + Y10,22 + 13 + 11 + Y9,22 + 13 + 11 + 10 + 3 + 1P + 1,22 + 13 + 11 + 10 + 6 + 1P + 1,22 + 13 + 11 + 10 + Y10,22 + 13 + 11 + 10 + Y9,22 + 13 + Y2 + 3 + 1P + 1,22 + 13 + Y2 + 6 + 1P + 1,22 + 13 + Y2 + Y10,22 + 13 + Y2 + Y9,22 + 13 + Y2 + Y6,22 + 13 + Y2 + Y5,22 + 13 + Y2 + 8 + Y10,22 + 13 + Y2 + 8 + Y9,22 + 13 + Y2 + 8 + Y8,22 + 13 + Y2 + 8 + Y7,22 + 13 + Y2 + 8 + 7 + Y10,22 + 13 + Y + 8 + 7 + Y9,22 + 13 + 12 + 3 + 1P + 1,22 + 13 + 12 + 6 + 1P + 1,22 + 13 + 12 + Y10,22 + 13 + 12 + Y9,22 + 13 + 12 + Y6,22 + 13 + 12 + Y5,22 + 13 + 12 + 8 + Y10,22 + 13 + 12 + 8 + Y9,22 + 13 + 12 + 8 + Y8,22 + 13 + 12 + 8 + Y7,22 + 13 + 12 + 8 + 7 + Y10,22 + 13 + 12 + 8 + 7 + Y9,22 + 13 + 12 + 11 + 3 + 1P + 1,22 + 13 + 12 + 11 + 6 + 1P + 1,22 + 13 + 12 + 11 + Y10,22 + 13 + 12 + 11 + Y9,22 + 13 + Y1 + 3 + 1P + 1,22 + 13 + Y1 + 6 + 1P + 1,22 + 13 + Y1 + Y10,22 + 13 + Y1 + Y9,22 + 13 + Y1 + Y4,22 + 13 + Y1 + Y3,22 + 3 + Y1 + 9 + Y10,22 + 13 + Y1 + 9 + Y9,22 + 13 + Y1 + 9 + Y6,22 + 13 + Y1 + 9 + Y5,22 + 13 + Y1 + 9 + 8 + Y10,22 + 13 + Y1 + 9 + 8 + Y9,22 + 13 + Y1 + 9 + 8 + Y8,22 + 13 + Y1 + 9 + 8 + Y7,22 + 13 + Y1 + 9 + 8 + 7 + Y10,22 + 13 + Y1 + 9 + 8 + 7 + Y9,
23 + 13 + 3 + 1P + 1,23 + 13 + 6 + 1P + 1,23 + 13 + Y10,23 + 13 + Y9,23 + 13 + 11 + 3 + 1P + 1,23 + 13 + 11 + 6 + 1P + 1,23 + 13 + 11 + Y10,23 + 13 + 11 + Y9,23 + 13 + 11 + 10 + 3 + 1P + 1,23 + 13 + 11 + 10 + 6 + 1P + 1,23 + 13 + 11 + 10 + Y10,23 + 13 + 11 + 10 + Y9,23 + 13 + Y2 + 3 + 1P + 1,23 + 13 + Y2 + 6 + 1P + 1,23 + 13 + Y2 + Y10,23 + 13 + Y2 + Y9,23 + 13 + Y2 + Y6,23 + 13 + Y2 + Y5,23 + 13 + Y2 + 8 + Y10,23 + 13 + Y2 + 8 + Y9,23 + 13 + Y2 + 8 + Y8,23 + 13 + Y2 + 8 + Y7,23 + 13 + Y2 + 8 + 7 + Y10,23 + 13 + Y + 8 + 7 + Y9,23 + 13 + 12 + 3 + 1P + 1,23
+ 13 + 12 + 6 + 1P + 1,23 + 13 + 12 + Y10,23 + 13 + 12 + Y9,23 + 13 + 12 + Y6,23 + 13 + 12 + Y5,23 + 13 + 12 + 8 + Y10,23 + 13 + 12 + 8 + Y9,23 + 13 + 12 + 8 + Y8,23 + 13 + 12 + 8 + Y7,23 + 13 + 12 + 8 + 7 + Y10,23 + 13 + 12 + 8 + 7 + Y9,23 + 13 + 12 + 11 + 3 + 1P + 1,23 + 13 + 12 + 11 + 6 + 1P + 1,23 + 13 + 12 + 11 + Y10,23 + 13 + 12 + 11 + Y9,23 + 13 + Y1 + 3 + 1P + 1,23 + 13 + Y1 + 6 + 1P + 1,23 + 13 + Y1 + Y10,23 + 13 + Y1 + Y9,23 + 13 + Y1 + Y4,23 + 13 + Y1 + Y3,23 + 13 + Y1 + 9 + Y10,23 + 13 + Y1 + 9 + Y9,2 + 13 + Y1 + 9 + Y6,23 + 13 + Y1 + 9 + Y5,23 + 13 + Y1 + 9 + 8 + Y10,23 + 13 + Y1 + 9 + 8 + Y9,23 + 13 + Y1 + 9 + 8 + Y8,23 + 13 + Y1 + 9 + 8 + Y7,23 + 13 + Y1 + 9 + 8 + 7 + Y10,23 + 13 + Y1 + 9 + 8 + 7 + Y9,
24 + 13 + 3 + 1P + 1,24 + 13 + 6 + 1P + 1,24 + 13 + Y10,24 + 13 + Y9,24 + 13 + 11 + 3 + 1P + 1,24 + 13 + 11 + 6 + 1P + 1,24 + 13 + 11 + Y10,24 + 13 + 11 + Y9,24 + 13 + 11 + 10 + 3 + 1P + 1,24 + 13 + 11 + 10 + 6 + 1P + 1,24 + 13 + 11 + 10 + Y10,24 + 13 + 11 + 10 + Y9,24 + 13 + Y2 + 3 + 1P + 1,24 + 13 + Y2 + 6 + 1P + 1,24 + 13 + Y2 + Y10,24 + 13 + Y2 + Y9,24 + 13 + Y2 + Y6,24 + 13 + Y2 + Y5,24 + 13 + Y2 + 8 + Y10,24 + 13 + Y2 + 8 + Y9,24 + 13 + Y2 + 8 + Y8,24 + 13 + Y2 + 8 + Y7,24 + 13 + Y2 + 8 + 7 + Y10,24 + 13 + Y + 8 + 7 + Y9,24 + 13 + 12 + 3 + 1P + 1,24 + 13 + 12 + 6 + 1P + 1,24 + 13 + 12 + Y10,24 + 13 + 12 + Y9,24 + 13 + 12 + Y6,24 + 13 + 12 + Y5,24 + 13 + 12 + 8 + Y10,24 + 13 + 12 + 8 + Y9,24 + 13 + 12 + 8 + Y8,24 + 13 + 12 + 8 + Y7,24 + 13 + 12 + 8 + 7 + Y10,24 + 13 + 12 + 8 + 7 + Y9,24 + 13 + 12 + 11 + 3 + 1P + 1,24 + 13 + 12 + 11 + 6 + 1P + 1,24 + 13 + 12 + 11 + Y10,24 + 13 + 12 + 11 + Y9,24 + 13 + Y1 + 3 + 1P + 1,24 + 13 + Y1 + 6 + 1P + 1,24 + 13 + Y1 + Y10,24 + 13 + Y1 + Y9,24 + 13 + Y1 + Y4,24 + 13 + Y1 + Y3,24 + 3 + Y1 + 9 + Y10,24 + 13 + Y1 + 9 + Y9,24 + 13 + Y1 + 9 + Y6,24 + 13 + Y1 + 9 + Y5,24 + 13 + Y1 + 9 + 8 + Y10,24 + 13 + Y1 + 9 + 8 + Y9,24 + 13 + Y1 + 9 + 8 + Y8,24 + 13 + Y1 + 9 + 8 + Y7,24 + 13 + Y1 + 9 + 8 + 7 + Y10,24 + 13 + Y1 + 9 + 8 + 7 + Y9,
24 + 17 + 13 + 3 + 1P + 1,24 + 17 + 13 + 6 + 1P + 1,24 + 17 + 13 + Y10,24 + 17 + 13 + Y9,24 + Z7 + 3 + 1P + 1,24 + Z7 + 6 + 1P + 1,24 + Z7 + Y10,24 + Z7 + Y9,24 + Z7 + 10 + 3 + 1P + 1,24 + Z7 + 10 + 6 + 1P + 1,24 + Z7 + 10 + Y10,24 + Z7 + 10 + Y9,24 + 17 + 13 + Y2 + 3 + 1P + 1,24 + 17 + 13 + Y2 + 6 + 1P + 1,24 + 17 + 13 + Y2 + Y10,24 + 17 + 13 + Y2 + Y9,24 + 17 + 13 + Y2 + Y6,24 + 17 + 13 + Y2 + Y5,24 + 17 + 13 + Y2 + 8 + Y10,24 + 17 + 13 + Y2 + 8 + Y9,24 + 17 + 13 + Y2 + 8 + Y8,24 + 17 + 13 + Y2 + 8 + Y7,24 + 17 + 3 + Y2 + 8 + 7 + Y10,24 + 17 + 13 + Y2 + 8 + 7 + Y9,24 + Z6 + 3 + 1P + 1,24 + Z6 + 6 + 1P + 1,24 + Z6 + Y10,24 + Z6 + Y9,24 + Z6 + Y6,24 + Z6 + Y5,24 + Z6 + 8 + Y10,24 + Z6 + 8 + Y9,24 + Z6 + 8 + Y8,24 + Z6 + 8 + Y7,24 + Z6 + 8 + 7 + Y10,24 + Z6 + 8 + 7 + Y9,24 + Z6 + 11 + 3 + 1P + 1,24 + Z6 + 11 + 6 + 1P + 1,24 + Z6 + 11 + Y10,24 + Z6 + 11 + Y9,24 + 17 + 13 + Y1 + 3 + 1P + 1,24 + 17 + 13 + Y1 + 6 + 1P + 1,24 + 17 + 13 + Y1 + Y10,24 + 17 + 13 + Y1 + Y9,24 + 17 + 13 + Y1 + Y4,24 + 17 + 13 + Y1 + Y3,24 + 17 + 13 + 1 + 9 + Y10,24 + 17
+ 13 + Y1 + 9 + Y9, 24 + 17 + 13 + Y1 + 9 + Y6, 24 + 17 + 13 + Y1 + 9 + Y5, 24 + 17 + 13 + Y1 + 9 + 8 + Y10, 24 + 17 + 13 + Y1 + 9 + 8 + Y9, 24 + 17 + 13 + Y1 + 9 + 8 + Y +, 24 + 17 + 13 + Y1 + 9 + 7 +
25 + 13 + 3 + 1P + 1,25 + 13 + 6 + 1P + 1,25 + 13 + Y10,25 + 13 + Y9,25 + 13 + 11 + 3 + 1P + 1,25 + 13 + 11 + 6 + 1P + 1,25 + 13 + 11 + Y10,25 + 13 + 11 + Y9,25 + 13 + 11 + 10 + 3 + 1P + 1,25 + 13 + 11 + 10 + 6 + 1P + 1,25 + 13 + 11 + 10 + Y10,25 + 13 + 11 + 10 + Y9,25 + 13 + Y2 + 3 + 1P + 1,25 + 13 + Y2 + 6 + 1P + 1,25 + 13 + Y2 + Y10,25 + 13 + Y2 + Y9,25 + 13 + Y2 + Y6,25 + 13 + Y2 + Y5,25 + 13 + Y2 + 8 + Y10,25 + 13 + Y2 + 8 + Y9,25 + 13 + Y2 + 8 + Y8,25 + 13 + Y2 + 8 + Y7,25 + 13 + Y2 + 8 + 7 + Y10,25 + 13 + Y + 8 + 7 + Y9,25 + 13 + 12 + 3 + 1P + 1,25 + 13 + 12 + 6 + 1P + 1,25 + 13 + 12 + Y10,25 + 13 + 12 + Y9,25 + 13 + 12 + Y6,25 + 13 + 12 + Y5,25 + 13 + 12 + 8 + Y10,25 + 13 + 12 + 8 + Y9,25 + 13 + 12 + 8 + Y8,25 + 13 + 12 + 8 + Y7,25 + 13 + 12 + 8 + 7 + Y10,25 + 13 + 12 + 8 + 7 + Y9,25 + 13 + 12 + 11 + 3 + 1P + 1,25 + 13 + 12 + 11 + 6 + 1P + 1,25 + 13 + 12 + 11 + Y10,25 + 13 + 12 + 11 + Y9,25 + 13 + Y1 + 3 + 1P + 1,25 + 13 + Y1 + 6 + 1P + 1,25 + 13 + Y1 + Y10,25 + 13 + Y1 + Y9,25 + 13 + Y1 + Y4,25 + 13 + Y1 + Y3,25 + 3 + Y1 + 9 + Y10,25 + 13 + Y1 + 9 + Y9,25 + 13 + Y1 + 9 + Y6,25 + 13 + Y1 + 9 + Y5,25 + 13 + Y1 + 9 + 8 + Y10,25 + 13 + Y1 + 9 + 8 + Y9,25 + 13 + Y1 + 9 + 8 + Y8,25 + 13 + Y1 + 9 + 8 + Y7,25 + 13 + Y1 + 9 + 8 + 7 + Y10,25 + 13 + Y1 + 9 + 8 + 7 + Y9,
25 + Z4 + 3 + 1P + 1,25 + Z4 + 6 + 1P + 1,25 + Z4 + Y10,25 + Z4 + Y9,25 + Z4 + 11 + 3 + 1P + 1,25 + Z4 + 11 + 6 + 1P + 1,25 + Z4 + 11 + Y10,25 + Z4 + 11 + Y9,25 + Z4 + 11 + 10 + 3 + 1P + 1,25 + Z4 + 11 + 10 + 6 + 1P + 1,25 + Z4 + 11 + 10 + Y10,25 + Z4 + 11 + 10 + Y9,25 + Z4 + Y2 + 3 + 1P + 1,25 + Z4 + Y2 + 6 + 1P + 1,25 + Z4 + Y2 + Y10,25 + Z4 + Y2 + Y9,25 + Z4 + Y2 + Y6,25 + Z4 + Y2 + Y5,25 + Z4 + Y2 + 8 + Y10,25 + Z4 + Y2 + 8 + Y9,25 + Z4 + Y2 + 8 + Y8,25 + Z4 + Y2 + 8 + Y7,25 + Z4 + Y2 + 8 + 7 + Y10,25 + Z4 + Y + 8 + 7 + Y9,25 + Z4 + 12 + 3 + 1P + 1,25 + Z4 + 12 + 6 + 1P + 1,25 + Z4 + 12 + Y10,25 + Z4 + 12 + Y9,25 + Z4 + 12 + Y6,25 + Z4 + 12 + Y5,25 + Z4 + 12 + 8 + Y10,25 + Z4 + 12 + 8 + Y9,25 + Z4 + 12 + 8 + Y8,25 + Z4 + 12 + 8 + Y7,25 + Z4 + 12 + 8 + 7 + Y10,25 + Z4 + 12 + 8 + 7 + Y9,25 + Z4 + 12 + 11 + 3 + 1P + 1,25 + Z4 + 12 + 11 + 6 + 1P + 1,25 + Z4 + 12 + 11 + Y10,25 + Z4 + 12 + 11 + Y9,25 + Z4 + Y1 + 3 + 1P + 1,25 + Z4 + Y1 + 6 + 1P + 1,25 + Z4 + Y1 + Y10,25 + Z4 + Y1 + Y9,25 + Z4 + Y1 + Y4,25 + Z4 + Y1 + Y3,25 + 4 + Y1 + 9 + Y10,25 + Z4 + Y1 + 9 + Y9,25 + Z4 + Y1 + 9 + Y6,25 + Z4 + Y1 + 9 + Y5,25 + Z4 + Y1 + 9 + 8 + Y10,25 + Z4 + Y1 + 9 + 8 + Y9,25 + Z4 + Y1 + 9 + 8 + Y8,25 + Z4 + Y1 + 9 + 8 + Y7,25 + Z4 + Y1 + 9 + 8 + 7 + Y10,25 + Z4 + Y1 + 9 + 8 + 7 + Y9,
25 + Z3 + 3 + 1P + 1, 25 + Z3 + 6 + 1P + 1, 25 + Z3 + Y10, 25 + Z3 + Y9, 25 + Z3 + 11 + 3 + 1P + 1, 25 + Z3 + 11 + 6 + 1P + 1, 25 + Z3 + 11 + Y10, 25 + Z3 + 11 + Y9, 25 + Z3 + 11 + 10 + 3 + 1P + 1
, 25 + Z3 + 11 + 10 + 6 + 1P + 1,25 + Z3 + 11 + 10 + Y10,25 + Z3 + 11 + 10 + Y9,25 + Z3 + Y2 + 3 + 1P + 1,25 + Z3 + Y2 + 6 + 1P + 1,25 + Z3 + Y2 + Y10,25 + Z3 + Y2 + Y9,25 + Z3 + Y2 + Y6,25 + Z3 + Y2 + Y5,25 + Z3 + Y2 + 8 + Y10,25 + Z3 + Y2 + 8 + Y9,25 + Z3 + Y2 + 8 + Y8,25 + Z3 + Y2 + 8 + Y7,25 + Z3 + Y2 + 8 + 7 + Y10,25 + Z3 + Y2 + 8 + 7 + Y9,25 + Z3 + 12 + 3 + 1P + 1,25 + Z3 + 12 + 6 + 1P + 1,25 + Z3 + 12 + Y10,25 + Z3 + 12 + Y9,25 + Z3 + 12 + Y6,25 + Z3 + 12 + Y5,25 + Z3 + 12 + 8 + Y10,25 + Z3 + 12 + 8 + Y9,2 + Z3 + 12 + 8 + Y8,25 + Z3 + 12 + 8 + Y7,25 + Z3 + 12 + 8 + 7 + Y10,25 + Z3 + 12 + 8 + 7 + Y9,25 + Z3 + 12 + 11 + 3 + 1P + 1,25 + Z3 + 12 + 11 + 6 + 1P + 1,25 + Z3 + 12 + 11 + Y10,25 + Z3 + 12 + 11 + Y9,25 + Z3 + Y1 + 3 + 1P + 1,25 + Z3 + Y1 + 6 + 1P + 1,25 + Z3 + Y1 + Y10,25 + Z3 + Y1 + Y9,25 + Z3 + Y1 + Y4,25 + Z3 + Y1 + Y3,25 + Z3 + Y1 + 9 + Y10,25 + Z3 + Y1 + 9 + Y9,25 + Z3 + Y1 + 9 + Y6,25 + Z3 + Y1 + 9 + Y5,25 + Z3 + Y1 + 9 + 8 + Y10,25 + Z3 + Y1 + 9 + 8 + Y9,25 + Z3 + Y1 + 9 + 8 + Y8,25 + Z3 + Y1 + 9 + 8 + Y7,2 + Z3 + Y1 + 9 + 8 + 7 + Y10,25 + Z3 + Y1 + 9 + 8 + 7 + Y9,25 + Z2 + 3 + 1P + 1,25 + Z2 + 6 + 1P + 1,25 + Z2 + Y10,25 + Z2 + Y9,25 + Z2 + 11 + 3 + 1P + 1,25 + Z2 + 11 + 6 + 1P + 1,25 + Z2 + 11 + Y10,25 + Z2 + 11 + Y9,25 + Z2 + 11 + 10 + 3 + 1P + 1,25 + Z2 + 11 + 10 + 6 + 1P + 1,25 + Z2 + 11 + 10 + Y10,25 + Z2 + 11 + 10 + Y9,25 + Z2 + Y2 + 3 + 1P + 1,25 + Z2 + Y2 + 6 + 1P + 1,25 + Z2 + Y2 + Y10,25 + Z2 + Y2 + Y9,25 + Z2 + Y2 + Y6,25 + Z2 + Y2 + Y5,25 + Z2 + Y2 + 8 + Y10,25 + Z2 + Y2 + 8 + Y9,25 + Z2 + Y2 + 8 + Y8,25 + Z2 + Y2 + 8 + Y7, 25 + Z2 + Y2 + 8 + 7 + Y10, 25 + Z2 + Y2 + 8 + 7 + Y9,
25 + Z2 + 12 + 3 + 1P + 1,25 + Z2 + 12 + 6 + 1P + 1,25 + Z2 + 12 + Y10,25 + Z2 + 12 + Y9,25 + Z2 + 12 + Y6,25 + Z2 + 12 + Y5,25 + Z2 + 12 + 8 + Y10,25 + Z2 + 12 + 8 + Y9,25 + Z2 + 12 + 8 + Y8,25 + Z2 + 12 + 8 + Y7,25 + Z2 + 12 + 8 + 7 + Y10,25 + Z2 + 12 + 8 + 7 + Y9,25 + Z2 + 12 + 11 + 3 + 1P + 1,25 + Z2 + 12 + 11 + 6 + 1P + 1,25 + Z2 + 12 + 11 + Y10,25 + Z2 + 12 + 11 + Y9,25 + Z2 + Y1 + 3 + 1P + 1,25 + Z2 + Y1 + 6 + 1P + 1,25 + Z2 + Y1 + Y10,25 + Z2 + Y1 + Y9,25 + Z2 + Y1 + Y4,25 + Z2 + Y1 + Y3,25 + Z2 + Y1 + 9 + Y 0,25 + Z2 + Y1 + 9 + Y9,25 + Z2 + Y1 + 9 + Y6,25 + Z2 + Y1 + 9 + Y5,25 + Z2 + Y1 + 9 + 8 + Y10,25 + Z2 + Y1 + 9 + 8 + Y9,25 + Z2 + Y1 + 9 + 8 + Y8,25 + Z2 + Y1 + 9 + 8 + Y7,25 + Z2 + Y1 + 9 + 8 + 7 + Y10,25 + Z2 + Y1 + 9 + 8 + 7 + Y9,25 + Z1 + 3 + 1P + 1,25 + Z1 + 6 + 1P + 1,25 + Z1 + Y10,25 + Z1 + Y9,25 + Z1 + 11 + 3 + 1P + 1,25 + Z1 + 11 + 6 + 1P + 1,25 + Z1 + 11 + Y10,25 + Z1 + 11 + Y9,25 + Z1 + 11 + 10 + 3 + 1P + 1,25 + Z1 + 11 + 10 + 6 + 1P + 1,25 + Z1 + 11 + 10 + Y10,25 + Z1 + 11 + 10 + Y9,25 + Z1 + Y2 + 3 + 1P + 1 25 + Z1 + Y2 + 6 + 1P + 1,25 + Z1 + Y2 + Y10,25 + Z1 + Y2 + Y9,25 + Z1 + Y2 + Y6,25 + Z1 + Y2 + Y5,25 + Z1 + Y2 + 8 + Y10,25 + Z1 + Y2 + 8 + Y9,25 + Z1 + Y2 + 8 + Y8,25 + Z1 + Y2 + 8 + Y7,25 + Z1 + Y2 + 8 + 7 + Y10,25 + Z1 + Y2 + 8 + 7 + Y9,25 + Z1 + 12 + 3 + 1P + 1,25 + Z1 + 12 + 6 + 1P + 1,25 + Z1 + 12 + Y10,25 + Z1 + 12 + Y9,25 + Z1 + 12 + Y6,25 + Z1 + 12 + Y5,25 + Z1 + 12 + 8 + Y10,25
+ Z1 + 12 + 8 + Y9,25 + Z1 + 12 + 8 + Y8,25 + Z1 + 12 + 8 + Y7,25 + Z1 + 12 + 8 + 7 + Y10,25 + Z1 + 12 + 8 + 7 + Y9,25 + Z1 + 12 + 11 + 3 + 1P + 1,25 + Z1 + 12 + 11 + 6 + 1P + 1,25 + Z1 + 12 + 11 + Y10,25 + Z1 + 12 + 11 + Y9,25 + Z1 + Y1 + 3 + 1P + 1,25 + Z1 + Y1 + 6 + 1P + 1,25 + Z1 + Y1 + Y10,25 + Z1 + Y1 + Y9,25 + Z1 + Y1 + Y4,25 + Z1 + Y1 + Y3,25 + Z1 + Y1 + 9 + Y10,25 + Z1 + Y1 + 9 + Y9,25 + Z1 + Y1 + 9 + Y6,25 + Z1 + Y1 + 9 + Y5,25 + Z1 + Y1 + 9 + 8 + Y10,25 + Z1 + Y1 + 9 + 8 + Y9,25 + Z1 + Y1 + 9 + 8 + Y8,25 + Z + Y1 + 9 + 8 + Y7,25 + Z1 + Y1 + 9 + 8 + 7 + Y10,25 + Z1 + Y1 + 9 + 8 + 7 + Y9,
32 + 1P + 1,32 + 2 + 1P + 1,32 + 3 + 1P + 1,32 + 4 + 1P + 1,32 + 5 + 1P + 1,32 + 6 + 1P + 1,32 + Y10,32 + Y9,32 + 10 + 3 + 1P + 1,32 + 10 + 6 + 1P + 1,32 + 10 + Y10,32 + 10 + Y9,32 + 10 + Y4,32 + 10 + Y3,32 + 10 + 9 + Y10,32 + 10 + 9 + Y9,32 + 10 + 9 + Y6,32 + 10 + 9 + Y5,32 + 10 + 9 + 8 + Y10,32 + 10 + 9 + 8 + Y9,32 + 10 + 9 + 8 + Y8,32 + 10 + 9 + 8 + Y7,32 + 10 + 9 + 8 + 7 + Y10,32 + 10 + 9 + 8 + 7 + Y9,32 + 13 + 3 + 1P + 1, 32 + 13 + 6 + 1P + 1, 32 + 13 + Y10, 32 + 13 + Y9, 32 + 13 + 11 + 3 + 1P + 1, 32 + 13 + 11 + + 1P + 1,32 + 13 + 11 + Y10,32 + 13 + 11 + Y9,32 + 13 + 11 + 10 + 3 + 1P + 1,32 + 13 + 11 + 10 + 6 + 1P + 1,32 + 13 + 11 + 10 + Y10,32 + 13 + 11 + 10 + Y9,32 + 13 + Y2 + 3 + 1P + 1,32 + 13 + Y2 + 6 + 1P + 1,32 + 13 + Y2 + Y10,32 + 13 + Y2 + Y9,32 + 13 + Y2 + Y6,32 + 13 + Y2 + Y5,32 + 13 + Y2 + 8 + Y10,32 + 13 + Y2 + 8 + Y9,32 + 13 + Y2 + 8 + Y8,32 + 13 + Y2 + 8 + Y7,32 + 13 + Y2 + 8 + 7 + Y10,32 + 13 + Y2 + 8 + 7 + Y9,32 + 13 + 12 + 3 + 1P + 1,32 + 13 + 12 + 6 + 1P + 1,32 + 13 + 12 + Y10,32 + 13 + 12 + Y9,32 + 1 + 12 + Y6,32 + 13 + 12 + Y5,32 + 13 + 12 + 8 + Y10,32 + 13 + 12 + 8 + Y9,32 + 13 + 12 + 8 + Y8,32 + 13 + 12 + 8 + Y7,32 + 13 + 12 + 8 + 7 + Y10,32 + 13 + 12 + 8 + 7 + Y9,32 + 13 + 12 + 11 + 3 + 1P + 1,32 + 13 + 12 + 11 + 6 + 1P + 1,32 + 13 + 12 + 11 + Y10,32 + 13 + 12 + 11 + Y9,32 + 13 + Y1 + 3 + 1P + 1,32 + 13 + Y1 + 6 + 1P + 1,32 + 13 + Y1 + Y10,32 + 13 + Y1 + Y9,32 + 13 + Y1 + Y4,32 + 13 + Y1 + Y3,32 + 13 + Y1 + 9 + Y10,32 + 13 + Y1 + 9 + Y9,32 + 13 + Y1 + 9 + Y6,32 + 13 + Y1 + 9 + Y5,32 + 13 + Y1 + 9 + 8 + Y10, 32 + 13 + Y1 + 9 + 8 + Y9, 32 + 13 + Y1 + 9 + 8 + Y8, 32 + 13 + Y1 + 9 + 8 + Y7, 32 + 13 + Y1 + 9 + 8 + 7 + Y10, 32 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 14 + 3 + 1P + 1,32 + 14 + 6 + 1P + 1,32 + 14 + Y10,32 + 14 + Y9,32 + 14 + 12 + 3 + 1P + 1,32 + 14 + 12 + 6 + 1P + 1,32 + 14 + 12 + Y10,32 + 14 + 12 + Y9,32 + 14 + 12 + Y6,32 + 14 + 12 + Y5,32 + 14 + 12 + 8 + Y10,32 + 14 + 12 + 8 + Y9,32 + 14 + 12 + 8 + Y8,32 + 14 + 12 + 8 + Y7,32 + 14 + 12 + 8 + 7 + Y10,32 + 14 + 12 + 8 + 7 + Y9,32 + 14 + 12 + 11 + 3 + 1P + 1,32 + 14 + 12 + 11 + 6 + 1P + 1,32 + 14 + 12 + 11 + Y10,32 + 14 + 12 + 11 + Y9,32 + 14 + Y1 + 3 + 1P + 1,32 + 14 + Y1 + 6 + 1P + 1,32 + 14 + Y1 + Y10,32 + 4 + Y1 + Y9,32 + 14 + Y1 + Y4,32 + 14 + Y1 + Y3,32 + 14 + Y1 + 9 + Y10,32 + 14 + Y1 + 9 + Y9,32 + 14 + Y1 + 9 + Y6,32 + 14 + Y1 + 9 + Y5,32 + 14 + Y1 + 9 + 8 + Y10,32 + 14 + Y1 + 9 + 8 + Y9,32 + 14 + Y1 + 9 + 8 + Y8,32 + 14 + Y1
+ 9 + 8 + Y7, 32 + 14 + Y1 + 9 + 8 + 7 + Y10, 32 + 14 + Y1 + 9 + 8 + 7 + Y9,
32 + 15 + 13 + 3 + 1P + 1,32 + 15 + 13 + 6 + 1P + 1,32 + 15 + 13 + Y10,32 + 15 + 13 + Y9,32 + 15 + 13 + 11 + 3 + 1P + 1,32 + 15 + 13 + 11 + 6 + 1P + 1,32 + 15 + 13 + 11 + Y10,32 + 15 + 13 + 11 + Y9,32 + 15 + 13 + 11 + 10 + 3 + 1P + 1,32 + 15 + 13 + 11 + 10 + 6 + 1P + 1,32 + 15 + 13 + 11 + 10 + Y10,32 + 15 + 13 + 11 + 10 + Y9,32 + 15 + 13 + Y2 + 3 + 1P + 1,32 + 15 + 13 + Y2 + 6 + 1P + 1,32 + 15 + 13 + Y2 + Y10,32 + 15 + 13 + Y2 + Y9,32 + 15 + 13 + Y2 + Y6,32 + 15 + 13 + Y2 + Y5,32 + 15 + 13 + Y2 + 8 + Y10,32 + 15 + 13 + 2 + 8 + Y9,32 + 15 + 13 + Y2 + 8 + Y8,32 + 15 + 13 + Y2 + 8 + Y7,32 + 15 + 13 + Y2 + 8 + 7 + Y10,32 + 15 + 13 + Y2 + 8 + 7 + Y9,32 + Z8 + 3 + 1P + 1,32 + Z8 + 6 + 1P + 1,32 + Z8 + Y10,32 + Z8 + Y9,32 + Z8 + Y6,32 + Z8 + Y5,32 + Z8 + 8 + Y10,32 + Z8 + 8 + Y9,32 + Z8 + 8 + Y8,32 + Z8 + 8 + Y7,32 + Z8 + 8 + 7 + Y10,32 + Z8 + 8 + 7 + Y9,32 + Z8 + 11 + 3 + 1P + 1,32 + Z8 + 11 + 6 + 1P + 1,32 + Z8 + 11 + Y10,32 + Z8 + 11 + Y9,32 + 15 + 13 + Y1 + 3 + 1P + 1,32 + 15 + 13 + Y1 + 6 + 1P + 1,32 + 15 + 13 + Y1 + Y10,32 + 15 + 3 + Y1 + Y9,32 + 15 + 13 + Y1 + Y4,32 + 15 + 13 + Y1 + Y3,32 + 15 + 13 + Y1 + 9 + Y10,32 + 15 + 13 + Y1 + 9 + Y9,32 + 15 + 13 + Y1 + 9 + Y6,32 + 15 + 13 + Y1 + 9 + Y5,32 + 15 + 13 + Y1 + 9 + 8 + Y10,32 + 15 + 13 + Y1 + 9 + 8 + Y9,32 + 15 + 13 + Y1 + 9 + 8 + Y8,32 + 15 + 13 + Y1 + 9 + 8 + Y7,32 + 15 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 15 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 17 + 13 + 3 + 1P + 1,32 + 17 + 13 + 6 + 1P + 1,32 + 17 + 13 + Y10,32 + 17 + 13 + Y9,32 + Z7 + 3 + 1P + 1,32 + Z7 + 6 + 1P + 1,32 + Z7 + Y10,32 + Z7 + Y9,32 + Z7 + 10 + 3 + 1P + 1,32 + Z7 + 10 + 6 + 1P + 1,32 + Z7 + 10 + Y10,32 + Z7 + 10 + Y9,32 + 17 + 13 + Y2 + 3 + 1P + 1,32 + 17 + 13 + Y2 + 6 + 1P + 1,32 + 17 + 13 + Y2 + Y10,32 + 17 + 13 + Y2 + Y9,32 + 17 + 13 + Y2 + Y6,32 + 17 + 13 + Y2 + Y5,32 + 17 + 13 + Y2 + 8 + Y10,32 + 17 + 13 + Y2 + 8 + Y9,32 + 17 + 13 + Y2 + 8 + Y8,32 + 17 + 13 + Y2 + 8 + Y7,32 + 17 + 3 + Y2 + 8 + 7 + Y10,32 + 17 + 13 + Y2 + 8 + 7 + Y9,
32 + Z6 + 3 + 1P + 1,32 + Z6 + 6 + 1P + 1,32 + Z6 + Y10,32 + Z6 + Y9,32 + Z6 + Y6,32 + Z6 + Y5,32 + Z6 + 8 + Y10,32 + Z6 + 8 + Y9,32 + Z6 + 8 + Y8,32 + Z6 + 8 + Y7,32 + Z6 + 8 + 7 + Y10,32 + Z6 + 8 + 7 + Y9,32 + Z6 + 11 + 3 + 1P + 1,32 + Z6 + 11 + 6 + 1P + 1,32 + Z6 + 11 + Y10,32 + Z6 + 11 + Y9,32 + 17 + 13 + Y1 + 3 + 1P + 1,32 + 17 + 13 + Y1 + 6 + 1P + 1,32 + 17 + 13 + Y1 + Y10,32 + 17 + 13 + Y1 + Y9,32 + 17 + 13 + Y1 + Y4,32 + 17 + 13 + Y1 + Y3,32 + 17 + 13 + Y1 + 9 + Y10,32 + 17 + 13 + Y1 + 9 + Y9,32 + 17 + 1 + Y1 + 9 + Y6,32 + 17 + 13 + Y1 + 9 + Y5,32 + 17 + 13 + Y1 + 9 + 8 + Y10,32 + 17 + 13 + Y1 + 9 + 8 + Y9,32 + 17 + 13 + Y1 + 9 + 8 + Y8,32 + 17 + 13 + Y1 + 9 + 8 + Y7,32 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 17 + 13 + Y1 + 9 + 8 + 7 + Y9,32 + Z5 + 3 + 1P + 1,32 + Z5 + 6 + 1P + 1,32 + Z5 + Y10,32 + Z5 + Y9,32 + Z5 + 11 + 3 + 1P + 1,32 + Z5 + 11 + 6 + 1P + 1,32 + Z5 + 11 + Y10,32 + Z5 + 11 + Y9,32 + Z5 + 11 + 10 + 3 + 1P + 1
, 32 + Z5 + 11 + 10 + 6 + 1P + 1,32 + Z5 + 11 + 10 + Y10,32 + Z5 + 11 + 10 + Y9,32 + Z5 + Y2 + 3 + 1P + 1,32 + Z5 + Y2 + 6 + 1P + 1,32 + Z5 + Y2 + Y10,32 + Z5 + Y2 + Y9,32 + Z5 + Y2 + Y6,32 + Z5 + Y2 + Y5,32 + Z5 + Y2 + 8 + Y10,32 + Z5 + Y2 + 8 + Y9,32 + Z5 + Y2 + 8 + Y8,32 + Z5 + Y2 + 8 + Y7,32 + Z5 + Y2 + 8 + 7 + Y10,32 + Z5 + Y2 + 8 + 7 + Y9,32 + Z5 + 12 + 3 + 1P + 1,32 + Z5 + 12 + 6 + 1P + 1,32 + Z5 + 12 + Y10,32 + Z5 + 12 + Y9,32 + Z5 + 12 + Y6,32 + Z5 + 12 + Y5,32 + Z5 + 12 + 8 + Y10,32 + Z5 + 12 + 8 + Y9,3 + Z5 + 12 + 8 + Y8,32 + Z5 + 12 + 8 + Y7,32 + Z5 + 12 + 8 + 7 + Y10,32 + Z5 + 12 + 8 + 7 + Y9,32 + Z5 + 12 + 11 + 3 + 1P + 1,32 + Z5 + 12 + 11 + 6 + 1P + 1,32 + Z5 + 12 + 11 + Y10,32 + Z5 + 12 + 11 + Y9,32 + Z5 + Y1 + 3 + 1P + 1,32 + Z5 + Y1 + 6 + 1P + 1,32 + Z5 + Y1 + Y10,32 + Z5 + Y1 + Y9,32 + Z5 + Y1 + Y4,32 + Z5 + Y1 + Y3,32 + Z5 + Y1 + 9 + Y10,32 + Z5 + Y1 + 9 + Y9,32 + Z5 + Y1 + 9 + Y6,32 + Z5 + Y1 + 9 + Y5,32 + Z5 + Y1 + 9 + 8 + Y10,32 + Z5 + Y1 + 9 + 8 + Y9,32 + Z5 + Y1 + 9 + 8 + Y8,32 + Z5 + Y1 + 9 + 8 + Y7,3 + Z5 + Y1 + 9 + 8 + 7 + Y10,32 + Z5 + Y1 + 9 + 8 + 7 + Y9,
32 + 18 + 17 + 13 + 3 + 1P + 1,32 + 18 + 17 + 13 + 6 + 1P + 1,32 + 18 + 17 + 13 + Y10,32 + 18 + 17 + 13 + Y9,32 + 18 + Z7 + 3 + 1P + 1,32 + 18 + Z7 + 6 + 1P + 1,32 + 18 + Z7 + Y10,32 + 18 + Z7 + Y9,32 + 18 + Z7 + 10 + 3 + 1P + 1,32 + 18 + Z7 + 10 + 6 + 1P + 1,32 + 18 + Z7 + 10 + Y10,32 + 18 + Z7 + 10 + Y9,32 + 18 + 17 + 13 + Y2 + 3 + 1P + 1,32 + 18 + 17 + 13 + Y2 + 6 + 1P + 1,32 + 18 + 17 + 13 + Y2 + Y10,32 + 18 + 17 + 13 + Y2 + Y9,32 + 18 + 17 + 13 + Y2 + Y6,32 + 18 + 17 + 13 + Y2 + Y5,32 + 18 + 17 + 13 + Y2 + 8 + Y10, 2 + 18 + 17 + 13 + Y2 + 8 + Y9,32 + 18 + 17 + 13 + Y2 + 8 + Y8,32 + 18 + 17 + 13 + Y2 + 8 + Y7,32 + 18 + 17 + 13 + Y2 + 8 + 7 + Y10,32 + 18 + 17 + 13 + Y2 + 8 + 7 + Y9,32 + 18 + Z6 + 3 + 1P + 1,32 + 18 + Z6 + 6 + 1P + 1,32 + 18 + Z6 + Y10,32 + 18 + Z6 + Y9,32 + 18 + Z6 + Y6,32 + 18 + Z6 + Y5,32 + 18 + Z6 + 8 + Y10,32 + 18 + Z6 + 8 + Y9,32 + 18 + Z6 + 8 + Y8,32 + 18 + Z6 + 8 + Y7,32 + 18 + Z6 + 8 + 7 + Y10,32 + 18 + Z6 + 8 + 7 + Y9,32 + 18 + Z6 + 11 + 3 + 1P + 1,32 + 18 + Z6 + 11 + 6 + 1P + 1,32 + 18 + Z6 + 11 + Y10,32 + 8 + Z6 + 11 + Y9,32 + 18 + 17 + 13 + Y1 + 3 + 1P + 1,32 + 18 + 17 + 13 + Y1 + 6 + 1P + 1,32 + 18 + 17 + 13 + Y1 + Y10,32 + 18 + 17 + 13 + Y1 + Y9,32 + 18 + 17 + 13 + Y1 + Y4,32 + 18 + 17 + 13 + Y1 + Y3,32 + 18 + 17 + 13 + Y1 + 9 + Y10,32 + 18 + 17 + 13 + Y1 + 9 + Y9,32 + 18 + 17 + 13 + Y1 + 9 + Y6,32 + 18 + 17 + 13 + Y1 + 9 + Y5,32 + 18 + 17 + 13 + Y1 + 9 + 8 + Y10,32 + 18 + 17 + 13 + Y1 + 9 + 8 + Y9,32 + 18 + 17 + 13 + Y1 + 9 + 8 + Y8,32 + 18 + 17 + 13 + Y1 + 9 + 8 + Y7,32 + 18 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 18 + 17 + 1 3 + Y1 + 9 + 8 + 7 + Y9,
32 + Z4 + 3 + 1P + 1,32 + Z4 + 6 + 1P + 1,32 + Z4 + Y10,32 + Z4 + Y9,32 + Z4 + 11 + 3 + 1P + 1,32 + Z4 + 11 + 6 + 1P + 1,32 + Z4 + 11 + Y10,32 + Z4 + 11 + Y9,32 + Z4 + 11 + 10 + 3 + 1P + 1,32 + Z4 + 11 + 10 + 6 + 1P + 1,32 + Z4 + 11 + 10 + Y10,32 + Z4 + 11 + 10 + Y9,32 + Z4 + Y2 + 3 + 1P + 1,32 + Z4 + Y2 + 6 + 1P + 1,32 + Z4 + Y2 + Y10,32 + Z4 + Y2 + Y9,32 + Z4 + Y2 + Y6,
32 + Z4 + Y2 + Y5,32 + Z4 + Y2 + 8 + Y10,32 + Z4 + Y2 + 8 + Y9,32 + Z4 + Y2 + 8 + Y8,32 + Z4 + Y2 + 8 + Y7,32 + Z4 + Y2 + 8 + 7 + Y10,32 + Z4 + Y2 + 8 + 7 + Y9,32 + Z4 + 12 + 3 + 1P + 1,32 + Z4 + 12 + 6 + 1P + 1,32 + Z4 + 12 + Y10,32 + Z4 + 12 + Y9,32 + Z4 + 12 + Y6,32 + Z4 + 12 + Y5,32 + Z4 + 12 + 8 + Y10,32 + Z4 + 12 + 8 + Y9,32 + Z4 + 12 + 8 + Y8,32 + Z4 + 12 + 8 + Y7,32 + Z4 + 12 + 8 + 7 + Y10,32 + Z4 + 12 + 8 + 7 + Y9,32 + Z4 + 12 + 11 + 3 + 1P + 1,32 + Z4 + 12 + 11 + 6 + 1P + 1,32 + Z4 + 12 + 11 + Y10,32 + Z4 + 2 + 11 + Y9,32 + Z4 + Y1 + 3 + 1P + 1,32 + Z4 + Y1 + 6 + 1P + 1,32 + Z4 + Y1 + Y10,32 + Z4 + Y1 + Y9,32 + Z4 + Y1 + Y4,32 + Z4 + Y1 + Y3,32 + Z4 + Y1 + 9 + Y10,32 + Z4 + Y1 + 9 + Y9,32 + Z4 + Y1 + 9 + Y6,32 + Z4 + Y1 + 9 + Y5,32 + Z4 + Y1 + 9 + 8 + Y10,32 + Z4 + Y1 + 9 + 8 + Y9,32 + Z4 + Y1 + 9 + 8 + Y8,32 + Z4 + Y1 + 9 + 8 + Y7,32 + Z4 + Y1 + 9 + 8 + 7 + Y10,32 + Z4 + Y1 + 9 + 8 + 7 + Y9,
32 + Z3 + 3 + 1P + 1,32 + Z3 + 6 + 1P + 1,32 + Z3 + Y10,32 + Z3 + Y9,32 + Z3 + 11 + 3 + 1P + 1,32 + Z3 + 11 + 6 + 1P + 1,32 + Z3 + 11 + Y10,32 + Z3 + 11 + Y9,32 + Z3 + 11 + 10 + 3 + 1P + 1,32 + Z3 + 11 + 10 + 6 + 1P + 1,32 + Z3 + 11 + 10 + Y10,32 + Z3 + 11 + 10 + Y9,32 + Z3 + Y2 + 3 + 1P + 1,32 + Z3 + Y2 + 6 + 1P + 1,32 + Z3 + Y2 + Y10,32 + Z3 + Y2 + Y9,32 + Z3 + Y2 + Y6,32 + Z3 + Y2 + Y5,32 + Z3 + Y2 + 8 + Y10,32 + Z3 + Y2 + 8 + Y9,32 + Z3 + Y2 + 8 + Y8,32 + Z3 + Y2 + 8 + Y7,32 + Z3 + Y2 + 8 + 7 + Y10,32 + Z3 + Y + 8 + 7 + Y9,32 + Z3 + 12 + 3 + 1P + 1,32 + Z3 + 12 + 6 + 1P + 1,32 + Z3 + 12 + Y10,32 + Z3 + 12 + Y9,32 + Z3 + 12 + Y6,32 + Z3 + 12 + Y5,32 + Z3 + 12 + 8 + Y10,32 + Z3 + 12 + 8 + Y9,32 + Z3 + 12 + 8 + Y8,32 + Z3 + 12 + 8 + Y7,32 + Z3 + 12 + 8 + 7 + Y10,32 + Z3 + 12 + 8 + 7 + Y9,32 + Z3 + 12 + 11 + 3 + 1P + 1,32 + Z3 + 12 + 11 + 6 + 1P + 1,32 + Z3 + 12 + 11 + Y10,32 + Z3 + 12 + 11 + Y9,32 + Z3 + Y1 + 3 + 1P + 1,32 + Z3 + Y1 + 6 + 1P + 1,32 + Z3 + Y1 + Y10,32 + Z3 + Y1 + Y9,32 + Z3 + Y1 + Y4,32 + Z3 + Y1 + Y3,32 + 3 + Y1 + 9 + Y10,32 + Z3 + Y1 + 9 + Y9,32 + Z3 + Y1 + 9 + Y6,32 + Z3 + Y1 + 9 + Y5,32 + Z3 + Y1 + 9 + 8 + Y10,32 + Z3 + Y1 + 9 + 8 + Y9,32 + Z3 + Y1 + 9 + 8 + Y8,32 + Z3 + Y1 + 9 + 8 + Y7,32 + Z3 + Y1 + 9 + 8 + 7 + Y10,32 + Z3 + Y1 + 9 + 8 + 7 + Y9,
32 + Z2 + 3 + 1P + 1,32 + Z2 + 6 + 1P + 1,32 + Z2 + Y10,32 + Z2 + Y9,32 + Z2 + 11 + 3 + 1P + 1,32 + Z2 + 11 + 6 + 1P + 1,32 + Z2 + 11 + Y10,32 + Z2 + 11 + Y9,32 + Z2 + 11 + 10 + 3 + 1P + 1,32 + Z2 + 11 + 10 + 6 + 1P + 1,32 + Z2 + 11 + 10 + Y10,32 + Z2 + 11 + 10 + Y9,32 + Z2 + Y2 + 3 + 1P + 1,32 + Z2 + Y2 + 6 + 1P + 1,32 + Z2 + Y2 + Y10,32 + Z2 + Y2 + Y9,32 + Z2 + Y2 + Y6,32 + Z2 + Y2 + Y5,32 + Z2 + Y2 + 8 + Y10,32 + Z2 + Y2 + 8 + Y9,32 + Z2 + Y2 + 8 + Y8,32 + Z2 + Y2 + 8 + Y7,32 + Z2 + Y2 + 8 + 7 + Y10,32 + Z2 + Y + 8 + 7 + Y9,32 + Z2 + 12 + 3 + 1P + 1,32 + Z2 + 12 + 6 + 1P + 1,32 + Z2 + 12 + Y10,32 + Z2 + 12 + Y9,32 + Z2 + 12 + Y6,32 + Z2 + 12 + Y5,32 + Z2 + 12 + 8 + Y10,32 + Z2 + 12 + 8 + Y9,32 + Z2 + 12 + 8 + Y8,32 + Z2 + 12 + 8 + Y7,32 + Z2 + 12 + 8 + 7 + Y10,32 + Z2 + 12 + 8 + 7 + Y9,32 + Z2 + 12 + 11 + 3 + 1P + 1,32 + Z2 + 12 + 11 + 6 + 1P + 1,32 + Z2 + 12 +
