JP2016093104A - ANTIHUMAN CD3ε ANTIBODY OR FRAGMENT THEREOF, AND IMMUNOSUPPRESSIVE AGENT CONTAINING IT AS ACTIVE INGREDIENT - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an antibody or a fragment thereof which binds to CD3ε constituting a complex of CD3 with a novel human T cell antigen receptor.SOLUTION: The invention provides an antibody or a fragment thereof which binds to CD3ε constituting the complex of CD3 with a human T cell antigen receptor, and which induces the decreased expression of a TCR-CD3 complex, and additionally induces neither a T cell proliferation response nor activation (production of IL-2). The antibody or a fragment thereof may be advantageously used as an immunosuppressive agent at the time of an organ transplantation or as a therapeutic agent of autoimmune disease, because it has a character to induce unresponsiveness also to a naive T cell and a primed T cell with or without an antigenic sensitization.SELECTED DRAWING: Figure 9

Description

  The present invention relates to an antibody or fragment thereof that binds to CD3ε constituting a complex of human T cell antigen receptor (T cell antigen receptor: TCR) and CD3 (hereinafter referred to as “TCR-CD3 complex”). Is. The antibody of the present invention or a fragment thereof induces a decrease in the expression of the TCR-CD3 complex, and does not induce a proliferative response or activation (IL-2 production) of T cells. Furthermore, the antibody or fragment thereof of the present invention has the property of inducing unresponsiveness to both naïve and sensitized T cells regardless of the presence or absence of antigen sensitization. It can be advantageously used as an immunosuppressant at the time of transplantation or as a therapeutic agent for autoimmune diseases.

  In Non-Patent Document 1, when antigen-sensitized human T cells are co-stimulated with BC3 (a mouse antibody that binds to human CD3ε) and alloantigen MHC in vitro, continuous antigen-specific unresponsiveness is induced. It is described that it is done. However, in order for BC3 to induce an unresponsiveness in T cells, it is necessary that an antigen coexists, and BC3 cannot induce an unresponsiveness to T cells once sensitized with an antigen. Have been described. In Patent Document 1, an in vitro system is prepared by artificially modifying the humanized antibody of OKT3 antibody (mouse antibody that binds to human CD3ε) with amino acids at positions 234 and 235 of the Fc region to alanine. The T cell proliferation is not induced and T cell activation is reduced by less than 40% of the maximum activation of the OKT3 antibody. However, an antibody that does not artificially modify the Fc region and does not induce T cell proliferation and substantially suppresses T cell activation is not described. Furthermore, in Patent Document 2 and Non-Patent Document 2, the Fc region of OKT3 antibody and YTH12.5 antibody (rat antibody specific for human CD3 antigen) is artificially substituted with an amino acid that does not cause glycosylation, It has been described to produce deglycosylated antibodies that do not exist in nature. The deglycosylated CD3 antibody retains some ability to bind to the Fc region, and does not induce T cell activation in an in vitro system while retaining its antigen binding specificity and immunosuppressive activity. It has been described to reduce cytokine release levels in an in vivo system. However, antibodies that are not deglycosylated and do not induce T cell proliferation and substantially suppress T cell activation are not described.

There are two types of T cells that function differently depending on the CD4 and CD8 proteins expressed on the cell surface. Among them, CD4 ⁺ T cells recognize and activate antigens presented by antigen-presenting cells (APC), and attack and eliminate cells different from their own. Since CD4 ⁺ T cells have a function of eliminating foreign substances (cellular immunity) at such a cell level, there is a problem of inducing rejection when organ transplantation is performed, for example. In autoimmune diseases, there is a problem that CD4 ⁺ T cells that react with self are activated and attack normal cells of the self to cause various symptoms.

  Conventionally, the OKT3 antibody has only been approved and used as an antibody therapeutic for acute rejection during organ transplantation. The OKT3 antibody is a mouse monoclonal antibody that recognizes human CD3ε. It is known that the amount of TCR-CD3 complex expressed on the cell surface is temporarily reduced by the decrease in the number of T cells by the administration of the OKT3 antibody and the binding of the OKT3 antibody to the human CD3ε molecule. However, on the other hand, it is also known that the OKT3 antibody is a cell growth promoting substance (Proc. Natl. Acad. Sci. USA, 78: 1805-1808 (1981)). Therefore, when the OKT3 antibody binds to the T cell, the T cell is initially activated by this binding, and causes fever, muscle pain, headache, joint pain, and the like.

In addition, antibodies as described in Non-Patent Documents 1 and 2 and Patent Documents 1 and 2 have been proposed as antibodies that suppress or control the activation of CD4 ⁺ T cells.

CD4 ⁺ T cell activation, CD4 ⁺ T TCR on the cell surface by recognizing a complex between the antigen and MHC class II molecules on APC, CD4 ⁺ T cells to the activation signals (first Signal) is transmitted. At this time, in addition to the intermolecular interaction between TCR, antigen and MHC class II, intermolecular between CD4 ⁺ T cells and APC (eg, CD40 and CD40L, B7 and CD28, CD72 and CD5, ICAM1 / 2 and LFA1, etc.) ), There are various intermolecular interactions, and these intermolecular interactions also induce and transmit an important signal (second signal) that leads to CD4 ⁺ T cell activation to T cells. Both this first and second signal are required for CD4 ⁺ T cell activation, while only one does not induce normal activation of CD4 ⁺ T cells.

There is an approach for suppressing or controlling the activation of CD4 ⁺ T cells by inhibiting the interaction between molecules responsible for the second signal transduction (Non-patent Document 3). Also known is a method of suppressing or controlling the activation of CD4 ⁺ T cells by substituting amino acids of antigen molecules (peptides) so that a normal first signal does not enter although it is recognized by TCR. (Non-Patent Document 4).

Japanese National Patent Publication No. 9-501824 JP2004-249

J Exp. Med., 172: 1691-1700 (1990) Eur. J. Immunol., 23: 403-411 (1993) Immunol. Rev., 192: 161-180 (2003) The Journal of Immunology, 186 (1): 7-8 (2011)

The present invention may be allowed to act on CD4 + ^T cells, without or grown or activate CD4 + ^T cells, provides a novel antibody or fragments thereof having an action to suppress the proliferation and activation of T cells The task is to do. That is, an object of the present invention is to provide an antibody or fragment thereof that induces a decrease in the expression of the TCR-CD3 complex and does not induce T cell proliferation or activation (IL-2 production).

