JP2016155769A - Psf1 gene silencing agent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide more effective therapeutic means of cancer via PSF1 gene silencing activity.SOLUTION: The invention relates to a composition having PSF1 gene silencing activity and containing a component (I) with a peak at 11.1 minutes in retention time and/or a component (II) with a peak at 14.6 minutes in retention time on the basis of HPLC analyses in the conditions of the following (A)-(F): (A) HPLC column: the column filled with octadecyl silica gel support (particle diameter 3 μm) and having an inside diameter of 4.6 mm and a height of 150 mm; (B) HPLC column oven temperature: 40°C; (C) flow rate: 0.8 ml/minute; (D) detection: 190-400 nm; (E) mobile phase: (a) methanol and (b) 10 mM of ammonium formate aqueous solution; and (F) gradient condition: maintaining a mixed solvent of 85% of (a) and 15% of (b) for 5 minutes, subsequently linearly increasing the concentration of the (a) in the mixed solvent from 85% to 100% over 15 minutes, and then maintaining the concentration of the (a) 100%.SELECTED DRAWING: None

Description

  The present invention relates to an anticancer agent, and more particularly, to an anticancer agent effective for suppressing the growth of cancer stem cells and use thereof.

  Traditionally, cancer tissues were thought to be composed of cancer cell populations with uniform properties. However, in recent years, it has been found that some cancer cells have higher invasion ability, metastasis ability, and resistance to radiation therapy and chemotherapy than other cancer cells. Cancer cells with these characteristics express the same genes as undifferentiated cells such as embryonic stem cells and produce differentiated cancer cells with different gene expression, so they are called cancer stem cells. (Non-Patent Documents 1 and 2).

  The major difference between cancer stem cells and other cancer cells is that cancer stem cells can form cancer tissue with a single cell, whereas cancer cells cannot build cancer tissue. . Therefore, even if many cancer cells are killed by treatment, if cancer stem cells remain, they will cause recurrence. In addition, regarding cancer drug resistance, it has been considered that cancer cells acquire drug resistance in the course of continuous treatment. Certainly, such cells may appear as a response to a therapeutic agent. However, in recent years, it has been clarified that cells having treatment resistance exist in advance in the primary tumor focus, and this has been found to be cancer stem cells (Non-patent Document 3).

  Based on the above knowledge, development of a cancer treatment method that effectively controls cancer stem cells is expected. Cancer stem cells have the characteristics of “activating various intracellular survival signals”, “having a mechanism for maintaining undifferentiation”, and “having self-replication ability”. In particular, the latter two are called stem cell. Therefore, differentiation of cancer stem cells into treatable cancer cells, and killing cancer cells with conventional anticancer drugs, or suppressing cancer stem cell self-replication and suppressing cancer growth The method to do is examined.

  As therapeutic agents targeting cancer stem cells currently under development, for example, there are so-called multikinase inhibitors that suppress various intracellular signals such as cMyc pathway, Stat3 pathway, and β-catenin pathway. In addition, based on the finding that the activation of notch receptor is involved in the undifferentiation of cancer stem cells, a method for suppressing notch receptor activity and differentiating cancer stem cells into cancer cells has also been proposed. (Patent Document 1). Furthermore, in recent years, Sonic hedgehog (shh) is a cell signaling substance involved in cell proliferation, differentiation, and survival during fetal organogenesis, and various cancer cells (for example, chronic leukemia, lung cancer, breast cancer, pancreas) It is suggested that it contributes to the maintenance of cancer stem cells in cancer, liver cancer models, and medullary cancers, and treatment efficacy against prostate cancer using a compound that inhibits Shh has been proposed ( Non-patent document 4). However, the effect on cancer stem cells by these methods has not yet been confirmed.

  No intracellular signal related to cell survival specific to cancer stem cells has been found so far. That is, the cell survival signal used in cancer stem cells is an important molecule for cell survival of stem cells even in normal cells other than cancer stem cells. Therefore, if such a survival signal is blocked, it is considered that the stem cells of normal tissues are also killed. As for the molecular mechanism for maintaining the undifferentiated nature of stem cells, none specific to cancer stem cells has been found. Therefore, since inhibition of the undifferentiated maintenance molecule of cancer stem cells also induces differentiation of stem cells of normal tissues, there is a concern that normal stem cells may be depleted.

  By the way, PSF1 (partner of sld five 1) has been reported to function in rapid self-renewal of undifferentiated stem cells (Non-patent Documents 5 and 6), and its expression has also been reported in cancer tissues. (Non-Patent Documents 7 to 9). In recent years, a lung cancer cell line (Lewis Lung Carcinoma; LLC) and a colon cancer cell line (colon26) in which the PSF1 gene has been cloned and a gene encoding an EGFP fluorescent protein operably linked downstream of the promoter have been produced. (Non-Patent Document 10). As a result of tests using these cells, (1) high-positive cells with high PSF1 transcriptional activity have tumorigenicity even when a small number of cells are re-implanted, and the ability to dissolve and infiltrate matrix components. And high metastatic activity, and (2) the common location that PSF1-positive cancer stem cells in mouse tumor tissue and PSF1-positive cancer cells in human tumor tissue are located in the vicinity of tumor blood vessels. (3) When the PSF1 gene in human cells is knocked down by RNAi method, the cell cycle is stopped or delayed. (4) High positive cells with high PSF1 transcriptional activity are more embryonic than low positive cells. It has been confirmed that the expression of genes unique to stem cells is high (Non-patent Document 11). Furthermore, it has been reported that PSF1 high-expressing cells enhance anticancer drug resistance by administration test of anticancer drugs to mice (Non-patent Document 11).

Special table 2012-501626 JP2011-195530 JP20111955531 JP2011-195533 JP2011-195534

Ben-Porath I et al., Nat. Genet. 2008; 40: 499-507 Somervaille TC et al., Cell Stem Cell 2009; 4: 129-40 Visvader JE, Lindeman GJ, Nat Rev Cancer 2008; 8: 755-68 Nanta R et al., Oncogenesis 2, e42,2013 Ueno M et al., Mol Cell Biol 2005; 25: 10528-32 Ueno M et al., Blood 2009; 113: 555-62 Obama K et al., Oncol Rep 2005; 14: 701-6 Hayashi R et al, Genomics Proteomics Bioinformatics 2006; 4: 156-64; Ryu B et al., PLoS One 2007; 2: e594 Nagahama Y et al., Cancer Res 70, 1215-1224, 2010 Matsui T et al., Am J Pathol 182; 1790-1799, 2013

  In addition to the above, the present inventors have confirmed that the gene expression pattern of PSF1-positive cells matches the gene expression pattern of CD44 strongly positive cells, which is said to be a cancer stem cell marker. From the above, it can be seen that by suppressing the expression of the PSF1 gene, it is possible to effectively treat cancer by suppressing the ability of cancer cells such as tumor forming ability, invasion ability, and metastasis ability. This is because PSF1 gene is highly expressed in cancer stem cells among cancer cells, and by targeting PSF1 gene, the activity of cancer stem cells that are the source of cancer cells can be contained. Because. However, an anticancer drug through suppression of PSF1 gene expression has not yet been reported. Accordingly, an object of the present invention is to provide a more effective cancer treatment means through PSF1 gene expression-suppressing activity.