11 + Y10,32 + Z2 + 12 + 11 + Y9,32 + Z2 + Y1 + 3 + 1P + 1,32 + Z2 + Y1 + 6 + 1P + 1,32 + Z2 + Y1 + Y10,32 + Z2 + Y1 + Y9,32 + Z2 + Y1 + Y4,32 + Z2 + Y1 + Y3,32 + Z2 + Y1 + 9 + Y10,32 + Z2 + Y1 + 9 + Y9,32 + Z2 + Y1 + 9 + Y6,32 + Z2 + Y1 + 9 + Y5,32 + Z2 + Y1 + 9 + 8 + Y10,32 + Z2 + Y1 + 9 + 8 + Y9,32 + Z2 + Y1 + 9 + 8 + Y8,32 + Z2 + Y1 + 9 + 8 + Y7,32 + Z2 + Y1 + 9 + 8 + 7 + Y10,32 + Z2 + Y1 + 9 + 8 + 7 + Y9,
32 + Z1 + 3 + 1P + 1,32 + Z1 + 6 + 1P + 1,32 + Z1 + Y10,32 + Z1 + Y9,32 + Z1 + 11 + 3 + 1P + 1,32 + Z1 + 11 + 6 + 1P + 1,32 + Z1 + 11 + Y10,32 + Z1 + 11 + Y9,32 + Z1 + 11 + 10 + 3 + 1P + 1,32 + Z1 + 11 + 10 + 6 + 1P + 1,32 + Z1 + 11 + 10 + Y10,32 + Z1 + 11 + 10 + Y9,32 + Z1 + Y2 + 3 + 1P + 1,32 + Z1 + Y2 + 6 + 1P + 1,32 + Z1 + Y2 + Y10,32 + Z1 + Y2 + Y9,32 + Z1 + Y2 + Y6,32 + Z1 + Y2 + Y5,32 + Z1 + Y2 + 8 + Y10,32 + Z1 + Y2 + 8 + Y9,32 + Z1 + Y2 + 8 + Y8,32 + Z1 + Y2 + 8 + Y7,32 + Z1 + Y2 + 8 + 7 + Y10,32 + Z1 + Y + 8 + 7 + Y9,32 + Z1 + 12 + 3 + 1P + 1,32 + Z1 + 12 + 6 + 1P + 1,32 + Z1 + 12 + Y10,32 + Z1 + 12 + Y9,32 + Z1 + 12 + Y6,32 + Z1 + 12 + Y5,32 + Z1 + 12 + 8 + Y10,32 + Z1 + 12 + 8 + Y9,32 + Z1 + 12 + 8 + Y8,32 + Z1 + 12 + 8 + Y7,32 + Z1 + 12 + 8 + 7 + Y10,32 + Z1 + 12 + 8 + 7 + Y9,32 + Z1 + 12 + 11 + 3 + 1P + 1,32 + Z1 + 12 + 11 + 6 + 1P + 1,32 + Z1 + 12 + 11 + Y10,32 + Z1 + 12 + 11 + Y9,32 + Z1 + Y1 + 3 + 1P + 1,32 + Z1 + Y1 + 6 + 1P + 1,32 + Z1 + Y1 + Y10,32 + Z1 + Y1 + Y9,32 + Z1 + Y1 + Y4,32 + Z1 + Y1 + Y3,32 + 1 + Y1 + 9 + Y10,32 + Z1 + Y1 + 9 + Y9,32 + Z1 + Y1 + 9 + Y6,32 + Z1 + Y1 + 9 + Y5,32 + Z1 + Y1 + 9 + 8 + Y10,32 + Z1 + Y1 + 9 + 8 + Y9,32 + Z1 + Y1 + 9 + 8 + Y8,32 + Z1 + Y1 + 9 + 8 + Y7,32 + Z1 + Y1 + 9 + 8 + 7 + Y10,32 + Z1 + Y1 + 9 + 8 + 7 + Y9,
32 + 20 + 17 + 13 + 3 + 1P + 1,32 + 20 + 17 + 13 + 6 + 1P + 1,32 + 20 + 17 + 13 + Y10,32 + 20 + 17 + 13 + Y9,32 + 20 + Z7 + 3 + 1P + 1,32 + 20 + Z7 + 6 + 1P + 1,32 + 20 + Z7 + Y10,32 + 20 + Z7 + Y9,32 + 20 + Z7 + 10 + 3 + 1P + 1,32 + 20 + Z7 + 10 + 6 + 1P + 1,32 + 20 + Z7 + 10 + Y10,32 + 20 + Z7 + 10 + Y9,32 + 20 + 17 + 13 + Y2 + 3 + 1P + 1,32 + 20 + 17 + 13 + Y2 + 6 + 1P + 1,32 + 20 + 17 + 13 + Y2 + Y10,32 + 20 + 17 + 13 + Y2 + Y9,32 + 20 + 17 + 13 + Y2 + Y6,32 + 20 + 17 + 13 + Y2 + Y5,32 + 20 + 17 + 13 + Y2 + 8 + Y10, 2 + 20 + 17 + 13 + Y2 + 8 + Y9,32 + 20 + 17 + 13 + Y2 + 8 + Y8,32 + 20 + 17 + 13 + Y2 + 8 + Y7,32 + 20 + 17 + 13 + Y2 + 8 + 7 + Y10,32 + 20 + 17 + 13 + Y2 + 8 + 7 + Y9,
32 + 20 + Z6 + 3 + 1P + 1,32 + 20 + Z6 + 6 + 1P + 1,32 + 20 + Z6 + Y10,32 + 20 + Z6 + Y9,32 + 20 + Z6 + Y6,32 + 20 + Z6 + Y5,32 + 20 + Z6 + 8 + Y10,32 + 20 + Z6 + 8 + Y9,32 + 20 + Z6 + 8 + Y8,32 + 20 + Z6 + 8 + Y7,32 + 20 + Z6 + 8 + 7 + Y10,32 + 20 + Z6 + 8 + 7 + Y9,32 + 20 + Z6 + 11 + 3 + 1P + 1,32 + 20 + Z6 + 11 + 6 + 1P + 1,32 + 20 + Z6 + 11 + Y10,32 + 20 + Z6 + 11 + Y9,32 + 20 + 17 + 13 + Y1 + 3 + 1P + 1,32 + 20 + 17 + 13 + Y1 + 6 + 1P + 1,32 + 20 + 17 + 13 + Y1 + Y10,32 + 20 + 17 + 13 + Y1 + Y9,32 + 20 + 17 + 13 + 1 + Y4,32 + 20 + 17 + 13 + Y1 + Y3,32 + 20 + 17 + 13 + Y1 + 9 + Y10,32 + 20 + 17 + 13 + Y1 + 9 + Y9,32 + 20 + 17 + 13 + Y1 + 9 + Y6,32 + 20 + 17 + 13 + Y1 + 9 + Y5,32
+ 20 + 17 + 13 + Y1 + 9 + 8 + Y10, 32 + 20 + 17 + 13 + Y1 + 9 + 8 + Y9, 32 + 20 + 17 + 13 + Y1 + 9 + 8 + Y8, 32 + 20 + 17 + 13 + Y1 + 9 + 8 + Y7, 32 + 20 + 17 + 13 + Y1 + 9 + 8 + 7 + 9 + 13 + 20 + 17 + 9 + 7 + 17 +
32 + 20 + Z5 + 3 + 1P + 1,32 + 20 + Z5 + 6 + 1P + 1,32 + 20 + Z5 + Y10,32 + 20 + Z5 + Y9,32 + 20 + Z5 + 11 + 3 + 1P + 1,32 + 20 + Z5 + 11 + 6 + 1P + 1,32 + 20 + Z5 + 11 + Y10,32 + 20 + Z5 + 11 + Y9,32 + 20 + Z5 + 11 + 10 + 3 + 1P + 1,32 + 20 + Z5 + 11 + 10 + 6 + 1P + 1,32 + 20 + Z5 + 11 + 10 + Y10,32 + 20 + Z5 + 11 + 10 + Y9,32 + 20 + Z5 + Y2 + 3 + 1P + 1,32 + 20 + Z5 + Y2 + 6 + 1P + 1,32 + 20 + Z5 + Y2 + Y10,32 + 20 + Z5 + Y2 + Y9,32 + 20 + Z5 + Y2 + Y6,32 + 20 + Z5 + Y2 + Y5,32 + 20 + Z5 + Y2 + 8 + Y10,32 + 20 + Z5 + 2 + 8 + Y9,32 + 20 + Z5 + Y2 + 8 + Y8,32 + 20 + Z5 + Y2 + 8 + Y7,32 + 20 + Z5 + Y2 + 8 + 7 + Y10,32 + 20 + Z5 + Y2 + 8 + 7 + Y9,32 + 20 + Z5 + 12 + 3 + 1P + 1,32 + 20 + Z5 + 12 + 6 + 1P + 1,32 + 20 + Z5 + 12 + Y10,32 + 20 + Z5 + 12 + Y9,32 + 20 + Z5 + 12 + Y6,32 + 20 + Z5 + 12 + Y5,32 + 20 + Z5 + 12 + 8 + Y10,32 + 20 + Z5 + 12 + 8 + Y9,32 + 20 + Z5 + 12 + 8 + Y8,32 + 20 + Z5 + 12 + 8 + Y7,32 + 20 + Z5 + 12 + 8 + 7 + Y10,32 + 20 + Z5 + 12 + 8 + 7 + Y9,32 + 20 + Z5 + 12 + 11 + 3 + 1P + 1,32 + 20 + Z5 + 12 + 11 + 6 + 1P + 1,3 + 20 + Z5 + 12 + 11 + Y10,32 + 20 + Z5 + 12 + 11 + Y9,32 + 20 + Z5 + Y1 + 3 + 1P + 1,32 + 20 + Z5 + Y1 + 6 + 1P + 1,32 + 20 + Z5 + Y1 + Y10,32 + 20 + Z5 + Y1 + Y9,32 + 20 + Z5 + Y1 + Y4,32 + 20 + Z5 + Y1 + Y3,32 + 20 + Z5 + Y1 + 9 + Y10,32 + 20 + Z5 + Y1 + 9 + Y9,32 + 20 + Z5 + Y1 + 9 + Y6,32 + 20 + Z5 + Y1 + 9 + Y5,32 + 20 + Z5 + Y1 + 9 + 8 + Y10,32 + 20 + Z5 + Y1 + 9 + 8 + Y9,32 + 20 + Z5 + Y1 + 9 + 8 + Y8,32 + 20 + Z5 + Y1 + 9 + 8 + Y7,32 + 20 + Z5 + Y1 + 9 + 8 + 7 + Y10,32 + 20 + Z5 + Y1 + 9 + 8 + 7 + Y9,
32 + 20 + 18 + 17 + 13 + 3 + 1P + 1,32 + 20 + 18 + 17 + 13 + 6 + 1P + 1,32 + 20 + 18 + 17 + 13 + Y10,32 + 20 + 18 + 17 + 13 + Y9,32 + 20 + 18 + Z7 + 3 + 1P + 1,32 + 20 + 18 + Z7 + 6 + 1P + 1,32 + 20 + 18 + Z7 + Y10,32 + 20 + 18 + Z7 + Y9,32 + 20 + 18 + Z7 + 10 + 3 + 1P + 1,32 + 20 + 18 + Z7 + 10 + 6 + 1P + 1,32 + 20 + 18 + Z7 + 10 + Y10,32 + 20 + 18 + Z7 + 10 + Y9,32 + 20 + 18 + 17 + 13 + Y2 + 3 + 1P + 1,32 + 20 + 18 + 17 + 13 + Y2 + 6 + 1P + 1,32 + 20 + 18 + 17 + 13 + Y2 + Y10,32 + 20 + 18 + 17 + 13 + Y2 + Y9,32 + 20 + 18 + 7 + 13 + Y2 + Y6,32 + 20 + 18 + 17 + 13 + Y2 + Y5,32 + 20 + 18 + 17 + 13 + Y2 + 8 + Y10,32 + 20 + 18 + 17 + 13 + Y2 + 8 + Y9,32 + 20 + 18 + 17 + 13 + Y2 + 8 + Y8,32 + 20 + 18 + 17 + 13 + Y2 + 8 + Y7,32 + 20 + 18 + 17 + 13 + Y2 + 8 + 7 + Y10,32 + 20 + 18 + 17 + 13 + Y2 + 8 + 7 + Y9,32 + 20 + 18 + Z6 + 3 + 1P + 1,32 + 20 + 18 + Z6 + 6 + 1P + 1,32 + 20 + 18 + Z6 + Y10,32 + 20 + 18 + Z6 + Y9,32 + 20 + 18 + Z6 + Y6,32 + 20 + 18 + Z6 + Y5,32 + 20 + 18 + Z6 + 8 + Y10,32 + 20 + 18 + Z6 + 8 + Y9,32 + 20 + 18 + Z6 + 8 + Y8,32 + 20 18 + Z6 + 8 + Y7,32 + 20 + 18 + Z6 + 8 + 7 + Y10,32 + 20 + 18 + Z6 + 8 + 7 + Y9,32 + 20 + 18 + Z6 + 11 + 3 + 1P + 1,32 + 20 + 18 + Z6 + 11 + 6 + 1P + 1,32 + 20 + 18 + Z6 + 11 + Y10,32 + 20 + 18 + Z6 + 11 + Y9,
32 + 20 + 18 + 17 + 13 + Y1 + 3 + 1P + 1, 32 + 20 + 18 + 17 + 13 +
Y1 + 6 + 1P + 1,32 + 20 + 18 + 17 + 13 + Y1 + Y10,32 + 20 + 18 + 17 + 13 + Y1 + Y9,32 + 20 + 18 + 17 + 13 + Y1 + Y4,32 + 20 + 18 + 17 + 13 + Y1 + Y3,32 + 20 + 18 + 17 + 13 + Y1 + 9 + Y10,32 + 20 + 18 + 17 + 13 + Y1 + 9 + Y9,32 + 20 + 18 + 17 + 13 + Y1 + 9 + Y6,32 + 20 + 18 + 17 + 13 + Y1 + 9 + Y5,32 + 20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y10,32 + 20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y9,32 + 20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y8,32 + 20 + 18 + 17 + 13 + Y1 + 9 + 8 + Y7,32 + 20 + 18 + 17 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 20 + 18 + 17 + 13 + Y + 9 + 8 + 7 + Y9,
32 + 22 + 13 + 3 + 1P + 1,32 + 22 + 13 + 6 + 1P + 1,32 + 22 + 13 + Y10,32 + 22 + 13 + Y9,32 + 22 + 13 + 11 + 3 + 1P + 1,32 + 22 + 13 + 11 + 6 + 1P + 1,32 + 22 + 13 + 11 + Y10,32 + 22 + 13 + 11 + Y9,32 + 22 + 13 + 11 + 10 + 3 + 1P + 1,32 + 22 + 13 + 11 + 10 + 6 + 1P + 1,32 + 22 + 13 + 11 + 10 + Y10,32 + 22 + 13 + 11 + 10 + Y9,32 + 22 + 13 + Y2 + 3 + 1P + 1,32 + 22 + 13 + Y2 + 6 + 1P + 1,32 + 22 + 13 + Y2 + Y10,32 + 22 + 13 + Y2 + Y9,32 + 22 + 13 + Y2 + Y6,32 + 22 + 13 + Y2 + Y5,32 + 22 + 13 + Y2 + 8 + Y10,32 + 22 + 13 + 2 + 8 + Y9,32 + 22 + 13 + Y2 + 8 + Y8,32 + 22 + 13 + Y2 + 8 + Y7,32 + 22 + 13 + Y2 + 8 + 7 + Y10,32 + 22 + 13 + Y2 + 8 + 7 + Y9,32 + 22 + 13 + 12 + 3 + 1P + 1,32 + 22 + 13 + 12 + 6 + 1P + 1,32 + 22 + 13 + 12 + Y10,32 + 22 + 13 + 12 + Y9,32 + 22 + 13 + 12 + Y6,32 + 22 + 13 + 12 + Y5,32 + 22 + 13 + 12 + 8 + Y10,32 + 22 + 13 + 12 + 8 + Y9,32 + 22 + 13 + 12 + 8 + Y8,32 + 22 + 13 + 12 + 8 + Y7,32 + 22 + 13 + 12 + 8 + 7 + Y10,32 + 22 + 13 + 12 + 8 + 7 + Y9,32 + 22 + 13 + 12 + 11 + 3 + 1P + 1,32 + 22 + 13 + 12 + 11 + 6 + 1P + 1,3 + 22 + 13 + 12 + 11 + Y10,32 + 22 + 13 + 12 + 11 + Y9,32 + 22 + 13 + Y1 + 3 + 1P + 1,32 + 22 + 13 + Y1 + 6 + 1P + 1,32 + 22 + 13 + Y1 + Y10,32 + 22 + 13 + Y1 + Y9,32 + 22 + 13 + Y1 + Y4,32 + 22 + 13 + Y1 + Y3,32 + 22 + 13 + Y1 + 9 + Y10,32 + 22 + 13 + Y1 + 9 + Y9,32 + 22 + 13 + Y1 + 9 + Y6,32 + 22 + 13 + Y1 + 9 + Y5,32 + 22 + 13 + Y1 + 9 + 8 + Y10,32 + 22 + 13 + Y1 + 9 + 8 + Y9,32 + 22 + 13 + Y1 + 9 + 8 + Y8,32 + 22 + 13 + Y1 + 9 + 8 + Y7,32 + 22 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 22 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 23 + 13 + 3 + 1P + 1,32 + 23 + 13 + 6 + 1P + 1,32 + 23 + 13 + Y10,32 + 23 + 13 + Y9,32 + 23 + 13 + 11 + 3 + 1P + 1,32 + 23 + 13 + 11 + 6 + 1P + 1,32 + 23 + 13 + 11 + Y10,32 + 23 + 13 + 11 + Y9,32 + 23 + 13 + 11 + 10 + 3 + 1P + 1,32 + 23 + 13 + 11 + 10 + 6 + 1P + 1,32 + 23 + 13 + 11 + 10 + Y10,32 + 23 + 13 + 11 + 10 + Y9,32 + 23 + 13 + Y2 + 3 + 1P + 1,32 + 23 + 13 + Y2 + 6 + 1P + 1,32 + 23 + 13 + Y2 + Y10,32 + 23 + 13 + Y2 + Y9,32 + 23 + 13 + Y2 + Y6,32 + 23 + 13 + Y2 + Y5,32 + 23 + 13 + Y2 + 8 + Y10,32 + 23 + 13 + 2 + 8 + Y9,32 + 23 + 13 + Y2 + 8 + Y8,32 + 23 + 13 + Y2 + 8 + Y7,32 + 23 + 13 + Y2 + 8 + 7 + Y10,32 + 23 + 13 + Y2 + 8 + 7 + Y9,32 + 23 + 13 + 12 + 3 + 1P + 1,32 + 23 + 13 + 12 + 6 + 1P + 1,32 + 23 + 13 + 12 + Y10,32 + 23 + 13 + 12 + Y9,32 + 23 + 13 + 12 + Y6,32 + 23 + 13 + 12 + Y5,32 + 23 + 13 + 12 + 8 + Y10,32 + 23 + 13 + 12 + 8 + Y9,32 + 23 + 13 + 12 + 8 + Y8,32 + 23 + 13 + 12 + 8 + Y7,32 + 23 + 13 + 12 + 8 + 7 + Y10,32 + 23 + 13 + 12 + 8 + 7 + Y9,32 + 23 + 13 + 12 + 11 + 3 + 1P
+ 1,32 + 23 + 13 + 12 + 11 + 6 + 1P + 1,32 + 23 + 13 + 12 + 11 + Y10,32 + 23 + 13 + 12 + 11 + Y9,32 + 23 + 13 + Y1 + 3 + 1P + 1,32 + 23 + 13 + Y1 + 6 + 1P + 1,32 + 23 + 13 + Y1 + Y10,32 + 23 + 13 + Y1 + Y9,32 + 23 + 13 + Y1 + Y4,32 + 23 + 13 + Y1 + Y3,32 + 23 + 13 + Y1 + 9 + Y10,32 + 23 + 13 + Y1 + 9 + Y9,32 + 23 + 13 + Y1 + 9 + Y6,32 + 23 + 13 + Y1 + 9 + Y5,32 + 23 + 13 + Y1 + 9 + 8 + Y10,32 + 23 + 13 + Y1 + 9 + 8 + Y9,32 + 23 + 13 + Y1 + 9 + 8 + Y8,32 + 23 + 13 + Y1 + 9 + 8 + Y7,32 + 23 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 2 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 24 + 13 + 3 + 1P + 1,32 + 24 + 13 + 6 + 1P + 1,32 + 24 + 13 + Y10,32 + 24 + 13 + Y9,32 + 24 + 13 + 11 + 3 + 1P + 1,32 + 24 + 13 + 11 + 6 + 1P + 1,32 + 24 + 13 + 11 + Y10,32 + 24 + 13 + 11 + Y9,32 + 24 + 13 + 11 + 10 + 3 + 1P + 1,32 + 24 + 13 + 11 + 10 + 6 + 1P + 1,32 + 24 + 13 + 11 + 10 + Y10,32 + 24 + 13 + 11 + 10 + Y9,32 + 24 + 13 + Y2 + 3 + 1P + 1,32 + 24 + 13 + Y2 + 6 + 1P + 1,32 + 24 + 13 + Y2 + Y10,32 + 24 + 13 + Y2 + Y9,32 + 24 + 13 + Y2 + Y6,32 + 24 + 13 + Y2 + Y5,32 + 24 + 13 + Y2 + 8 + Y10,32 + 24 + 13 + 2 + 8 + Y9,32 + 24 + 13 + Y2 + 8 + Y8,32 + 24 + 13 + Y2 + 8 + Y7,32 + 24 + 13 + Y2 + 8 + 7 + Y10,32 + 24 + 13 + Y2 + 8 + 7 + Y9,32 + 24 + 13 + 12 + 3 + 1P + 1,32 + 24 + 13 + 12 + 6 + 1P + 1,32 + 24 + 13 + 12 + Y10,32 + 24 + 13 + 12 + Y9,32 + 24 + 13 + 12 + Y6,32 + 24 + 13 + 12 + Y5,32 + 24 + 13 + 12 + 8 + Y10,32 + 24 + 13 + 12 + 8 + Y9,32 + 24 + 13 + 12 + 8 + Y8,32 + 24 + 13 + 12 + 8 + Y7,32 + 24 + 13 + 12 + 8 + 7 + Y10,32 + 24 + 13 + 12 + 8 + 7 + Y9,32 + 24 + 13 + 12 + 11 + 3 + 1P + 1,32 + 24 + 13 + 12 + 11 + 6 + 1P + 1,3 + 24 + 13 + 12 + 11 + Y10,32 + 24 + 13 + 12 + 11 + Y9,32 + 24 + 13 + Y1 + 3 + 1P + 1,32 + 24 + 13 + Y1 + 6 + 1P + 1,32 + 24 + 13 + Y1 + Y10,32 + 24 + 13 + Y1 + Y9,32 + 24 + 13 + Y1 + Y4,32 + 24 + 13 + Y1 + Y3,32 + 24 + 13 + Y1 + 9 + Y10,32 + 24 + 13 + Y1 + 9 + Y9,32 + 24 + 13 + Y1 + 9 + Y6,32 + 24 + 13 + Y1 + 9 + Y5,32 + 24 + 13 + Y1 + 9 + 8 + Y10,32 + 24 + 13 + Y1 + 9 + 8 + Y9,32 + 24 + 13 + Y1 + 9 + 8 + Y8,32 + 24 + 13 + Y1 + 9 + 8 + Y7,32 + 24 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 24 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 24 + 17 + 13 + 3 + 1P + 1,32 + 24 + 17 + 13 + 6 + 1,32 + 24 + 17 + 13 + Y10,32 + 24 + 17 + 13 + Y9,32 + 24 + Z7 + 3 + 1P + 1,32 + 24 + Z7 + 6 + 1P + 1,32 + 24 + Z7 + Y10,32 + 24 + Z7 + Y9,32 + 24 + Z7 + 10 + 3 + 1P + 1,32 + 24 + Z7 + 10 + 6 + 1P + 1,32 + 24 + Z7 + 10 + Y10,32 + 24 + Z7 + 10 + Y9,32 + 24 + 17 + 13 + Y2 + 3 + 1P + 1,32 + 24 + 17 + 13 + Y2 + 6 + 1P + 1,32 + 24 + 17 + 13 + Y2 + Y10,32 + 24 + 17 + 13 + Y2 + Y9,32 + 24 + 17 + 13 + Y2 + Y6,32 + 24 + 17 + 13 + Y2 + Y5,32 + 24 + 17 + 13 + Y2 + 8 + Y10,32 + 4 + 17 + 13 + Y2 + 8 + Y9,32 + 24 + 17 + 13 + Y2 + 8 + Y8,32 + 24 + 17 + 13 + Y2 + 8 + Y7,32 + 24 + 17 + 13 + Y2 + 8 + 7 + Y10,32 + 24 + 17 + 13 + Y2 + 8 + 7 + Y9,32 + 24 + Z6 + 3 + 1P + 1,32 + 24 + Z6 + 6 + 1P + 1,32 + 24 + Z6 + Y10,32 + 24 + Z6 + Y9,32 + 24 + Z6 + Y6,32 + 24 + Z6 + Y5,32 + 24 + Z6 + 8 + Y10,32 + 24 + Z6 + 8 + Y9,32 + 24 + Z6 + 8 + Y8,32 + 24 + Z6 + 8 + Y7,32 + 24 + Z6 + 8 + 7 + Y10,32 + 24 + Z6 + 8 + 7 + Y9,32 + 24 + Z6 + 11 + 3 + 1P + 1,32 + 24 + Z6 + 11 + 6 + 1
P + 1,32 + 24 + Z6 + 11 + Y10,32 + 24 + Z6 + 11 + Y9,32 + 24 + 17 + 13 + Y1 + 3 + 1P + 1,32 + 24 + 17 + 13 + Y1 + 6 + 1P + 1,32 + 24 + 17 + 13 + Y1 + Y10,32 + 24 + 17 + 13 + Y1 + Y9,32 + 24 + 17 + 13 + Y1 + Y4,32 + 24 + 17 + 13 + Y1 + Y3,32 + 24 + 17 + 13 + Y1 + 9 + Y10,32 + 24 + 17 + 13 + Y1 + 9 + Y9,32 + 24 + 17 + 13 + Y1 + 9 + Y6,32 + 24 + 17 + 13 + Y1 + 9 + Y5,32 + 24 + 17 + 13 + Y1 + 9 + 8 + Y10,32 + 24 + 17 + 13 + Y1 + 9 + 8 + Y9,32 + 24 + 17 + 13 + Y1 + 9 + 8 + Y8,32 + 24 + 17 + 13 + Y1 + 9 + 8 + Y7,32 + 24 + 17 + 13 Y1 + 9 + 8 + 7 + Y10,32 + 24 + 17 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 25 + 13 + 3 + 1P + 1,32 + 25 + 13 + 6 + 1P + 1,32 + 25 + 13 + Y10,32 + 25 + 13 + Y9,32 + 25 + 13 + 11 + 3 + 1P + 1,32 + 25 + 13 + 11 + 6 + 1P + 1,32 + 25 + 13 + 11 + Y10,32 + 25 + 13 + 11 + Y9,32 + 25 + 13 + 11 + 10 + 3 + 1P + 1,32 + 25 + 13 + 11 + 10 + 6 + 1P + 1,32 + 25 + 13 + 11 + 10 + Y10,32 + 25 + 13 + 11 + 10 + Y9,32 + 25 + 13 + Y2 + 3 + 1P + 1,32 + 25 + 13 + Y2 + 6 + 1P + 1,32 + 25 + 13 + Y2 + Y10,32 + 25 + 13 + Y2 + Y9,32 + 25 + 13 + Y2 + Y6,32 + 25 + 13 + Y2 + Y5,32 + 25 + 13 + Y2 + 8 + Y10,32 + 25 + 13 + 2 + 8 + Y9,32 + 25 + 13 + Y2 + 8 + Y8,32 + 25 + 13 + Y2 + 8 + Y7,32 + 25 + 13 + Y2 + 8 + 7 + Y10,32 + 25 + 13 + Y2 + 8 + 7 + Y9,32 + 25 + 13 + 12 + 3 + 1P + 1,32 + 25 + 13 + 12 + 6 + 1P + 1,32 + 25 + 13 + 12 + Y10,32 + 25 + 13 + 12 + Y9,32 + 25 + 13 + 12 + Y6,32 + 25 + 13 + 12 + Y5,32 + 25 + 13 + 12 + 8 + Y10,32 + 25 + 13 + 12 + 8 + Y9,32 + 25 + 13 + 12 + 8 + Y8,32 + 25 + 13 + 12 + 8 + Y7,32 + 25 + 13 + 12 + 8 + 7 + Y10,32 + 25 + 13 + 12 + 8 + 7 + Y9,32 + 25 + 13 + 12 + 11 + 3 + 1P + 1,32 + 25 + 13 + 12 + 11 + 6 + 1P + 1,3 + 25 + 13 + 12 + 11 + Y10,32 + 25 + 13 + 12 + 11 + Y9,32 + 25 + 13 + Y1 + 3 + 1P + 1,32 + 25 + 13 + Y1 + 6 + 1P + 1,32 + 25 + 13 + Y1 + Y10,32 + 25 + 13 + Y1 + Y9,32 + 25 + 13 + Y1 + Y4,32 + 25 + 13 + Y1 + Y3,32 + 25 + 13 + Y1 + 9 + Y10,32 + 25 + 13 + Y1 + 9 + Y9,32 + 25 + 13 + Y1 + 9 + Y6,32 + 25 + 13 + Y1 + 9 + Y5,32 + 25 + 13 + Y1 + 9 + 8 + Y10,32 + 25 + 13 + Y1 + 9 + 8 + Y9,32 + 25 + 13 + Y1 + 9 + 8 + Y8,32 + 25 + 13 + Y1 + 9 + 8 + Y7,32 + 25 + 13 + Y1 + 9 + 8 + 7 + Y10,32 + 25 + 13 + Y1 + 9 + 8 + 7 + Y9,
32 + 25 + Z4 + 3 + 1P + 1,32 + 25 + Z4 + 6 + 1P + 1,32 + 25 + Z4 + Y10,32 + 25 + Z4 + Y9,32 + 25 + Z4 + 11 + 3 + 1P + 1,32 + 25 + Z4 + 11 + 6 + 1P + 1,32 + 25 + Z4 + 11 + Y10,32 + 25 + Z4 + 11 + Y9,32 + 25 + Z4 + 11 + 10 + 3 + 1P + 1,32 + 25 + Z4 + 11 + 10 + 6 + 1P + 1,32 + 25 + Z4 + 11 + 10 + Y10,32 + 25 + Z4 + 11 + 10 + Y9,32 + 25 + Z4 + Y2 + 3 + 1P + 1,32 + 25 + Z4 + Y2 + 6 + 1P + 1,32 + 25 + Z4 + Y2 + Y10,32 + 25 + Z4 + Y2 + Y9,32 + 25 + Z4 + Y2 + Y6,32 + 25 + Z4 + Y2 + Y5,32 + 25 + Z4 + Y2 + 8 + Y10,32 + 25 + Z4 + 2 + 8 + Y9,32 + 25 + Z4 + Y2 + 8 + Y8,32 + 25 + Z4 + Y2 + 8 + Y7,32 + 25 + Z4 + Y2 + 8 + 7 + Y10,32 + 25 + Z4 + Y2 + 8 + 7 + Y9,32 + 25 + Z4 + 12 + 3 + 1P + 1,32 + 25 + Z4 + 12 + 6 + 1P + 1,32 + 25 + Z4 + 12 + Y10,32 + 25 + Z4 + 12 + Y9,32 + 25 + Z4 + 12 + Y6,32 + 25 + Z4 + 12 + Y5,32 + 25 + Z4 + 12 + 8 + Y10,32 + 25 + Z4 + 12 + 8 + Y9,32 + 25 + Z4 + 12 + 8 + Y8,32 + 25 + Z4 + 12 + 8 + Y7,32 + 25 + Z4 + 12 + 8 + 7 + Y1
0,32 + 25 + Z4 + 12 + 8 + 7 + Y9,32 + 25 + Z4 + 12 + 11 + 3 + 1P + 1,32 + 25 + Z4 + 12 + 11 + 6 + 1P + 1,32 + 25 + Z4 + 12 + 11 + Y10,32 + 25 + Z4 + 12 + 11 + Y9,32 + 25 + Z4 + Y1 + 3 + 1P + 1,32 + 25 + Z4 + Y1 + 6 + 1P + 1,32 + 25 + Z4 + Y1 + Y10,32 + 25 + Z4 + Y1 + Y9,32 + 25 + Z4 + Y1 + Y4,32 + 25 + Z4 + Y1 + Y3,32 + 25 + Z4 + Y1 + 9 + Y10,32 + 25 + Z4 + Y1 + 9 + Y9,32 + 25 + Z4 + Y1 + 9 + Y6,32 + 25 + Z4 + Y1 + 9 + Y5,32 + 25 + Z4 + Y1 + 9 + 8 + Y10,32 + 25 + Z4 + Y1 + 9 + 8 + Y9,32 + 25 + Z4 + Y1 + 9 + 8 + Y8,32 + 25 Z4 + Y1 + 9 + 8 + Y7,32 + 25 + Z4 + Y1 + 9 + 8 + 7 + Y10,32 + 25 + Z4 + Y1 + 9 + 8 + 7 + Y9,
32 + 25 + Z3 + 3 + 1P + 1,32 + 25 + Z3 + 6 + 1P + 1,32 + 25 + Z3 + Y10,32 + 25 + Z3 + Y9,32 + 25 + Z3 + 11 + 3 + 1P + 1,32 + 25 + Z3 + 11 + 6 + 1P + 1,32 + 25 + Z3 + 11 + Y10,32 + 25 + Z3 + 11 + Y9,32 + 25 + Z3 + 11 + 10 + 3 + 1P + 1,32 + 25 + Z3 + 11 + 10 + 6 + 1P + 1,32 + 25 + Z3 + 11 + 10 + Y10,32 + 25 + Z3 + 11 + 10 + Y9,32 + 25 + Z3 + Y2 + 3 + 1P + 1,32 + 25 + Z3 + Y2 + 6 + 1P + 1,32 + 25 + Z3 + Y2 + Y10,32 + 25 + Z3 + Y2 + Y9,32 + 25 + Z3 + Y2 + Y6,32 + 25 + Z3 + Y2 + Y5,32 + 25 + Z3 + Y2 + 8 + Y10,32 + 25 + Z3 + 2 + 8 + Y9,32 + 25 + Z3 + Y2 + 8 + Y8,32 + 25 + Z3 + Y2 + 8 + Y7,32 + 25 + Z3 + Y2 + 8 + 7 + Y10,32 + 25 + Z3 + Y2 + 8 + 7 + Y9,32 + 25 + Z3 + 12 + 3 + 1P + 1,32 + 25 + Z3 + 12 + 6 + 1P + 1,32 + 25 + Z3 + 12 + Y10,32 + 25 + Z3 + 12 + Y9,32 + 25 + Z3 + 12 + Y6,32 + 25 + Z3 + 12 + Y5,32 + 25 + Z3 + 12 + 8 + Y10,32 + 25 + Z3 + 12 + 8 + Y9,32 + 25 + Z3 + 12 + 8 + Y8,32 + 25 + Z3 + 12 + 8 + Y7,32 + 25 + Z3 + 12 + 8 + 7 + Y10,32 + 25 + Z3 + 12 + 8 + 7 + Y9,32 + 25 + Z3 + 12 + 11 + 3 + 1P + 1,32 + 25 + Z3 + 12 + 11 + 6 + 1P + 1,3 + 25 + Z3 + 12 + 11 + Y10,32 + 25 + Z3 + 12 + 11 + Y9,32 + 25 + Z3 + Y1 + 3 + 1P + 1,32 + 25 + Z3 + Y1 + 6 + 1P + 1,32 + 25 + Z3 + Y1 + Y10,32 + 25 + Z3 + Y1 + Y9,32 + 25 + Z3 + Y1 + Y4,32 + 25 + Z3 + Y1 + Y3,32 + 25 + Z3 + Y1 + 9 + Y10,32 + 25 + Z3 + Y1 + 9 + Y9,32 + 25 + Z3 + Y1 + 9 + Y6,32 + 25 + Z3 + Y1 + 9 + Y5,32 + 25 + Z3 + Y1 + 9 + 8 + Y10,32 + 25 + Z3 + Y1 + 9 + 8 + Y9,32 + 25 + Z3 + Y1 + 9 + 8 + Y8,32 + 25 + Z3 + Y1 + 9 + 8 + Y7,32 + 25 + Z3 + Y1 + 9 + 8 + 7 + Y10,32 + 25 + Z3 + Y1 + 9 + 8 + 7 + Y9,
32 + 25 + Z2 + 3 + 1P + 1,32 + 25 + Z2 + 6 + 1P + 1,32 + 25 + Z2 + Y10,32 + 25 + Z2 + Y9,32 + 25 + Z2 + 11 + 3 + 1P + 1,32 + 25 + Z2 + 11 + 6 + 1P + 1,32 + 25 + Z2 + 11 + Y10,32 + 25 + Z2 + 11 + Y9,32 + 25 + Z2 + 11 + 10 + 3 + 1P + 1,32 + 25 + Z2 + 11 + 10 + 6 + 1P + 1,32 + 25 + Z2 + 11 + 10 + Y10,32 + 25 + Z2 + 11 + 10 + Y9,32 + 25 + Z2 + Y2 + 3 + 1P + 1,32 + 25 + Z2 + Y2 + 6 + 1P + 1,32 + 25 + Z2 + Y2 + Y10,32 + 25 + Z2 + Y2 + Y9,32 + 25 + Z2 + Y2 + Y6,32 + 25 + Z2 + Y2 + Y5,32 + 25 + Z2 + Y2 + 8 + Y10,32 + 25 + Z2 + 2 + 8 + Y9,32 + 25 + Z2 + Y2 + 8 + Y8,32 + 25 + Z2 + Y2 + 8 + Y7,32 + 25 + Z2 + Y2 + 8 + 7 + Y10,32 + 25 + Z2 + Y2 + 8 + 7 + Y9,32 + 25 + Z2 + 12 + 3 + 1P + 1,32 + 25 + Z2 + 12 + 6 + 1P + 1,32 + 25 + Z2 + 12 + Y10,32 + 25 + Z2 + 12 + Y9,32 + 25 + Z2 + 12 + Y6,32 + 25 + Z2 + 12 + Y5,32 + 25 + Z2 + 12 + 8 + Y10,32 + 25 + Z2 + 12 + 8 + Y9,32 + 25 + Z2 + 12 + 8 + Y8,32 + 25 + Z2 + 12 + 8 + Y7,32 + 25 + Z2 + 12 + 8 + 7 + Y1
0,32 + 25 + Z2 + 12 + 8 + 7 + Y9,32 + 25 + Z2 + 12 + 11 + 3 + 1P + 1,32 + 25 + Z2 + 12 + 11 + 6 + 1P + 1,32 + 25 + Z2 + 12 + 11 + Y10,32 + 25 + Z2 + 12 + 11 + Y9,32 + 25 + Z2 + Y1 + 3 + 1P + 1,32 + 25 + Z2 + Y1 + 6 + 1P + 1,32 + 25 + Z2 + Y1 + Y10,32 + 25 + Z2 + Y1 + Y9,32 + 25 + Z2 + Y1 + Y4,32 + 25 + Z2 + Y1 + Y3,32 + 25 + Z2 + Y1 + 9 + Y10,32 + 25 + Z2 + Y1 + 9 + Y9,32 + 25 + Z2 + Y1 + 9 + Y6,32 + 25 + Z2 + Y1 + 9 + Y5,32 + 25 + Z2 + Y1 + 9 + 8 + Y10,32 + 25 + Z2 + Y1 + 9 + 8 + Y9,32 + 25 + Z2 + Y1 + 9 + 8 + Y8,32 + 25 Z2 + Y1 + 9 + 8 + Y7,32 + 25 + Z2 + Y1 + 9 + 8 + 7 + Y10,32 + 25 + Z2 + Y1 + 9 + 8 + 7 + Y9,
32 + 25 + Z1 + 3 + 1P + 1,32 + 25 + Z1 + 6 + 1P + 1,32 + 25 + Z1 + Y10,32 + 25 + Z1 + Y9,32 + 25 + Z1 + 11 + 3 + 1P + 1,32 + 25 + Z1 + 11 + 6 + 1P + 1,32 + 25 + Z1 + 11 + Y10,32 + 25 + Z1 + 11 + Y9,32 + 25 + Z1 + 11 + 10 + 3 + 1P + 1,32 + 25 + Z1 + 11 + 10 + 6 + 1P + 1,32 + 25 + Z1 + 11 + 10 + Y10,32 + 25 + Z1 + 11 + 10 + Y9,32 + 25 + Z1 + Y2 + 3 + 1P + 1,32 + 25 + Z1 + Y2 + 6 + 1P + 1,32 + 25 + Z1 + Y2 + Y10,32 + 25 + Z1 + Y2 + Y9,32 + 25 + Z1 + Y2 + Y6,32 + 25 + Z1 + Y2 + Y5,32 + 25 + Z1 + Y2 + 8 + Y10,32 + 25 + Z1 + 2 + 8 + Y9,32 + 25 + Z1 + Y2 + 8 + Y8,32 + 25 + Z1 + Y2 + 8 + Y7,32 + 25 + Z1 + Y2 + 8 + 7 + Y10,32 + 25 + Z1 + Y2 + 8 + 7 + Y9,32 + 25 + Z1 + 12 + 3 + 1P + 1,32 + 25 + Z1 + 12 + 6 + 1P + 1,32 + 25 + Z1 + 12 + Y10,32 + 25 + Z1 + 12 + Y9,32 + 25 + Z1 + 12 + Y6,32 + 25 + Z1 + 12 + Y5,32 + 25 + Z1 + 12 + 8 + Y10,32 + 25 + Z1 + 12 + 8 + Y9,32 + 25 + Z1 + 12 + 8 + Y8,32 + 25 + Z1 + 12 + 8 + Y7,32 + 25 + Z1 + 12 + 8 + 7 + Y10,32 + 25 + Z1 + 12 + 8 + 7 + Y9,32 + 25 + Z1 + 12 + 11 + 3 + 1P + 1,32 + 25 + Z1 + 12 + 11 + 6 + 1P + 1,3 + 25 + Z1 + 12 + 11 + Y10,32 + 25 + Z1 + 12 + 11 + Y9,32 + 25 + Z1 + Y1 + 3 + 1P + 1,32 + 25 + Z1 + Y1 + 6 + 1P + 1,32 + 25 + Z1 + Y1 + Y10,32 + 25 + Z1 + Y1 + Y9,32 + 25 + Z1 + Y1 + Y4,32 + 25 + Z1 + Y1 + Y3,32 + 25 + Z1 + Y1 + 9 + Y10,32 + 25 + Z1 + Y1 + 9 + Y9,32 + 25 + Z1 + Y1 + 9 + Y6,32 + 25 + Z1 + Y1 + 9 + Y5,32 + 25 + Z1 + Y1 + 9 + 8 + Y10,32 + 25 + Z1 + Y1 + 9 + 8 + Y9,32 + 25 + Z1 + Y1 + 9 + 8 + Y8,32 + 25 + Z1 + Y1 + 9 + 8 + Y7,32 + 25 + Z1 + Y1 + 9 + 8 + 7 + Y10,32 + 25 + Z1 + Y1 + 9 + 8 + 7 + Y9,33 + 5 + 1P + 1, 34 + 5 + 1P + 1, 35 + 5 + 1P + 1, 36 + 1P + 1,
37 + 1, 37 + 34 + 1, 37 + 35 + 1 and 38 + 37 + 1 and 38 + 37 + 34 + 1 and 38 + 37 + 35 + 1,39 + 37 + 1,39 + 37 + 34 + 1,39 + 37 + 35 + 1, 40 + 37 + 1, 40 + 37 + 34 + 1, 40 + 37 + 35 + 1 and 41 + 37 + 1 and 41 + 37 + 34 + 1 and 41 + 37 + 35 + 1 and 41 + 38 + 37 + 1 and 41 + 38 + 37 + 34 + 1 and 41 + 38 + 37 + 35 + 1 and 41 + 39 + 37 + 1 and 41 + 39 + 37 + 34 + 1 and 41 + 39 + 37 + 35 + 1 and 41 + 40 + 37 + 1 and 41 + 40 + 37 + 34 + 1 and 41 + 40 + 37 + 35 + 1, 42 + 37 + 1, 42 + 37 + 34 + 1, 42 + 37 + 35 + 1, 42 + 38 + 37 + 1, 42 + 38 + 37 + 34 + 1, 42 + 38 + 37 + 35 + 1, 42 + 39 + 7 + 1, 42 + 39 + 37 + 34 + 1, 42 + 39 + 37 + 35 + 1, 42 + 40 + 37 + 1, 42 + 40 + 37 + 34 + 1, 42 + 40 + 37 + 35 + 1, 42 + 41 + 37 + 1, 42 + 41 + 37 + 34 + 1, 42 + 41 + 37 + 35 + 1, 42 + 41 + 38 + 37 + 1, 42 + 41 + 38 + 37 + 34 + 1, 42 + 41 + 38 + 37 + 35 + 1, 42 + 41 + 39 + 37 + 1, 42 + 41 + 39 + 37 + 34 + 1, 42 + 41 + 39 + 37 + 35 + 1, 42 + 41 + 40 + 37 + 1, 42 + 41 +
40 + 37 + 34 + 1, 42 + 41 + 40 + 37 + 35 + 1,
43 + 37 + 1,43 + 37 + 34 + 1,43 + 37 + 35 + 1,43 + 38 + 37 + 1,43 + 38 + 37 + 34 + 1,43 + 38 + 37 + 35 + 1,43 + 39 + 37 + 1,43 + 39 + 37 + 34 + 1,43 + 39 + 37 + 35 + 1,43 + 40 + 37 + 1,43 + 40 + 37 + 34 + 1,43 + 40 + 37 + 35 + 1,43 + 41 + 37 + 1,43 + 41 + 37 + 34 + 1,43 + 41 + 37 + 35 + 1,43 + 41 + 38 + 37 + 1,43 + 41 + 38 + 37 + 34 + 1,43 + 41 + 38 + 37 + 35 + 1,43 + 41 + 39 + 37 + 1,43 + 41 + 39 + 37 + 34 + 1,43 + 41 + 39 + 37 + 35 + 1,43 + 41 + 40 + 37 + 1,43 + 41 + 40 + 37 + 34 + 1,43 + 41 + 40 + 37 + 35 + 1,44 + 7 + 1,44 + 37 + 34 + 1,44 + 37 + 35 + 1,44 + 38 + 37 + 1,44 + 38 + 37 + 34 + 1,44 + 38 + 37 + 35 + 1,44 + 39 + 37 + 1,44 + 39 + 37 + 34 + 1,44 + 39 + 37 + 35 + 1,44 + 41 + 37 + 1,44 + 41 + 37 + 34 + 1,44 + 41 + 37 + 35 + 1,44 + 41 + 38 + 37 + 1,44 + 41 + 38 + 37 + 34 + 1,44 + 41 + 38 + 37 + 35 + 1,44 + 41 + 39 + 37 + 1,44 + 41 + 39 + 37 + 34 + 1,44 + 41 + 39 + 37 + 35 + 1,45 + 1 out there.