As a result of intensive studies to solve the above problems, the present inventors suppress or control the activation of CD4 ⁺ T cells by decreasing the expression of TCR, and as a result, the proliferation of CD4 ⁺ T cells. A method for suppressing or controlling the above was investigated. That is, even if the molecular complex between the antigen on APC and MHC class II is normally expressed and various intermolecular interactions between CD4 ⁺ T cells and APC are maintained normally, Since it is expected that the activation of CD4 ⁺ T cells can be suppressed or controlled by reducing the expression of TCR corresponding to the starting point for signal transmission, an antibody that induces a decrease in the expression of TCR is provided. Aimed to establish.

By immunizing rats with human CD4 ⁺ T cells to produce hybridomas, the culture supernatant, to induce decreased expression of TCR-CD3 complex of the human CD4 ⁺ T cells, activation of human CD4 ⁺ T cells The antibody of the present invention or a fragment thereof was selected by evaluating that it was not induced and that it had the activity of inhibiting the growth of human CD4 ⁺ T cells, and the present invention was completed.

The present invention comprises the following.
1. Anti-human CD3ε antibody or fragment thereof having the following properties (1) to (5):
(1) binds to human CD4 ⁺ T cell antigen receptor CD3ε;
(2) induces a decrease in the expression of the T cell antigen receptor-CD3 complex of human CD4 ⁺ T cells;
(3) does not induce activation of human CD4 ⁺ T cells;
(4) has human CD4 ⁺ T cell growth inhibitory activity;
(5) Induces unresponsiveness in human CD4 ⁺ T cells regardless of the presence or absence of antigen sensitization.
2. 2. The antibody or fragment thereof according to item 1 above, wherein the anti-human CD3ε antibody is an anti-human CD3ε rat antibody.
3. The antibody or fragment thereof according to item 1 or 2, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region each have the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14).
4). The antibody or fragment thereof according to item 1 or 2, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the light chain variable region each have the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32);
CDR2: ArgAspAsp (SEQ ID NO: 33);
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34).
5. 3. The heavy chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 according to the previous item 3 and the light chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 according to the previous item 4, An antibody or fragment thereof.
6). A humanized antibody or fragment thereof that binds to human CD3ε, wherein the complementarity determining regions CDR1, CDR2, and CDR3 of the heavy chain variable region each have the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14).
7). Humanized antibodies or fragments thereof that bind to human CD3ε, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the light chain variable region each have the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32);
CDR2: ArgAspAsp (SEQ ID NO: 33);
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34).
8). A human that binds to human CD3ε, comprising the heavy chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 of claim 6 and the light chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 of claim 7 Antibody or fragment thereof.
9. An expression vector comprising DNA encoding a heavy chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 each having the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14).
10. An expression vector comprising DNA encoding a light chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 each comprising the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32)
CDR2: ArgAspAsp (SEQ ID NO: 33)
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34)
11. An expression vector comprising DNA encoding the heavy chain variable region according to item 9 and DNA encoding the light chain variable region according to item 10.
12 A method for producing a humanized antibody or fragment thereof that binds to human CD3ε according to item 8 above, wherein (i) the expression vector according to item 9 and the expression vector according to item 10 are used, or (ii) ) A method comprising transforming a host cell using the expression vector according to the preceding item 11, culturing the host cell, and isolating the produced humanized antibody or a fragment thereof.
13. 9. An immunosuppressant comprising the antibody or fragment thereof according to any one of items 1 to 8 as an active ingredient.
14 14. The immunosuppressive agent according to 13 above, wherein the fragment is F (ab ′) ₂ .
15. 9. A therapeutic agent for autoimmune diseases comprising the antibody or fragment thereof according to any one of items 1 to 8 as an active ingredient.
16. 16. The therapeutic agent for autoimmune disease according to 15 above, wherein the fragment is F (ab ′) ₂ .

  The antibody of the present invention or a fragment thereof induces an unresponsiveness to T cells even in the absence of an antigen. For example, upon organ transplantation, an antibody of the present invention is administered to a recipient beforehand to induce an unresponsiveness. Therefore, organ transplantation can be advantageously performed. In addition, since the antibody of the present invention can induce unresponsiveness to sensitized or sensitized T cells, it can be used as a therapeutic agent for autoimmune diseases.