  As a result of searching for a substance having PSF1 gene expression-inhibiting activity, the present inventors have found that the extract of rapeseed and its various fractions have its activity, and the extract of rapeseed and its various fractions. Has found that the expression of PSF1 gene is suppressed without immediately inducing cell death of PSF1 gene-expressing cells. Based on such findings, the present inventors have repeated further tests, and the extract of the seed moth and its various fractions stop or delay the cell division cycle of cancer cells including cancer stem cells, and make them rest. Was confirmed to suppress the tumor growth.

  On the other hand, the extract of the seed sprout is disclosed in Patent Documents 2 to 5. For example, Patent Documents 2 and 3 describe that the extract of Solanum spp. Has a protein saccharification-inhibiting action, and a wrinkle improving action or dullness improving action based thereon is expected. Patent Document 4 describes that the extract derived from the seed moth has a fibroblast proliferation-promoting effect, and an anti-aging effect or a wrinkle-improving effect based thereon is expected. Patent Document 5 describes that the extract derived from the seed moth has a hyaluronic acid production promoting action, and an anti-aging action or wrinkle improving action based thereon is expected.

  The present inventors have the protein saccharification inhibiting action, fibroblast proliferation promoting action, and hyaluronic acid production promoting action as described in Patent Documents 2 to 5 in the various fractions of the above-mentioned extract Confirmed not to. In other words, it was confirmed that the various actions described in Patent Documents 2 to 5 are caused by components that are not present in the various fractions of the extract of the seed moth.

Based on the above findings, further studies and improvements are made, and the inventions represented below are provided.
Item 1.
In HPLC analysis under the following conditions (A) to (F), component (I) having a peak at a retention time of 11.1 minutes and / or component (II) having a peak at a retention time of 14.6 minutes A composition containing and having PSF1 gene expression inhibitory activity:
(A) HPLC column: a column having an inner diameter of 4.6 mm and a length of 150 mm packed with an octadecylated silica gel carrier (particle diameter: 3 μm) (B) HPLC column oven temperature: 40 ° C.
(C) Flow rate: 0.8 ml / min (D) Detection: 190-400 nm
(E) Mobile phase: (a) Methanol and (b) 10 mM ammonium formate aqueous solution (F) Gradient condition: 85% of (a) and 15% of (b) mixed solvent is held for 5 minutes, then 15 minutes The concentration of (a) in the mixed solvent is increased linearly from 85% to 100%, and then the concentration of (a) is maintained at 100%.
Item 2.
Item 2. The composition according to Item 1, which is a PSF1 gene expression inhibitor.
Item 3.
Item 3. The composition according to Item 1 or 2, which is a preventive or therapeutic agent for cancer.
Item 4.
Item 4. The composition according to Item 3, wherein the cancer is one or more selected from the group consisting of brain tumor, breast cancer, respiratory cancer, gastrointestinal cancer, urological tumor, female genital tumor, and blood tumor.
Item 5.
Item 5. The composition according to any one of Items 1 to 4, which has no protein glycation-inhibiting activity, fibroblast proliferation promoting activity, and hyaluronic acid production promoting activity.
Item 6.
Item 6. The composition according to any one of Items 1 to 5, wherein the components (I) and (II) are derived from a spruce.
Item 7.
Item 7. The composition according to any one of Items 1 to 6, wherein the composition is a fraction obtained by extracting the seed moth with water-containing lower alcohol and subjecting the obtained extract to reverse phase column chromatography.
Item 8.
Item 8. The composition according to Item 7, wherein a lower alcohol or acetonitrile is used as a mobile phase in the reverse phase gel column chromatography.
Item 9.
Item 6. The composition according to any one of Items 1 to 6, obtained by a method comprising the following (1) to (3):
(1) Extracting the seedling with lower alcohol and recovering the extract,
(2) subjecting the extract obtained in (1) to liquid partition with hexane and collecting the lower layer;
(3) Subject the lower layer obtained in (2) to liquid-liquid partition with chloroform and collect the chloroform fraction.
Item 10.
Item 10. The composition according to Item 9, wherein the method further comprises (4) below:
(4) Use the chloroform fraction obtained in (3) for silica gel column chromatography using a mixture of a low polarity solvent and a lower alcohol as a mobile phase.
Item 11.
The foodstuff in which the composition in any one of claim | item 1 -10 was concentrated.
Item 12.
Use of the composition according to any one of Items 1 to 10 to suppress PSF1 gene expression (except for medical practice for humans).

  According to the present invention, it is possible to effectively treat cancer by suppressing the expression of PSF1 gene. This suppresses not only normal cancer cells but also cancer stem cell proliferation by suppressing PSF1 gene activity (or causing these cells to diapause), and not only the ability of cancer to form tumors. This is because invasive ability and metastatic ability can also be effectively suppressed. Therefore, according to the present invention, malignancy or seriousness of cancer can be prevented. In addition, suppression of PSF1 gene expression (particularly moderate suppression of expression) does not show a significant effect on normal cells that do not cause cell growth or have a slow cell growth rate. Even if cancer cells are induced to diapause, the cell cycle checkpoint is broken, so the cells do not pause division and the molecules necessary for cell division are not prepared. In order to continue division, division death is induced in the next division, but in the case of normal cells, even if dormancy is induced, division occurs after sufficient molecules are prepared for cell division. This is because death is not induced. Accordingly, the present invention provides a safer means of treating cancer that is less burdensome for the patient.