The following abbreviations are used: Y1 means 12 + 11 + 10; Y2 means 11 + 10 + 9; Y3 means 9 + 6 + 1P + 1; Y4 means 9 + 3 + 1P + 1; Y5 means 8 + 6 + 1P + 1; Y6 means 8 + 3 + 1P + 1 Y7 means 7 + 6 + 1P + 1; Y8 means 7 + 3 + 1P + 1; Y9 means 6 + 4 + 1P + 1; Y10 means 6 + 3 + 1P + 1; Z1 means 19 + 18 + 17 + 13; Z2 means 19 + 18 + 15 + 13; Z3 means 19 + 17 + 13; Z4 means 19 + 15 + 13; Z5 means 18 + 15 + 13; Z6 means 17 + 13 + 12; Z7 means 17 + 13 + 11; Z8 means 15 + 13 + 12;
The above list is made possible on the basis of the dependencies of aspects 1) to 45) disclosed above and is not to be construed as a limitation on the further aspects intended. In the above table, the numbers mean the modes corresponding to the above numbers, and “+” represents the dependency on other modes. Various aspects are individually divided by reading points. In other words, for example, “6 + 3 + 1P + 1” is aspect 6), subordinate to aspect 3), subordinate to aspect 1P), and subordinate to aspect 1), that is, aspect “6 + 3 + 1P + 1” It corresponds to the compound of embodiment 1) further limited by the features of 1P), 3) and 6).