The primary screening result of the target antibody was shown, and it was confirmed that antibodies # 1 to 4 decreased the expression of TCR-CD3 complex. FIG. (A) shows that all lymphocytes prepared from human peripheral blood were treated in the presence and absence of the antibody to be evaluated, and the reactivity with OKT3 antibody (anti-human CD3ε antibody) was confirmed. A peak is confirmed on the right side (indicated as Y) in the absence of antibody, and a peak is observed on the left side (indicated as X) in the presence of antibody. In addition, human T cells were treated in the presence and absence of the antibody, and the reactivity with the anti-T cell antigen receptor (TCR) antibody was confirmed in FIG. A peak is confirmed in the display) in the absence of the antibody, and a peak is seen on the left side (indicated as X) in the presence of the antibody. Example 1 The result of the secondary screening of the target antibody was shown, and it was confirmed that antibodies # 1 to 3 did not induce T cell proliferation and induce T cell activation. The results of treating total lymphocytes prepared from human peripheral blood with OKT3 antibody (anti-human CD3ε antibody) are shown in (a), confirming cell proliferation induction (control). The results of treatment with candidate antibodies # 1 to 4 are shown in (b). The antibodies # 1 to 3 did not induce cell proliferation, but # 4 induced cell proliferation. Example 1 (A) Jurkat and the displayed figure (upper left) confirm the strong reactivity of the human T cell line (Jurkat) expressing the TCR-CD3 complex with the OKT3 antibody (anti-human CD3ε antibody). The right peak (P) corresponds. The left peak (O) is unstained. J. of (a). The figure labeled RT3-T3.5 (upper right figure) is a result of a cell line that does not express the TCR-CD3 complex as a sub-line of the human T cell line (Jurkat) and did not react with the OKT3 antibody. Show. (B) Jurkat and the figure (lower left figure) confirm the strong reactivity with antibody # 1 which is a candidate antibody of human T cell line (Jurkat) expressing TCR-CD3 complex. Corresponds to the right peak (P). The left peak (O) is unstained. J. of (b). The figure labeled RT3-T3.5 (bottom right) is the result of a cell line that does not express the TCR-CD3 complex in a sub-line of the human T cell line (Jurkat) and did not react with antibody # 1. I will show you. And it was confirmed that the target molecule of # 1 antibody is either TCR or CD3 molecule. (Example 2) It shows that the target molecule of antibody # 1 is human CD3ε (hCD3ε). In the figure, (a) is a mouse lymphoma Yac-1, which expresses a mouse CD3ε and mouse CD3γ complex, and (b) is a mouse CD3ε and mouse CD3γ complex, and a human CD3ε and mouse CD3γ complex. The result of staining with PE-labeled OKT3 antibody and the result of staining with PE-labeled anti-rat IgG antibody after treatment with # 1 antibody were observed for the body hCD3ε-Yac-1 cells. In (a), no staining, OKT3 antibody treatment , # 1 antibody treatment shows the same reactivity (no reaction), (b) confirms the reactivity consisting of three different peaks, and the rightmost peak (U) is the middle (T) when OKT3 antibody treatment However, in the case of # 1 antibody treatment, the left side (S) is unstained. As a result, it was confirmed that the target molecule of antibody # 1 was hCD3ε. (Example 2) Reactivity with antibody # 1 was confirmed by SDS-PAGE for Yac-1 cells (no hCD3ε expression), hCD3ε-Yac-1 cells (hCD3ε expression), and Jurkat cells (hCD3ε expression). It was confirmed that the target molecule of antibody # 1 was hCD3ε. (Example 2) It shows that antibody # 1 suppresses T cell activation by OKT3 antibody. In the figure, OKT3 and (F) indicate the results of cell proliferation when whole lymphocytes derived from human peripheral blood were treated with OKT3 antibody. OKT3 + # 1Ab (G) indicates that OKT3 antibody and # 1 antibody were added simultaneously. It is a cell growth result when processing. (Example 3) It shows that antibody # 1 suppresses T cell activation by mitogen. In the above figure, PHA (H) indicates the results of cell proliferation when whole lymphocytes derived from human peripheral blood are treated with PHA, and PHA + # 1Ab (I) is a treatment with simultaneous addition of PHA and # 1 antibody. It is a cell growth result when doing. In the figure below, PWM and (H) indicate the results of cell proliferation when PWM processing was performed on human peripheral blood-derived total lymphocytes, and PWM + # 1Ab (I) was obtained by simultaneously adding PWM and # 1 antibody. Sometimes cell proliferation results. (Example 3) The # 1 antibody shows that the production of IL-10, which is an inhibitory cytokine, can be confirmed in an in vivo system, while the inflammatory cytokine is markedly reduced compared to the OKT3 antibody. In the figure, mIgG is a mouse IgG _2a , OKT3 is an OKT3 antibody, RatIgG is a rat IgG, and # 1Ab is a # 1 antibody administered intravenously to a test mouse. Example 4 It shows that antibody # 1 suppresses the onset of GVHD. In the figure, RatIg (M) indicates that rat IgG is administered to gamma-irradiated mice, and # 1Ab (N) indicates that # 1 antibody is intravenously administered to gamma-irradiated mice. Survival is observed up to 200 days. (N) in the # 1 antibody administration group. (Example 5) Antibody # 1 is shown to induce unresponsiveness to T cells. The left figure shows the proliferation of spleen cells obtained by intravenous administration of rat IgG to humanized NOG mice, and the right figure shows the PHA of spleen cells obtained by administering # 1 antibody. Indicates that the stimulus was substantially suppressed. (Example 6) Intravenous administration of control antibody (rat IgG) showed CD4 ⁺ T cell proliferation induction upon PHA stimulation (+) (F), and intravenous administration of # 1 antibody (# 1 Ab) induced proliferation of CD4 ⁺ T cells It shows that induction is substantially suppressed (G). (Example 6)

In order to obtain the antibody or fragment thereof of the present invention, an antibody or fragment thereof that suppresses or controls the activation of CD4 ⁺ T cells by reducing the expression of TCR, and consequently suppresses or controls the proliferation of CD4 ⁺ T cells. Was examined. That is, even if the molecular complex between the antigen on APC and MHC class II is normally expressed and various intermolecular interactions between CD4 ⁺ T cells and APC are maintained normally, Since it is expected that the activation of CD4 ⁺ T cells can be suppressed or controlled by reducing the expression of TCR corresponding to the starting point for signal transmission, an antibody that induces a decrease in the expression of TCR is provided. Aimed to establish.

However, it is known that when normal antigen presentation is performed and first and second activation signals are transmitted to CD4 ⁺ T cells, a decrease in TCR expression is temporarily induced thereafter (Nature, 375,148-151, 1995). Based on this, it was decided to select an antibody that does not activate or proliferate CD4 ⁺ T cells even if it acts on CD4 ⁺ T cells as an antibody that induces a decrease in TCR expression.

  TCR forms a complex with three molecules of CD3ε, CD3γ and CD3δ, and it is known that the expression of these CD3s decreases when TCR expression decreases (J. Exp. Med. 160: 1284-1299 , 1984). Therefore, in order to measure the decrease in the expression of TCR, the expression of CD3ε was used as an index. That is, T cells are treated with a test antibody, then the T cells are treated with a labeled OKT3 antibody that binds to human CD3ε, and the degree of TCR expression is measured by measuring the degree of labeling of the T cells with the labeled antibody. And succeeding in achieving the antibody of the present invention or a fragment thereof.