It is a HPLC chromatograph of the chloroform fraction obtained by carrying out the liquid-fraction fractionation of the seed-crab extract. The vertical axis represents absorbance at the detection wavelength (280 nm), and the horizontal axis represents retention time (minutes). Here, the presence of two characteristic peaks (I) (retention time 11.223 minutes) and (II) (retention time 14.722 minutes) is shown. It is a HPLC chromatograph of the normal phase fraction (1) obtained by subjecting the chloroform fraction obtained by liquid-fractionating the seed extract to the pressure phase to normal phase medium pressure fractionation column chromatography. The vertical axis represents absorbance at the detection wavelength (280 nm), and the horizontal axis represents retention time (minutes). Here, the presence of two characteristic peaks (I) (retention time 11.072 minutes) and (II) (retention time 14.658 minutes) is shown. It is a HPLC chromatograph of the reverse-phase fraction (2) obtained by attaching | subjecting the extract of S. cerevisiae to reverse phase intermediate pressure preparative column chromatography. The vertical axis represents absorbance at the detection wavelength (280 nm), and the horizontal axis represents retention time (minutes). Here, the presence of two characteristic peaks (I) (retention time 10.948 minutes) and (II) (retention time 14.546 minutes) is shown. It is a microscope picture which shows the form of a cell, after adding various extracts (A) and the fraction (B) of the seed extract of Bush to LLC cells, and culturing for 16 hours. 1 of A is a negative control (DMSO), 2 of A is an extract of the radish, and 3 of A is a positive control (when Rhus taitensis extract is added). 1 of B is a chloroform fraction of the extract of S. cerevisiae, 2 of B is a normal phase fraction (1), and 3 of B is a reverse phase fraction (2). Various extracts (A) and fractions of B. edulis extract (B) were added to LLC cells expressing EGFP fluorescent protein under PSF1 promoter control, and EGFP expression intensity and PI staining intensity were analyzed by flow cytometry. Results are shown. 1 of A is a negative control (DMSO), 2 of A is an extract of the radish, and 3 of A is a positive control (when Rhus taitensis extract is added). 1 of B is a chloroform fraction of the extract of S. cerevisiae, 2 of B is a normal phase fraction (1), and 3 of B is a reverse phase fraction (2). The result of having analyzed the expression level of intracellular PSF1 mRNA by real-time PCR is shown by adding the seed extract and the fraction obtained by fractionating the seed extract from various methods to LLC cells. Compared with DMSO addition, the expression of PSF1 gene is attenuated in cells to which the extract of rapeseed and the extract of rapeseed is added. 1 on the horizontal axis is negative control (addition of DMSO), 2 is extract of seedlings, 3 is chloroform fraction of extract of seedlings, 4 is normal phase fraction (1), 5 is reverse phase fraction (2 ) Is added. The vertical axis shows the relative expression level of PSF1 RNA based on the control. Seeds of rapeseed extract and fractions obtained from various extracts of rapeseed extract by various methods. Various human cancer cells [glioma (U87MG), breast cancer (MCF7), lung cancer (EBC1), gastric cancer (HGC-27) , colon cancer (HT29), prostate cancer (PC3), cervical cancer (HELA), leukemia (MEG01) [() shows the cell line name]], and the expression level of intracellular PSF1 mRNA is real-time PCR The result of analysis is shown. 1 on the horizontal axis is negative control (addition of DMSO), 2 is extract of seedlings, 3 is chloroform fraction of extract of seedlings, 4 is normal phase fraction (1), 5 is reverse phase fraction (2 ) Is added. The vertical axis shows the relative expression level of PSF1 RNA based on the control. The result of calculating the number of tumor masses that are formed in the lung when a rapeseed extract is administered to a mouse in a cancer development model using a mouse lung cancer cell line (KLN205 cell line) is shown. The vertical axis shows the number of tumor masses formed per lung. 1 on the horizontal axis is a negative control (administration of DMSO), and 2 is a case where the extract of rapeseed is administered. The result of having measured the influence which the fraction of the extract of a rapeseed extract has on protein glycation by the expression level of CML [carboxymethyllysine] is shown. CML is one of advanced glycosylation end products (AGEs), which are end glycation products, and is a marker for glycation. Negative control to which no fraction was added was taken as 100. Regarding the horizontal axis, 1 is a negative control (DMSO added), 2 is a chloroform fraction of the extract of the seed moth, 3 is a normal phase fraction (1), and 4 is a reverse phase fraction (2). It is. A vertical axis | shaft shows the relative production amount of AGEs on the basis of control. In any fraction, an effect of promoting saccharification was observed. The result at the time of observing the influence which the fraction of the extract of a spruce on fibroblast proliferation shows is shown. The proliferation level of fibroblasts in a negative control to which no fraction was added was taken as 100. Regarding the horizontal axis, 1 is a negative control (DMSO added), 2 is a chloroform fraction of the extract of the seed moth, 3 is a normal phase fraction (1), and 4 is a reverse phase fraction (2). It is. The vertical axis represents the relative amount of fibroblast proliferation based on the control. In any fraction, it was observed that cell proliferation was suppressed. The result at the time of measuring the influence which the fraction of the rapeseed extract extracts on the production of hyaluronic acid from fibroblasts is shown. Hyaluronic acid production level in a negative control to which no fraction was added was defined as 100. Regarding the horizontal axis, 1 is a negative control (DMSO added), 2 is a chloroform fraction of the extract of the seed moth, 3 is a normal phase fraction (1), and 4 is a reverse phase fraction (2). It is. A vertical axis | shaft shows the relative production amount of hyaluronic acid on the basis of control. In any fractions, it was observed that promotion of hyaluronic acid production was not observed or acted in a suppressive manner.

The composition having PSF1 gene expression inhibitory activity has a component (I) having a peak at a retention time of 11.1 minutes and / or a retention time of 14.1 minutes in HPLC analysis under the following conditions (A) to (F). It is preferable to contain component (II) having a peak at 6 minutes.
(A) HPLC column: a column having an inner diameter of 4.6 mm and a length of 150 mm packed with an octadecylated silica gel carrier (particle diameter: 3 μm) (B) HPLC column oven temperature: 40 ° C.
(C) Flow rate: 0.8 ml / min (D) Detection: 190-400 nm
(E) Mobile phase: (a) Methanol and (b) 10 mM ammonium formate aqueous solution (F) Gradient condition: 85% (a) and 15% (b) mixed solvent is held for 5 minutes, then 15 minutes The concentration of (a) in the mixed solvent is increased linearly from 85% to 100%, and then the concentration of (a) is maintained at 100%. “Retention time 11.1 minutes” and “retention time” with respect to the retention time “14.6 minutes” includes a range of several seconds before and after (for example, 20 seconds, 15 seconds, 10 seconds, 5 seconds, 3 seconds, 2 seconds, or 1 second). This is because even if the HPLC analysis is performed under the same conditions, a slight experimental error occurs in the holding time between lots.