The invention also includes isotope-labeled, in particular ² H (deuterium) -labeled compounds of formula (I), wherein the isotope-labeled compounds have one or more atoms at the same atom. Identical to the compounds of formula (I) except that they are each replaced by an atom having an atomic weight different from the atomic weight normally found in nature. Isotopically labeled, especially ² H (deuterium) labeled compounds of formula (I), and salts thereof are within the scope of the invention. Replacing hydrogen with the heavier isotope ² H (deuterium) increases metabolic stability, for example, increasing in-vivo half-life, or reducing the required dose, or For example, the safety profile is improved because inhibition of cytochrome P450 enzymes can be reduced. In one embodiment of the invention, the compounds of formula (I) are not isotopically labeled or they are only labeled with one or more deuterium atoms. In a sub-embodiment, the compound of formula I is not isotopically labeled at all. Isotopically-labelled compounds of formula I may be prepared in the same manner as described below except that the appropriate reagents or appropriate isotopic species of starting materials are used.

The term “pharmaceutically acceptable salts” refers to non-toxic, inorganic or organic acid and / or base addition salts, literature, eg “Salt selection for basic”.
drugs ", Int. J. et al. Pharm. (1986), 33, 201-217.

  Where the plural form is used for compounds, salts, pharmaceutical compositions, diseases and the like, this is intended to mean also a single compound, salt, or the like.

A compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for use as a medicament. In particular, compounds of formula (I), to adjust the P2X ₇ receptor, i.e., act as P2X ₇ receptor antagonists, pain; neurodegenerative and neuroinflammatory diseases; joint disease; obstructive airways disease; cardiovascular disease; eye disease; skin disorders; abdominal and gastrointestinal disease; urogenital diseases; cancer; other autoimmune and allergic disorders; and activity of P2X ₇ receptors such as other disorders with an inflammatory or immune component It is useful for the prevention or treatment of diseases associated with chemical conversion.

  In particular, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of pain. Pain is acute pain; chronic pain; pain associated with sprains and muscular contusions; chronic joint pain; pain associated with rheumatic fever; musculoskeletal pain; lumbar neck pain; inflammatory pain; neuropathic pain; Pain associated with viral infections of the stomach; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine; toothache and dysmenorrhea; headache including tension and cluster headache; Pain associated with functional bowel disorder; sympathetic-dependent pain; myositis; pain associated with cancer chemotherapy; and postoperative pain.

  Neuropathic pain is especially diabetic neuropathy, sciatica, nonspecific back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV-related neuropathy, postherpetic neuralgia, and physical trauma, amputation, phantom limb syndrome Including pain caused by spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, neuropathic pain states are usually painless sensations such as “tricky sensations” (sensory and abnormal sensations), increased sensitivity when touched (hypersensitivity), harmless stimulation Later sensation of pain (dynamic, static, thermal or cold allodynia), increased sensitivity to nociceptive stimuli (hyperalgesia to thermal, cold, mechanical stimuli), pain sensation after removal of stimulus Continuation (hyperalgesia) or absence or lack of selective sensory pathways (hyperalgesia).

  Chronic arthralgia includes in particular rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis.

  Pain associated with functional bowel disorders includes in particular non-ulcer gastrointestinal disorders, non-cardiac chest pain and irritable bowel syndrome.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of neurodegeneration and neuroinflammatory diseases. Neurodegenerative and neuroinflammatory diseases include Alzheimer's disease and Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); amyotrophic lateral sclerosis, amyloidosis; multiple sclerosis and others Other dementia diseases including, but not limited to, demyelinating; cerebral arteriosclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy body dementia; and Parkinson's disease Including.

Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of osteoarticular diseases. Osteoarthritis diseases include rheumatoid arthritis, osteoarthritis, arthritis such as gout or crystal arthropathy; disc degeneration; temporomandibular joint degeneration; bone remodeling diseases such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; Mixed connective tissue disease; spondyloarthritis; periodontal disease such as periodontitis; primary and associated with osteoarthritis / osteoarthritis both secondary to congenital hip dysplasia or Including arthritis; cervical and lumbar spondylosis; Still's disease; including ankylosing spondylitis, psoriatic arthritis, seronegative spondyloarthritis including reactive and undifferentiated spondyloarthritis; including septic arthritis and Potts disease and Ponce syndrome, Other infection-related arthropathy and bone disorders such as tuberculosis; acute and chronic crystal-induced slipping, including uric acid gout, calcium pyrophosphate deposition disease and calcium apatite-related tendons, synovial sac and synovial inflammation Behcet's disease; primary and secondary Sjogren's syndrome; systemic sclerosis and localized scleroderma; systemic lupus erythematosus, mixed connective tissue disease and undifferentiated connective tissue disease; inflammatory including dermatomyositis and polymyositis Rheumatoid polymyalgia; juvenile arthritis and related syndromes including idiopathic inflammatory arthritis regardless of affected joints and rheumatic fever and its systemic complications; giant cell arteritis, Takayasu arteritis, Churg Strauss Vasculitis, including syndrome, nodular polyarteritis, microscopic polyangiitis and viral infections, hypersensitivity reactions, vasculitis associated with cryoglobulin and abnormal proteins; familial Mediterranean fever, Maccle-Wells syndrome and familial Irish fever Kikuchi disease; and myopathy including drug-induced arthralgia, tendonitis and dystrophies and other inflammatory myopathy.

  Furthermore, the compound of formula (I) according to any one of embodiments 1) to 45) or a pharmaceutically acceptable salt thereof is suitable for the prevention or treatment of obstructive diseases of the airways. Obstructive airway disease is both intermittent and persistent, and of all severity, bronchial, allergic, intrinsic and extrinsic asthma, exercise-induced, drug-induced (including aspirin and NSAID-induced) Asthma and other causes of airway hypersensitivity including sexual and dust-induced asthma; chronic obstructive pulmonary disease (COPD); bronchitis including infectious and eosinophilic bronchitis; emphysema; bronchiectasis; cystic fibers Sarcoidosis; farmer's lung and related diseases; Treatment of pulmonary fibrosis including fibrosis; complications of lung transplantation; vasculitic and thrombotic disorders of the pulmonary vasculature and pulmonary hypertension; chronic cough with inflammatory and secretory symptoms of the respiratory tract and iatrogenic cough Including antitussive Acute and chronic rhinitis including drug-induced rhinitis and vascular neurorhinitis; perennial and seasonal allergic rhinitis including neural rhinitis (hay fever); nasal polyps; and acute viral infections and respiratory rash viruses including the common cold , Influenza, infections caused by coronaviruses (including SARS) and adenoviruses.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of cardiovascular diseases. Cardiovascular disease affects atherosclerosis that adversely affects coronary and peripheral circulation; pericarditis; myocarditis; inflammatory and autoimmune cardiomyopathy including cardiac sarcoidosis; ischemia reperfusion injury; endocarditis, valvular Aortitis including inflammation and infectious (eg, syphilitic) vasculitis; and disorders of proximal and peripheral veins including phlebitis and thrombosis, including complications of deep vein thrombosis and varicose veins.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of eye diseases. Eye diseases include blepharitis; conjunctivitis including perennial and spring allergic conjunctivitis; irisitis; anterior and posterior uveitis; choroiditis; autoimmune, degenerative or inflammatory disorders that adversely affect the retina; Ophthalmitis, including ophthalmitis; sarcoidosis; and ocular infections, including viral, fungal and bacterial infections.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of skin diseases. Skin diseases include psoriasis, burns, atopic dermatitis, contact dermatitis or other eczema skin disease and delayed type hypersensitivity reaction; plant and photodermatitis; seborrheic dermatitis, herpetic dermatitis, flat Lichen, sclerotrophic lichen, gangrenous pyoderma, cutaneous sarcoid, discoid lupus erythematosus, pemphigus, pemphigoid, epidermolysis bullosa, urticaria, angioedema, vasculitis, toxic erythema, skin favor Eosinophilia, alopecia areata, androgenetic baldness, Sweet syndrome, Weber-Christian syndrome, erythema multiforme; both infectious and non-infectious cellulitis; panniculitis; cutaneous lymphoma, non-melanoma Includes skin cancer and other neoplastic lesions; and drug-induced disorders including fixed drug eruptions.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of abdominal cavity and gastrointestinal diseases. Abdominal and gastrointestinal diseases include hepatitis including autoimmune, alcoholic and viral hepatitis; liver fibrosis and cirrhosis; cholecystitis; both acute and chronic pancreatitis; non-inflammatory diarrhea; glossitis, gingivitis, Periodontitis; Esophagitis including reflux esophagitis; Eosinophilic gastroenteritis, mastocytosis, Crohn's disease, colitis including ulcerative colitis, proctitis, anal pruritus; Celiac disease, irritable bowel disease / Food-related allergies that may have a syndrome and effects away from the gastrointestinal tract (eg migraine, rhinitis or eczema); eg acute after kidney, heart, liver, lung, bone marrow, skin or retina transplantation or after blood transfusion And allograft rejection, including chronic allograft rejection; and chronic graft-versus-host disease.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of urogenital diseases. Urogenital diseases include nephritis including interstitial and glomerulonephritis; nephrotic syndrome; cystitis and Hanner ulcer including acute and chronic (interstitial) cystitis; acute and chronic urethritis, hemorrhagic cystitis, Includes prostatitis, accessory testicularitis, ovitis and fallopian tubeitis; vulvovaginitis; Peyronie's disease; and erectile dysfunction (both male and female).

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of cancer. Treatment of cancer includes brain tumors, prostate, lung, breast, ovary, intestine and colon, stomach, pancreas, skin and bone marrow (including leukemia) and lymphoproliferative systems such as non-Hodgkin and Hodgkin lymphoma, and metastatic disease And prevention or treatment of tumor recurrence and paraneoplastic syndromes.

  Furthermore, the compounds of formula (I) according to any one of embodiments 1) to 45) or pharmaceutically acceptable salts thereof are suitable for the prevention or treatment of other autoimmune and allergic disorders. Other autoimmune and allergic disorders include Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes, idiopathic thrombocytopenic purpura, eosinophilic fasciitis, high IgE syndrome and antiphospholipid syndrome.

  Furthermore, a compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of other disorders with inflammatory or immunological factors. Is appropriate. Other disorders involving inflammatory or immunological components include acquired immune deficiency syndrome (AIDS), leprosy, Sezary syndrome and paraneoplastic syndromes.

  Furthermore, the compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of embodiments 1) to 45) is suitable for the prevention or treatment of mood, depression, sleep and anxiety disorders.

  Furthermore, the compound of formula (I) according to any one of embodiments 1) to 45) or a pharmaceutically acceptable salt thereof is suitable for the prevention or treatment of injured induced trauma and spinal cord injury. is there.

In particular, the compound of formula (I) according to any one of embodiments 1) to 45) or a pharmaceutically acceptable salt thereof is selected from one, some or all of the following groups of diseases and disorders: Suitable for the prevention or treatment of disease:
1) Pain, acute pain; chronic pain; pain associated with sprains and muscular contusions; chronic arthralgia; pain associated with rheumatic fever; musculoskeletal pain; lumbar neck pain; inflammatory pain; Pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine; toothache and dysmenorrhea; Pain associated with myocardial ischemia; pain associated with functional bowel disorder; sympathetic nerve-dependent pain; myositis;
Pain associated with cancer chemotherapy; as well as postoperative pain;
Neuropathic pain is notably diabetic neuropathy, sciatica, nonspecific low back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV-related neuropathy, postherpetic neuralgia, trigeminal neuralgia and physical trauma, amputation, phantom Includes pain caused by limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, neuropathic pain states are usually painless sensations such as “tricky sensations” (sensory and abnormal sensations), increased sensitivity when touched (hypersensitivity), harmless stimulation Later pain sensation (dynamic, static, thermal or cold allodynia), increased sensitivity to noxious stimuli (hot, cold, hyperalgesia to mechanical stimuli), pain sensation after removal of the stimulus Continuation (hyperalgesia) or absence or deficiency of a selective sensory pathway (hyperalgesia);
Chronic joint pain conditions include rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis, among others;
Pain associated with functional bowel disorders includes in particular non-ulcerative gastrointestinal disorders, non-cardiac chest pain and irritable bowel syndrome;
2) Alzheimer's disease and Creutzfeldt-Jakob disease (CJD) and new variant Creutzfeldt-Jakob disease (nvCJD); Amyloidosis; Amyotrophic lateral sclerosis, multiple sclerosis and other demyelinating diseases; Neurodegeneration and nerves such as, but not limited to: sclerosis and vasculitis; temporal arteritis; myasthenia gravis; Huntington's disease; Lewy body dementia; and Parkinson's disease; Inflammatory diseases;
3) Rheumatoid arthritis, osteoarthritis, gout or crystal arthropathy; arthritis such as intervertebral disc degeneration; temporomandibular joint degeneration; bone remodeling diseases such as osteoporosis, Paget's disease or osteonecrosis; polychondritis; scleroderma; Connective tissue disease; spondyloarthritis; periodontal diseases such as periodontitis; Behcet's disease; primary and secondary Sjogren's syndrome; systemic sclerosis and localized scleroderma; systemic lupus erythematosus, mixed connective tissue disease and not Inflammatory myopathy including dermatomyositis and polymyositis; polymyalgia rheumatic; juvenile arthritis and related syndromes including idiopathic inflammatory arthritis regardless of affected joints and rheumatic fever and its systemic nature Complications: giant cell arteritis, Takayasu arteritis, Churg-Strauss syndrome, nodular polyarteritis, microscopic polyangiitis and viral infection, hypersensitivity reaction, cryoglob Vasculitis, including vasculitis associated with phosphorus and abnormal proteins; McKull-Wells syndrome and familial Irish fever, Kikuchi disease; and drug-induced arthralgia, tendonitis and myopathy;
4) Chronic obstructive pulmonary disease (COPD); cystic fibrosis; emphysema; sarcoidosis; farmer's lung and related diseases; pulmonary fibrosis including fibrosis as a complication of tuberculosis; and chronic with inflammation and secretory symptoms of the respiratory tract Obstructive airway diseases such as cough;
5) cardiovascular diseases such as inflammatory and autoimmune cardiomyopathy;
6) Eye diseases such as degeneration or inflammatory disorders that adversely affect the retina;
7) Psoriasis, burns, atopic dermatitis, contact dermatitis or other eczema skin diseases; and skin diseases such as discoid lupus erythematosus;
8) Liver fibrosis and cirrhosis; cholecystitis; both acute and chronic pancreatitis; Crohn's disease; colitis including ulcerative colitis; and abdominal and gastrointestinal diseases such as irritable bowel disease / syndrome;
9) nephritis including interstitial and glomerulonephritis; nephrotic syndrome; and urogenital diseases such as cystitis including acute and chronic (interstitial) cystitis; and 10) Hashimoto's thyroiditis, Graves' disease, Addison's disease Other autoimmune and allergic disorders such as diabetes, idiopathic thrombocytopenic purpura, eosinophilic fasciitis, high IgE syndrome and antiphospholipid syndrome.

Most preferably, the compound of formula (I) according to any one of embodiments 1) to 45) or a pharmaceutically acceptable salt thereof is selected from one, some or all of the following groups of diseases and disorders: Appropriate for the prevention or treatment of common diseases:
1) Pain, acute pain; chronic pain; pain associated with sprains and muscular contusions; chronic joint pain; pain associated with rheumatic fever; musculoskeletal pain (preferred); lumbar neck pain; inflammatory pain; neuropathic pain (Preferred); visceral pain; pain associated with influenza or other viral infections; pain associated with cancer and tumor invasion; joint and bone pain; atypical facial pain; pain associated with migraine; toothache and dysmenorrhea; And pain associated with myocardial ischemia; pain associated with functional bowel disorder; sympathetic dependent pain; myositis; pain associated with cancer chemotherapy; and the above pain meaning postoperative pain;
Neuropathic pain includes, among others, diabetic neuropathy, sciatica, nonspecific back pain, trigeminal neuralgia, multiple sclerosis pain, fibromyalgia, HIV-related neuropathy, postherpetic neuralgia, trigeminal neuralgia and physical trauma, amputation, phantom Includes pain caused by limb syndrome, spinal surgery, cancer, toxins or chronic inflammatory conditions. In addition, pain associated with normally painless sensations (sensory and abnormal sensations), such as “a tingling sensation”, increased sensitivity when touched (hypersensitivity), painful sensation of pain after movement (motion) , Static, thermal or cold allodynia), increased sensitivity to nociceptive stimuli (heat, cold, hyperalgesia to mechanical stimuli), continued pain sensation after removal of the stimulus (hyperalgesia) or Neuropathic pain conditions, including the absence or absence of selective sensory pathways (painlessness);
Chronic joint pain, particularly including rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis;
Pain associated with functional bowel disorders, particularly including non-ulcerative gastrointestinal disorders, non-cardiac chest pain and irritable bowel syndrome;
2) rheumatoid arthritis and osteoarthritis;
3) Chronic obstructive pulmonary disease (COPD); and 4) Crohn's disease.

  The invention also relates to the use of a compound of formula (I) according to any one of embodiments 1) to 45) for the manufacture of a pharmaceutical composition for the treatment and / or prevention of the above mentioned diseases.

  The invention also relates to pharmaceutically acceptable salts and pharmaceutical compositions and formulations of compounds of formula (I) according to any one of embodiments 1) to 45). The pharmaceutical composition according to the invention comprises as active ingredient at least one compound of formula (I) according to any one of embodiments 1) to 45) (or a pharmaceutically acceptable salt thereof), optionally Including carriers and / or diluents and / or adjuvants.

  The compounds of formula (I) and their pharmaceutically acceptable salts according to any one of embodiments 1) to 45) are used as medicaments, e.g. enterally (especially orally) or enterally (topically applied or inhaled). (Including) can be used in the form of a pharmaceutical composition for parenteral administration.

  The manufacture of the pharmaceutical composition is carried out by methods well known to any person skilled in the art (eg Remington, The Science and Practice of Pharmacy, 21st Edition (2005), Part 5, “Pharmaceutical Manufacturing” in LipinWirco Publication]), a compound of formula (I) as defined above, or a pharmaceutically acceptable salt thereof, optionally in combination with other therapeutically beneficial substances, suitable non-toxic inert therapeutic compatibility This can be accomplished by preparing a pharmaceutical dosage form with a solid or liquid carrier material and, if necessary, a conventional pharmaceutical adjuvant.

  The present invention also includes administering to a patient a pharmaceutically active amount of a compound of formula (I) according to any one of embodiments 1) to 45), or a pharmaceutically acceptable salt thereof. The present invention relates to a method for preventing or treating a disease or disorder mentioned in the specification.

Any reference herein to a compound of formula (I), (I _Ar ), (I _St1 ) or (I _St2 ) is appropriate and depending on the context, salts of such compounds (and in particular pharmaceuticals) It is understood that reference is also made to the acceptable salts. The suitability shown for compounds of formula (I) is, of course, of formula (I _Ar ), of formula (I _St1 ), and of formula (I _St2
) And pharmaceutically acceptable salts of the compounds of formula (I), (I _Ar ), of formula (I _St1 ) and of formula (I _St2 ). The same applies to these compounds as medicaments, to pharmaceutical compositions comprising these compounds as active ingredients, or to the use of these compounds for the manufacture of medicaments for the treatment of diseases.

  When not used with respect to temperature, the term “about” (or “approximately”) prefixed with the numerical value “X” is preferably used in this application between X−10% X and X + 10% X. Represents between X-5% X and X + 5% X. In the specific case of temperature, the term “about” (or “approximately”) before the temperature “Y” is used in this application between Y-10 ° C. and Y + 10 ° C., preferably Y-5. It represents between 0 ° C. and Y + 5 ° C. Further, the term “room temperature” (RT) as used herein means a temperature of about 25 ° C.

  Whenever the word “between” is used to describe a numerical range, it is understood that the end point of the indicated range is explicitly included in that range. This means, for example, that the temperature range is described as being between 40 ° C. and 80 ° C., the end point of 40 ° C. to 80 ° C. is included in the range; When defined as an integer between 1 and 4, the variable number is an integer 1, 2, 3 or 4.

  The compounds of formula (I) can be manufactured by the following methods, by the methods given in the examples or by analogous methods. Optimum reaction conditions will vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures.

Unless otherwise stated, the generic groups R ¹ , R ² , R ³ , R ⁴ , R ⁵ and R ⁶ are as defined in formula (I). Other abbreviations used are defined in the experimental section.

In some cases, the generic groups R ¹ , R ² , R ³ , R ⁴ , R ⁵ and R ⁶ are not compatible with the process illustrated in the scheme below, thus requiring the use of a protecting group (PG). It will be. The use of protecting groups is well known in the art (see, eg, Protective Groups in Organic Synthesis, TW Greene, PMGM Wuts, Wiley-Interscience, 1999). Suppose that such protecting groups are properly introduced as needed.

Preparation of compounds of formula (I):
Compounds of formula (I) can be prepared by TBTU, EDC. Using standard amide coupling reagents such as HCl / HOBt, HATU or PyBOP, in the presence of a suitable base such as DIPEA or Et ₃ N, in a suitable solvent such as DCM, THF or DMF, preferably from RT to 45 It can be prepared by reacting a carboxylic acid of formula II with an amine of formula III at a temperature between 0 ° C. (Scheme 1).

The compound of formula (I) in which R ⁴ represents —CH (OH) Me is obtained by using an appropriate reducing agent such as NaBH ₄ in a suitable solvent such as MeOH at a temperature near RT, and R ⁴ is acetylated. It can be produced by reducing the represented compound of formula (I). Other primary or secondary alcohols may be prepared similarly.

The compound of formula (I) in which R ⁴ represents —C (OH) Me ₂ can be added to a temperature between −10 ° C. and RT in the presence of a suitable solvent such as THF by adding a methylmagnesium halide solution. And can be prepared from a compound of formula (I) wherein R ⁴ represents acetyl. Other tertiary alcohols may be produced similarly.

A compound of formula (I) in which R ⁴ represents hydroxy- (C ₂ -C ₄ ) alkoxy is treated with an appropriate acid such as TFA, so that at a temperature near RT in an appropriate solvent such as DCM. It can be prepared from a compound of formula (I) in which R ⁴ represents tert-butyloxy- (C ₂ -C ₄ ) alkoxy.

  Compounds of formula Ia where Y represents N or CH (Scheme 2) can be prepared as described in Scheme 1 above.

  A compound of formula Ib wherein Y represents N or CH (Scheme 2) is treated with a suitable acid such as HCl or TFA in a suitable solvent such as dioxane, EtOAc or DCM at a temperature near RT. Can be prepared by cleaving the Boc protecting group of the compound.

A compound of formula Ic (Scheme 2) in which Y represents N or CH and R ¹⁰ represents (C ₁ -C ₄ ) alkyl is a suitable reducing agent such as NaBH (OAc) ₃ , NaBH ₃ CN or NaBH ₄ . Produced by reductive alkylation of an amine of formula Ib with a suitable aldehyde or ketone in the presence of a suitable solvent such as dichloroethane or a mixture of solvents such as DCM / MeOH / AcOH at a temperature near RT. Can do.

A compound of formula Id (Scheme 2) in which Y represents N or CH and R ¹⁰ represents (C ₁ -C ₄ ) alkyl is a compound such as DCM or THF in the presence of a suitable base such as Et ₃ N or DIPEA. It can be prepared by acylating the amine of formula Ib by treatment with a suitable acid chloride or acid anhydride at a temperature between 0 ° C. and 50 ° C. in a suitable solvent.

A compound of formula Ie (Scheme 2) in which Y represents N or CH and R ¹⁰ represents (C ₁ -C ₄ ) alkyl can be synthesized in the presence of a suitable base such as Et ₃ N or DIPEA, such as DCM or THF. It can be prepared by alkoxycarbonylating the amine of formula Ib by treatment with a suitable alkyl chloroformate at a temperature between 0 ° C. and 50 ° C. in a suitable solvent.

A compound of formula If where Y represents N or CH and R ¹⁰ represents (C ₁ -C ₄ ) alkyl (Scheme 2) is prepared in the presence of a suitable base such as Et ₃ N or DIPEA, such as DCM or THF. It can be prepared by sulfonating the amine of formula Ib by treatment with a suitable alkylsulfonyl chloride at a temperature between 0 ° C. and 50 ° C. in a suitable solvent.

  Indole carboxylic acids of formula IIa can be prepared according to the synthetic route described in Scheme 3.

  A regioisomer of formula XII in which Y represents methoxycarbonyl or cyano (with various amounts of regioisomer XI) (scheme 3) is obtained in a suitable solvent such as EtOH in the presence of a catalyst such as silver sulfate. It can be prepared by iodination of an aniline of formula XIV in which Y represents methoxycarbonyl or cyano using a suitable iodination reagent such as about 1.05 equivalents of iodine at a temperature near RT. Separation of both regioisomers can be done by standard CC.

A compound of formula IX in which R ⁴ represents hydrogen and Y represents methoxycarbonyl or cyano (Scheme 3) is a compound of formula XI in which Y represents methoxycarbonyl or cyano. In the presence of an appropriate palladium catalyst such as copper iodide, in the presence of an appropriate copper catalyst such as copper iodide, in the presence of a ligand such as triphenylphosphine, in the presence of an appropriate base such as Et ₃ N, and It can manufacture by heating in a solvent and carrying out a Sogashira type cross coupling with trimethylsilyl acetylene at the temperature between 50 degreeC and 100 degreeC.

Alternatively, compounds of formula IX wherein R ⁴ represents (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl and Y represents methoxycarbonyl or cyano (Scheme 3) Represents Sonogashira cross-coupling conditions as described above, wherein R ⁴ represents (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl, and Y represents methoxy It can be prepared from an iodide of formula VII representing carbonyl or cyano. A compound of formula VII in which R ⁴ represents (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl and Y represents methoxycarbonyl or cyano (Scheme 3
) Can be prepared according to standard iodination conditions as described above for the synthesis of compounds of formulas XI and XII where R ⁴ is (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) It can be prepared by iodination of an aniline of the formula VIII which represents alkyl and Y represents methoxycarbonyl or cyano. Compounds of formula VIII (Scheme 3) in which R ⁴ represents (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl and Y represents methoxycarbonyl or cyano are: Pd (dppf) Cl ₂ . Dioxane (or toluene / water 20) in the presence of a suitable palladium catalyst such as DCM (or bis (triphenylphosphine) palladium (II) dichloride and in the presence of a base such as K ₃ PO ₄ (in other cases)). A compound of the formula XII in which Y represents methoxycarbonyl or cyano, heated to a temperature between 50 ° C. and 100 ° C. (or around 110 ° C. (other cases)) in a suitable solvent such as Wherein R ⁴ represents (C ₁ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl, and X represents chloro, bromo or (C ₁ -C ₄ ) alkyl R ⁴ ZnX-type organozinc reagent (or R ⁴ B (OH) type ₂ boronic acid (in another case)) and Negishi (or Suzuki (in another case)) type cross-coupling Can be manufactured more.

Alternatively, compounds of formula VIII where R ⁴ represents (C ₃ -C ₄ ) alkyl or (C ₁ -C ₂ ) alkoxy- (C ₃ -C ₄ ) alkyl and Y represents methoxycarbonyl or cyano (Scheme 3) In the presence of a suitable palladium catalyst such as bis (triphenylphosphine) palladium (II) dichloride, in the presence of a suitable copper catalyst such as copper iodide, in the presence of a suitable base such as Et ₃ N, THF, etc. And an iodide of formula XII in which Y represents methoxycarbonyl or cyano at a temperature between RT and 80 ° C. (C ₁ -C ₂ ) alkylacetylene or (C ₁ -C ₂ ) It can be produced by performing a Sonogashira type cross coupling with an alkoxy- (C ₁ -C ₂ ) alkylacetylene. Subsequently, the reduction of the triple bond can be performed at a temperature near RT in the presence of an appropriate catalyst such as PtO ₂ and an appropriate solvent such as EtOH under hydrogenation conditions. Alternatively, when (C ₁ -C ₂ ) alkylacetylene is used as a reagent, it is treated with an acid such as p-toluenesulfonic acid at a temperature around 80 ° C. in the presence of a suitable solvent such as toluene. Allows the subsequent hydrogenation of the triple bond to give a compound of formula VIII, wherein R ⁴ represents (C ₂ -C ₄ ) alkyl-carbonyl and Y represents methoxycarbonyl or cyano.

Alternatively, the compound of formula VIII (Scheme 3), wherein R ⁴ represents (C ₁ -C ₂ ) alkoxy- (C ₂ -C ₄ ) alkyl and Y represents methoxycarbonyl or cyano, is prepared in a two-step procedure. (I) In the presence of an appropriate palladium catalyst such as Pd (OAc) ₂ , an appropriate ligand such as 2-dicyclohexylphosphino-2 ′, 6′-dimethoxybiphenyl and a base such as KOH, CH ₃ CN and the like In an appropriate solvent of the formula XII, wherein Y represents methoxycarbonyl or cyano, and (C ₁ -C ₂ ) alkoxy-vinylboronic acid pinacol ester or (C ₁ -C ₂₎ ) alkoxy - _(C 1 -C ₂₎ alkyl - vinyl boronic pinacol ester reagents and Suzuki-type cross-coupling, and (ii) I wrote was such a hydrogenation conditions, reduction of the double bond. Alternatively, a compound of formula VII where R ⁴ represents acetyl or ethyl and Y represents methoxycarbonyl (Scheme 3) can be prepared according to standard conditions as described above for the synthesis of compounds of formula VIII where Y represents methoxycarbonyl. It can be regioselectively prepared by the coupling of the formula XXXI iodide with trimethylsilylacetylene and a Sonogashira type cross coupling. Subsequently, the triple bond is reduced under hydrogenation conditions as described above for the synthesis of the compound of formula VIII to give the compound of formula VII where R ⁴ represents ethyl and Y represents methoxycarbonyl. Alternatively, the presence of a suitable solvent such as toluene, at a temperature in the vicinity of 80 ° C., by treatment with an acid such as p- toluenesulfonic acid, it can carry out the hydrogenation subsequent triple bond is R ⁴ This gives a compound of formula VII which represents acetyl and Y represents methoxycarbonyl. The compound of formula XXXI where Y represents methoxycarbonyl or cyano follows standard iodination conditions as described above for the synthesis of compounds of formula XI and XII, but using about 2.2 equivalents of iodination reagent Can be prepared by bis-iodination of an aniline of the formula XIV in which represents methoxycarbonyl or cyano.

  A compound of formula V in which Y represents methoxycarbonyl or cyano (Scheme 3) is obtained by using a base such as potassium carbonate in the presence of a suitable solvent such as MeOH at a temperature near RT and Y is methoxycarbonyl or cyano. Can be prepared by protodesilylation of a compound of formula IX representing

  Compounds of formula IV where Y represents methoxycarbonyl or cyano (Scheme 3) are rhodium catalysts such as chloro (1,5-cyclooctadiene) rhodium (I) dimer and tris (4-fluorophenyl) phosphine By heating in an appropriate solvent such as DMF in the presence of a ligand and rhodium catalyzed cycloisomerization of an aniline of formula V wherein Y represents methoxycarbonyl or cyano at a temperature between 50 ° C. and 90 ° C. Can be manufactured.

  Alternatively, a compound of formula IV where Y represents methoxycarbonyl or cyano (Scheme 3) is heated in a suitable solvent such as DMF using a suitable copper catalyst such as copper iodide and heated to 50-100 ° C. Can be prepared by copper-catalyzed cycloisomerization of an aniline of formula IX in which Y represents methoxycarbonyl or cyano at temperatures between.

Alternatively, a compound of formula IV where R ⁴ represents hydrogen and Y represents methoxycarbonyl (Scheme 3) is treated with a suitable catalyst such as Raney nickel in the presence of a suitable solvent such as EtOH at a temperature near RT. Thus, the methylsulfanylindole of formula XIII can be prepared by simultaneous deiodination and desulfurization.