(Antibodies or fragments thereof)
In the present invention, the term “antibody or fragment thereof” as used herein refers to an immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule, ie, an antigen binding site that specifically binds an antigen. It is a requirement that it be capable of binding to at least CD3ε. Also included are immunoglobulin-like proteins selected by techniques including phage display that specifically bind to the target molecule or protein. The immunoglobulin molecules of the invention are of any type (eg IgG, IgE, IgM, IgD, IgA and IgY), class (eg IgG ₁ , IgG ₂ , IgG ₃ , IgG ₄ , IgA ₁ and IgA ₂ ), Or it may be a subclass of an immunoglobulin molecule. “Antibodies and fragments thereof” suitable for use in the present invention include polyclonal antibodies, monoclonal antibodies, monovalent antibodies, bispecific antibodies, heteroconjugate antibodies, multispecific antibodies, human antibodies, humanized (especially CDR grafts). ) Antibodies, deimmunized or chimeric antibodies, single chain antibodies (eg scFv), Fab fragments, F (ab ′) ₂ fragments, fragments produced by Fab expression libraries, diabodies or tetrabodies (Holliger P. et al., 1993), Nanobodies, anti-idiotype (anti-Id) antibodies (including, for example, anti-Id antibodies to the antibodies of the invention), and epitope binding fragments of any of the above. A preferred fragment is an F (ab ′) ₂ fragment.

(Antibody derived from antibodies)
In the present invention, the antibody or fragment thereof may be derived from any animal origin including birds and mammals. Preferably, the antibody or fragment thereof is a human, monkey (eg, chimpanzee, bonobo, macaque), rodent (eg, mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse or chicken antibody. . It is particularly preferred that the antibody or fragment thereof is of human origin or mouse origin or rat origin.

(Binding to antigen)
The antibody of the present invention or a fragment thereof is, for example, 100 μM or less, preferably 50 μM or less, preferably 30 μM or less, preferably 20 μM or less, preferably 10 μM or less, preferably 5 μM or less, more preferably 1 μM or less with respect to an antigen such as a target protein. More preferably 900 nM or less, more preferably 800 nM or less, more preferably 700 nM or less, more preferably 600 nM or less, more preferably 500 nM or less, more preferably 400 nM or less, more preferably 300 nM or less, more preferably 200 nM or less. More preferably 100 nM or less, even more preferably 90 nM or less, even more preferably 80 nM or less, even more preferably 70 nM or less, even more preferably 60 nM or less, even more preferably 50 nM or less, further More preferably 40 nM or less, even more preferably 30 nM or less, even more preferably 20 nM or less, and even more preferably 10 nM or less, the antibody or fragment thereof of the present invention is “specific” with the antigen or target protein. Think together. "

(Characteristics of the antibody of the present invention or a fragment thereof)
With respect to the antibody or fragment thereof of the present invention, its characteristic character is characterized by the following characteristics (1) to (5), and selection of such an antibody or fragment thereof is known per se such as its reactivity. It can be specified by law.
(1) It binds to CD3ε of the human CD4 ⁺ T cell antigen receptor.
(2) Induces a decrease in the expression of T cell antigen receptor-CD3 complex in human CD4 ⁺ T cells.
(3) Does not induce activation of human CD4 ⁺ T cells.
(4) It has the activity of suppressing the growth of human CD4 ⁺ T cells.
(5) Induces unresponsiveness in human CD4 ⁺ T cells regardless of the presence or absence of antigen sensitization.

In preparing the antibody of the present invention, human CD4 ⁺ T cells as an antigen can be obtained from a biological specimen containing human CD4 ⁺ T cells, such as blood. For example, lymphocytes can be obtained from peripheral blood or the like of a healthy person, and an antigen consisting of human CD4 ⁺ T cells can be prepared. The antigen is administered to the antibody-derived animal or the like to immunize the animal, spleen cells are collected from the immunized animal or the like, and a hybridoma can be obtained by a conventional method.

The term “(1) binding to human CD4 ⁺ T cell antigen receptor CD3ε” means binding to human T cell CD3ε, and also a function of retaining a known OKT3 antibody. Such characteristics can be evaluated using, for example, cells expressing the TCR-CD3 complex and cells not expressing the TCR-CD3 complex. By treating these cells with a candidate antibody and observing the reactivity of the candidate antibody, it is possible to confirm whether the target molecule of the candidate antibody is a TCR or CD3 molecule. Examples of cells expressing the TCR-CD3 complex include Jurkat cells, and examples of cells not expressing the TCR-CD3 complex include sub-strains thereof. Furthermore, whether or not the target molecule of the candidate antibody is human CD3ε by reacting with the candidate antibody using cells expressing the mouse CD3ε and mouse CD3γ complex and cells expressing the human CD3ε and mouse CD3γ complex. Or can be evaluated by biochemical analysis of the reactivity between a cell expressing a human CD3ε molecule and a candidate antibody. Thereby, an antibody that binds to human CD3ε of human CD4 ⁺ T cell antigen receptor can be selected. The evaluation of the inducibility of the expression reduction of the T cell antigen receptor-CD3 complex of human CD4 ⁺ T cells in (2) above is carried out by treating the T cells in the presence or absence of the candidate antibody, and then the labeled OKT3 antibody and labeled TCR. (T cell antigen receptor) It can be evaluated by labeling and staining T cells with an antibody. Thereby, an antibody that causes a decrease in the expression of the T cell antigen receptor-CD3 complex of the T cell can be selected. The property of not inducing the activation of human CD4 ⁺ T cells in (3) above can be evaluated by adding an antibody to the medium for the effect on proliferation of human peripheral blood-derived whole lymphocytes in culture. As an index of activation of human CD4 ⁺ T cells, for example, production of IL-2 by T cells can be mentioned, and it can be evaluated by measuring IL-2 production after addition of an antibody. Thereby, for example, an antibody that does not induce IL-2 production can be selected as an antibody that does not induce the activation of human CD4 ⁺ T cells. The characteristic (4) of having the activity of suppressing the growth of human CD4 ⁺ T cells is a characteristic function as compared with the OKT3 antibody. The effect on the proliferation of human peripheral blood-derived whole lymphocytes in culture was compared between the OKT3 antibody alone system and the combination of the OKT3 antibody and the candidate antibody of the present invention, or the substance having mitogenic activity alone. This can be confirmed by comparison between the system and a combination system of a substance having mitogenic activity and the candidate antibody of the present invention. Thus, for example, when T cell proliferation is suppressed in the combined system when the OKT3 antibody alone system and the combined system of the OKT3 antibody and the candidate antibody are compared, the candidate antibody is inhibited from proliferation of human CD4 + T cells. It can be selected as an antibody having activity. Further, when a system of a substance having mitogenic activity alone is compared with a system of a combination of a substance having mitogenic activity and a candidate antibody, when the proliferation of T cells is suppressed in the combined system, the candidate antibody is It can be selected as an antibody that also suppresses T cell proliferation by the T cell activator. (5) Regardless of the presence or absence of antigen sensitization, the ability to induce unresponsiveness to human CD4 ⁺ T cells is achieved by, for example, using a humanized mouse, intravenous administration of a candidate antibody, etc. It is possible to evaluate by confirming. Alternatively, it can be determined by evaluating the survival rate of a model by intravenous administration of a candidate antibody using a model for developing GVHD by human T cells. Thereby, it is possible to select an antibody having an ability to induce unresponsiveness to human CD4 ⁺ T cells regardless of the presence or absence of antigen sensitization.