Octadecylated silica gel carriers having a particle size of 3 μm are commercially available, and can be appropriately selected and used, but preferably satisfy the following specifications.
(A) Base material: high purity spherical silica gel (ES silica)
(B) Surface area: 200 m ² / g
(C) Pore diameter: 200 mm (20 nm)
(D) Pore volume: 1.00 mL / g
(E) Chemical bonding group: octadecyl group (f) End cap: Yes (g) Carbon content: 9%
(H) UPS code: L1
As a simple substance satisfying the above specifications, for example, “InertSustainSwift (registered trademark) C18” manufactured by GL Science Co., Ltd. used in Production Example 2 described later can be cited. “Particle size 3 μm” means that the average particle size is 3 μm.

  As the detection wavelength, a wavelength arbitrarily selected from the range of 190 nm to 400 nm can be used. For example, the detection wavelength can be set to 254 nm, 280 nm, or 365 nm.

  Means for obtaining a composition having PSF1 gene expression inhibitory activity, raw materials, and the like are not particularly limited. In a preferred embodiment, the composition having PSF1 gene expression suppressing activity can be obtained by extracting a plant as a raw material. Preferable plants include radish. “Tanetsukibana” is a plant belonging to the genus Brassicaceae, and includes Cardamine scutata and Cardamine regeliana.

  The part of the plant subjected to the extraction is not particularly limited, and can be appropriately selected from whole grass, aerial parts, leaves, bark, stems, roots, fruits, seeds, seed coats, flowers, and the like. From the standpoint of obtaining an extract having a higher PSF1 gene expression inhibitory activity, the extract of Solanum spp. Is preferably the whole plant extract.

  The plant extract can be obtained by arbitrarily selecting known extraction methods and combining them. For example, a plant or a part thereof can be directly or after drying, pulverized or chopped, and extracted in a batch or continuous manner using a solvent.

  As the extraction solvent, any solvent can be selected and used. For example, water; lower alcohol solvents such as methanol, ethanol, propanol and isopropanol; polyhydric alcohol solvents such as 1,3-butylene glycol, propylene glycol, dipropylene glycol and glycerin; ether solvents such as ethyl ether and propyl ether; acetic acid Ester solvents such as methyl, ethyl acetate and butyl acetate; ketone solvents such as acetone and methyl ethyl ketone; methane derivatives such as dichloromethane and chloroform; ethane derivatives such as 1,1,1-trichloroethane; and ethylene derivatives such as tetrachloroethylene There may be mentioned certain chlorinated aliphatic hydrocarbon solvents. These solvents can be used alone, in combination or in combination. As a preferable solvent for obtaining the extract of Solanum spp., A low polarity solvent (for example, ethyl acetate and chloroform) and an alcohol solvent are raised from the same viewpoint as described above, and more preferably an ester solvent and an aliphatic chloride chloride. Solvents and lower alcohol solvents (for example, hydrous lower alcohol solvents), more preferably fatty acid lower alkyl ester solvents, chlorinated aliphatic lower hydrocarbon solvents, and methanol and ethanol.

  The amount of the solvent used for the extraction can be appropriately selected. Usually, the extraction solvent is preferably used in an amount of 1 to 100 times that of the raw material. The extraction temperature may be appropriately determined according to the purpose, but in the case of water extraction, it is usually preferably 4 to 130 ° C, more preferably 25 to 100 ° C. When the lower alcohol is contained in the solvent, the range of 4 to 70 ° C. is preferable. When using a non-alcohol organic solvent, it is preferable to perform extraction at 4 ° C. to reflux temperature.

  The extraction time can be set in consideration of extraction efficiency. For example, the raw material, the extraction solvent, and the extraction temperature can be set to be in the range of several minutes to several days, preferably 30 minutes to 1 day. The extraction operation may be performed, for example, while stirring or standing, and may be repeated several times as necessary. Furthermore, if necessary, an extract having PSF1 gene expression inhibitory activity can be obtained by combining treatments such as filtration, centrifugation, concentration, and ultrafiltration.

  The above-described extract can be used as a composition having PSF1 gene expression inhibitory activity as it is, but if necessary, the extract is concentrated and dried to dissolve again in water, a polar solvent, or a nonpolar solvent. Thus, a composition having PSF1 gene expression inhibitory activity can also be obtained. A composition having PSF1 gene expression inhibitory activity can be used to decolorize, deodorize, desalinate, distribute liquid, column chromatography (chromatography such as normal phase and / or reverse phase), etc., as long as physiological effects are not impaired. It is preferable to obtain it as a purified product (or a fraction) obtained by performing the fractionation / purification treatment according to 1.

  In one embodiment, the composition having PSF1 gene expression inhibitory activity is preferably obtained by subjecting the above-described extract to liquid-liquid distribution. Liquid-liquid distribution uses two kinds of liquid solvents that are not mixed with each other, selected from hexane, chloroform, ethyl acetate, n-butanol, water, etc., in each of the upper and lower layers formed by the solvent used. It is a method of fractionating each component to be dissolved. By repeating this, for example, it is possible to fractionate into a hexane soluble fraction, a chloroform soluble fraction, an ethyl acetate soluble fraction, an n-butanol soluble fraction, and a water soluble fraction. Preferred solvents used are hexane, chloroform, hydrous alcohol (eg, 80% methanol, 80% ethanol), and water. In one embodiment, hexane and water (or hydrous alcohol) are used for liquid partitioning, the lower aqueous layer (or hydrous alcohol layer) is recovered, and further used for liquid-liquid partitioning using chloroform. It is preferable to recover the chloroform layer. The obtained chloroform layer is preferably washed with water. Each liquid distribution can be repeated a plurality of times, for example, 2-5 times.

  In one embodiment, the composition having PSF1 gene expression suppression activity is preferably obtained by subjecting the above-described extract to normal phase chromatography. In normal phase chromatography, it is preferable to use silica gel as the stationary phase. As the mobile phase (elution solvent), an organic solvent such as a low polarity solvent (for example, toluene, hexane, chloroform, ethyl acetate, etc.), acetone and a lower alcohol (for example, methanol, etc.) can be used. Use a single solvent or a mixed solvent of 2 to 3 types as appropriate, and increase the polarity of the solvent used from low to high polarity to lower the polarity of substances adsorbed on silica gel (extracts, etc.) Fractions can be eluted and eluted sequentially from the substance. As the mobile phase, use of a chloroform-methanol solvent or an ethyl acetate-methanol solvent is preferred. When obtaining a composition having PSF1 gene expression inhibitory activity using normal phase chromatography, it is preferable to use the fraction obtained by the liquid-liquid partition described above (for example, the chloroform fraction) as the sample.