Alternatively, the compound of formula IV (Scheme 3), wherein R ⁴ represents (C ₁ -C ₄ ) alkyl and Y represents methoxycarbonyl, is prepared by Raney nickel in the presence of a suitable solvent such as EtOH at a temperature near RT. By desulfurization of a methylsulfanylindole of formula VI wherein R ⁴ represents (C ₁ -C ₄ ) alkyl.

A compound of formula VI (Scheme 3), wherein R ⁴ represents (C ₁ -C ₄ ) alkyl, is obtained from a compound of formula XIII by Nejishi type cross-coupling according to standard conditions as described above for compounds of formula VIII. Can be manufactured.

A compound of formula XIII (Scheme 3) is prepared by reacting an aniline of formula XII where Y represents methoxycarbonyl at (i) a temperature between −50 ° C. and −78 ° C. in the presence of a suitable solvent such as DCM. A chlorinating reagent such as chlorosuccinimide or tert-butyl hypochlorite, (ii)
Et ₃ N etc. at a temperature between 80 ° C. and 120 ° C. in the presence of a suitable solvent such as methylsulfanyl-protected aldehyde such as methylthioacetaldehyde dimethyl acetal and (iii) chlorobenzene under the same conditions as in (i) And (iv) can be prepared by Gassman indole synthesis by continuous treatment with an acid such as HCl in the presence of a solvent such as (iv) dioxane or Et ₂ O at a temperature near RT. it can.

Alternatively, a compound of formula IV (Scheme 3) in which R ³ represents hydrogen, R ⁶ represents methyl (or ethyl (in another case)) and Y represents methoxycarbonyl or cyano can be represented by [1,3-bis ( 2,6-diisopropylphenyl) imidazol-2-ylidene] (3-chloropyridyl) palladium (II) dichloride and the like, in the presence of a suitable base such as K ₂ CO ₃ , Heating in a suitable solvent and at a temperature around 110 ° C., the chloride of formula IV wherein R ³ represents hydrogen, R ⁶ represents chloro and Y represents methoxycarbonyl or cyano is converted to trimethylboroxine (or vinyl boron). An acid pinacol ester (in another case) can be produced by Suzuki-type cross coupling. When vinylboronic acid pinacol ester was used as a reagent, the subsequent double bond reduction was carried out under hydrogenation conditions as described above.

Alternatively, the compound of formula IV (Scheme 3) in which R ⁴ represents hydroxy (or hydroxy- (C ₁ -C ₄ ) alkyl (otherwise)) and Y represents cyano is present in the presence of a suitable solvent such as DCM Under treatment with BBr ₃ at a temperature between −78 ° C. and 55 ° C., R ⁴ represents methoxy (or methoxy- (C ₁ -C ₄ ) alkyl (otherwise)) and Y represents It can be prepared from methyl ether of formula IV representing cyano. Subsequently, optionally, the phenol of formula IV, wherein R ⁴ represents hydroxy and Y represents cyano, is 0 ° C. to 80 ° C. in the presence of a suitable base such as K ₂ CO ₃ and a suitable solvent such as DMF. Alkylation by treatment with (C ₁ -C ₄ ) alkyl halides or (C ₁ -C ₄ ) alkoxy- (C ₂ -C ₄ ) alkyl halides at temperatures between R ^{4 and} (C ₁ -C ₄₎ alkoxy or _(C 1 -C ₄₎ alkoxy - _(C 2 -C ₄₎ alkoxy, to give a compound of formula IV in which Y represents cyano.

  Carboxylic acid derivatives of formula IIa (Scheme 3) can be prepared using a suitable base such as LiOH, NaOH or KOH at a temperature between RT and 60 ° C. in the presence of water and a suitable organic solvent such as MeOH, EtOH or THF. Can be prepared by hydrolysis of the methyl ester of formula IV wherein Y represents methoxycarbonyl.

  Alternatively, the carboxylic acid derivative of formula IIa (Scheme 3) can be synthesized with a suitable base such as KOH or NaOH at a temperature around 150 ° C. in the presence of water and optionally a suitable organic solvent such as 2-propanol. Can be prepared by hydrolysis of a nitrile of the formula IV in which is cyano.

  Indole carboxylic acids of formula IIb can be prepared according to the synthetic route described in Scheme 4.

  Hydrazine of formula XVII (Scheme 4) is prepared by diazotization of the aniline of formula XII with, for example, sodium nitrite, in a suitable solvent such as concentrated HCl and water, for example sodium nitrite, followed by appropriate addition of HCl and water, etc. For example, by reducing the diazonium salt with tin (II) chloride dihydrate at a temperature between 0 ° C. and RT in a suitable solvent.

An indole of formula XVIII (Scheme 4) is prepared by reacting a hydrazine derivative of formula XVII with R ^{5 in} the presence of a suitable acid such as HCl and a suitable solvent such as EtOH at a temperature between 50 ° C. and 80 ° C. It can be prepared by a Fisher indole reaction with a ketone of the formula R ⁵ COCH ₂ SMe representing _1- C ₄ ) alkyl.

Compounds of formula XVI where R ⁴ represents (C ₁ -C ₄ ) alkyl, (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄ ) alkyl or (C ₁ -C ₄ ) alkyl-carbonyl (Scheme 4) Can be prepared by a Negishi, Sonogashira or Suzuki cross-coupling reaction according to standard conditions such as those described above for the synthesis of compounds of formula VIII.
It can be produced from I iodide. Subsequently, an optional reduction or hydration step can be performed as described above for the synthesis of compound VIII.

  Alternatively, a compound of formula XVI (Scheme 4) can be prepared from an aniline of formula VIII where Y represents methoxycarbonyl using similar conditions as described above for the synthesis of a compound of formula XVIII from a compound of formula XII. It can be produced by a two-step sequence (hydrazine formation and Fisher indole synthesis).

R ⁴ is fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₄ ) alkyl-carbonyl, (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄₎ alkyl or _(C 1 -C ₄₎ alkoxy - _(C 2 -C ₄₎ compounds of the formula XV in which an alkoxy (scheme 4) according to standard conditions as described above for the synthesis of compounds of formula IV, It can be prepared from the compound of formula XVI by desulfurization.

Alternatively, a compound of formula XV in which R ⁴ represents hydrogen can be obtained by simultaneous deiodination and desulfurization from a compound of formula XVIII according to standard conditions as described above for the synthesis of compounds of formula IV from compounds of formula XIII. Can be manufactured.

  Carboxylic acid derivatives of formula IIb (Scheme 4) can be prepared by hydrolyzing the methyl ester of formula XV according to standard conditions as described above for the synthesis of compounds of formula IIa.

  If not commercially available, the aniline intermediate of formula XIV can be prepared according to procedures known in the art. A possible synthetic route is outlined in Scheme 5 below.

Carboxylic acid derivatives of formula XX in which R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkoxy, fluoro or chloro and R ⁶ represents fluoro, chloro or (C ₁ -C ₂ ) fluoroalkyl are water, pyridine and the like In the presence of the above solvent, at a temperature around 100 ° C., R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkoxy, fluoro, or chloro, and R ⁶ represents fluoro, chloro, with a suitable oxidizing reagent such as KMnO _4. Alternatively, it can be prepared by oxidizing a toluene derivative of formula XIX representing (C ₁ -C ₂ ) fluoroalkyl. A toluene derivative of the formula XIX in which R ⁴ represents (C ₁ -C ₄ ) alkoxy is a suitable compound such as Cs ₂ CO ₃ or K ₂ CO _{3 in} the presence of a suitable solvent such as DMF at a temperature near RT. It can be prepared by treating a phenol of formula XIX where R ⁴ represents hydroxy with a base and a suitable alkylating agent such as (C ₁ -C ₄ ) alkyl iodide or bromide.

Alternatively, the carboxylic acid derivative of formula XX (Scheme 5), wherein R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro, is suitable for water and 2-propanol Formula XXIII in which R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro, or chloro after treatment with a suitable base such as KOH or NaOH in the presence of an organic solvent. The nitrile can be produced by hydrolysis. Hydrolysis of the primary amine intermediate may require further treatment with sodium nitrite at a temperature around 80 ° C. in the presence of water and acids such as sulfuric acid. A nitrile of formula XXIII (Scheme 5) in which R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro is an appropriate cyanide such as copper (I) cyanide R ⁴ is hydrogen, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy at a temperature between 0 ° C. and 80 ° C. in a suitable solvent such as CH ₃ CN in the presence of a reagent. An aniline of the formula XXII representing fluoro or chloro can be prepared by treatment with a suitable diazotizing reagent such as tert-butyl nitrite.

Alternatively, a carboxylic acid derivative of formula XX (Scheme 5) in which R ⁴ represents (C ₁ -C ₄ ) alkoxy is obtained from RT to 110 ° C. in the presence of a base such as Cs ₂ CO ₃ and a suitable solvent such as DMF. Can be prepared by nucleophilic aromatic substitution of the fluoride of formula XX, wherein R ⁴ represents fluoro, using (C ₁ -C ₄ ) -alcohol at temperatures between.

R ^N is a methyl ester of formula XXI to a nitro (Scheme 5) in the presence of a suitable solvent such as DMF, at a temperature of around RT, the carboxylic acid of formula XX, _Cs 2 CO ₃ or _K 2 CO ₃ Can be produced by treating with an appropriate base such as MeI and an appropriate alkylating agent such as MeI.

Alternatively, ^{R N} represents acetylamino, compounds of formula XXI representing the ^{R 6} is methyl or ethyl (Scheme 5), ^{R N} represents acetylamino, phenol of formula XXI ^{in which R 6} represents hydroxy, 2 steps (I) Triflate is treated with trifluoromethanesulfonic anhydride in the presence of a base such as Et ₃ N and a suitable solvent such as DCM at a temperature near RT. Formation, and (ii) followed by Pd (dppf) Cl ₂ . In the presence of an appropriate palladium catalyst such as DCM and a base such as K ₃ PO ₄ , the mixture is heated to a temperature around 65 ° C. in an appropriate solvent such as THF, and methyl- or ethyl-boronic acid and Suzuki type cross-coupling. .

An aniline of formula XIV in which Y represents methoxycarbonyl (or VIII in which R ⁴ represents (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro and Y represents methoxycarbonyl If)) (scheme 5), ^{R N} represents a nitro, nitrobenzene derivatives of the formula XXI ^{in which R 4} represents hydrogen (or ^{R N} represents nitro, ^{R 4} is _(C 1 -C ₄₎ alkyl, (C _1- C ₄ ) XXI (in another case) representing alkoxy, fluoro or chloro) in the presence of a suitable solvent such as DMF at a temperature of around 100 ° C. such as tin (II) chloride dihydrate It can be produced by reduction with zinc dust and ammonium formate at a temperature near RT in the presence of a suitable reducing agent or in a suitable solvent such as MeOH.

Alternatively, an aniline of formula XIV where Y represents methoxycarbonyl (or VIII where R ⁴ represents (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro and Y represents methoxycarbonyl if)) (scheme 5) in the presence of MeOH, at a temperature in the vicinity of RT, ^{R N} represents acetylamino, acetylation anilines of formula XXI ^{in which R 4} represents hydrogen (or, ^{R N} is acetylamino And R ⁴ is (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro, XXI (in another case)) prepared by methanolysis using K ₂ CO ₃ it can.

Alternatively, R ³ represents hydrogen or chloro, Y represents cyano, an aniline of formula XIV (or R ⁴ represents (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy or chloro, and R ³ represents VIII representing hydrogen or chloro and Y representing cyano (in another case) (Scheme 5) is heated in a suitable solvent such as DMF in the presence of a suitable palladium catalyst such as Pd (PPh ₃ ) _4. A bromide of formula XXXII in which R ³ represents hydrogen or chloro, R ⁴ represents hydrogen, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy or chloro at a temperature around 110 ° C. It can be produced by palladium-catalyzed cyanation with zinc cyanide.

Alternatively, an aniline of formula XIV where Y represents methoxycarbonyl (or VIII where R ⁴ represents (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro and Y represents methoxycarbonyl )) (Scheme 5) can be prepared according to standard procedures such as, for example, treatment with acetyl chloride, in the presence of MeOH at a temperature around 65 ° C., where aniline of formula XIV in which Y represents hydroxycarbonyl (or R ⁴ Can be prepared by esterifying VIII (in other cases) wherein (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, fluoro or chloro and Y represents hydroxycarbonyl.

市販されていない場合には、式ＩＩＩのアミン前駆体は、ＷＯ２００９／１３２０００に記載の又は下記のスキーム６に概略した手順に従って製造することができる。

If not commercially available, the amine precursor of formula III can be prepared according to the procedure described in WO2009 / 132000 or outlined in Scheme 6 below.

A heteronitryl of formula XXV, wherein NR ¹¹ R ¹² is unsubstituted or substituted by 1 or 2 substituents; cycloalkylamino; cycloalkylmethylamino; N— (C ₁ -C ₄₎ alkylamino; N, N- di - _[(C 1 -C ₄₎ alkyl] - amino or N- arylmethyl -N- _(C 1 -C ₄₎ alkyl - represents amino, the substituents of the heterocyclyl Is independently selected from (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkylcarbonyl, (C ₁ -C ₄ ) alkoxycarbonyl, (C ₁ -C ₄ ) alkylsulfonyl and halogen, The aminonitrile of formula XXV (Scheme 6) is prepared in the presence of a suitable cyanating reagent such as TMSCN and a suitable Lewis acid catalyst such as ZnI ₂ in Et ₂ O. Can be prepared by a Strecker reaction between an aldehyde of formula XXIV and an amine of formula R ¹¹ R ¹² NH in a suitable solvent mixture such as / MeOH at a temperature between 0 ° C. and 80 ° C. The resulting nitrile of formula XXV is reduced to the diamine of formula IIIa (Scheme 6) under hydrogenation conditions in the presence of a suitable catalyst such as Raney nickel and a suitable solvent such as ammonia and methanol at a temperature near RT. Can be converted.

Nitroalkenes of formula XXVI (Scheme 6) can be prepared according to a two-step procedure by a Henry reaction between an aldehyde of formula XXIV and nitromethane: (i)
treatment with a suitable base such as KOtBu in a suitable solvent such as tBuOH / THF at a temperature around 0 ° C., and (ii) in the presence of a base such as DMAP, in a suitable solvent such as DCM, near RT Treat the isolated β-nitroalcohol intermediate with a suitable dehydrating agent such as acetic anhydride at temperature.

An ether derivative of formula XXVII (Scheme 6) in which OR ¹¹ represents heterocyclyloxy; (C ₃ -C ₆ ) cycloalkoxy or (C ₂ -C ₆ ) alkoxy is prepared in the presence of a suitable base such as NaH It can be prepared by Michael addition of an alcohol of formula R ¹¹ OH to a nitroalkene of formula XXVI in a suitable solvent at a temperature between 0 ° C. and RT.

  The resulting ether XXVII is obtained by reducing the nitro group under hydrogenation conditions at a temperature near RT in the presence of a suitable catalyst such as platinum dioxide and a suitable solvent such as EtOH. (Scheme 6).

If not commercially available, nitriles of formula XXIX (Scheme 6) can be prepared by a two-step procedure: (i) J. et al. Org. Chem. , 2008, 73, 4, 1643-1645, in the presence of an appropriate base such as KOtBu, an appropriate palladium catalyst such as Pd (OAc) ₂ , and an appropriate ligand such as dppf. in a solvent, arylation or hetero arylation of methyl cyanoacetate by treatment with Buromoaren or bromo heteroarenediyl of formula Br-R ^1, and (ii) Subsequently, an appropriate solvent mixture such as DMSO / water, Decarboxylation of isolated aryl or heteroaryl methyl cyanoacetate intermediates by treatment with a suitable salt such as LiCl at a temperature around 140 ° C.

  Alternatively, if not commercially available, the nitrile of formula XXIX is Am. Chem. Soc. 2011, 133, 6948-6951.

A cyanoalkene of formula XXX (Scheme 6), wherein R ¹¹ and R ¹² are heterocyclyl that is unsubstituted or substituted with one or two substituents, together with the carbon atom to which they are attached. The substituent is independently from (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkylcarbonyl, (C ₁ -C ₄ ) alkoxycarbonyl, (C ₁ -C ₄ ) alkylsulfonyl and halogen. A cyano of formula XXX above, wherein said heterocyclyl is selected; (C ₃ -C ₆ ) cycloalkyl which is unsubstituted or substituted by 1 or 2 halogens or (C ₃ -C ₆ ) alkyl; Alkenes are prepared by reacting an aryl- or heteroaryl-acetonitrile of formula XXIX with KOH or N at a temperature between 0 ° C. and 60 ° C. in a suitable solvent such as MeOH. By treatment with an appropriate base OMe etc., it can be prepared by Knoevenagel condensation with aldehyde or ketone of formula ^R 11 ^{COR 12.}

  Each amine of formula IIIc (Scheme 6) can be prepared by reducing the cyanoalkene of formula XXX using a two-step procedure: (i) in the presence of a suitable catalyst such as Pd / C, Hydrogenation, then (ii) hydrogenation in the presence of a suitable catalyst such as Raney nickel. Both steps are performed in a suitable solvent such as ammonia and methanol at a temperature near RT.

Alternatively, an amine of formula IIIc is prepared by reducing a cyanoalkene of formula XXX in a suitable solvent such as THF at a temperature around 60 ° C. in the presence of a suitable reducing agent such as BH ₃ THF complex. be able to.

Experimental part (used in this section and in the above part of the specification) Abbreviations:
Ac acetyl anh. Anhydride aq. Aqueous ATP adenosine-5′-triphosphate Boc tert-butoxycarbonyl tBu tert-butyl CC column chromatography cDNA complementary deoxyribonucleic acid CNS central nervous system DCM dichloromethane DEA diethylamine DIPEA diisopropylethylamine DMAP 4- (dimethylamino) pyridine DMEM Dulbecco's modification Method Eagle medium DMF dimethylformamide DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dppf 1,1′-bis (diphenylphosphino) ferrocene EDC. HCl N- (3-dimethylaminopropyl) -N′-
Ethyl carbodiimide hydrochloride eq equivalent Et ethyl FCS fetal calf serum FLIPR fluorescence imaging plate reader h time HATU 2- (7-aza-1H-benzotriazol-1-yl)-
1,1,3,3-tetramethyluronium
Hexafluorophosphate Hept Heptane HOBT 1-hydroxybenzotriazole hydrate HV High vacuum LC-MS Liquid chromatography-mass spectrometry M Molarity Me Methyl min Minute MS Mass spectrometry NCS N-chlorosuccinimide NMR Nuclear magnetic resonance ON overnight PBS Phosphorus Acid buffered saline PEPPSI®-IPr [1,3-bis (2,6-diisopropylphenyl)
Imidazole-2-ylidene]
(3-Chloropyridyl) palladium (II)
Dichloride PG protecting group Ph phenyl PyBOP benzotriazol-1-yl-oxy-tris-pyrrolidino-
Phosphonium-hexafluorophosphate RNA Ribonucleic acid RT Room temperature sat. Saturated TBTU O- (benzotriazol-1-yl) -N, N, N ′, N′-
Tetramethyluronium tetrafluoroborate TFA trifluoroacetic acid THF tetrahydrofuran TMS trimethyl-silyl t _R retention time UV UV Vis visible

A. Qualitative analysis method used NMR: Brucker Avance 400, 400 MHz; chemical shifts are given in ppm relative to the solvent used; multiplicity: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, br = broadband, coupling constant is shown in Hz.

  LC-MS (I): Thermo Finnigan MSQ Surveyor MS with Agilent 1100 Binary Pump and DAD.

Eluent (acidic conditions): A: H ₂ O + 0.04% TFA; B: CH ₃ CN; Gradient: 5% B to 95% B; runtime: 1.5 min; flow rate: 4.5 mL / min Detection: UV / Vis + MS, t _R is min. Represented by

LC-MS (A): Column Zorbax SB-AQ, 3.5 μm, 4.6 × 50 mm;
LC-MS (B): Column Waters XBridge C18, 2.5 μm, 4.6 × 30 mm;
LC-MS (C): Column Waters Atlantis T3, 5 μm, 4.6 × 30 mm;
Eluent (basic conditions): A: H ₂ O + 13 mmol / L NH ₄ OH; B: CH ₃ CN; Gradient: 5% B to 95% B; runtime: 1.5 min; flow rate: 4.5 mL / Min:
LC-MS (D): Column Waters XBridge C18, 5 [mu] m, 4.6 x 50 mm.

LC-MS (D ^* ): column Zorbax Extended C18, 5 [mu] m, 4.6 x 50 mm.

LC-MS (II): Dionex Ultimate 3000 with Thermo MSQ MS, HPG-3000 pump and photodiode array detector.
Eluent (basic conditions): A: H ₂ O + 0.05% NH ₄ OH + 2% CH ₃ CN; B: CH ₃ CN; Gradient: 5% B to 95% B; Runtime: 2.0 min; Flow rate: 1 Detection: UV / Vis + MS, t _R is expressed in min.

  LC-MS (E): Column Ascentis Express C18, 2.7 μm, 2.1 × 50 mm.

  LC-MS (F): Same as E except runtime is 1.1 min.

Eluent (acidic conditions): A: H ₂ O + 0.05% HCOOH; B: CH ₃ CN + 0.05% HCOOH; Gradient: 5% B to 95% B; Runtime: 2.0 min; Flow rate: 1.4 mL / min; Detection: UV / Vis + MS, t _R is expressed in min.

  LC-MS (G): Column Ascentis Express C18, 2.7 μm, 2.1 × 50 mm.

B. Purification method used LC-MS for preparative (A): Flow rate: 75 mL / min. Detection: UV / Vis and / or MS.

Additional information on purification is summarized in the table below using the following description:
XBridge: Column Waters XBridge C18, 10 μm, 30 x 75 mm
Atlantis: Column Waters Atlantis T3, 10 μm, 30 × 75 mm
Acidity: Eluent: A = H ₂ O containing 0.5% HCOOH, B = CH ₃ CN.

Basic: Eluent: A = 0.25% NH ₂ OH with H ₂ O, B = CH ₃ CN.

Lipophilic gradient: 30% B to 95% B over 4 minutes, then 95% B over 2 minutes.

Normal phase gradient: 20% B to 95% B over 4 minutes, then 95% B over 2 minutes.

Polarity gradient: 10% B to 95% B over 4 minutes, then 95% B over 2 minutes.

High polarity gradient: 5% B to 50% B over 3 minutes, then 50% B to 95% B over 1 minute, and finally 95% B over 2 minutes.

分取用ＬＣ−ＭＳ （Ｂ）：流速：ｍＬ／ｍｉｎ。検出：ＵＶ／Ｖｉｓ及び／又はＭＳ。

Preparative LC-MS (B): Flow rate: mL / min. Detection: UV / Vis and / or MS.

XBridge: Column Waters XBridge C18 OBD®, 5 μm, 19 × 50 mm.

Acidity: Eluent: A = H ₂ O containing 0.1% HCOOH, B = CH ₃ CN containing 0.1% HCOOH.

Basic: Eluent: A = H ₂ O containing 0.1% NH ₄ OH, B = CH ₃ CN containing 0.1% NH ₄ OH.

Normal phase gradient: 25% B over 0.2 minutes, 25% to 35% B over 0.1 minutes, 35% to 65% B over 2.9 minutes, 65% over 0.1 minutes To 95% B, and finally 95% B over 1 minute.

Polarity gradient: 10% B for 0.2 minutes, 10% to 20% B for 0.1 minutes, 20% to 50% B for 2.9 minutes, 50% for 0.1 minutes 95% B and finally 95% B in 1 minute.

High polarity gradient: 5% B over 0.3 minutes, 5% to 35% B over 2.9 minutes, 35% to 95% B over 0.1 minutes, and finally 95 over 1 minute % B.

Column chromatography (CC) can be performed using silica gel 60 Merck (0.063-0.200 mm) or Biotage filled cartridges (SNAP KP-SIL®, SNAP KP-NH®, Isolute®). Silica II, were performed using Isolute (TM) NH ₂ or Isolute ^{(TM) C 18).} Additional information regarding purification is summarized in the table below:

  The following examples illustrate the invention and are not intended to limit its scope in any way.

Production of precursors and intermediates:
A. Synthesis of carboxylic acid 1. Synthesis of 4-chloro-1H-indole-5-carboxylic acid 1. a. Methyl 4-amino-2-chlorobenzoate 4-amino-2-chlorobenzoic acid (54.2 mmol) dissolved in MeOH (325 mL) was added dropwise with acetyl chloride (163 mmol), and the mixture was refluxed for 5 h. It was concentrated in vacuo and partitioned between EtOAc and a saturated solution of NaHCO ₃ . The organic phase was washed with a saturated solution of NaHCO ₃ , dried over MgSO ₄ and concentrated in vacuo to give the title compound as a beige solid.
_{LC-MS (B): t} R = 0.57min; [M + CH 3 CN + H] +: 227.30.

A. 1. b. Mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate Methyl 4-amino-2-chlorobenzoate (55.8 mmol) was added to EtOH ( Iodine (58.6 mmol) and silver sulfate (55.8 mmol) were added to the suspension in 558 mL). The mixture was stirred for 15 min, filtered, and the filtrate was concentrated in vacuo. The residue was partitioned between DCM and 1M aqueous NaOH. The organic phase was washed with a 1M aqueous solution of NaOH, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC (Biotage SNAP KP-SIL®) using Hept / EtOAc / MeOH (89/11/1 to 81/19/1) to give a mixture of regioisomers. Obtained as a salmon solid. The mixture was recrystallized in Hept / EtOAc 75/25 and the mother liquor was filtered and evaporated to separate the solid methyl 4-amino-2-chloro-5-iodobenzoate, thereby separating the methyl 4-amino-2- Chloro-3-iodobenzoate was increased from 59% to 66%.
_{LC-MS (B): t} R = 0.72min; [M + CH 3 CN + H] +: 352.79.

In addition, the pure methyl 4-amino-2-chloro-5-iodobenzoate regioisomer was isolated as a pink to orange solid.
_{LC-MS (B): t} R = 0.75min; [M + CH 3 CN + H] +: 352.80.

A. 1. c. Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate obtained in the previous step and methyl 4-amino-2-chloro- A mixture of 5-iodobenzoate (13.3 mmol) dissolved in Et ₃ N (110 mL) and toluene (110 mL) was heated to 60 ° C. under argon to produce PPh ₃ (1.33 mmol), CuI ( 1.33 mmol), Pd (PPh ₃ ) ₂ Cl ₂ (0.66 mmol) and trimethylsilylacetylene (19.9 mmol). The mixture was stirred at 60 ° C. for 30 min and at 70 ° C. for 1 h, quenched with 10% aqueous NH ₄ Cl and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 1/0 to 8/2) to give the title compound (second eluting product) as a light yellow solid Got as.
_{LC-MS (B): t} R = 0.93min; [M + CH 3 CN + H] +: 322.70.

In addition, methyl 4-amino-2-chloro-5-((trimethylsilyl) ethynyl) benzoate was isolated as an orange solid (first eluting product).
_{LC-MS (B): t} R = 0.97min; [M + CH 3 CN + H] +: 323.22.

A. 1. d. Methyl 4-amino-2-chloro-3- ethynylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate (8.81 mmol) was dissolved in MeOH (8.81 mL). To that was added K ₂ CO ₃ (9.69 mmol). The mixture was stirred for 15 min and the solvent was evaporated. The residue was partitioned between DCM and water. The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC (Isolute® Silica II® from Biotage) using DCM to give the title compound as a yellowish solid.
_{LC-MS (B): t} R = 0.66min; [M + H] +: 210.04.

A. 1. e. Methyl 4-chloro-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate (5.57 mmol), chloro (1,5-cyclooctadiene) rhodium (I) To a mixture of dimer (0.28 mmol) and tris (4-fluorophenyl) phosphine (3.34 mmol) was added degassed DMF (28 mL) under argon. The mixture was heated to 85 ° C. for 50 min, cooled to RT, and partitioned between Et ₂ O and water. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / DCM, 1/0 to 0/1) to give the title compound as a brownish solid.
_{LC-MS (B): t} R = 0.69min; [M + H] +: 210.14.

A. 1. f. 4-Chloro-1H-indole-5-carboxylic acid (saponification I)
To a suspension of methyl 4-chloro-1H-indole-5-carboxylate (4 mmol) in MeOH (24 mL) was added a 2M aqueous solution of LiOH (4 mL). The mixture was stirred at 65 ° C. for 5 h and then at 45 ° C. overnight. Evaporate it, EtOAc and H ₂
Fractionated between O. The aqueous phase was acidified with 25% HCl solution and extracted three times with DCM. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo to give the title compound as an off-white solid.
_{LC-MS (A): t} R = 0.65min; [M + H] +: 196.06.

A. 2. Synthesis of 4-chloro-7-methyl-1H-indole-5-carboxylic acid 2. a. Methyl 4-chloro-7-iodo-3- (methylthio) -1H-indole-5-carboxylate (Gassman indole)
To a suspension of methyl 4-amino-2-chloro-5-iodobenzoate (6.21 mmol) in anhydrous DCM (29 mL) was added NCS (7.45 mmol) at −60 ° C. and the mixture was added for 10 min. Stir. A solution of (methylthio) acetaldehyde dimethyl acetal (7.45 mmol) in anhydrous DCM (5.8 mL) was added at −60 ° C., the mixture was stirred and the temperature was allowed to reach −30 ° C. Et ₃ N (7.45 mmol) dissolved in anhydrous DCM (5 mL) was added at −30 ° C., the mixture was stirred and the temperature was allowed to reach RT. It was concentrated in vacuo, PhCl (17.4 mL) and Et ₃ N (20.5 mmol) were added, the mixture was heated to 125 ° C. and stirred for 2 h. The volatiles were evaporated, the residue was taken up in Et ₂ O (28.7 mL) and treated with 4M HCl in dioxane (11 mL) for 30 min. It was partitioned between EtOAc and a saturated solution of NaHCO ₃ and the organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 9/1 to 65/35) to give the title compound as a yellow solid.
_{LC-MS (A): t} R = 0.93min; [M + H] +: 381.71.

A. 2. b. Methyl 4-chloro-7-methyl-3- (methylthio) -1H-indole-5-carboxylate methyl 4-chloro-7-iodo-3- (methylthio) -1H-indole-5-carboxylate (0.42 mmol) in dioxane (1 mL) was added to a 2M solution of methylchlorozinc in THF (1.04 mmol) and Pd (dppf) Cl ₂ . A solution of DCM (0.03 mmol) in dioxane (0.5 mL) was added. The mixture was stirred in a sealed vial at 65 ° C. overnight, diluted with EtOAc, and washed with a saturated solution of Rochelle salt and brine. The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC (Biotage SNAP KP-SIL®) using DCM to give the title compound as a yellow solid.
_{LC-MS (A): t} R = 0.86min; [M + H] +: 270.11.

A. 2. c. Methyl 4-chloro-7-methyl-1H-indole-5-carboxylate Methyl 4-chloro-7-methyl-3- (methylthio) -1H-indole-5-carboxylate (0.24 mmol). Actmet M Raney nickel (14 mg) was added to what was dissolved in EtOH (4.11 mL). The mixture was stirred at RT for 2 h and filtered over a pad of celite. The filtrate was concentrated in vacuo to give the title compound as a white solid.
_{LC-MS (A): t} R = 0.82min; [M + H] +: 224.16.

A. 2. d. 4-Chloro-7-methyl-1H-indole-5-carboxylic acid (saponification II)
Obtained by dissolving methyl 4-chloro-7-methyl -1H- indol-5-carboxylate (0.11 mmol) in MeOH (0.4mL), THF (0.4mL ) and _H 2 O (0.4mL) LiOH. H ₂ O (0.44 mmol) was added. The mixture was stirred at 60 ° C. for 2 h. It was evaporated and partitioned between EtOAc and _{H 2} O. 25 water phase
Acidified with% HCl solution and extracted three times with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo to give the title compound as a pink solid.
_{LC-MS (A): t} R = 0.69min; [M + H] +: 209.98.

A. 3. Synthesis of 4-chloro-2-methyl-1H-indole-5-carboxylic acid 3. a. Methyl 2-chloro-4-hydrazinyl-5-iodobenzoate Methyl 4-amino-2-chloro-5-iodobenzoate (6.42 mmol) dissolved in 37% HCl (4.40 mL) A solution of sodium nitrite (7.49 mmol) in water (2.15 mL) was added dropwise at 0 ° C. The mixture was stirred at 0 ° C. for 15 min, and tin (II) chloride dihydrate (16 mmol) dissolved in water (1 mL) and 37% HCl (4.28 mL) was added dropwise at 0 ° C. The mixture was stirred for 15 min and quenched by sequential addition of water, 10% Na ₂ CO ₃ solution and 20% NaOH solution. It was extracted 3 times with DCM and the combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 95/5 to 62/38) to give the title compound as a beige solid.
_{LC-MS (A): t} R = 0.73min; [M + CH 3 CN + H] +: 367.75.