(Base sequence encoding antibody, etc.)
Based on the antibody having the above characteristics, gene information of the antibody variable region can be obtained by a conventional method of gene recombination technology. In other words, cDNA was synthesized using RNA fractionated from the monoclonal antibody-producing hybridoma cells as a template, a PCR product was obtained using this as a template, a transformant was obtained based on this, and a known immunoglobulin sequence prediction software was used. The complementarity determining region and the site of the framework are specified, and an antibody having each base sequence and amino acid sequence determined can be obtained.

(CDR and FR)
The term “CDR” in reference to an antibody of the invention or fragment thereof refers to any of the complementarity determining regions of the antibody. There are three CDRs (CDR1, CDR2 and CDR3) in the variable (V) region of an antibody. Since an antibody usually consists of two polypeptide chains, a heavy chain and a light chain, there are about six frequencies of CDRs for each antigen binding region that can contact an antigen (each heavy chain and light chain). Contains three CDRs). Of these, CDR3 exhibits the greatest variability. The term “FR” in reference to an antibody or fragment thereof of the present invention refers to a framework region that is a relatively less mutated part other than the complementarity determining region of the antibody. There are four FRs (FR1, FR2, FR3 and FR4) in the variable (V) region of the antibody. Since an antibody usually consists of two polypeptide chains, there are about eight frequencies of FR for each antigen-binding region that can contact the antigen (each heavy and light chain contains four FRs). To do).

(Modification of antibody or fragment thereof)
By modifying the antibody and fragments thereof of the present invention, it is possible to enhance stability and antigen binding. Factors affecting stability include exposing the hydrophobic residues hidden at the interface of all Ig molecules to the constant region interface; exposing the hydrophobic region on the Fv surface and causing intermolecular interactions And hydrophilic residues within the Fvβ sheet or at the normal interface between the heavy chain variable region and the light chain variable region (Chowdhury et al., Engineering scFvs for Improved Stability, p. 237-254 in Recombinant Antibodies for Cancer Therapy Methods and Protocols, (Eds. Welschof and Krauss) Humana Press, Totowa, New Jersey, 2003.). In addition, the stability can be enhanced by substituting a problematic residue that affects the stability. Such modifications are, for example, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 singles in the polypeptide chain of an antibody of the invention or fragment thereof. This can be accomplished by making single amino acid substitutions, deletions, modifications and / or insertions, preferably up to three, most preferably one single substitution, deletion, modification and / or insertion. Techniques for increasing the stability of single chain antibodies taking into account the problematic residues are known in the art (Chowdhury et al., Engineering scFvs for Improved Stability, p.237-254 in Recombinant Antibodies for Cancer Therapy Methods and Protocols, (Eds. Welschof and Krauss) Humana Press, Totowa, New Jersey, 2003.).

  The antibody or fragment thereof of the present invention comprises a heavy chain having a heavy chain variable region and / or a light chain having a light chain variable region, wherein the heavy chain variable region and / or the light chain variable region are It has an amino acid sequence of any of the CDRs 1-3 shown, and optionally the light and heavy chains contain a total of one, two or three single amino acid substitutions, deletions, modifications and / or insertions.

One embodiment is an antibody or fragment thereof in which CDR1, CDR2, and CDR3 of the heavy chain variable region have the following amino acid sequences.
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12)
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13)
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14)

Another embodiment is an antibody or fragment thereof in which CDR1, CDR2, CDR3 of the light chain variable region have the following amino acid sequences.
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32)
CDR2: ArgAspAsp (SEQ ID NO: 33)
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34)

Yet another embodiment is an antibody in which each CDR1, CDR2, CDR3 of the heavy chain variable region and the light chain variable region has the amino acid sequences of SEQ ID NOs: 12, 13, 14, and SEQ ID NOs: 32, 33, 34, respectively. . These CDRs are sequences based on rat antibodies, but humanized antibodies can be prepared from these sequences using conventional methods.
One embodiment of the antibody or fragment thereof of the present invention is characterized by maintaining the binding property to human CD3ε as a property in addition to specifying the amino acid sequence of each heavy chain variable region and / or light chain variable region. .

In addition, the phrase “single amino acid substitution, deletion, modification and / or insertion” in an antibody of the invention or fragment thereof generally represents a modified form of the listed protein or polypeptide, eg, protein or poly One amino acid of the peptide can be deleted, inserted, modified and / or substituted. Where the polypeptide or protein contains several single amino acid substitutions, deletions, modifications and / or insertions, the total number of such substitutions, deletions, modifications and / or insertions is indicated in each case. The insertion is an insertion of a specified number of single amino acids into the original polypeptide or protein. The amino acids of the protein or polypeptide may be modified, for example chemically modified with the total number of modifications indicated. For example, the amino acid side chain or free amino terminus or free carboxy terminus of a protein or polypeptide may be modified, for example, by glycosylation, amidation, phosphorylation, ubiquitination, and the like. Chemical modification can also be performed in vivo, for example in a host cell (host cell), as is known in the art. For example, a protein is glycosylated by a suitable chemical modification motif present in the amino acid sequence of the protein, such as a glycosylation sequence motif. Where the polypeptide or protein contains one or more single amino acid substitutions, the substitution can be a conservative or non-conservative substitution, preferably a conservative substitution, in each case independently. In the most preferred embodiments, all substitutions have conservative properties as further defined below. In some embodiments, the substitution also includes the replacement of a naturally occurring amino acid with a non-naturally occurring amino acid. A conservative substitution includes the substitution of one amino acid for another amino acid having similar chemical properties as the amino acid to be substituted. Preferably, the conservative substitution is a substitution selected from the group consisting of:
(I) substitution of a basic amino acid with another different basic amino acid,
(Ii) substitution of an acidic amino acid with another different acidic amino acid;
(Iii) substitution of an aromatic amino acid with another different aromatic amino acid;
(Iv) Substitution of a nonpolar aliphatic amino acid to another different nonpolar aliphatic amino acid, and (v) Substitution of a polar uncharged amino acid to another different polar uncharged amino acid.