  In one embodiment, the composition having PSF1 gene expression inhibitory activity is preferably obtained by subjecting the above-described extract to reverse phase chromatography. In reverse-phase chromatography, a stationary phase having a low polarity (for example, an octyl group having 8 carbon chains or an octadecyl group having 18 carbon chains bonded to silica gel, the latter being called ODS) should be used. preferable. As the mobile phase (elution solvent), a highly polar one (for example, water or a salt-containing aqueous solution, a lower alcohol, and an organic solvent such as acetonitrile) can be used as a single or mixed solvent. For example, when a water-alcohol system is used as the mobile phase, it is possible to obtain a fraction by starting to elute from a highly polar substance in order by sequentially increasing the alcohol content. As the mobile phase, it is preferable to use a water-methanol solvent or a water-ethanol solvent.

  As a variation of normal phase chromatography, hydrophilic interaction chromatography or the like can be used. Separation of polar compounds that are difficult to separate by reversed-phase chromatography by using silica gel whose surface is modified with polar groups (diol, amide, sulfobetaine, etc.) for the stationary phase and a solvent containing water for the mobile phase Is possible. In addition, a composition having PSF1 gene expression inhibitory activity using molecular sieve chromatography that separates a mixture according to its molecular size, ion exchange chromatography that separates inorganic ions or highly polar molecules using their charge, and the like It is also possible to obtain

  The inhibitory activity of PSF1 gene expression can be measured by any technique. For example, as shown in the Examples described later, a cell line constructed to express EGFP under the control of the PSF1 gene promoter (for example, , LLC cells).

  In one embodiment, the composition having PSF1 gene expression inhibitory activity does not have at least one activity selected from the group consisting of protein saccharification inhibitory activity, fibroblast proliferation promoting activity, and hyaluronic acid production promoting activity. Preferably, it does not have two or more activities selected from said group, more preferably it does not have all the activities belonging to said group. Protein saccharification inhibiting activity can be measured by the method described in Test Example 5 described later. The fibroblast proliferation promoting activity can be measured by the method described in Test Example 6 described later. Hyaluronic acid production promoting activity can be measured by the method described in Test Example 7 described later.

  In one embodiment, the composition having PSF1 gene expression inhibitory activity comprises component (I) and component (II), and can comprise any other component, but substantially comprises component (I) and component ( It is preferable to include only II). In another embodiment, the composition having PSF1 gene expression inhibitory activity preferably contains component (I) or component (II).

  Since the extract of Solanum spp. And its various fractions have PSF1 gene expression inhibitory activity, they can be used as PSF1 gene expression inhibitors or cancer preventive or therapeutic agents. Even if PSF1 gene expression inhibitor is an extract of rapeseed or various fractions thereof (for example, herbal medicine), a combination of the extract of rapeseed or various fractions thereof and other components (for example, Chinese medicine). Further, the PSF1 gene expression inhibitor may be in the form of food. The food includes general foods and functional foods (for example, health foods, health supplements, sick foods, nutritional supplements, health functional foods, foods for specified health, and nutritional functional foods).

  When a PSF1 gene expression inhibitor is used as a preventive or therapeutic agent for cancer, the type of cancer is not particularly limited and can be arbitrarily selected. For example, cancer is brain tumor (eg, glioma), breast cancer, respiratory cancer (eg, lung cancer), digestive organ cancer (eg, colon cancer, stomach cancer), urinary system tumor (eg, prostate cancer). ), Female genital tumors (eg, cervical cancer), and blood tumors (eg, leukemia). In one embodiment, preferred cancer types for prevention or treatment are lung cancer, cervical cancer, colon cancer, gastric cancer, and glioma.

  The form of the PSF1 gene expression inhibitor or the preventive or therapeutic agent for cancer is not particularly limited, and can be any form such as liquid, paste, gel, solid, and powder. Depending on the purpose of use, the extract of spinach or its various fractions is blended with various pharmaceutically acceptable carriers, and optionally, a solvent, a dispersant, an emulsifier, a buffer, a stabilizer, an excipient, a binding Additives, disintegrants, lubricants, etc. can be added to form solids such as tablets, granules, powders, powders and capsules, and liquids such as normal solutions, suspensions and emulsions.

  The pharmaceutically acceptable carrier is not particularly limited. For example, starch, lactose, sucrose, mannitol, corn starch, crystalline cellulose, carboxymethyl cellulose, polyvinyl alcohol, polyvinyl pyrrolidone, polyvinyl ether, ethyl cellulose, gum arabic, tragacanth, gelatin , Hydroxypropylcellulose, dextrin, pectin, magnesium stearate, talc, polyethylene glycol, water, ethyl alcohol, ethylene glycol, glycerin and the like. One or a combination of two or more of these can be appropriately selected and used.

  The compounding amount in the case of using the extract of rapeseed having PSF1 gene expression inhibitory activity or various fractions thereof as a medicine varies depending on the degree of disease, patient age, etc., and is preferably determined experimentally. For example, in the case of an oral preparation containing an extract having PSF1 gene expression inhibitory activity as an active ingredient, the daily dose per adult (60 kg body weight) is about 5 mg to 30 g, preferably about 20 mg to 10 g. It can be administered once to several times a day. In addition, in the case of intravascular administration, it is preferably about 0.5 mg to 3 g, or about 2 mg to 1 g. In this case as well, it may be administered once or several times a day by injection or with an infusion solution. it can.

  The extract of the seed moth or the various fractions thereof having PSF1 gene expression inhibitory activity can be made into a food product in which the extract or the various fractions thereof are concentrated by blending it with the food. The amount of the extract or its various fractions blended in a concentrated state in the food can be appropriately set according to the purpose, for example, in terms of dry weight of the extract or its various fractions, Adult daily intake can be set to be 0.1-30 g.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to these.

Production Example 1: Preparation of extract of radish seeds 5 L of 80% ethanol was added to 500 g of dried radish whole plant, shaken occasionally at 50 ° C. for 8 hours, and then allowed to stand overnight at room temperature. This was filtered, and the filtrate was concentrated under reduced pressure, and then freeze-dried overnight to obtain 96.6 g of the extract of Sedum.