A. 3. b. Methyl 4-chloro-7-iodo-2-methyl-3- (methylthio) -1H-indole-5-carboxylate Methyl 2-chloro-4-hydrazinyl-5-iodobenzoate (0.76 mmol). To a solution dissolved in 1.25M HCl in EtOH (1.8 mL) was added 1-methylthio-2-propanone (1.38 mmol). The mixture was stirred at 65 ° C. for 2 h and filtered. The filtrate was concentrated in vacuo and the crude was purified by preparative LC-MS using Method I.
_{LC-MS (A): t} R = 0.96min; [M + H] +: 395.73.

A. 3. c. Methyl 4-chloro-2-methyl-1H-indole-5-carboxylate The reaction mixture was stirred at RT for 48 h, and Actimet M until the reaction was complete.
4-chloro-7-methyl-3- (methylthio) -1H-indole-5-carboxylate was converted to methyl 4-chloro-7-iodo-2-methyl, except that further addition of Raney nickel was required. The compound was prepared using a method analogous to methyl 4-chloro-7-methyl-1H-indole-5-carboxylate, replacing with -3- (methylthio) -1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.83min; [M + H] +: 224.10.

A. 3. d. 4-chloro-2-methyl-1H-indole-5-carboxylic acid methyl 4-chloro- 1H-indole-5-carboxylate is converted to methyl 4-chloro-2-methyl-1H-indole-5-carboxylate The compound was prepared using a method analogous to 4-chloro-1H-indole-5-carboxylic acid, replacing the rate.
_{LC-MS (A): t} R = 0.69min; [M + H] +: 210.04

A. 4). Synthesis of 4,6-dichloro-1H-indole-5-carboxylic acid 4). a. 2,6-dichloro-4-nitrobenzoic acid 1,3-dichloro-2-methyl-5-nitrobenzene (4.85 mmol) dissolved in pyridine (5 mL) and water (10 mL) was heated to 90 ° C. And KMnO ₄ (29.1 mmol) was added in small portions. The mixture was refluxed for 2 h and stirred overnight at RT. It was heated to 90 ° C., an additional amount of KMnO ₄ (12.7 mmol) was added and it was refluxed for 7 h. The mixture was filtered and the filtrate was basified to pH 12-13 with 1M NaOH solution and washed with EtOAc. Acidify the aqueous phase with 1 M HCl solution to pH 1-2,
Extracted 3 times with EtOAc. The combined organic phases were dried over MgSO ₄ and concentrated in vacuo to give the crude acid as an orange solid.
^{_{LC-MS (A): t}} R = 0.45min; LC-MS (D *): t R = 0.17min; [M-H] -: 234.01.

A. 4). b. To a solution of methyl 2,6-dichloro-4-nitrobenzoate 2,6-dichloro-4-nitrobenzoate (1.63 mmol) in DMF (5 mL) was added cesium carbonate (2.44 mmol). The suspension was stirred at RT for 30 min and MeI (1.63 mmol) was added. The mixture was stirred for 2 h, quenched with water and extracted 3 times with EtOAc. The combined organic phases were dried and concentrated in vacuo to give the title compound as a yellow solid.
^{_{LC-MS (A): t}} R = 0.88min; 1 H NMR ((CD 3) 2 SO) δ: 8.48 (s, 2H), 3.99 (s, 3H).

A. 4). c. Methyl 4-amino-2,6-dichlorobenzoate Methyl 2,6-dichloro-4-nitrobenzoate (1.44 mmol) dissolved in DMF (2 mL) was added to tin (II) chloride dihydrate. The Japanese product (5.04 mmol) was added. The mixture was stirred at 100 ° C. for 40 min under microwave conditions and quenched with water. It was basified to pH 11-12 with 1M NaOH solution and extracted 3 times with EtOAc. The combined organic phases were washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 1/0 to 1/1) to give the title compound as a yellow solid.
_{LC-MS (A): t} R = 0.78min; [M + H] +: 220.07.

A. 4). d. Methyl 4-amino-2,6-dichloro-3-iodobenzoate Methyl 4-amino-2-chlorobenzoate was converted to methyl 4-amino-2,6-dichloro, except that no purification was performed. Replacing with benzoate, the compound was prepared using a method analogous to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.86min; [M + CH 3 CN + H] +: 386.57.

A. 4). e. Methyl 4-amino-2,6-dichloro-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodo The mixture of benzoate was replaced with methyl 4-amino-2,6-dichloro-3-iodobenzoate and the compound was used in a manner similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate. Manufactured.
_{LC-MS (A): t} R = 1.00min; [M + H] +: 316.07.

A. 4). f. Methyl 4-amino-2,6-dichloro-3-ethynylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-2,6-dichloro-3 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.83min; [M + H] +: 243.91.

A. 4). g. Methyl 4,6-dichloro-1H-indole-5-carboxylate methyl 4-amino-2-chloro-3-ethynylbenzoate is replaced with methyl 4-amino-2,6-dichloro-3-ethynylbenzoate Was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.84min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.79 (s, 1 H), 7.62 (dd, J ₁ = 2.9 Hz, J ₂ = 2.5 Hz, 1 H), 7.59 (d , J = 0.9 Hz, 1H), 6.58 (m, 1H), 3.91 (s, 3H).

A. 4). h. 4,6-dichloro-1H-indole-5-carboxylate methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 4,6-dichloro-1H-indole-5-carboxylate The compound was prepared using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting for the rate.
_{LC-MS (A): t} R = 0.68min. _{^{LC-MS (D *):}} t R = 0.15min; [M-H] -: 228.06.

A. 5. Synthesis of 4-chloro-7-isobutyl-1H-indole-5-carboxylic acid 5. a. Methyl 4-amino-2-chloro-5-isobutylbenzoate Methyl 4-amino-2-chloro-5-iodobenzoate (3.36 mmol) was dissolved in toluene / water, 20/1 (40 mL). To it was added K ₃ PO ₄ (11.8 mmol), PdCl ₂ (PPh ₃ ) ₂ (0.34 mmol) and (2-methylpropyl) boronic acid (6.72 mmol) under argon. The mixture was heated in a sealed vial at 110 ° C. overnight, quenched with water and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-Sil®; Hept / EtOAc, 1/0 to 0/1) to give the title compound as a yellow oil.
_{LC-MS (A): t} R = 0.90min; [M + CH 3 CN + H] +: 283.06.

A. 5. b. Methyl 4-amino-2-chloro-3-iodo-5-isobutylbenzoate This compound is obtained by replacing methyl 4-amino-2-chlorobenzoate with methyl 4-amino-2-chloro-5-isobutylbenzoate. Was prepared using a method similar to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.97min; [M + CH 3 CN + H] +: 408.77.

A. 5. c. Methyl 4-amino-2-chloro-5-isobutyl-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the iodobenzoate mixture with methyl 4-amino-2-chloro-3-iodo-5-isobutylbenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.07min; [M + H] +: 337.90.

A. 5. d. Methyl 4-amino-2-chloro-3-ethynyl-5-isobutylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-2-chloro-5 The compound was prepared using a method similar to methyl 4-amino-2-chloro-3-ethynylbenzoate, substituting with isobutyl-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.94min; [M + H] +: 266.07.

A. 5. e. Methyl 4-chloro-7-isobutyl-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-2-chloro-3-ethynyl-5- The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate, substituting with isobutylbenzoate.
_{LC-MS (A): t} R = 0.94min; [M + H] +: 266.16.

A. 5. f. 4-chloro-7-isobutyl-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 4-chloro-7-isobutyl-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.82min, [M + H] +: 252.06.

A. 6). Synthesis of 4-chloro-7- (3-methoxypropyl) -1H-indole-5-carboxylic acid 6). a. Methyl 4-amino-2-chloro-5- (3-methoxyprop-1-yn-1-yl) benzoate Methyl 4-amino-2-chloro-5-iodobenzoate (3.51 mmol), Pd To a mixture of (PPh ₃ ) ₂ Cl ₂ (0.18 mmol) and CuI (0.18 mmol), THF (12 mL), Et ₃ N (14 mmol) and methyl propargyl ether (14 mmol) were sequentially added under argon. The mixture was stirred at RT for 1 h, diluted with EtOAc and filtered. The filtrate was concentrated in vacuo and the crude was purified by CC (Biotage SNAP KP-Sil®; Hept / EtOAc from 85/15 to 40/60) to give the title compound as an orange solid Obtained.
_{LC-MS (A): t} R = 0.82min, [M + H] +: 253.99.

A. 6). b. Methyl 4-amino-2-chloro-5- (3-methoxypropyl) benzoate methyl 4-amino-2-chloro-5- (3-methoxyprop-1-in-1-yl) benzoate (3 .48 mmol) dissolved in EtOH (14 mL) was added PtO ₂ (0.35 mmol). The mixture was stirred for 2 h under hydrogen atmosphere. It was filtered over celite, washed with EtOH and concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-Sil®; Hept / EtOAc, 1/0 to 8/2) to give the title compound as a yellow oil.
_{LC-MS (A): t} R = 0.80min, [M + H] +: 257.90.

A. 6). c. Methyl 4-amino-2-chloro-3-iodo-5- (3-methoxypropyl) benzoate Methyl 4-amino-2-chlorobenzoate is converted to methyl 4-amino-2-chloro-5- (3- Replacing with methoxypropyl) benzoate, the compound was prepared using a method similar to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.90min; [M + H] +: 383.91.

A. 6). d. Methyl 4-amino-2-chloro-5- (3-methoxypropyl) -3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino- The mixture of 2-chloro-5-iodobenzoate was replaced with methyl 4-amino-2-chloro-3-iodo-5- (3-methoxypropyl) benzoate and the compound was converted to methyl 4-amino-2-chloro-3 Prepared using an analogous method to-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 1.00min; [M + H] +: 353.85.

A. 6). e. Methyl 4-amino-2-chloro-3-ethynyl-5- (3-methoxypropyl) benzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 4-amino- The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, substituting 2-chloro-5- (3-methoxypropyl) -3-((trimethylsilyl) ethynyl) benzoate. did.
_{LC-MS (A): t} R = 0.85min; [M + H] +: 281.83.

A. 6). f. Methyl 4-chloro-7- (3-methoxypropyl) -1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-2-chloro-3 The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate, replacing with ethynyl-5- (3-methoxypropyl) benzoate.
_{LC-MS (A): t} R = 0.86min; [M + H] +: 282.07.

A. 6). g. 4-chloro-7- (3-methoxypropyl) -1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5 -carboxylate is converted to methyl 4-chloro-7- The compound was prepared using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, replacing with (3-methoxypropyl) -1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.72min, [M + H] +: 268.07.

A. 7). Synthesis of 4-methyl-1H-indole-5-carboxylic acid 7). a. Methyl 4-methyl -1H- indol-5-carboxylate <br/> methyl 4-chloro -1H- indole-5-carboxylate _{(0.48mmol), K 2 CO 3} (1.91mmol) and PEPPSI (TM ) -IPr (0.05 mmol) was put in a pressure vessel, and anhydrous dioxane (2 mL) and trimethylboroxine (0.23 mL) were added successively. The tube was sealed under argon and heated to 115 ° C. After 17 h, the reaction mixture was cooled to RT, filtered over a pad of celite, and the cake was washed with EtOAc. The filtrate was concentrated in vacuo and the crude was purified by CC (Biotage SNAP KP-Sil®; Hept / EtOAc, 96/4 to 50/50) to give the title compound as a white solid. .
_{LC-MS (A): t} R = 0.78min, [M + H] +: 190.10.

A. 7). b. 4-Methyl-1H-indole-5-carboxylic acid Methyl 4-chloro-7- methyl-1H-indole-5-carboxylate was prepared except that the reaction mixture was stirred at 60C for 16h. The compound was prepared using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting methyl 4-methyl-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.64min. _{^{LC-MS (D *):}} t R = 0.15min, [M-H] -: 173.91.

A. 8). Synthesis of 4-ethyl-1H-indole-5-carboxylic acid 8). a. Methyl 4-vinyl-1H-indole-5-carboxylate Substituting trimethylboroxine with vinylboronic acid pinacol ester to give a similar method to methyl 4-methyl-1H-indole-5-carboxylate. Manufactured.
_{LC-MS (A): t} R = 0.80min, [M + H] +: 202.20.

A. 8). b. Methyl 4-ethyl-1H-indole-5-carboxylate Methyl 4-vinyl-1H-indole-5-carboxylate (0.21 mmol) dissolved in EtOH (2 mL) was added to platinum dioxide ( 0.021 mmol) was added. The mixture was stirred under a hydrogen atmosphere for 2 h, filtered over celite and concentrated in vacuo to give the title compound as a pinkish solid.
_{LC-MS (A): t} R = 0.83min, [M + H] +: 204.18.

A. 8). c. 4-Ethyl-1H-indole-5-carboxylic acid 4-chloro-7-methyl-1H-indole-5-carboxylate is replaced with methyl 4-methyl-1H-indole-5-carboxylate to give the compound 4 Prepared using a method analogous to -chloro-7-methyl-1H-indole-5-carboxylic acid.
_{LC-MS (A): t} R = 0.70min, [M + CH 3 CN + H] +: 231.08.

A. 9. Synthesis of 4-chloro-7-acetyl-1H-indole-5-carboxylic acid 9. a. Methyl 4-amino-2-chloro-3,5-diiodobenzoate Suspended methyl 4-amino-2-chlorobenzoate (10.8 mmol) in EtOH (100 mL) under argon. Iodine (23.7 mmol) and silver sulfate (10.8 mmol) were added. The mixture was stirred for 2 h, filtered and the filtrate was treated with 10% aqueous sodium thiosulfate. After evaporation of EtOH, the residue was partitioned between EtOAc and 1M aqueous NaOH. The organic phase was washed with 1M aqueous NaOH and brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC using DCM and the solid was triturated in CH ₃ CN and filtered to give the title compound as a beige solid.
_{LC-MS (A): t} R = 0.92min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.13 (s, 1H), 6.02 (s, 2H), 3.79 (s, 3H).

A. 9. b. Methyl 4-amino-2-chloro-3-iodo-5-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3,5-diiodobenzoate (9.6 mmol) was added to Et _3. Dissolve in N (80 mL) and toluene (80 mL) under argon with PPh ₃ (0.96 mmol), CuI (4.80 mmol), Pd (PPh ₃ ) ₂ Cl ₂ (0.48 mmol) and trimethylsilylacetylene. Treated with (10.1 mmol). The mixture was stirred at RT for 2 h, quenched with 10% aqueous NH ₄ Cl and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/0 to 85/15) to give the title compound as an orange solid.
_{LC-MS (A): t} R = 1.05min; [M + H] +: 408.02.

A. 9. c. Methyl 5-acetyl-4-amino-2-chloro-3-iodobenzoate methyl 4-amino-2-chloro-3-iodo-5-((trimethylsilyl) ethynyl) benzoate (4.39 mmol) in toluene What was dissolved in (20 mL) was treated with 4-toluenesulfonic acid monohydrate (11 mmol). The mixture was stirred at 80 ° C. for 3 h and poured into water. The aqueous phase was basified with 32% aqueous NaOH to pH = 12-13 and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/1 to 75/25) to give the title compound as a light yellow solid.
LC-MS (A): t _R = 0.88 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.37 (s, 1H), 8.00 (sbr, 2H), 3.83 (s 3H), 2.63 (s, 3H.)

A. 9. d. Methyl 5-acetyl-4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the iodobenzoate mixture with methyl 5-acetyl-4-amino-2-chloro-3-iodobenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.03min; [M + H] +: 324.25.

A. 9. e. Methyl 5-acetyl-4-amino-2-chloro-3-ethynylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 5-acetyl-4-amino-2 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -chloro-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.84min; [M + H] +: 251.99.

A. 9. f. Methyl 7-acetyl-4-chloro-1H-indole-5-carboxylate methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 5-acetyl-4-amino-2-chloro-3- Substituting ethynyl benzoate, the compound was prepared using a method similar to methyl 4-chloro-1H-indole-5-carboxylate. LC-MS (A): t _R = 0.83 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.96 (s, 1 H), 8.32 (s, 1 H), 7.56 (dd _{, J 1 = J 2 = 2.9Hz} , 1H), 6.74 (dd, J 1 = 2.1Hz, J 2 = 3.2Hz, 1H), 3.92 (s, 3H), 2.72 ( s, 3H).

A. 9. g. 7-acetyl-4-chloro-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 7-acetyl-4-chloro-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
LC-MS (A): t _R = 0.69 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 13.25 (s, 1 H), 11.91 (s, 1 H), 8.34 (s _{, 1H), 7.54 (dd,} J 1 = J 2 = 2.9Hz, 1H), 6.72 (dd, J 1 = 2.1Hz, J 2 = 3.1Hz, 1H), 2.72 ( s, 3H).

A. 10. Synthesis of 7-methyl-4- (trifluoromethyl) -1H-indole-5-carboxylic acid 10. a. Methyl 4-amino-2- (trifluoromethyl) benzoate 4-amino-2-chlorobenzoic acid is replaced with 4-amino-2- (trifluoromethyl) benzoic acid to convert the compound to methyl 4-amino-2- Prepared using a method similar to chlorobenzoate.
_{LC-MS (A): t} R = 0.77min, [M + H] +: 220.04.

A. 10. b. Methyl 4-amino-5-iodo-2- (trifluoromethyl) benzoate The methyl 4-amino-2-chlorobenzoate was converted to methyl 4-amino-2 except that only the 5-iodo regioisomer was isolated. Using a method analogous to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, substituting-(trifluoromethyl) benzoate Manufactured.
_{LC-MS (A): t} R = 0.88min, [M + H] +: 345.7.

A. 10. c. Methyl 4-amino-5-methyl-2- (trifluoromethyl) benzoate Methyl 4-amino-5-iodo-2- (trifluoromethyl) benzoate (24.6 mmol) in dioxane (49 mL). To the dissolved one was added a 2M solution of methylchlorozinc in THF (61.6 mmol) under argon, then Pd (dppf) Cl ₂ . DCM (1.72 mmol) was added. The mixture was stirred in a sealed vial at 65 ° C. for 30 min, diluted with EtOAc and filtered. The filtrate was washed with a saturated solution of Rochelle salt and brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC (Biotage SNAP KP-SIL®) using DCM to give the title compound as a brown solid.
_{LC-MS (A): t} R = 0.81min; [M + H] +: 234.01.

A. 10. d. Methyl 4-amino-3-iodo-5-methyl-2- (trifluoromethyl) benzoate Methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred at 50 <0> C for 7 h. Is replaced with methyl 4-amino-5-methyl-2- (trifluoromethyl) benzoate to give methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5- Prepared using a method similar to a mixture of iodobenzoates.
_{LC-MS (A): t} R = 0.88min, [M + H] +: 400.78.

A. 10. e. Methyl 4-amino-5-methyl-2- (trifluoromethyl) -3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino except that the reaction mixture was stirred at 70 <0> C for 3 h30. A mixture of 2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate was replaced with methyl 4-amino-3-iodo-5-methyl-2- (trifluoromethyl) benzoate This compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 1.02min; [M + H] +: 330.09.

A. 10. f. Methyl 4-amino-3-ethynyl-5-methyl-2- (trifluoromethyl) benzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 4-amino-5 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -methyl-2- (trifluoromethyl) -3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.85min; [M + H] +: 257.90.

A. 10. g. Methyl 7-methyl-4- (trifluoromethyl) -1H-indo
Ru-5-carboxylate methyl 4-amino-2-chloro-3-ethynylbenzoate was replaced with methyl 4-amino-3-ethynyl-5-methyl-2- (trifluoromethyl) benzoate The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.86min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.87 (s, 1H), 7.68 (dd, J ₁ = J ₂ = 2.8 Hz, 1H), 7.22 (s, 1H), 6.65 (m, 1H), 3.85 (s, 3H), 2.58 (s, 3H).

A. 10. h. 7-methyl-4- (trifluoromethyl) -1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-, except that the reaction mixture was stirred at 60C overnight. 1H-indole-5-carboxylate is replaced with methyl 7-methyl-4- (trifluoromethyl) -1H-indole-5-carboxylate to give 4-chloro-7-methyl-1H-indole-5 -Prepared using a method similar to carboxylic acid.
LC-MS (A): t _R = 0.73 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 13.07 (s br, 1 H), 11.79 (s, 1 H), 7.65 ( dd, J ₁ = J ₂ = 2.7 Hz, 1H), 7.21 (s, 1H), 6.63 (m, 1H), 2.57 (s, 3H).

A. 11. Synthesis of 4,7-dimethyl-1H-indole-5-carboxylic acid 11. a. 4-Amino-2,5-dimethylbenzonitrile 4-bromo-2,5-dimethylaniline (5 mmol), zinc cyanide (6 mmol) and Pd (PPh ₃ ) ₄ (0.1 mmol) are put in a pressure vessel and anhydrous. DMF (3 mL) was added. The tube was sealed under argon and heated at 110 ° C. After 35 h, it was quenched with 10% Na ₂ CO ₃ solution and extracted 3 times with EtOAc. The organic phase was washed with saturated NaHCO ₃ solution, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 92/8 to 40/60) to give the title compound as a white solid.
_{LC-MS (A): t} R = 0.72min, [M + H] +: 147.16.

A. 11. b. 4-Amino-3-iodo-2,5-dimethylbenzonitrile Methyl 4-amino-2-chlorobenzoate is replaced with 4-amino-2,5-dimethylbenzonitrile to replace the compound with methyl 4- Prepared using a method similar to a mixture of amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.85min; [M + CH 3 CN + H] +: 313.83.

A. 11. c. 4-amino-2,5-dimethyl-3-((trimethylsilyl) ethynyl) benzonitrile methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodo The mixture of benzoates was replaced with 4-amino-3-iodo-2,5-dimethylbenzonitrile and the compound was used in a manner similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate. Manufactured.
_{LC-MS (A): t} R = 1.00min; [M + H] +: 243.13.

A. 11. d. 4-Amino-3-ethynyl-2,5-dimethylbenzonitrile Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to 4-amino-2,5-dimethyl-3- The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, substituting ((trimethylsilyl) ethynyl) benzonitrile.
_{LC-MS (A): t} R = 0.81min; [M + CH 3 CN + H] +: 212.12.

A. 11. e. 4,7-dimethyl-1H-indole-5-carbonitrile methyl 4-amino-2-chloro-3 -ethynylbenzoate was replaced with 4-amino-3-ethynyl-2,5-dimethylbenzonitrile This compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.81min; [M + CH 3 CN + H] +: 212.13. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.64 (s br, 1H), 7.52 (dd, J ₁ = J ₂ = 2.8 Hz, 1H), 7.17 (s, 1H) 6.67 (dd, J ₁ = 2.9 Hz, J ₂ = 1.9 Hz, 1H), 2.63 (s, 3H), 2.47 (s, 3H).

A. 11. f. 4,7-dimethyl-1H-indole-5-carboxylic acid 4,7-dimethyl-1H-indole-5-carbonitrile (0.19 mmol) dissolved in EtOH (1 mL) was added to a 4M KOH solution (3. 9 mL) was added and the mixture was heated at 120 ° C. for 18 h. It was partitioned between water and EtOAc and the aqueous phase was acidified with 25% HCl solution to pH 1-2 and extracted three times with EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo to give the title compound as a white solid.
_{LC-MS (A): t} R = 0.68min; [M + H] +: 190.18.

A. 12 Synthesis of 4-chloro-7-ethyl-1H-indole-5-carboxylic acid 12 a. Methyl 4-amino-2-chloro-5-ethynyl-3-iodobenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-2-chloro-3 The compound was prepared using a method similar to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with iodo-5-((trimethylsilyl) ethynyl) benzoate.
LC-MS (A): t _R = 0.88 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.76 (s, 1H), 6.17 (s, 2H), 4.65 (s 1H), 3.78 (s, 3H).

A. 12 b. Methyl 4-amino-2-chloro-5-ethyl-3-iodobenzoate Methyl 4-amino-2-chloro-5-ethynyl-3-iodobenzoate (0.99 mmol) in EtOH (4 mL). To the dissolved material, platinum dioxide (0.099 mmol) was added. The mixture was stirred for 1 h under hydrogen atmosphere, filtered over celite and concentrated in vacuo. The crude was purified on CC using DCM to give the title compound as a light yellow solid.
_{LC-MS (A): t} R = 0.90min, [M + H] +: 339.83.

A. 12 c. Methyl 4-amino-2-chloro-5-ethyl-3-((trimethylsilyl) ethynyl) benzoate methyl 4-amino-2-chloro, except that the reaction was stirred at 80C for 30 min. The mixture of -3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate was replaced with methyl 4-amino-2-chloro-5-ethyl-3-iodobenzoate to give the compound methyl 4-amino Prepared using a method analogous to 2-chloro-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 1.03min; [M + H] +: 310.22.

A. 12 d. Methyl 4-amino-2-chloro-5-ethyl-3-ethynylbenzo
Acetate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is replaced with methyl 4-amino-2-chloro-5-ethyl-3-((trimethylsilyl) ethynyl) benzoate, This compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate.
_{LC-MS (A): t} R = 0.86min; [M + H] +: 238.21.

A. 12 e. Methyl 4-chloro-7-ethyl-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-2-chloro-5-ethyl-3- Substituting ethynyl benzoate, the compound was prepared using a method similar to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.86min, [M + H] +: 238.05.

A. 12 f. 4-chloro-7-ethyl-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 7-methyl-4- (trifluoromethyl) The compound was prepared using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, replacing 1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.73min, [M + H] +: 224.20.

A. 13. Synthesis of 7-chloro-4-methyl-1H-indole-5-carboxylic acid 13. a. Methyl 4-acetamido-5-chloro-2-(((trifluoromethyl) sulfonyl) oxy) benzoate Methyl 4-acetamido-5-chloro-2-hydroxybenzoate (20.5 mmol) was added to DCM (100 mL). Et ₃ N (22.6 mmol) and trifluoromethanesulfonic anhydride (22.6 mmol) were added at 0 ° C. to what was dissolved therein. The mixture was stirred at RT for 1 h, quenched with a saturated solution of NaHCO ₃ and extracted with DCM. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/0 to 65/35) to give the title compound as a light yellow solid.
LC-MS (A): t _R = 0.90 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 9.94 (s, 1H), 8.35 (s, 1H), 8.14 (s 1H, 3.88 (s, 3H), 2.23 (s, 3H).

A. 13. b. Methyl 4-acetamido-5-chloro-2-methylbenzoate <br/> methyl 4-acetamido-5-chloro-2 - (((trifluoromethyl) sulfonyl) oxy) benzoate _(2.61mmol), K 3 PO ₄ (5.23 mmol), methyl boronic acid (5.23 mmol) and Pd (dppf) Cl ₂ . A suspension of DCM (0.26 mmol) in THF (26 mL) was stirred at 65 ° C. for 2 h under argon. The reaction mixture was quenched with a saturated solution of NaHCO ₃ and extracted three times with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/0 to 60/40) to give the title compound as a white solid.
_{LC-MS (A): t} R = 0.77min, [M + H] +: 241.90.

A. 13. c. Methyl 4-amino-5-chloro-2-methylbenzoate <br/> methyl 4-acetamido-5-chloro-2-methylbenzoate and (2.25 mmol) is dissolved in a in MeOH _(14mL), K 2 CO ₃ (2.48 mmol) was added. The suspension is stirred at RT for 3 days, the MeOH is evaporated and the residue is washed with EtOAc and HC.
Fractionated between 1M solutions of l. The aqueous phase was extracted twice with EtOAc and the combined organic phases were washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/0 to 80/20) to give the title compound as a white solid.
_{LC-MS (A): t} R = 0.81min, [M + H] +: 200.12.

A. 13. d. Methyl 4-amino-5-chloro-3-iodo-2-methylbenzoate Methyl 4-amino-2-chlorobenzoate was converted to methyl 4-amino except that the reaction mixture was stirred at RT for 1 h. Substituting -5-chloro-2-methylbenzoate for a similar method to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate Manufactured.
_{LC-MS (A): t} R = 0.91min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.76 (s, 1H), 6.02 (s, 2H), 3.77 (s, 3H), 2.65 (s, 3H).

A. 13. e. Methyl 4-amino-5-chloro-2-methyl-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the mixture of iodobenzoate with methyl 4-amino-5-chloro-3-iodo-2-methylbenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.06min; [M + H] +: 296.14.

A. 13. f. Methyl 4-amino-5-chloro-3-ethynyl-2-methylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-5-chloro-2 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -methyl-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.88min; [M + H] +: 224.03.

A. 13. g. Methyl 7-chloro-4-methyl-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-5-chloro-3-ethynyl-2- The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate, replacing with methyl benzoate.
_{LC-MS (A): t} R = 0.86 min, [M + H] +: 223.46.

A. 13. h. 7-chloro-4-methyl-1H-indole-5-carboxylic acid methyl 4 -chloro-7-methyl-1H-indole-5-carboxylate is converted to methyl 7-chloro-4-methyl-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.72min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 12.62 (s, 1H), 11.77 (s, 1H), 7.67 (s, 1H), 7.49 (dd, J ₁ = J ₂ = 2.8 Hz, 1H), 6.78 (dd, J ₁ = 2.0 Hz, J ₂ = 3.0 Hz, 1H), 2.75 (s, 3H).

A. 14 Synthesis of 7-methoxy-4-methyl-1H-indole-5-carboxylic acid 14 a. To a solution of 5-methoxy-2-methyl-4-nitrobenzonitrile CuCN (25.2 mmol) in CH ₃ CN (32 mL), tert-butyl nitrite (19.8 mmol) was added at RT, then A suspension of 5-methoxy-2-methyl-4-nitroaniline (11 mmol) in CH ₃ CN (5 mL) was added at 0 ° C. The mixture was stirred at 85 ° C. for 1 h, then at RT overnight, quenched with 10% Na ₂ CO ₃ solution and extracted three times with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc, 100/0 to 85/15) to give the title compound as an orange solid.
LC-MS (A): t _R = 0.82 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.00 (s, 1 H), 7.88 (s, 1 H), 3.95 (s 3H), 2.47 (s, 3H).

A. 14 b. 5-methoxy-2-methyl-4-nitrobenzoic acid 5-methoxy-2-methyl-4-nitrobenzonitrile (1.92 mmol) was suspended in 2-propanol (4.3 mL) and water (4.3 mL). To the cloudy one, KOH (9.6 mmol) was added. The mixture was stirred at 70 ° C. for 2 h, diluted with water and extracted three times with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was dissolved in water (1 mL) and H ₂ SO ₄ (2.9 mL) and the mixture was heated to 80 ° C. Sodium nitrite (3.46 mmol) was added dropwise and the reaction mixture was stirred at 80 ° C. for 45 min. It was diluted with water and extracted 3 times with EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo to give the crude title compound as an orange solid.
^{_{LC-MS (A): t}} R = 0.82min; LC-MS (D *): t R = 0.17min; [M-H] -: 210.19.

A. 14 c. Methyl 5-methoxy-2-methyl-4-nitrobenzoate 4-amino-2-chloro-benzoic acid was replaced with 5-methoxy-2-methyl-4-nitrobenzoic acid to convert the compound to methyl 4-amino-2 -Prepared using a method similar to chlorobenzoate.
LC-MS (A): t _R = 0.85 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.87 (s, 1H), 7.64 (s, 1H), 3.95 (s 3H), 3.89 (s, 3H), 2.46 (s, 3H).

A. 14 d. Methyl 4-amino-5-methoxy-2-methylbenzoate Methyl 5-methoxy-2-methyl-4-nitrobenzoate (2.13 mmol) dissolved in MeOH (21 mL) was dissolved in zinc dust ( 21.3 mmol) at RT followed by ammonium formate (21.3 mmol) at 0 ° C. The mixture was stirred at RT for 1 h, filtered over celite, and the filtrate was concentrated in vacuo. The residue was partitioned between EtOAc and a saturated solution of NaHCO ₃ . The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (DCM / MeOH, 100/0 to 99/1) to give the title compound as a light yellow solid.
LC-MS (A): tR = 0.71 min; [M + H] +: 196.15.