  The basic amino acid is preferably selected from the group consisting of arginine, histidine and lysine. The acidic amino acid is preferably aspartic acid or glutamic acid. The aromatic amino acid is preferably selected from the group consisting of phenylalanine, tyrosine and tryptophan. The nonpolar aliphatic amino acid is preferably selected from the group consisting of glycine, alanine, valine, leucine, methionine and isoleucine. The polar uncharged amino acid is preferably selected from the group consisting of serine, threonine, cysteine, proline, asparagine and glutamine. In contrast to a conservative amino acid substitution, a non-conservative amino acid substitution is an exchange of an amino acid for any amino acid that does not apply to the conservative substitutions (i) to (v) outlined above.

(Preparation of humanized antibody)
In the present invention, humanization can be produced according to a known method (Nature 332, 323-327, 1988, Japanese Patent No. 3121823, Japanese Patent Laid-Open No. 2003-199594, Japanese Patent No. 2912618 (EP239400B1)). As human sequences, known NEW (RJJBiol. Chem. 253, 585-597 (1987), REI (R. Eur. J. Biochem. 45, 523-52481974), CAMPATH-1 (The Journal of Immunology 162: 3663-3671), etc. The FR regions of the rat antibody of the present invention are identified as follows, with four heavy chains as SEQ ID NOs: 19 to 22 and four light chains as SEQ ID NOs: 39 to 42 as follows: The three regions of SEQ ID NOs: 12 to 14 and the light chain of SEQ ID NOs: 32 to 34 have been identified as described above. The CDR regions of the present invention are known as human antibody sequences. NEW, REI, CAMPATH Humanization can be achieved by substituting one or more or all of the amino acid sequences in which at least the FR region is a human type or a sequence that is substantially homologous thereto.
Heavy chain FR1 (amino acid sequence): (SEQ ID NO: 19)
GluValProLeuValGluSerGlyGlyGlyLeuValGlnProGlyArgSerLeuLysLeuSerCysAlaAlaSer
Heavy chain FR2 (amino acid sequence): (SEQ ID NO: 20)
MetAlaTrpValArgHisProProLysLysGlyLeuGluTrpValAlaThr
Heavy chain FR3 (amino acid sequence): (SEQ ID NO: 21)
TyrTyrProAspSerValLysGlyArgPheThrIleSerArgAspAsnAlaArgSerSerLeuTyrLeuGlnMetSerSerLeuArgSerGluAspThrAlaThrTyrTyrCys
Heavy chain FR4 (amino acid sequence): (SEQ ID NO: 22)
TrpGlyGlnGlyValMetValThrValSerSerAlaGluThrThr
Light chain FR1 (amino acid sequence): (SEQ ID NO: 39)
GlnPheValLeuThrGlnProAsnSerValSerThrAsnLeuGlySerThrValLysLeuSerCysLysArgSer
Light chain FR2 (amino acid sequence): (SEQ ID NO: 40)
ValAsnTrpTyrGlnGlnHisGluGlyArgSerProThrThrMetIleTyr
Light chain FR3 (amino acid sequence): (SEQ ID NO: 41)
GlyArgProAspGlyValProAspArgPheSerGlySerIleAspArgSerSerAsnSerAlaLeuLeuThrIleLysAsnValGlnSerGluAspGluAlaAspTyrPheCys
Light chain FR4 (amino acid sequence): (SEQ ID NO: 42)
PheGlyGlyGlyThrSerLeuThrValLeuGlyGlnProLysSerThr

(Transformant)
Based on the above description, the antibody of the present invention or a fragment thereof encodes an amino acid sequence including at least one or more or preferably all of CDRs and preferably, preferably FR regions, of heavy and / or light chains. It can be produced and prepared by ligating an oligonucleotide chain comprising a base sequence with an appropriate oligonucleotide chain, cloning it into an expression vector, and transducing it into a host cell, preferably a mammalian cell.

One aspect of the expression vector is an expression vector comprising DNA encoding a heavy chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 comprising at least the following amino acid sequences;
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12)
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13)
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14)
Another aspect of the expression vector is an expression vector comprising DNA encoding a light chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 comprising at least the following amino acid sequences;
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32)
CDR2: ArgAspAsp (SEQ ID NO: 33)
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34)
Another embodiment of the expression vector is an expression vector comprising DNA encoding the heavy chain variable region of SEQ ID NOs: 12 to 14 and DNA encoding the light chain variable region of SEQ ID NOs: 32-34.

  The expression vector in the present invention is a replicable expression vector containing an appropriate promoter operably linked to a DNA sequence encoding at least the heavy chain and / or light chain variable region. In the expression vector, the variable region includes a framework region from a human antibody and the CDR of the present invention. When the variable region includes a constant region, the variable region includes those from a human antibody. The vector may carry at least the heavy chain and light chain variable regions in one replicable vector, or may be separately carried in two separate replicable vectors.

  One aspect of the expression vector of the present invention carries an expression vector carrying a DNA encoding the heavy chain variable region of SEQ ID NOs: 12 to 14 and a DNA encoding the light chain variable region of SEQ ID NOs: 32-34. Two of the expression vectors are used, and other embodiments of the expression vector of the present invention encode DNA encoding the heavy chain variable region of SEQ ID NOs: 12 to 14 and light chain variable region of SEQ ID NOs: 32-34. The expression vector containing the DNA to be used.

A cell line is transformed with these replicable vectors, and the transformed cell line is cultured to produce the antibody or fragment thereof of the present invention.
The cell line to be transformed may be a Chinese hamster ovary (CHO) cell line or an immortalized mammalian cell line such as a myeloma, hybridoma, trioma or quadroma cell line, preferably originating from lymphoid tissue. . This cell line also includes normal lymphocytes such as B cells that are immortalized by transformation with a virus such as Epstein-Barr virus. Most preferably, the immortalized cell line is a myeloma cell line or a derivative thereof. CHO cells used for expression of antibodies or fragments thereof according to the present invention may be those that lack dihydrofolate reductase (dhfr) and therefore rely on thymidine and hypoxanthine for growth (Urlaub et al., Proc. Natl. Acad. Sci. USA, 77, 4216-4220 (1980)).