Production Example 2: Preparation of Chloroform Fraction and Normal Phase Fraction (1) from Seedling Extracts Dissolve a part (20.31 g) of Seedling extract obtained in Preparation Example 1 in 1440 mL of methanol (with insolubles) ), 360 mL of water was added, stirred and almost dissolved. 450 mL, 360 mL, and 360 mL of hexane were used for a total of three liquid-liquid distributions. The lower layer was subjected to liquid-liquid partitioning using 2700 mL and 200 mL of chloroform in total. The obtained chloroform layers were combined, washed with 500 mL of water, and then concentrated under reduced pressure, to obtain a chloroform fraction (1793 mg) of Solanum spp. This chloroform fraction was dissolved in a solvent obtained by adding a small amount of methanol to chloroform, and about 15 ml of diatomaceous earth was added and concentrated to dryness. This fraction-supporting diatomaceous earth was placed in a 25 ml syringe, connected in front of the following column, and subjected to medium pressure preparative column chromatography under the following conditions. Column: Biotage ZIP ^™ 80 g Si (40-63 μm) (silica gel 80 g, volume 102 ml) (manufactured by Biotage Japan KK),
Flow rate: 50ml / min, Fraction volume: 25ml, Detection: UV254nm
Time mode: W 3 minutes Chloroform: Methanol = 100: 0 (Fr.1-6)
G 21 minutes Chloroform: methanol = 100: 0 → 90:10 (Fr.7 ~ 48)
T 5 min Chloroform: methanol = 90: 10 (Fr.49-58)
Fr. 24-29 were combined and concentrated under reduced pressure to obtain 128 mg of a normal phase fraction (1) of Spodoptera spp.

The thus obtained chloroform fraction and normal-phase fraction (1) of Spodoptera spp. Showed the chromatograms of FIGS. 1 and 2, respectively, in HPLC analysis. In any chromatogram, two characteristic peaks (I) (retention time around 11.1 minutes) and (II) (retention time around 14.6 minutes) were confirmed. The HPLC measurement conditions are as follows.
Column: InertSustainSwift C18 (3μm, 4.6φX150mm) (manufactured by GL Sciences Inc.)
LC system: Shimadzu LC-6A system (manufactured by Shimadzu Corporation)
Column oven temperature: 40 ° C
Flow rate: 0.8 mL / min
Detection: UV280nm
Mobile phase: Methanol (A), 10 mM ammonium formate solution (B)
Gradient program: 0 → 5min A (85%), B (15%),
5 → 20min A (85 → 100%), B (15 → 0%),
20 → 40min A (100%), B (0%),
40 → 45min A (100 → 85%), B (0 → 15%)

Production Example 3: Preparation of reverse-phase fraction (2) of the extract of the radish seedling Add 170 ml of 80% methanol to 17 g of the dried plant of the vinegar, and shake it occasionally at 50 ° C for 8 hours, and then leave it overnight at room temperature. did. This was filtered, and the obtained filtrate was subjected to flash column chromatography using an ODS column. A column (YMC-DispoPack AT (ODS-25: 40 g), manufactured by YMC Co., Ltd.) was preinfiltrated with 80% methanol in advance, and the filtrate was poured into the column. Next, 120 ml of 90% methanol was passed as a mobile phase, and elution was continued with 100% methanol. Fractions were fractionated 60 ml each from the time of switching to 100% methanol, and fractions 3 to 5 were combined and concentrated to dryness to obtain 66 mg of reverse-phase fraction (2) of Satsuma vaginalis.

  As a result of the HPLC analysis, the reverse phase fraction (2) of S. cerevisiae thus obtained showed the chromatogram of FIG. Two characteristic peaks (I) (retention time around 11.1 minutes) and (II) (retention time around 14.6 minutes) were confirmed in the same manner as the above-mentioned chloroform fraction and progressive fraction. It was. The HPLC conditions are the same as the analysis conditions in Production Example 2.

Test Example 1: Examination of cell death induction based on cell morphology
A lung cancer cell line LLC (Cancer Res 70, 1215-1224, 2010) expressing EGFP under the control of the PSF1 gene promoter was obtained from Osaka University. This cell line was cultured in DMEM supplemented with 10% fetal calf serum (FCS), 100 units / ml penicillin, and 100 μg / ml streptomycin under conditions of 5% CO ₂ and 37 ° C. The LLC cultured in this manner was seeded in a 6-well culture dish by 10 ⁴ cells, and cultured in 2 ml of the above culture medium for 24 hours. Extracts from the seed crabs obtained in Production Examples 1, 2, and 3 above, their chloroform fractions, normal phase fractions (1) and reverse phase fractions (2) into dimethyl sulfoxide (DMSO; manufactured by Nacalai Tesque) Dissolved and added to wells where LLC was cultured to a final concentration of 100 μg / ml. Only the normal phase fraction (1) had a final concentration of 30 μg / ml. As a negative control, 2 μl of DMSO alone was added. For the positive control, an extract obtained from leaves of Rhus taitensis was added in the same manner as in Production Example 1 so that the final concentration was 100 μg / ml. Thereafter, the cells were cultured for 16 hours under the above culture conditions, and the morphology of the cells was observed with a microscope. The results are shown in FIG. Similar to the cell image of the negative control, the morphology of the cells to which the extract of S. cerevisiae was added was not particularly changed, indicating that cell death was not induced (1 and 2 in FIG. 4A). On the other hand, in the cells to which the extract of Rhus taitensis was added, a change in morphology peculiar to cell death was observed, and induction of cell death was confirmed (3 in FIG. 4A). It was also confirmed that cell death was not induced by the chloroform fraction, normal phase fraction (1), and reverse phase fraction (2) of the extract of the seed moth (Fig. 4B, 1 to 3).

Test Example 2: Examination of PSF1 gene expression inhibitory action LLC cells cultured under the same conditions as in Test Example 1 were washed once with a phosphate buffer solution (PBS) containing 5% FCS, and then PBS containing 500 μl of 5% FCS. Dispersed. Thereto, 2 μl of propidium iodide (PI: manufactured by BD Bioscience) was added and gently mixed, and allowed to react at room temperature in the dark for 15 minutes. Thereafter, the cells were subjected to a flow cytometer (FACS Calibur: manufactured by Becton Dickinson), and analyzed for GFP fluorescence intensity and PI fluorescence intensity using a flow cytometry method (FIG. 5). Most of the negative control cells are GFP positive PI negative (1 in FIG. 5A). This means that the cells are alive and the PSF1 gene continues to be transcribed. On the other hand, in cells to which an extract of Rhus taitensis, which is a positive control, was added, the PI intensity increased until exceeding 10 ³ , confirming that cell death was induced (3 in FIG. 5A). Compared with these, it was confirmed that in the cells to which the extract of Aedes spp. Was added, the PI intensity did not increase so much and the GFP intensity decreased (2 in FIG. 5A). Also, in the chloroform fraction, the normal phase fraction (1) and the reverse phase fraction (2) of the extract of Solanum spp., The PI intensity was slightly higher, but did not reach 10 ³ , The same result as that of the extract of the spider was obtained (1 to 3 in FIG. 5B). From these results, cell death was not induced in the culture time of 16 hours, but the PSF1 gene was not induced in the culture time of 16 hours by the extract of Rhizoma spp., Its chloroform fraction, normal phase fraction (1) and reverse phase fraction (2). It was found that promoter activity was suppressed.