A. 14 e. Methyl 4-amino-3-iodo-5-methoxy-2-methylbenzoate Methyl 4-amino-2-chlorobenzoate was converted to methyl 4-amino except that the reaction mixture was stirred at RT for 1 h. Substituting -5-methoxy-2-methylbenzoate, the compound was treated in a similar manner to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate. Manufactured.
_{LC-MS (A): t} R = 0.87min, [M + H] +: 321.73.

A. 14 f. Methyl 4-amino-5-methoxy-2-methyl-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the iodobenzoate mixture with methyl 4-amino-3-iodo-5-methoxy-2-methyl benzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.01min; [M + H] +: 292.21.

A. 14 g. Methyl 4-amino-3-ethynyl-5-methoxy-2-methylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-5-methoxy-2 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -methyl-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.83min; [M + H] +: 220.13.

A. 14 h. Methyl 7-methoxy-4-methyl-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-3-ethynyl-5-methoxy-2- The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate, replacing with methyl benzoate. _{LC-MS (A): t} R = 0.81min; [M + H] +: 220.07.

A. 14 i. 7-methoxy-4-methyl-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 7-methoxy-4-methyl-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.67min; [M + H] +: 206.15.

A. 15. Synthesis of 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid 15. a. 4-Amino-2-chloro-5-methoxybenzonitrile 4-bromo-2,5-dimethylaniline was converted to 4-bromo-5 except that the reaction mixture was stirred at 110C overnight. The compound was prepared using a method analogous to 4-amino-2,5-dimethylbenzonitrile, replacing with -chloro-2-methoxyaniline.
_{LC-MS (A): t} R = 0.76min, [M + H] +: 183.19.

A. 15. b. Methyl 4-amino-2-chlorobenzoate was converted to 4-amino-2-chloro-benzoate except that the 4-amino-2-chloro-3-iodo-5-methoxybenzonitrile reaction mixture was stirred at RT for 45 min. Replacing with 5-methoxybenzonitrile, the compound was prepared using a method similar to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate. . LC-MS (A): t _R = 0.86 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.33 (s, 1H), 6.11 (s, 2H), 3.85 (s 3H).

A. 15. c. 4-amino-2-chloro-5-methoxy-3-((trimethylsilyl) ethynyl) benzonitrile methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 The mixture of iodobenzoate was replaced with 4-amino-2-chloro-3-iodo-5-methoxybenzonitrile and the compound was similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.00min; [M + H] +: 279.04.

A. 15. d. 4-Amino-2-chloro-3-ethynyl-5-methoxybenzonitrile Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to 4-amino-2-chloro-5- The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, substituting methoxy-3-((trimethylsilyl) ethynyl) benzonitrile.
_{LC-MS (A): t} R = 0.82min; [M + CH 3 CN + H] +: 248.23.

A. 15. e. 4-Chloro-7-methoxy-1H-indole-5-carbonitrile methyl 4-amino-2-chloro-3-ethynylbenzoate was replaced with 4-amino-2-chloro-3-ethynyl-5-methoxybenzonitrile This compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.83min, [M + CH 3 CN + H] +: 248.23. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 12.23 (s, 1H), 7.56 (d, J = 3.1 Hz, 1H), 7.14 (s, 1H), 6.61 ( d, J = 3.1 Hz, 1H), 3.99 (s, 3H).

A. 15. f. 4-Chloro-7-hydroxy-1H-indole-5-carbonitrile 4-Chloro-7-methoxy-1H-indole-5-carbonitrile (2.53 mmol) dissolved in DCM (106 mL) was dissolved in BBr. ₃ of a 1M solution in DCM (14.8 mmol), was added dropwise at -78 ° C.. The mixture was warmed to RT and stirred at 45 ° C. for 15 h and then at 55 ° C. for 4 h30. It was quenched with MeOH (40 mL) and concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; EtOAc / MeOH, 100/0 to 90/10) to give the title compound as a brownish solid.
LC-MS (A): t _R = 0.75 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.99 (s, 1 H), 10.69 (s, 1 H), 7.54 (dd , J ₁ = J ₂ = 2.8 Hz, 1H), 6.80 (s, 1H), 6.57 (m, 1H).

A. 15. g. 4-Chloro-7-ethoxy-1H-indole-5-carbonitrile 4-Chloro-7-hydroxy-1H-indole-5-carbonitrile (1.31 mmol) dissolved in DMF (2.6 mL) , K ₂ CO ₃ (1.58 mmol) and ethyl bromide (1.44 mmol) were added at 0 ° C. The mixture was stirred at RT overnight, quenched with water and extracted with EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc from 100/0 to 50/50) to give the title compound as a white solid. _{LC-MS (A): t} R = 0.88min, [M + CH 3 CN + H] +: 262.10.

A. 15. h. Replacing 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid 4,7-dimethyl-1H-indole-5-carbonitrile with 4-chloro-7-ethoxy-1H-indole-5-carbonitrile This compound was prepared using a method analogous to 4,7-dimethyl-1H-indole-5-carboxylic acid.
_{LC-MS (A): t} R = 0.73min; [M + H] +: 240.05.

A. 16. Synthesis of 4-chloro-7-propyl-1H-indole-5-carboxylic acid 16. a. Replacing methyl 4-amino-2-chloro-5-propylbenzoate (2-methylpropyl) boronic acid with 1-propylboronic acid, the compound is similar to methyl 4-amino-2-chloro-5-isobutylbenzoate. Produced using the method.
_{LC-MS (A): t} R = 0.86min; [M + H] +: 228.15.

A. 16. b. Methyl 4-amino-2-chloro-3-iodo-5-propylbenzoate The compound is obtained by replacing methyl 4-amino-2-chlorobenzoate with methyl 4-amino-2-chloro-5-propylbenzoate. Was prepared using a method similar to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.94min; [M + H] +: 353.66.

A. 16. c. Methyl 4-amino-2-chloro-5-propyl-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the iodobenzoate mixture with methyl 4-amino-2-chloro-3-iodo-5-propylbenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 1.05min; [M + H] +: 324.10.

A. 16. d. Methyl 4-amino-2-chloro-3-ethynyl-5-propylbenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 4-amino-2-chloro-5 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -propyl-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.90min; [M + H] +: 252.25.

A. 16. e. Methyl 4-chloro-7-propyl-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate was converted to methyl 4-amino-2-chloro-3-ethynyl-5- The compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate, replacing with propylbenzoate. _{LC-MS (A): t} R = 0.91min; [M + H] +: 252.21.

A. 16. f. 4-chloro-7-propyl-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 4-chloro-7-propyl-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.78min, [M + H] +: 238.19.

A. 17. Synthesis of 7- (2- (tert-butoxy) ethoxy) -4-chloro-1H-indole-5-carboxylic acid 17. a. 7- (2- (tert-Butoxy) ethoxy) -4-chloro-1H-
Indole-5-carbonitrile Ethyl bromide was replaced with 2- (2-bromoethoxy) -2-methylpropane, except that the reaction mixture was stirred at 80 <0> C for 8 h. Prepared using a method analogous to 4-chloro-7-ethoxy-1H-indole-5-carbonitrile.
_{LC-MS (A): t} R = 0.94min, [M + CH 3 CN + H] +: 334.12.

A. 17. b. 7- (2- (tert-butoxy) ethoxy) -4-chloro-1H-indole-5-carboxylic acid 4,7-dimethyl-1H-indole-5-carbonitrile is converted to 7- (2- (tert-butoxy) The compound was prepared using a method analogous to 4,7-dimethyl-1H-indole-5-carboxylic acid, substituting ethoxy) -4-chloro-1H-indole-5-carbonitrile.
_{LC-MS (A): t} R = 0.80min; [M + CH 3 CN + H] +: 353.16. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 12.86 (s, very br, 1H), 11.74 (s, 1H), 7.43 (dd, J ₁ = J ₂ = 2.7 Hz 1H), 7.17 (s, 1H), 6.58 (m, 1H), 4.26 (m, 2H), 3.74 (m, 2H), 1.18 (s, 9H).

A. 18. Synthesis of 4-chloro-7-methoxy-1H-indole-5-carboxylic acid 18. a. 1-chloro-4-methoxy-2-methyl-5-nitrobenzene 4-chloro-5-methyl-2-nitrophenol (5.33 mmol) and K ₂ CO ₃ (10.70 mmol) were suspended in DMF (11 mL). To the cloudy, methyl iodide (5.86 mmol) was added and the mixture was stirred at RT for 6 h. It was quenched with half-saturated NaHCO ₃ solution and extracted 3 times with EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Biotage SNAP KP-SIL®; Hept / EtOAc from 85/15 to 80/20) to give the title compound as a yellow solid.
LC-MS (A): t _R = 0.88 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.01 (s, 1H), 7.44 (s, 1H), 3.93 (s 3H), 2.42 (s, 3H).

A. 18. b. 2-Chloro-5-methoxy-4-nitrobenzoic acid 1-chloro-4-methoxy-2-methyl-5-nitrobenzene (4.32 mmol) suspended in H ₂ O (207 mL) was added to KMnO _4. (17.30 mmol) was added and the mixture was refluxed for 3 h and filtered to remove solids. The filtrate was quenched with 40% NaHSO ₃ solution, acidified to pH 1-2 with 1M HCl solution and extracted three times with EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo to give the title compound as a light yellow solid.
^{_{LC-MS (A): t}} R = 0.69min; LC-MS (D *): t R = 0.26min, [M-H] -: 230.04.

A. 18. c. 4-amino-2-chloro-5-methoxybenzoic acid methyl 2,6-dichloro-4-nitro, except that the mixture was heated at 100 <0> C for 15 min under microwave conditions The compound was prepared using a method analogous to methyl 4-amino-2,6-dichlorobenzoate, replacing benzoate with 2-chloro-5-methoxy-4-nitrobenzoic acid.
_{LC-MS (A): t} R = 0.59min; [M + CH 3 CN + H] +: 242.70.

A. 18. d. Methyl 4-amino-2-chloro-5-methoxybenzoate 4-amino-2-chlorobenzoic acid is replaced with 4-amino-2-chloro-5-methoxybenzoic acid to give the compound methyl 4-amino-2- Prepared using a method similar to chlorobenzoate.
_{LC-MS (A): t} R = 0.75min; [M + H] +: 216.14.

A. 18. e. Methyl 4-amino-2-chloro-3-iodo-5-methoxybenzoate methyl 4-amino-2-chloro-5-methoxybenzoate is replaced with methyl 4-amino-2-chloro-5-methoxybenzoate Was prepared using a method similar to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
_{LC-MS (A): t} R = 0.85min; [M + H] +: 341.67.

A. 18. f. Methyl 4-amino-2-chloro-5-methoxy-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the mixture of iodobenzoate with methyl 4-amino-2-chloro-3-iodo-5-methoxybenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 0.99min; [M + H] +: 311.94.

A. 18. g. Methyl 4-amino-2-chloro-3-ethynyl-5-methoxybenzoate methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate was converted to methyl 4-amino-2-chloro-5 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -methoxy-3-((trimethylsilyl) ethynyl) -benzoate.
_{LC-MS (A): t} R = 0.81min; [M + H] +: 240.02.

A. 18. h. Methyl 4-chloro-7-methoxy-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-2-chloro-3-ethynyl-5- Replacing with methoxybenzoate, the compound was prepared using a method similar to methyl 4-chloro-1H-indole-5-carboxylate. _{LC-MS (A): t} R = 0.82min; [M + H] +: 239.95.

A. 18. i. 4-chloro-7-methoxy-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate to methyl 4-chloro-7-methoxy-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.68min, [M + H] +: 226.08.

A. 19. Synthesis of 4,7-difluoro-1H-indole-5-carboxylic acid 19. a. Methyl 2,5-difluoro-4-nitrobenzoate 4-amino-2-chlorobenzoic acid is replaced with 2,5-difluoro-4-nitrobenzoic acid to make this compound similar to methyl 4-amino-2-chlorobenzoate It was manufactured using the method.
_{LC-MS (A): t} R = 0.80min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.31 (dd, J ₁ = 6.0 Hz, J ₂ = 9.7 Hz, 1 H), 8.07 (dd, J ₁ = 5.8 Hz, J ₂ = 10.9 Hz, 1H), 3.92 (s, 3H).

A. 19. b. Methyl 4-amino-2,5-difluorobenzoate Methyl 5-methoxy-2-methyl-4-nitrobenzoate is replaced with methyl 2,5-difluoro-4-nitrobenzoate to give the compound 4-methyl-2- Prepared using an analogous method to amino-5-methoxy-2-methylbenzoate.
_{LC-MS (A): t} R = 0.70min, [M + H] +: 188.22.

A. 19. c. Methyl 4-amino -2-chlorobenzoate was converted to methyl 4-amino-2,5-difluoro, except that the methyl 4-amino-2,5-difluoro-3-iodobenzoate reaction mixture was stirred at RT for 1 h. Replacing with benzoate, the compound was prepared using a method analogous to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
LC-MS (A): t _R = 0.81 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.52 (dd, J ₁ = 6.7 Hz, J ₂ = 11.7 Hz, 1 H), 6.43 (s, 2H), 3.78 (s, 3H).

A. 19. d. Methyl 4-amino-2,5-difluoro-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodo The mixture of benzoate was replaced with methyl 4-amino-2,5-difluoro-3-iodobenzoate and the compound was used in a manner similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate. Manufactured.
_{LC-MS (A): t} R = 0.98min; [M + H] +: 284.22.

A. 19. e. Methyl 4-amino-3-ethynyl-2,5-difluorobenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 4-amino-2,5-difluoro-3 The compound was prepared using a method analogous to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.78min. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 7.48 (dd, J ₁ = 6.6 Hz, J ₂ = 11.8 Hz, 1 H), 6.66 (s, 2 H), 4.80 (s 1H), 3.78 (s, 3H).

A. 19. f. Methyl 4,7-difluoro-1H-indole-5-carboxylate Replace methyl 4-amino-2-chloro-3 -ethynylbenzoate with methyl 4-amino-3-ethynyl-2,5-difluorobenzoate This compound was prepared using a method analogous to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.79min, [M + H] +: 212.21.

A. 19. g. 4,7-difluoro-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl-1H-indole-5-carboxylate is converted to methyl 4,7-difluoro-1H-indole-5-carboxylate The compound was prepared using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting for the rate.
LC-MS (A): t _R = 0.64 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 12.96 (s, 1 H), 12.29 (s, 1 H), 7.56 (dd , J ₁ = J ₂ = 2.6 Hz, 1H), 7.32 (dd, J ₁ = 4.9 Hz, J ₂ = 11.3 Hz, 1H), 6.73 (m, 1H).

A. 20. Synthesis of 4-fluoro-7-methoxy-1H-indole-5-carboxylic acid 20. a. To a suspension of 2-fluoro-5-methoxy-4-nitrobenzoic acid 2,5-difluoro-4-nitrobenzoic acid (2.46 mmol) and Cs ₂ CO ₃ (12.3 mmol) in DMF was added MeOH. (16.5 mmol) was added and the mixture was stirred at RT for 3 h30. It was diluted with water, acidified with 1M HCl solution to pH = 1-2 and extracted three times with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo to give the title compound as a light yellow solid.
LC-MS (A): t _R = 0.67 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 13.96 (s br, 1 H), 8.03 (d, J = 9.6 Hz, 1 H ), 7.68 (d, J = 5.8 Hz, 1H), 3.97 (s, 3H).

A. 20. b. Methyl 2-fluoro-5-methoxy-4-nitrobenzoate 4-amino-2-chlorobenzoic acid was replaced with 2-fluoro-5-methoxy-4-nitrobenzoic acid to convert the compound to methyl 4-amino-2- Prepared using a method similar to chlorobenzoate.
LC-MS (A): t _R = 0.81 min; ¹ H NMR ((CD ₃ ) ₂ SO) δ: 8.09 (d, J = 9.7 Hz, 1H), 7.70 (d, J = 5.7 Hz, 1H), 3.98 (s, 3H), 3.92 (s, 3H).

A. 20. c. Methyl 4-amino-2-fluoro-5-methoxybenzoate Methyl 5-methoxy-2-methyl-4-nitrobenzoate is replaced with methyl 2-fluoro-5-methoxy-4-nitrobenzoate Was prepared using a method similar to methyl 4-amino-5-methoxy-2-methylbenzoate.
_{LC-MS (A): t} R = 0.70min, [M + H] +: 200.19.

A. 20. d. Methyl 4-amino-2-fluoro-3-iodo-5-methoxybenzoate Methyl 4-amino-2-chlorobenzoate was converted to methyl 4-amino except that the reaction mixture was stirred at RT for 2 h. Substituting 2-fluoro-5-methoxybenzoate, the compound was treated in a similar manner to a mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate. Manufactured.
_{LC-MS (A): t} R = 0.83min, [M + H] +: 325.97.

A. 20. e. Methyl 4-amino-2-fluoro-5-methoxy-3-((trimethylsilyl) ethynyl) benzoate Methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5 Replacing the mixture of iodobenzoate with methyl 4-amino-2-fluoro-3-iodo-5-methoxybenzoate, this compound is similar to methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate It was manufactured using the method.
_{LC-MS (A): t} R = 0.97min; [M + H] +: 296.03.

A. 20. f. Methyl 4-amino-3-ethynyl-2-fluoro-5-methoxybenzoate Methyl 4-amino-2-chloro-3-((trimethylsilyl) ethynyl) benzoate is converted to methyl 4-amino-2-fluoro-5 The compound was prepared using a method similar to methyl 4-amino-2-chloro-3-ethynylbenzoate, replacing with -methoxy-3-((trimethylsilyl) ethynyl) benzoate.
_{LC-MS (A): t} R = 0.78min; [M + H] +: 223.92.

A. 20. g. Methyl 4-fluoro-7-methoxy-1H-indole-5-carboxylate Methyl 4-amino-2-chloro-3-ethynylbenzoate is converted to methyl 4-amino-3-ethynyl-2-fluoro-5- Replacing with methoxybenzoate, the compound was prepared using a method similar to methyl 4-chloro-1H-indole-5-carboxylate.
_{LC-MS (A): t} R = 0.78min, [M + H] +: 223.76. ¹ H NMR ((CD ₃ ) ₂ SO) δ: 11.96 (s, 1H), 7.41 (dd, J ₁ = J ₂ = 2.6 Hz, 1H), 6.99 (d, J = 4 .9 Hz, 1H), 6.62 (m, 1H), 3.95 (s, 3H), 3.85 (s, 3H).

A. 20. h. 4-Fluoro-7-methoxy-1H-indole-5-carboxylic acid methyl 4-chloro-7-methyl -1H-indole-5-carboxylate is converted to methyl 4-fluoro-7-methoxy-1H-indole The compound was made using a method analogous to 4-chloro-7-methyl-1H-indole-5-carboxylic acid, substituting with -5-carboxylate.
_{LC-MS (A): t} R = 0.64min, [M + H] +: 210.15.

B. A. Synthesis of amines 1. Synthesis of 2-alkyl / (hetero) aryl-2-aminoethanamine B. 1. a. Strecker reaction (general procedure I)
To the corresponding aldehyde (24.6 mmol) suspended in anhydrous Et ₂ O (8 mL) was slowly added TMSCN (27 mmol) followed by ZnI ₂ (1.23 mmol) at RT. The mixture was cooled to 0 ° C. and the corresponding amine (24.6 mmol) dissolved in anhydrous MeOH (20 mL) (additional 24.6 mmol of TEA was added when the amine was the HCl salt). It was dripped. The mixture was heated at 70 ° C. for 1-6 h and then cooled to RT. It was quenched with 10% aqueous Na ₂ CO _{3 and} extracted 3 times with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude product was purified by CC (Biotage from KP-NH®) and isolated as α-amino-nitrile (see table below).

B. 1. b. Nitrile hydrogenation (general procedure II)
A solution of α-amino-nitrile (4.38 mmol) obtained in the above step in 7M NH ₃ in MeOH (32 mL) was mixed with 4% thiophene in diisopropyl ether (0.16 mL) and Actimet M Raney nickel. Added at 0 ° C. The mixture was allowed to warm to RT and stirred for 30 h under a hydrogen atmosphere. It was filtered over celite, washed with MeOH and concentrated in vacuo. Optionally, the amine is dissolved in its hydrochloride by dissolving in Et ₂ O (8.8 mL), adding 4M HCl in dioxane (4.4 mL) at 0 ° C. and filtering the solid formed. Converted.

B. 2. Synthesis of 2-alkyl / cycloalkyl-2-heteroaryl-ethanamines. 2. a. Synthesis of tert-butyl 4- (2-amino-1- (pyridin-3-yl) ethyl) piperidine-1-carboxylate 2. a. 1. tert-Butyl 4-((6-chloropyridin-3-yl) (cyano) methylene) piperidine-1-carboxylate 2- (6-chloro-3-pyridinyl) acetonitrile (6.52 mmol) in MeOH (26 mL) To what was dissolved in was added a 30% solution of NaOMe in MeOH (13 mmol) followed by 1-Boc-4-piperidone (6.52 mmol). The mixture was heated to 70 ° C. for 5 h, poured into cold H ₂ O and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Kt-SIL® from Biotage; Hept / EtOAc, 1/0 to 7/3) to give the title compound as a colorless oil.
LC-MS (B): tR = 0.85min; [M + CH 3 CN + H] +: 375.32.

B. 2. a. 2. tert-Butyl 4- (2-amino-1- (pyridin-3-yl) ethylidene) piperidine-1-carboxylate α-amino-nitrile was converted to tert-butyl 4-((6-chloropyridin-3-yl) ( The compound was prepared using a method analogous to General Procedure II (nitrile hydrogenation), substituting cyano) methylene) piperidine-1-carboxylate. The crude was purified by preparative LC-MS method I to give the title compound as a white solid.
LC-MS (B): tR = 0.43 min; [M + H] +: 304.11.

B. 2. a. 3. tert-butyl 4- (2-amino-1- (pyridin-3-yl) ethyl) piperidine-1-carboxylate tert-butyl 4- (2-amino-1- (pyridin-3-yl) ethylidene) piperidine- To a solution of 1-carboxylate (1.27 mmol) in 7 M MeOH (20 mL) in NH ₃ was added 10% palladium / activated carbon (135 mg). The mixture was stirred for 2 h 30 min under hydrogen atmosphere. It was filtered over celite, washed with MeOH and concentrated in vacuo to give the title compound as a white foam.
LC-MS (B): tR = 0.42 min; [M + H] +: 306.31.

B. 2. b. Synthesis of 2- (2-methylpyrimidin-5-yl) -2- (tetrahydro-2H-pyran-4-yl) ethanamine 2. b. 1. 2- (2-Methylpyrimidin-5-yl) acetonitrile The compound was synthesized according to JACS, 2011, 133, 6948-6951.

To a solution of 5-bromo-2-methylpyrimidine (5.78 mmol) and 4-isoxazoleboronic acid pinacol ester (6.07 mmol) in DMSO (40 mL), potassium fluoride (17.30 mmol) is added to water. Dissolved in (17 mL) was added. The mixture was flushed with argon and Pd (dppf) Cl ₂ . DCM (0.58 mmol) was added and the mixture was heated at 130 ° C. for 48 h. It was filtered over a pad of celite and washed with EtOAc. The filtrate was partitioned between water and EtOAc and the aqueous phase was extracted twice with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (DCM / MeOH, 1/0 to 95/5) to give the title compound as a brown oil.
LC-MS (A): tR = 0.43 min; [M + H] +: 134.10.

B. 2. b. 2. 2- (Dihydro-2H-pyran-4 (3H) -ylidene) -2- (2-methylpyrimidin-5-yl) acetonitrile , except that the reaction mixture was stirred at 50C for 20 min. 2- (6-Chloro-3-pyridinyl) acetonitrile was replaced with 2- (2-methylpyrimidin-5-yl) acetonitrile and 1-Boc-4-piperidone was replaced with tetrahydro-4H-pyran-4-one This compound was prepared using a method analogous to tert-butyl 4-((6-chloropyridin-3-yl) (cyano) methylene) piperidine-1-carboxylate.
LC-MS (A): tR = 0.61 min; [M + H] +: 216.09.

B. 2. b. 3. 2- (2-Methylpyrimidin-5-yl) -2- (tetrahydro-2H-pyran-4-yl) ethanamine 2- (dihydro-2H-pyran-4 (3H) -ylidene) -2- (2-methyl To a solution of pyrimidin-5-yl) acetonitrile (0.22 mmol) in a solution of NH ₃ in 7M MeOH (3 mL) was added 10% palladium / activated carbon (24 mg). The mixture was stirred for 24 h under a hydrogen atmosphere. It was filtered over Celite and the filtrate was treated with Actimet M Raney nickel (25 mg) at 0 ° C. The mixture was allowed to warm to RT and stirred for 4 h under a hydrogen atmosphere. It was filtered over celite, washed with DCM / MeOH 8/2 and concentrated in vacuo to give the title compound as an orange oil.
LC-MS (A): tR = 0.38 min; [M + H] +: 222.14.

B. 2. c. Synthesis of 2- (6-chloropyridin-3-yl) -2-cyclohexylethanamine 2. c. 1. 2- (6- Chloropyridin -3-yl) -2-cyclohexylideneacetonitrile KOH (1.32 mmol) in MeOH (1.5 mL) was dissolved in 2- (6-chloro-3-pyridinyl) Acetonitrile (1.32 mmol) was added at 0 ° C. followed by cyclohexanone (1.32 mmol). The mixture was stirred overnight and the temperature was allowed to reach RT. It was quenched with saturated NH ₄ Cl solution, diluted with water and extracted three times with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo to give the crude as an orange oil.
LC-MS (A): tR = 0.90 min; [M + H] +: 233.15.

B. 2. c. 2. 2- (6- Chloropyridin-3-yl) -2-cyclohexylethanamine 2- (6-chloropyridin-3-yl) -2-cyclohexylideneacetonitrile (1.28 mmol) dissolved in THF (3 mL) To that was added a 1M solution of BH ₃ in THF (3.83 mmol). The mixture was heated at 60 ° C. for 3 h and at 0 ° C. MeO
Quenched with H then water. Volatiles were evaporated and the residue was diluted with water and acidified to pH 1-2 with 1M HCl solution. The aqueous phase was washed 3 times with EtOAc. Acidified to pH 13-14 with 32% NaOH solution and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo to give the title compound as a light yellow oil.
LC-MS (A): tR = 0.63 min; [M + H] +: 239.17.

B. 2. d. Synthesis of 2- (6-chloropyridin-3-yl) -4-methylpentan-1-amine 2. d. 1. 2- (6-Chloropyridin-3-yl) -4-methylpent-2-enenitrile Except that the reaction mixture was stirred at 0 ° C. for 30 min, cyclohexanone was replaced with isobutyraldehyde to give this compound. Was prepared using a method analogous to 2- (6-chloropyridin-3-yl) -2-cyclohexylideneacetonitrile.
LC-MS (A): tR = 0.88 min; [M + H] +: 207.16.

B. 2. d. 2. 2- (6-Chloropyridin-3-yl) -4-methylpentan-1-amine Except that the reaction mixture was stirred at 60C for 30 min, 2- (6-chloropyridin-3 -Yl) -2-cyclohexylideneacetonitrile was replaced with 2- (6-chloropyridin-3-yl) -4-methylpent-2-enenitrile to give this compound 2- (6-chloropyridin-3-yl) Prepared using a method similar to 2-cyclohexylethanamine.
LC-MS (A): tR = 0.59 min; [M + H] +: 213.16.

B. 2. e. Synthesis of 3-ethyl-2- (pyrimidin-5-yl) pentan-1-amine 2. e. 1. 3-Ethyl-2- (pyrimidin-5-yl) pent-2-enenitrile 5-Pyrimidineacetonitrile was 2- (6-chloro) except that the reaction mixture was stirred at 50C overnight. -3-pyridinyl) acetonitrile, 3-pentanone is replaced with 1-Boc-4-piperidone and the compound is tert-butyl 4-((6-chloropyridin-3-yl) (cyano) methylene) piperidine- Prepared using a method similar to 1-carboxylate.
LC-MS (A): tR = 0.76 min; [M + H] +: 188.24.

B. 2. e. 2. 3-ethyl-2- (pyrimidin-5-yl) pentan-1-amine 2- (dihydro-2H-pyran-4 (3H) -ylidene) -2- (2-methylpyrimidin-5-yl) acetonitrile 3 -Ethyl-2- (pyrimidin-5-yl) pent-2-enenitrile was replaced by 2- (2-methylpyrimidin-5-yl) -2- (tetrahydro-2H-pyran-4-yl) Prepared using a method similar to ethanamine.
LC-MS (A): tR = 0.50min; [M + CH 3 CN + H] +: 235.18.

B. 2. f. 2- (4,4-Difluorocyclohexyl) -2- (2-methylpyrimidin-5-yl) ethanamine 2. f. 1. 2- (6-Chloro-3) -2- (4,4-difluorocyclohexylidene) -2- (2-methylpyrimidin-5-yl) acetonitrile was stirred at 50 ° C. for 2 h30 min. -Pyridinyl) acetonitrile was replaced with 2- (2-methylpyrimidin-5-yl) acetonitrile, cyclohexanone was replaced with 4,4-difluorocyclohexanone,
This compound was prepared using a method analogous to 2- (6-chloropyridin-3-yl) -2-cyclohexylideneacetonitrile.
LC-MS (A): tR = 0.76 min; [M + H] +: 250.11.

B. 2. f. 2. 2- (4,4-Difluorocyclohexyl) -2- (2-methylpyrimidin-5-yl) ethanamine 2- (dihydro-2H-pyran-4 (3H) -ylidene) -2- (2-methylpyrimidine-5 -Yl) acetonitrile was replaced with 2- (4,4-difluorocyclohexylidene) -2- (2-methylpyrimidin-5-yl) acetonitrile to give this compound 2- (2-methylpyrimidin-5-yl) Prepared using a method analogous to 2- (tetrahydro-2H-pyran-4-yl) ethanamine.
LC-MS (A): tR = 0.50min; [M + CH 3 CN + H] +: 297.26.

B. 3. Synthesis of 2-alkoxy / cycloalkoxy-2-heteroarylethanamines. 3. a. Synthesis of 2- (cyclopentyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine 3. a. 1. 1- (2-methylpyrimidin-5-yl) -2 -nitroethanol 2-methyl-pyrimidine-5-carbaldehyde (13.9 mmol) and nitromethane (22.2 mmol) in THF (8.33 mL) and tBuOH (8 TBuOK (0.83 mmol) was added in portions at 0 ° C. to the mixture in .33 mL). The mixture was stirred at 0 ° C. for 5 min, quenched with water and volatiles were evaporated. The residue was partitioned between water and EtOAc. The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Hept / EtOAc, 1/1 to 0/1) to give the title compound as a yellowish solid.
LC-MS (A): tR = 0.40 min; [M + H] +: 184.13.

B. 3. a. 2. 2-Methyl-5- (2-nitrovinyl) pyrimidine 1- (2-methylpyrimidin-5-yl) -2-nitroethanol (6.73 mmol) dissolved in DCM (33.6 mL) was added to DMAP ( 0.34 mmol) followed by Ac ₂ O (7.40 mmol). The mixture was stirred at RT for 3 days, quenched with a saturated solution of NaHCO ₃ and extracted 3 times with DCM. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Hept / EtOAc, 75/25 to 30/70) to give the title compound as a yellow solid.
LC-MS (A): tR = 0.56min; [M + CH 3 CN + H] +: 207.42.

B. 3. a. 3. A suspension of 5- (1- (cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine tBuOK (1.31 mmol) in THF (3.84 mL) and tBuOH (0.77 mL) was added under argon. Cyclopentanol (1.15 mmol) was added. The mixture was cooled to 0 ° C., and 2-methyl-5- (2-nitrovinyl) pyrimidine (0.77 mmol) dissolved in THF (0.5 mL) was added dropwise. It was stirred at 0 ° C. for 5 min and then at RT for 30 min, quenched with a 2M solution of HCl and filtered over a pad of celite. The filtrate was diluted with water and extracted twice with EtOAc. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by CC (Hept / EtOAc, 1/0 to 0/1) to give the title compound as a white solid.
LC-MS (A): tR = 0.79 min; [M + H] +: 252.16.

B. 3. a. 4). 2- (Cyclopentyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine 5- (1- (cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine (0.22 mmol) was added to EtOH (1.45 mL). 10% Palladium / activated carbon (7.8 mg) was added to what was dissolved in). The mixture was stirred for 3 h under hydrogen atmosphere. It was filtered over celite and the filtrate was concentrated in vacuo to give the title compound as a yellow oil.
LC-MS (B): tR = 0.49min; [M + CH 3 CN + H] +: 263.22.