The cell line used to produce the antibodies or fragments thereof of the present invention is preferably a mammalian cell line, but other cell lines such as bacterial cell lines (eg, E. coli derived bacterial strains) or yeast cell lines. Appropriate cell lines can also be used.
Following expression, whole antibodies of the invention, their dimers, individual light and heavy chains, or other immunoglobulin forms are removed and standard in the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis, etc. (See, generally, Scopes, R., Protein Purification, Springer-Verlag, NY (1982)). For pharmaceutical use, substantially pure immunoglobulins having a homogeneity of at least about 90-95% are preferred, with 98-99% or more homogeneity being most preferred. Once desired, whether partially or homogeneous, once purified, it can be used for therapy or used in the development and implementation of assay procedures, immunofluorescence staining, etc. Immunological Methods, Volumes I and II, edited by Lefkovits and Pernis, Academic Press, New York, NY (1979 and 1981)).

(Use of antibody or fragment thereof)
The antibodies and fragments thereof of the present invention are useful for treating or preventing a subject and can be administered as a pharmaceutically effective amount of a compound or composition. Subjects are prevention / treatment of immunosuppressants or autoimmune diseases at the time of organ transplantation, which are associated with rheumatoid arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and multiple sclerosis It is useful for the treatment or prevention of certain conditions.

  The antibodies and fragments thereof of the present invention can be administered systemically, for example orally in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an absorbable edible carrier. These compounds can be enclosed in hard shell or soft shell gelatin capsules, tableted, or incorporated directly into the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. it can. Such compositions and preparations should contain at least 0.1% of active compound. Of course, the proportions of the compositions and preparations may vary and can conveniently be from about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically usable compositions is such that an effective dosage level will be obtained. For tablets, troches, pills, capsules, etc .: binders such as gum tragacanth, acacia, corn starch, gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch, potato starch, alginic acid; magnesium stearate And other sweeteners such as sucrose, fructose, lactose, or aspartame; and flavoring agents such as peppermint, winter green oil, and cherry flavor. When the unit dosage form is a capsule, in addition to the above types of substances, it may contain a liquid carrier such as vegetable oil or polyethylene glycol. Various other materials may be included as coatings and otherwise to modify the physical form of the solid unit dosage form. For example, tablets, pills, capsules can be coated with gelatin, wax, shellac, sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl or propylparaben as a preservative, a coloring agent and flavoring such as cherry or orange flavor. Of course, any substance used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts used. In addition, the active compound can be incorporated into sustained-release preparations and devices.

  The antibodies and fragments thereof of the present invention can also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the antibodies and fragments or salts thereof of the present invention can be prepared in water, optionally mixed with a harmless surfactant. Dispersants can also be prepared with glycerol, liquid polyethylene glycols, triacetin, mixtures thereof, and oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. Pharmaceutical dosage forms suitable for injection or infusion may include sterile injectable solutions or infusate solutions or sterile aqueous solutions, dispersions or powders containing the active ingredients that are compatible with the appropriate preparation of dispersions. . In some cases, a dispersant containing an active ingredient encapsulated in liposomes may be included. In all cases, the best dosage form must be a sterile liquid and be stable under the conditions of manufacture and storage. Liquid carriers or vehicles include, for example, water, ethanol, polyol (eg, glycerol, propylene glycol, liquid polyethylene glycols, etc.), vegetable oils, non-toxic glyceryl esters. Or a solvent or liquid dispersion medium containing a suitable mixture thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The action of microorganisms can be prevented by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. . In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. By using an absorption delaying agent such as aluminum monostearate or gelatin in the composition, the injectable composition can be absorbed for a long time. Sterile injectable solutions are prepared by incorporating the required amount of active compound in a suitable solvent, including some of the other previously listed ingredients required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are the vacuum drying technique and the lyophilization technique, by which any additional desired ingredients present in the solution that have been previously sterile filtered into the active ingredient are added. The added powder is brought about. For topical administration, ie when the compound is liquid, the compound can be applied in pure form. In general, however, it is desirable that the compound be administered to the skin as a composition or formulation in combination with a skin-acceptable carrier, which may be solid or liquid. Solid carriers that can be used include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Liquid carriers that can be used include water, hydroxyalkyl, glycols, or water-alcohol / glycol blends, in which case the compound is dissolved at an effective concentration, possibly with a non-toxic surfactant. Or can be dispersed. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resulting liquid composition can be applied from an absorbent pad and used to impregnate bandages and other dressings, or can be sprayed onto the affected area using a pump type or aerosol spray. Application pastes, gels, ointments for direct application to the user's skin using thickeners with liquid carriers such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified cellulose, modified mineral substances Soap can also be formed.

  The dose of an antibody or fragment thereof that can be used in the present invention can be quantified by comparing its in vitro activity and in vivo activity in animal models. Methods for estimating effective doses for mice and other animals up to humans are known in the art. In general, the concentration of the antibody of the present invention or a fragment thereof in a liquid composition such as a lotion is about 0.1 to 25 wt%, preferably about 0.5 to 10 wt%. The concentration in a semi-solid or solid composition such as a gel or powder is about 0.1-5 wt%, preferably about 0.5-2.5 wt%. The amount of the antibody or fragment thereof of the present invention required for therapeutic use will also vary depending on the route of administration, the nature of the condition being treated, the age, and the patient's condition, and ultimately the physician or clinician in charge. At the discretion. The dose of the antibody or fragment thereof of the present invention will also vary depending on the targeted cell, tumor, tissue, graft, or organ. The desired dose may conveniently be provided as a single dose or as divided doses administered at appropriate intervals, eg, 2, 3, 4 or more sub-doses per day. The sub-dose itself can be divided into several more roughly divided doses, such as multiple inhalations from a dispenser.

  In order to deepen an understanding of the present invention, the present invention will be described in more detail with reference to the following examples.