  The compounds of the two peaks (I) and (II) confirmed in the chromatograms of FIGS. 1 to 3 each inhibit PSF1 gene expression without causing cytotoxicity alone at a concentration of 3 μg / ml. (80-90% suppression) was confirmed.

Test Example 3: Examination of PSF1 expression inhibitory action using real-time PCR Using quantitative real-time PCR, LLC cells, human glioma cells (U87MG), breast cancer cells (MCF7), lung cancer cells (EBC1), gastric cancer cells ( HGC-27), colon cancer cells (HT29), prostate cancer cells (PC3), cervical cancer cells (HELA), and leukemia cells (MEG01) were examined for the effects of extracts and fractions on the expression of PSF1 gene. . Each cell was cultured under the same conditions as in Test Example 1, and from the cancer cells treated with the extract of Solanum spp., Its chloroform fraction, normal phase fraction (1) and reverse phase fraction (2), kit Total RNA was obtained using Qiagen. For LLC cells, only the chloroform fraction had a final concentration of 300 μg / ml. Next, cDNA was synthesized from each collected RNA using ExScript RT reagent Kit (manufactured by Takara), and the expression of PSF1 was analyzed by real-time PCR using the obtained cDNA. As a comparative control, the expression level of GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) mRNA, which is a glycolytic enzyme, was also measured. Real-time PCR was performed using Stratagene Mx300P (Stratagene). The following sequences were used as primers when synthesizing mouse PSF1 by PCR.

5'- CCGGTTGCTTCGGATTAGAG-3 '(SEQ ID NO: 1)
5'- CTCCCAGCGACCTCATGTAA-3 '(SEQ ID NO: 2)
The following sequences were used as primers for synthesizing mouse GAPDH by PCR.

5′-AACTTTGGCATTGTGGAAGG-3 ′ (SEQ ID NO: 3)
5'- GGATGCAGGGATGATGTTCT -3 '(SEQ ID NO: 4)
The following sequences were used as primers for the synthesis of human PSF1 by PCR.

5′-ACCTGTATGACCGCTTGCTTC-3 ′ (SEQ ID NO: 5)
5'-TTCATCTCCTCCCAGTGAC-3 '(SEQ ID NO: 6)
The following sequences were used as primers for the synthesis of human GAPDH by PCR.

5'-ACCCAGAAGACTGTGGATGG-3 '(SEQ ID NO: 7)
5'- CCCTGTTGCTGTAGCCAAAT-3 '(SEQ ID NO: 8)

  The measurement results are shown in FIG. 6 (mouse LLC cells) and FIG. 7 (human cancer cells). From the results shown in FIGS. 6 and 7, the extract of Solanum spp., Its chloroform fraction, normal-phase fraction (1) and reverse-phase fraction (2) showed that PSF1 in mouse and human cancer cells. It was confirmed that the expression was suppressed. In particular, from the results of analysis using human cancer cells, the extract of Spodoptera and its fractions are brain tumor, breast cancer, respiratory cancer, digestive cancer, urological tumor, female genital tumor, and blood tumor. As a result, it was found that PSF1 expression was suppressed against all types of cancer. This result shows that the extract of Spodoptera, its chloroform fraction, normal phase fraction (1) and reverse phase fraction (2) suppresses the expression of PSF1 in cancer cells and cancer stem cells. It means to induce the dormancy of cancer by stopping the cycle. According to the analysis so far, the expression of PSF1 gene is enhanced regardless of the type of cancer, so that the extract of Solanum spp., Its chloroform fraction, normal-phase fraction (1) and reverse-phase fraction The painting (2) is considered effective for the treatment of all types of cancer. It is also expected to be effective in preventing malignant and serious cancer.

Test Example 4: Examination of in vivo activity evaluation using mouse lung cancer development model
KLN205 cells (mouse squamous lung cancer cells) were obtained from RIKEN. The cells were treated with Eagle containing 10% FBS (Hyclon), Non-Essential Amino Acids (Lonza), penicillin (100 units / ml; Invitrogen), and streptomycin (100 μg / ml; Invitrogen). Culture was performed using MEM (Nissui Pharmaceutical). After culturing to 80% confluent, the cells were collected with Trypsin / EDTA (Invitrogen) and adjusted to 2.0 × 10 ⁶ cells / mL with PBS.

  Seven week old DBA / 2 female mice (Japan SLC) were purchased from Shimizu Experimental Materials Co., Ltd. Three mice in plastic breeding cages in a breeding room set at a temperature of 22 ± 3 ° C, humidity of 55 ± 15%, all-fresh ventilation, and 12hr / day lighting (6am to 6pm) Housed and raised. In addition, the feed was freely ingested by laboratory MR stock (Nippon Agricultural Industry), and tap water was automatically consumed by water using an automatic water supply device.

100 μL (2.0 × 10 ⁵ cells) of the prepared KLN205 cells were injected from the tail vein of a mouse that had been anesthetized with Somnopentyl (Kyoritsu Pharmaceutical Co., Ltd.). From 5 days after the injection, 200 μL of a perennial extract of DM was prepared intraperitoneally with DMSO and PBS at 10 mg / mL. The final concentration of DMSO was 5%. Each extract was administered 7 times every other day, and anesthesia was performed with somnopentyl two days after the final administration, and then the lungs were removed and the tissues were fixed with paraformaldehyde (Wako Pure Chemical Industries, Ltd.). Evaluation of the onset of lung cancer was performed by observing the fixed lung under a stereomicroscope and totaling the tumor mass that can be confirmed on the surface of one lung.

  The evaluation results are shown in FIG. As is clear from the results shown in FIG. 8, it was found that the number of tumor masses formed in the lung is reduced by the extract of S. cerevisiae as compared with the control. This analysis system is considered to be a model of tumor formation by cancer stem cells in which one cancer cell is expected to form one tumor mass (T. Kaneko et al.,: KLN205-a murine lung carcinoma cell line. In Vitro, 16 (1980), pp. 884-892). That is, it was suggested that the extract which suppresses the expression of PSF1 suppresses active self-renewal of cancer stem cells and suppresses the onset of cancer. In addition, even if cancer has already developed, suppression of cancer stem cell self-renewal can suppress the growth of cancer cells. It was suggested that it could be used.