B. 3. b. Synthesis of 2-ethoxy-2- (2-methylpyrimidin-5-yl) ethanamine 3. b. 1. 5- (1-Ethoxy-2-nitroethyl) -2-methylpyrimidine cyclopentanol was replaced with ethanol to make this compound similar to 5- (1- (cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine. Produced using the method. LC-MS (A): tR = 0.63 min; [M + H] +: 212.17.

B. 3. b. 2. 2-Ethoxy-2- (2-methylpyrimidin-5-yl) ethanamine 10% palladium / activated charcoal was replaced with platinum dioxide and the reaction mixture was stirred overnight, except that 5- (1- (cyclopentyloxy) 2-nitroethyl) -2-methylpyrimidine was replaced with 5- (1-ethoxy-2-nitroethyl) -2-methylpyrimidine to give this compound 2- (cyclopentyloxy) -2- (2-methylpyrimidine-5 -Yl) Prepared using a method analogous to ethanamine.
LC-MS (C): tR = 0.31min; [M + CH 3 CN + H] +: 223.21.

B. 3. c. Synthesis of 2- (cyclohexyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine 3. c. 1. To a suspension of 5- (1- (cyclohexyloxy) -2-nitroethyl) -2-methylpyrimidine NaH (1.70 mmol) in THF (1.89 mL), cyclohexanol (6 mmol) was added at 0 ° C. Added. The mixture was stirred for 5 min, and 2-methyl-5- (2-nitrovinyl) pyrimidine (0.30 mmol) dissolved in THF (2 mL) was added dropwise at 0 ° C. It was stirred at 0 ° C. for 5 min, then allowed to reach 10 ° C. and stirred for 1.5 h. It was quenched with AcOH and filtered over a pad of celite. The cake was washed with EtOAc and the filtrate was concentrated in vacuo. The crude was purified by CC (Hept / EtOAc, 8/2 to 25/75) to give the title compound as a yellow oil.
LC-MS (A): tR = 0.83 min; [M + H] +: 266.24.

B. 3. c. 2. 2- (Cyclohexyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine 10% Palladium / activated carbon was used as a catalyst, except that platinum dioxide was used as a catalyst, and the reaction mixture was stirred overnight. (1- (Cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine was replaced with 5- (1- (cyclohexyloxy) -2-nitroethyl) -2-methylpyrimidine to give 2- (cyclopentyloxy) Prepared using a method similar to 2- (2-methylpyrimidin-5-yl) ethanamine.
LC-MS (A): tR = 0.52 min; [M + H] +: 235.91.

B. 3. d. Synthesis of 2- (2-methylpyrimidin-5-yl) -2-((tetrahydro-2H-pyran-4-yl) oxy) ethanamine 3. d. 1. 2-methyl-5- (2-nitro-1-((tetrahydro-2H-pyran-4-yl) oxy) ethyl) pyrimidine Substituting cyclohexanol with tetrahydro-2H-pyran-4-ol, This compound was prepared using a method analogous to 5- (1- (cyclohexyloxy) -2-nitroethyl) -2-methylpyrimidine.
LC-MS (A): tR = 0.62 min; [M + H] +: 267.93.

B. 3. d. 2. 2- (2-Methylpyrimidin-5-yl) -2-((tetrahydro-2H-pyran-4-yl) oxy) ethanamine 10% Palladium instead of activated carbon / platinum dioxide was used as catalyst and the reaction mixture was Except for stirring for 5 h, 5- (1- (cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine was converted to 2-methyl-5- (2-nitro-1-((tetrahydro-2H-pyran- Substituting 4-yl) oxy) ethyl) pyrimidine, this compound was prepared using a method analogous to 2- (cyclopentyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine.
LC-MS (A): tR = 0.39 min; [M + H] +: 238.20.

B. 3. e. Synthesis of 2- (2-methylpyrimidin-5-yl) -2- (pentan-3-yloxy) ethanamine 3. e. 1. 2-Methyl-5- (2-nitro-1- (pentan-3-yloxy) ethyl) pyrimidine Substituting cyclopentanol with 3-pentanol to give 5- (1- (cyclohexyloxy) 2-Nitroethyl) -2-methylpyrimidine.
LC-MS (A): tR = 0.81 min; [M + H] +: 254.18.

B. 4). 2- (2-Methylpyrimidin-5-yl) -2- (pentan-3-yloxy) ethanamine except that platinum dioxide was used as the catalyst instead of 10% palladium / activated carbon and the reaction mixture was stirred overnight. , 5- (1- (cyclopentyloxy) -2-nitroethyl) -2-methylpyrimidine is replaced by 2-methyl-5- (2-nitro-1- (pentan-3-yloxy) ethyl) pyrimidine Was prepared using a method analogous to 2- (cyclopentyloxy) -2- (2-methylpyrimidin-5-yl) ethanamine.
LC-MS (A): tR = 0.51 min; [M + H] +: 222.04.

C. C. Chiral separation of amines of formula (III) 1. Synthesis of 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine (enantiomer A) and 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine (enantiomer B) 2 The racemate of-(2-methylpyrimidin-5-yl) -2-morpholinoethanamine was prepared by preparative chiral HPLC (Daicel, ChiralPak IC, 5 μm, 20 × 250 mm, CH ₃ CN / (EtOH + 0.1% DEA) 90 / 10, flow rate: 18 mL / min, detection: UV 210 nm) to separate the two enantiomers.

Both using analytical chiral HPLC (Daicel, ChiralPak IC, 5 μm, 4.6 × 250 mm, CH ₃ CN / (EtOH + 0.1% DEA) 90/10, flow rate: 0.8 mL / min, detection: UV 210-280 nm) Enantiomers were qualitatively analyzed.
Enantiomer A: tR = 12.63 min
Enantiomer B: tR = 17.92 min

  Both enantiomers were converted to their hydrochloride salts according to the procedure described above (described in B.1.b).

Enantiomer A: LC-MS (A): tR = 0.36 min; [M + H] +: 223.21.

Enantiomer B: LC-MS (A): tR = 0.36 min; [M + H] +: 223.18.

Example production:
A. Synthesis of compounds of formula (I) (general procedure for amide coupling)
Dissolve each carboxylic acid precursor of formula II (0.23 mmol) in a mixture of DCM / DMF (0.4 mL) to DIPEA (0.69 mmol), HOBt (0.28 mmol) and EDC. HCl (0.28 mmol) was added sequentially, followed by the respective amine precursor of formula III (0.25 mmol) dissolved in DCM (0.1 mL). The mixture was stirred at RT overnight, diluted with DCM and washed twice with 5% KHSO ₄ solution (if appropriate), a saturated solution of NaHCO ₃ and brine (if appropriate). The organic phase was dried over MgSO _{4 and} concentrated in vacuo. The crude product was purified under the conditions detailed in the table below.

  The compounds in the table below were synthesized according to the general procedure described above, except for those compounds marked “see section B below” or “see section C below”; It was synthesized according to the special procedure described in “B. Chiral separation of compounds of formula (I)” or “C. Steps after amide coupling”.

B. Chiral separation of compounds of formula (I) Example 3 4-Chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholine-4- Yl-ethyl] -amide (enantiomer A) and example 4 4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl- Ethyl] -amide (enantiomer B)
4-Chloro-1H-indole-5-carboxylic acid [2- (2-Methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide racemate was synthesized in general for amide coupling. According to the general procedure, 4-chloro-1H-indole-5-carboxylic acid as carboxylic acid precursor II and 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine as amine precursor III Were manufactured. LC-MS (B): tR = 0.41 min; [M + H] +: 400.02.

  Using preparative chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 20 × 250 mm, Hept / (EtOH + 0.1% DEA) 50/50, flow rate: 16 mL / min, detection: UV 230 nm) Separated into enantiomers.

Analytical chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 4.6 × 250 mm, (Hept + 0.05% DEA) / (EtOH + 0.05% DEA) 50/50, flow rate: 0.8 mL / min, detection: UV 210-280 nm ) Was used to qualitatively analyze both enantiomers.
Enantiomer A: tR = 8.67 min (Example 3)
Enantiomer B: tR = 10.70 min (Example 4)

Example 5 4-Chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl]-
Amide (Enantiomer A) and Example 6 4-Chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) ) -Ethyl] -amide (Enantiomer B)
Racemate of 4-chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide According to the general procedure for amide coupling and 4-chloro-1H-indole-5-carboxylic acid as carboxylic acid precursor II and 2- (4,4-difluoropiperidin-1-yl as amine precursor III ) -2- (2-Methylpyrimidin-5-yl) ethanamine.
LC-MS (B): tR = 0.52 min; [M + H] +: 434.33.

  Using preparative chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 20 × 250 mm, Hept / (EtOH + 0.1% DEA) 50/50, flow rate: 16 mL / min, detection: UV 210 nm) Separated into enantiomers.

Analytical chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 4.6 × 250 mm, (Hept + 0.05% DEA) / (EtOH + 0.05% DEA) 50/50, flow rate: 0.8 mL / min, detection: UV 210-280 nm ) Was used to qualitatively analyze both enantiomers.
Enantiomer A: tR = 8.72 min (Example 5)
Enantiomer B: tR = 10.92 min (Example 6)

Example 96 4-Chloro-7-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer A ) And Example 97 4-chloro-7-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide ( Enantiomer B)
Racemic 4-chloro-7-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide is converted to amide According to the general procedure of coupling, 4-chloro-7-methyl-1H-indole-5-carboxylic acid as carboxylic acid precursor II and 2- (2-methylpyrimidin-5-yl as amine precursor III ) -2-morpholinoethanamine was coupled. LC-MS (A): tR = 0.55 min; [M + H] +: 414.03.

  Using preparative chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 20 × 250 mm, Hept / (EtOH + 0.1% DEA) 70/30, flow rate: 20 mL / min, detection: UV 230 nm) Separated into enantiomers.

Analytical chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 4.6 × 250 mm, (Hept + 0.05% DEA) / (EtOH + 0.05% DEA) 70/30, flow rate: 1.0 mL / min, detection: UV 210-280 nm ) Was used to qualitatively analyze both enantiomers.
Enantiomer A: tR = 10.43 min (Example 96)
Enantiomer B: tR = 13.21 min (Example 97)

Example 105 4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-
Pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer A) and Example 106 4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidine- 5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer B)
Example 105 (or Example 106) provides 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine (enantiomer A) (or 2- (2-methylpyrimidine-5) as the chiral amine of formula III. -Yl) -2-morpholinoethanamine (enantiomer B)) was synthesized according to the general amide coupling procedure described above.

Analytical chiral HPLC (Daicel, ChiralPak AD-H, 5 μm, 4.6 × 250 mm, (Hept + 0.05% DEA) / (EtOH + 0.05% DEA) 50/50, flow rate: 1.2 mL / min, detection: UV 210-280 nm ) Was used to qualitatively analyze both enantiomers.
Enantiomer A: tR = 8.16 min (Example 105)
Enantiomer B: tR = 6.35 min (Example 106)

Example 114 4-Chloro-7-methoxy-1H-indole-5-carboxylic acid 2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer A) And Example 115 4-chloro-7-methoxy-1H-indole-5-carboxylic acid 2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer B )
Example 114 (or Example 115) provides 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine (enantiomer A) (or 2- (2-methylpyrimidine-5) as the chiral amine of formula III. -Yl) -2-morpholinoethanamine (enantiomer B)) was synthesized according to the general amide coupling procedure described above.

Both using analytical chiral HPLC (Daicel, ChiralPak ID, 5 μm, 4.6 × 250 mm, CH ₃ CN / (EtOAc + 0.1% DEA) 40/60, flow rate: 1.0 mL / min, detection: UV 210-280 nm) Enantiomers were qualitatively analyzed.
Enantiomer A: tR = 5.40 min (Example 114)
Enantiomer B: tR = 6.79 min (Example 115)

Example 119 4-Chloro-7-ethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide (enantiomer A )
Example 119 was synthesized according to the general amide coupling procedure described above using 2- (2-methylpyrimidin-5-yl) -2-morpholinoethanamine (enantiomer A) as the chiral amine of formula III. .

Qualitatively using analytical chiral HPLC (Daicel, ChiralPak ID, 5 μm, 4.6 × 250 mm, Hept / (EtOAc + 0.1% DEA) 10/90, flow rate: 1.4 mL / min, detection: UV 210-280 nm) analyzed.
Enantiomer A: tR = 5.61 min (Example 119) (tR = 8.09 min (the other enantiomer))

C. Step after amide coupling Example 20 rac-4-Chloro-1H-indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl-ethyl) -amide dihydrochloride Salt 4- {2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1-pyridin-3-yl-ethyl} -piperidine-1-carboxylic acid tert-butyl ester (Example 19) To a solution of (0.42 mmol) in EtOAc (2 mL) was added dropwise a 4M solution of HCl in dioxane (4.18 mmol). The mixture was stirred at RT for 4 h and concentrated in vacuo to give the title compound as a light pink solid.
LC-MS (A): tR = 0.43 min; [M + H] +: 383.01.

Example 21 rac-4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide formate 4-chloro- 1H-indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl-ethyl) -amide dihydrochloride (Example 20) (0.13 mmol) was added DCM (1 mL) and MeOH ( To what was dissolved in 2 mL) was added AcOH (0.16 mmol) followed by 37% aqueous formaldehyde (0.17 mmol) and sodium triacetoxyborohydride (0.18 mmol). The mixture was stirred at RT for 5 h and an additional amount of sodium triacetoxyborohydride (0.18 mmol) was added. It was stirred overnight at RT, quenched with a saturated solution of NaHCO ₃ and extracted twice with DCM. The aqueous phase was further basified with 1M NaOH solution to pH 13-14 and extracted twice with DCM. The combined organic phases were dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by preparative LC-MS using Method III to give the title compound as a white solid.
LC-MS (A): tR = 0.44 min; [M + H] +: 397.04.

Example 22 rac-4-chloro-1H-indole-5-carboxylic acid [2- (1-acetyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amido 4-chloro-1H- Indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl-ethyl) -amide dihydrochloride (Example 20) (0.13 mmol) and Et ₃ N (0.66 mmol) To what was suspended in DCM (1 mL), acetyl chloride (0.16 mmol) was added at 0 ° C. The mixture was stirred at 0 ° C. for 11.5 h, quenched with a saturated solution of NaHCO ₃ and extracted three times with EtOAc. The combined organic phases were washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by preparative LC-MS using Method III to give the title compound as a white solid.
LC-MS (A): tR = 0.54 min; [M + H] +: 424.99.

Example 23 rac-4-Chloro-1H-indole-5-carboxylic acid [2- (1-methanesulfonyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amido 4-chloro-1H - indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl - ethyl) - amide dihydrochloride (example 20) (0.13 mmol) and _Et 3 N (0.66 mmol) Was suspended in DCM (1 mL) to which methanesulfonyl chloride (0.16 mmol) was added at 0 ° C. The mixture was stirred at 0 ° C. for 1.5 h, quenched with a saturated solution of NaHCO ₃ and extracted three times with EtOAc. The combined organic phases were washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified by preparative LC-MS using Method III and further by CC (Biotage Isolute Silica II®) using DCM / MeOH 94/6 to give the title compound as a white solid. Obtained.
LC-MS (A): tR = 0.57 min; [M + H] +: 460.94.

Example 113 rac-4-chloro-7- (2-hydroxy-ethoxy) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl -Ethyl] -amido rac-7- (2-tert-butoxy-ethoxy) -4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholine To a solution of -4-yl-ethyl] -amide (Example 112) (0.047 mmol) in DCM (0.19 mL) was added TFA (0.18 mL). The mixture was stirred at RT for 2 h, concentrated in vacuo and coevaporated with toluene. The crude was purified by preparative LC-MS using Method IX to give the title compound as a beige solid.
LC-MS (A): tR = 0.51 min; [M + H] +: 460.02.

Example 116 rac-4-chloro-7- (1-hydroxy-1-methyl-ethyl) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholine -4-yl-ethyl] -amido rac-7-acetyl-4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl To a solution of -ethyl] -amide (0.05 mmol) in THF (1 mL), a 3M solution of methylmagnesium bromide in diethyl ether (0.54 mmol) was added dropwise at -10 ° C. The mixture was stirred at RT for 2 h and cooled to 0 ° C. It was quenched with saturated NH ₄ Cl solution and extracted 3 times with EtOAc. The organic phase was washed with brine, dried over MgSO _{4 and} concentrated in vacuo. The crude was purified on CC (Biotage Isolute Silica II®) using DCM / MeOH 90/10 to give the title compound as a light yellow solid. LC-MS (A): tR = 0.54 min; [M + H] +: 458.24.

Biological tests A. In vitro studies <br/> expression P2X ₇ receptor antagonist activity of compounds of formula (I), measured according to the following experimental method.

B. experimental method:
Cell Line Establishment and YO-PRO Test In general, cell line establishment was performed according to established molecular cloning protocols. Specifically, RNA was extracted from human whole blood using Qiagen RNeasy kit (Qiagen, CH) according to the manufacturer's instructions. Subsequently, cDNA was prepared (Superscript II, Invitrogen AG, CH) and the human P2X7 gene (genbank ref. BC0111913) was amplified using the following primers:
ATCGCGGCCCTCAGTAAGGAACTCTTGAAGCCACT and CCGCGCTAGACCACCCATGCCCGCCTGCTGCAGCTGCA. The amplified sequence was then ligated into pcDNA3.1 (+) NotI, NheI digested plasmid. Using lipofectamine 2000 (Invitrogen AG, CH) according to the manufacturer's instructions, human fetal kidney (HEK) cells (ATCC CRL-1573, Manassas, VA, USA) were pcDNA3.1 (+). The hP2X7 plasmid was introduced. After 24 h exposure to DNA, cells were trypsinized and replated at low density in the presence of 250 μg geneticin. Geneticin resistant cells were selected visually between two successive clonings with serial limiting dilution. Individual clones were screened for P2X7 expression by adding ATP and recording the resulting YO-PRO1 incorporation. Cell clones were selected based on RNA and protein expression. HEK cells stably expressing P2X7 were used for drug screening using the YO-PRO1 test. Cells were grown in adherent cultures at 37 ° C. in a humidified 5% CO ₂ incubator until confluent (3 in DMEM with 10% FCS, 1% penicillin / streptomycin, 250 μg / ml geneticin). ~ 1/5 passage ratio every 4 days). Adherent cells were detached by incubating with trypsin (1 ml per 165 cm ² dish) for 2 minutes, then washed with 10 ml PBS (without Mg ²⁺ and Ca ²⁺ ) and 10% FCS, 1% penicillin / streptomycin Resuspended in DMEM with and without geneticin. In 50 μl of full medium, 10'000 cells per well (48 hours before the test) or 25'000 cells per well (Vi-cell XR (Beckman Coulter) (24 hours before the test) are blackened on the sides The bottom surface was seeded in a 384 well plate, which was pre-coated with 10 μl poly-L-lysine per well, incubated at 37 ° C. for 30-60 minutes and washed once with PBS. The cells were removed from the cells and 50 μl of test buffer containing 0.5 μM YO-PRO-1 was added to the wells.The antagonist compound solution was serially diluted with PBS using BioMek (Beckman Coulter) with 10 mM DMSO solution of antagonist. Tested twice for each concentration Performed on the measurement of .IC _50, (and the highest concentration of 10 [mu] M, performs nine serially diluted in a ratio of 1/3 about it.) Performing the test in 10 concentrations. The cells of the present invention Incubation with antagonist and ATP at a final concentration of 250 μM for 90 minutes, 4 time points within this time period were selected, and at each time point, several measurements were made within seconds, and they were averaged. Measured with FLIPR tetra (Molecular Devices) using filters appropriate for fluorescence (excitation 485/20, emission 530/25), which is a Molecular Devices Screen Works system control software for defining and operating experimental protocols. Antagonist activity The maximum intensity was expressed as a percentage of the maximum intensity induced by the EC ₅₀ value for agonist activation (0.25 mM ATP for HEK-293 cells expressing the human recombinant P2X7 receptor). For IC50 measurements, IC50 values were determined by plotting maximum intensity against compound concentration.

Antagonist activity against P2X ₇ receptor exemplary compound _{(IC 50} value) shown in Table 1.

Claims (15)

A compound of formula (I) or a salt of such a compound:

Where
R ¹ represents a heteroaryl or aryl group, these groups are independently unsubstituted or substituted by 1, 2 or 3 substituents, the substituents being (C ₁ -C ₄ ) alkyl , (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₃ ) fluoroalkyl, (C ₁ -C ₃ ) fluoroalkoxy, hydroxy, halogen and phenoxy. Is selected;
R ² is
- a heterocyclyl, substituted by or is one or two substituents unsubstituted, the substituent _{is, (C} 1 -C _{4) alkyl, (C} 1 -C ₄₎ alkylcarbonyl, _{(C 1} -C _{4) alkoxycarbonyl,} are independently selected from _(C 1 -C ₄₎ alkylsulfonyl and halogen, said heterocyclyl;
-Heterocyclyloxy;
- substituted by or one or two halogen or unsubstituted _(C 3 -C ₆₎ cycloalkyl;
- _(C 3 -C ₆₎ cycloalkyloxy;
- N- _(C 3 -C ₆₎ cycloalkyl - amino;
- N- _(C 3 -C ₆₎ cycloalkyl-methyl - amino;
- _(C 3 -C ₆₎ alkyl;
- _(C 2 -C ₆₎ alkoxy;
- N- _(C 1 -C ₄₎ alkylamino;
- N, N-di - _[(C 1 -C ₄₎ alkyl] - amino; or - N- arylmethyl -N- _(C 1 -C ₄₎ alkyl - represents amino;
R ³ represents hydrogen or halogen;
R ⁴ is hydrogen, fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₄ ) alkyl-carbonyl, hydroxy- (C ₁ -C ₄ ) alkyl, hydroxy - represents _(C 2 -C ₄₎ alkoxy _(C 2 -C _{4) alkoxy, (C} 1 -C ₂₎ alkoxy - - _(C 1 -C ₄₎ alkyl or _(C 1 -C ₄₎ alkoxy;
R ⁵ represents hydrogen or (C ₁ -C ₄ ) alkyl;
R ⁶ represents fluoro, chloro, methyl, ethyl or (C ₁ -C ₂ ) fluoroalkyl. R ¹ represents a 5- or 6-membered monocyclic heteroaryl group, the group is unsubstituted or substituted by 1 or 2 substituents, and the substituents are (C ₁ -C ₄ ) Independently selected from the group consisting of alkyl, (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₄ ) alkoxy, (C ₁ -C ₃ ) fluoroalkyl and halogen;
R ² is
-Heterocyclyl, which is unsubstituted or substituted by one or two substituents, the substituents being independently selected from methyl and fluoro; or-unsubstituted or 1 or substituted by two fluoro _(C 3 -C ₆₎ cycloalkyl;
R ³ represents hydrogen;
R ⁴ represents hydrogen or (C ₁ -C ₄ ) alkyl;
R ⁵ represents hydrogen;
R ⁶ represents chloro or methyl;
2. A compound of formula (I) according to claim 1 or a salt of such a compound. R ¹ represents a 5- or 6-membered monocyclic heteroaryl or phenyl group, which groups are independently unsubstituted or substituted by 1 or 2 substituents, the substituents being (C Independently selected from the group consisting of ₁ -C ₄ ) alkyl, (C ₃ -C ₆ ) cycloalkyl, (C ₁ -C ₃ ) fluoroalkyl and halogen;
2. A compound of formula (I) according to claim 1 or a salt of such a compound. R ² represents heterocyclyl which is unsubstituted or substituted by 1 or 2 fluoro;
4. A compound of formula (I) according to any one of claims 1 to 3 or a salt of such a compound. R ² _{is, (C} 3 -C ₆₎ alkyl; represents or substituted by non-or substituted with one or two fluoro _(C 3 -C ₆₎ cycloalkyl;
4. A compound of formula (I) according to any one of claims 1 or 3 or a salt of such a compound. 2. A compound of formula (I) or a salt of such a compound according to claim 1 which is also a compound of formula (I _Ar ):

Where
A represents N or CH;
B represents N or CH;
R ² represents heterocyclyl which is unsubstituted or substituted by 1 or 2 fluoro, which heterocyclyl is pyrrolidinyl, piperidinyl, tetrahydropyranyl, morpholinyl, azepanyl, 1,4-oxazepanyl and 6-oxa-3 -Selected from azabicyclo [3.1.1] heptanyl; or R ² represents cyclohexyl which is unsubstituted or substituted by 1 or 2 fluoro;
R ⁴ is hydrogen, fluoro, chloro, (C ₁ -C ₄ ) alkyl, (C ₁ -C ₄ ) alkoxy, hydroxy- (C ₂ -C ₄ ) alkoxy or (C ₁ -C ₂ ) alkoxy- (C ₁ -C ₄₎ alkyl;
R ⁶ represents fluoro, chloro, methyl, ethyl or (C ₁ -C ₂ ) fluoroalkyl;
R ⁷ is hydrogen, halogen, (C ₁ -C ₄ ) alkyl, (C ₃ -C ₆ ) cycloalkyl, (
C ₁ -C ₄₎ alkoxy or _(C 1 -C ₃₎ represents a fluoroalkyl. A and B represent N and R ⁷ represents hydrogen, methyl, cyclopropyl or trifluoromethyl; or A represents N, B represents CH and R ⁷ represents chloro, Represents methyl, methoxy or trifluoromethyl; or A and B represent CH and R ⁷ represents fluoro or chloro;
R ² is 3,3-difluoro-pyrrolidin-1-yl, piperidin-1-yl, 4-fluoro-piperidin-1-yl, 3,3-difluoro-piperidin-1-yl, 4,4-difluoro- Piperidin-1-yl, tetrahydropyran-4-yl, morpholin-4-yl, azepan-1-yl, 1,4-oxazepan-4-yl or 6-oxa-3-azabicyclo [3.1.1] Represents heptan-3-yl;
R ⁴ represents hydrogen, chloro, methyl, ethyl, n-propyl, iso-butyl, methoxy, ethoxy, 2-hydroxy-ethoxy or 3-methoxy-prop-1-yl;
R ⁶ represents fluoro, chloro, methyl, ethyl or trifluoromethyl,
A compound of formula (I _Ar ) according to claim 6 or a salt of such a compound. A and B represent N; A compound of formula (I _Ar ) according to any one of claims 6 or 7, or a salt of such a compound. R ⁶ represents chloro;
9. A compound of formula (I) according to any one of claims 1 to 8, or a salt of such a compound. R ⁶ represents methyl;
9. A compound of formula (I) according to any one of claims 1 to 8, or a salt of such a compound. 2. A compound of formula (I) according to claim 1 selected from the group consisting of:
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2- (4,4-difluoro-piperidin-1-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-1H-indole-5-carboxylic acid [(R) -2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl]- An amide;
4-chloro-1H-indole-5-carboxylic acid [(S) -2- (4,4-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl]- An amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-methyl-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-piperidin-1-yl) -2- (2-trifluoromethyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-cyclopropyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (6-trifluoromethyl-pyridin-3-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-methoxy-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-dimethylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-azetidin-1-yl-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-pyrrolidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-diethylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4- {2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1-pyridin-3-yl-ethyl} -piperidine-1-carboxylic acid tert-butyl ester; 4-chloro-1H Indole-5-carboxylic acid (2-piperidin-4-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-acetyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methanesulfonyl-piperidin-4-yl) -2-pyridin-3-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyrimidin-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyrimidin-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-1H-pyrazol-4-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-methyl-1H-pyrazol-4-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-piperidin-1-yl-2- (2,4,6-trifluoro-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-difluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-fluoro-pyridin-2-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2,4,6-trifluoro-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-fluoro-pyridin-2-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-chloro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2,4-dichloro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-chloro-2-fluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-1H-indole-5-carboxylic acid [2- (cis-2,6-dimethyl-morpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide ;
4-Chloro-1H-indole-5-carboxylic acid [2- (trans-2,6-dimethyl-morpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide ;
4-chloro-1H-indole-5-carboxylic acid [2- (3-fluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-piperidin-1-yl-2- (4-trifluoromethyl-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,4-difluoro-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyridin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-p-tolyl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-trifluoromethoxy-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-trifluoromethyl-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,4-difluoro-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (tetrahydro-pyran-4-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclopentyloxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-dimethyl-isoxazol-4-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,5-dimethyl-isoxazol-4-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-p-tolyl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-phenoxy-phenyl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (4-phenoxy-phenyl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-methoxy-phenyl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-methyl-pyrazin-2-yl) -2-piperidin-1-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-isothiazol-5-yl-2-piperidin-1-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-thiazol-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (5-methyl-pyrazin-2-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-thiazol-5-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -2-cyclohexyl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (6-chloro-pyridin-3-yl) -4-methyl-pentyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-ethoxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (2-oxa-5-aza-bicyclo [2.2.1] hepta-5 Yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclohexyloxy-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (tetrahydro-pyran-4-yloxy) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1-ethyl-propoxy) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-2-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (2-piperidin-1-yl-2-pyridazin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-hydroxypyridin-4-yl) -2-piperidin-1-yl-ethyl] -amide;
1- [2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1- (2-methyl-pyrimidin-5-yl) -ethyl] -piperidine-4-carboxylic acid tert-butyl ester ;
4-chloro-1H-indole-5-carboxylic acid [2- (4-methyl-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4-fluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,3-difluoro-piperidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-azepan-1-yl-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- [1,4] oxazepan-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (3,3-difluoro-pyrrolidin-1-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-cyclopentylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (cyclopentylmethyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2-isobutylamino-2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (isobutyl-methyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (benzyl-methyl-amino) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid (3-ethyl-2-pyrimidin-5-yl-pentyl) -amide;
4- [2-[(4-Chloro-1H-indole-5-carbonyl) -amino] -1- (2-methyl-pyrimidin-5-yl) -ethyl] -piperazine-1-carboxylic acid tert-butyl ester ;
4-chloro-1H-indole-5-carboxylic acid (2-morpholin-4-yl-2-pyridazin-3-yl-ethyl) -amide;
4-chloro-1H-indole-5-carboxylic acid [2-morpholin-4-yl-2- (2-hydroxypyridin-4-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (1,1-dioxo-thiomorpholin-4-yl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (4,4-difluoro-cyclohexyl) -2- (2-methyl-pyrimidin-5-yl) -ethyl] -amide;
4,6-dichloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2- (6-oxa-3-aza-bicyclo [3.1.1] hept-3- Yl) -ethyl] -amide;
4-chloro-7-methyl-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-methyl-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-isobutyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-Chloro-7- (3-methoxy-propyl) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide ;
4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-ethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-acetyl-4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-methyl-4-trifluoromethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide; 4,7 -Dimethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-methyl-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-methyl-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-ethyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-chloro-4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7-methoxy-4-methyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-ethoxy-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-propyl-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
7- (2-tert-Butoxy-ethoxy) -4-chloro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] An amide;
4-Chloro-7- (2-hydroxy-ethoxy) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide ;
4-chloro-7-methoxy-1H-indole-5-carboxylic acid [(S) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7-methoxy-1H-indole-5-carboxylic acid [(R) -2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
4-chloro-7- (1-hydroxy-1-methyl-ethyl) -1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl- Ethyl] -amide;
4,7-difluoro-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide; and 4-fluoro-7- Methoxy-1H-indole-5-carboxylic acid [2- (2-methyl-pyrimidin-5-yl) -2-morpholin-4-yl-ethyl] -amide;
Or a salt of such a compound. 12. A compound of formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11 for use as a medicament. A medicament comprising a compound of formula (I) according to any one of claims 1 to 11 as an active ingredient or a pharmaceutically acceptable salt thereof and at least one therapeutically inactive excipient. Composition. Pain; neurodegenerative and neuroinflammatory diseases; osteoarticular diseases; obstructive airway diseases; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal diseases; genitourinary diseases; cancer; other autoimmune and allergic disorders And of the formula (I) according to any one of claims 1 to 11 for the manufacture of a medicament for the prevention or treatment of a disease selected from other disorders involving inflammatory or immune components Use of a compound or a pharmaceutically acceptable salt thereof. Pain; neurodegenerative and neuroinflammatory diseases; osteoarticular diseases; obstructive airway diseases; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal diseases; genitourinary diseases; cancer; other autoimmune and allergic disorders And a compound of formula (I) according to any one of claims 1 to 11 or a pharmaceutical thereof, for use in the prevention or treatment of a disease selected from other disorders involving inflammatory or immune components; Acceptable salt.