Test Example 5: Examination of protein glycation-inhibiting action
Test substance prepared with 1 / 6M glucose 6-phosphate disodium hydrate, 10mg / mL human serum albumin and DMSO prepared in phosphate buffer saline (PBS) in a 96-well plate The chloroform fraction, normal phase fraction (1), and reverse phase fraction (2)] were added at a final concentration of 4 mg / ml and incubated at 37 ° C. for 11 days. After the incubation, the production amount of CML [Ne- (carboxymethyl) lysine], which is one of the final glycation products, was measured by ELISA method using a CircuitLexTM CML / Ne (carboxymethyl) lysine ELISA Kit (CycLex). FIG. 9 shows the amount of CML in each sample solution when the control CML [carboxymethyllysine] to which no test substance solution is added is 100. Here, CML is one of advanced glycosylation end products (AGEs), which are end glycation products, and serves as a glycation marker.

  As is clear from the results shown in FIG. 9, the chloroform fraction, normal phase fraction (1) and reverse phase fraction (2) of the extract of Sedumella do not have the effect of suppressing CML production, but rather It was found to promote its production.

Test Example 6: Examination of fibroblast proliferation action Human 0-year-old foreskin-derived dermal fibroblasts were seeded in a 24-well plate at 6 × 10 ⁴ cells / well. After overnight culture in 1 ml of DMEM medium (manufactured by Sigma) supplemented with 0.5% bovine serum, the test substance [chloroform fraction, normal phase fraction (1) and reverse phase fraction (2) Was dissolved in DMSO to a final concentration of 0.003% by mass, and the number of cells was counted after 2 days of culture. FIG. 10 shows the relative values calculated when the control (control) to which no test substance solution is added is taken as 100. As is clear from the results shown in FIG. 10, the chloroform fraction, normal phase fraction (1) and reverse phase fraction of the extract of the seed moth, which are fractions that suppress the expression of PSF1 of the present invention. It was found that (2) had no effect of growing fibroblasts.

Test Example 7: Examination of hyaluronic acid production promoting action
When 24-well plates were seeded with human dermal fibroblasts at a concentration of 5 × 10 ⁴ cells / well and became confluent, the test substance [chloroform fraction, extract of normal phase (1) and normal phase fraction (1) and The reverse phase fraction (2)] was dissolved in DMSO at a concentration of 10 μg / ml and cultured in a DMEM (containing 0.5% bovine serum) medium. Two hours after the addition of the test substance, the culture supernatant was collected and the amount of hyaluronic acid produced was measured by ELISA. As a control group, a culture supernatant to which only DMSO was added was used. Hyaluronan assay kit (manufactured by Seikagaku Biobusiness) was used for the measurement. The results are shown in FIG. 11 by calculating the relative value when each test substance was added to the amount of hyaluronan (synonymous with hyaluronic acid) measured for the control to which no test substance solution was added. As is clear from the results shown in FIG. 11, the chloroform fraction, normal phase fraction (1) and reverse phase fraction (2) of the extract of Solanum spp. Have no effect of promoting hyaluronic acid production. Or, conversely, it was found to act in a suppressive manner.

Test Example 8: Examination of Extraction Conditions for Seeds of Seedling An extract was prepared from 1 g (dry weight) of Seedling leaves using the same procedure as in Production Example 1 using 10 ml of various extraction solvents shown in Table 1 below. However, what is described as “reflux” was subjected to reflux extraction for 1 hour at the reflux temperature. About each extract, the test similar to Test Example 1 and 2 was done, and there was no cell death induction activity and it was judged that there was activity about what has PSF1 gene expression suppression activity. The results are shown in the table.

Test Example 9: Test using Aedes crispana Part of filtrate obtained from 2 grams of dried plant of Cardamine regeliana using 20 ml of 80% ethanol by the same method as in Production Example 1 above. 10 ml was dried and 267 mg of extract was obtained. Using this extract, the same test as in Test Examples 1 and 2 was performed. As a result, there was no immediate cell death inducing activity, and PSF1 gene expression suppression activity was confirmed.

Claims (12)

In HPLC analysis under the following conditions (A) to (F), component (I) having a peak at a retention time of 11.1 minutes and / or component (II) having a peak at a retention time of 14.6 minutes A composition containing and having PSF1 gene expression inhibitory activity:
(A) HPLC column: a column having an inner diameter of 4.6 mm and a length of 150 mm packed with an octadecylated silica gel carrier (particle diameter: 3 μm) (B) HPLC column oven temperature: 40 ° C.
(C) Flow rate: 0.8 ml / min (D) Detection: 190-400 nm
(E) Mobile phase: (a) Methanol and (b) 10 mM ammonium formate aqueous solution (F) Gradient condition: 85% of (a) and 15% of (b) mixed solvent is held for 5 minutes, then 15 minutes The concentration of (a) in the mixed solvent is increased linearly from 85% to 100%, and then the concentration of (a) is maintained at 100%. The composition according to claim 1, which is a PSF1 gene expression inhibitor. The composition according to claim 1 or 2, which is a preventive or therapeutic agent for cancer. The composition according to claim 3, wherein the cancer is one or more selected from the group consisting of brain tumor, breast cancer, respiratory cancer, digestive organ cancer, urological tumor, female genital tumor, and blood tumor. . The composition according to any one of claims 1 to 4, which has no protein glycation-inhibiting activity, fibroblast proliferation promoting activity, and hyaluronic acid production promoting activity. The composition in any one of Claims 1-5 in which the said component (I) and (II) originates in a spruce. The composition according to any one of claims 1 to 6, wherein the composition is a fraction obtained by extracting Satsuma vaginalis with hydrous lower alcohol and subjecting the obtained extract to reverse phase column chromatography. The composition according to claim 7, wherein a lower alcohol or acetonitrile is used as a mobile phase of the reverse phase gel column chromatography. The composition in any one of Claims 1-6 obtained by the method containing following (1)-(3):
(1) Extracting the seedling with lower alcohol and recovering the extract,
(2) subjecting the extract obtained in (1) to liquid partition with hexane and collecting the lower layer;
(3) Subject the lower layer obtained in (2) to liquid-liquid partition with chloroform and collect the chloroform fraction. The composition according to claim 9, wherein the method further comprises:
(4) Use the chloroform fraction obtained in (3) for silica gel column chromatography using a mixture of a low polarity solvent and a lower alcohol as a mobile phase. The foodstuff in which the composition in any one of Claims 1-10 was concentrated. Use of the composition according to any one of claims 1 to 10 for suppressing expression of PSF1 gene (except for medical practice for humans).