Example 1 Production and Screening of Antibody of the Present Invention (1) Preparation of Antigen From a peripheral blood of a healthy person (used with consent from a donor through the ethics committee of Kyoto University), a lymphocyte separation solution d = 1.077 (Nacalai Tesque) was used and total lymphocytes were prepared according to the protocol. Next, human CD4 ⁺ T cells (purity 98% or more) were prepared from the total lymphocytes using anti-human CD4 microbeads (MiltenyiBiotec) according to the protocol.

(2) Immunization The above human CD4 ⁺ T cells (1 × 10 ⁶ cells) were injected into the abdominal cavity of 8-week-old Wistar rats (Japan SLC) for the first immunization. Next, 2 × 10 ⁶ and 5 × 10 ⁶ human CD4 ⁺ T cells were injected intraperitoneally at 2-week intervals to perform the second and third immunizations. Further, one month after the third immunization, the human CD4 ⁺ T cells (6 × 10 ⁶ ) were injected intravenously to perform the fourth immunization.

(3) Production of hybridoma Three days after the fourth immunization, the spleen was taken out from the immunized rat to obtain spleen cells. Spleen cells were suspended in RPMI1640 medium (Invitrogen) to prepare a spleen cell suspension. Next, the spleen cells (2 × 10 ⁸ cells) were mixed with the same number of myeloma cells (P3X63-Ag8-653, ATCC CRL 1580) and centrifuged (360 g, 5 minutes) to obtain a cell mass. 1 ml of a 50% solution of polyethylene glycol 1500 (Roche Diagnostics) was added to induce cell fusion. After the cell fusion operation, the cells were washed with Hank's solution, and 100 μl of each cell was seeded on 20 96-well plates. Subsequently, 100 μl of HAT medium (SIGMA) was added, and the cells were cultured under conditions of 5% CO ₂ and 37 ° C. for 2 weeks to select viable cells (hybridoma).

(4) Selection of antibodies that induce decreased expression of CD3 (primary screening)
In each well of a 96-well plate, 100 μl (5 × 10 ⁴ ) of total lymphocytes prepared from human peripheral blood were seeded in the same manner as in (1) above. Next, 100 μl of the culture supernatant of each hybridoma prepared in (3) above was added and treated at 37 ° C. for 1 hour. Thereafter, the lymphocytes were washed with Hanks' solution, and then 100 μl of PE-labeled OKT3 antibody (anti-human CD3ε antibody, eBioscience, diluted 400-fold) was added to each well, followed by staining at 4 ° C. for 20 minutes. Next, lymphocytes in each well were washed with Hank's solution and then subjected to FACSCantoII (Becton Dickinson) to measure the degree of staining of OKT3 antibody, and hybridomas producing culture supernatants with a reduced labeling amount were selected. As a result, 1920 wells were screened and 4 wells were selected.

Next, the hybridoma contained in each selected well was cloned by the limiting dilution method, and the same screening was repeated. As a result, four hybridomas were cloned. The antibodies produced by these four hybridomas were designated as # 1 Ab to # 4 Ab, respectively.
100 μl (5 × 10 ⁴ ) of total lymphocytes prepared from human peripheral blood in the same manner as in (1) above were pretreated at 37 ° C. for 1 hour in the absence of antibody, and then PE-labeled OKT3 antibody in the same manner as above. As shown in FIG. 1 (a), T cells in all lymphocytes were strongly stained (indicated as Y). On the other hand, 100 μl of the culture supernatant of each hybridoma of # 1 Ab to # 4 Ab (about 1 μg / ml as the amount of antibody) (100 μl of the culture supernatant with respect to 100 μl of all lymphocytes is referred to as “culture supernatant 50 When all lymphocytes were pretreated in the same manner in the presence, staining with PE-labeled OKT3 antibody was significantly reduced (indicated as X).

Similarly, Jurkat cells (human T cells, ATCC TIB-152) were pretreated and stained with an anti-TCR antibody (BDBiosciences, Cat # 555548). As a result, when pre-treated in the absence of antibody as shown in FIG. 1 (b), TCR expression was observed (indicated as Y), but the culture supernatant of each hybridoma of # 1 Ab to # 4 Ab was 50 %, The expression of TCR was decreased (indicated as X). As a control, the case where the cells were not stained is indicated by Z (autofluorescence).
From these results, it was confirmed that # 1Ab to # 4Ab are antibodies that reduce the expression of the TCR-CD3 complex.

(5) Selection of antibodies that do not show T cell proliferation-inducing action (secondary screening)
Anti-human CD3 antibody (OKT3, eBioscience) 0.001-1 μg / ml was added to 100 μl (7 × 10 ⁴ ) of total lymphocytes prepared from human peripheral blood in the same manner as (1) above, and cultured for 2 days in 5% CO ₂ conditions. ³ H-thymidine (NET027X, PerkinElmer) 37 MBq / well was added for the final 4 hours of the culture period, and the amount of ³ H-thymidine incorporated into the cells was measured with a liquid scintillation counter. As a result, as shown in FIG. 2 (a), it was confirmed that addition of OKT3 antibody activated T cells and induced cell proliferation.
In the above culture system, the culture supernatant of hybridomas # 1Ab to # 4Ab was added for 50 days (100 μl) to 6.25% (12.5 μl), respectively, instead of the OKT3 antibody. The amount of ³ H-thymidine incorporated into the cells was measured. As a result, as shown in FIG. 2 (b), # 4Ab induced a T cell proliferative reaction like OKT3 antibody, but # 1Ab to # 3Ab did not induce any T cell proliferative response.
From the above, it was confirmed that # 1Ab to # 3Ab are antibodies that reduce the expression of TCR and do not induce a proliferative response in T cells.
(6) Measurement of T cell activation inducing action To 100 μl (7 × 10 ⁴ ) of total lymphocytes prepared from human peripheral blood in the same manner as in (1) above, OKT3 antibody (eBioscience) or # 1 Ab to # Culture supernatant 50% (100 μl) of 3Ab hybridoma was added, and cultured for 2 days under conditions of 37 ° C. and 5% CO ₂ . Then, for each culture solution 100 [mu] l, as an indicator of cell proliferation CTLL-2 cell line that grows in IL-2-dependent, by measuring ³ H- thymidine amount incorporated into the cells, IL-2 production amount It was measured. As shown in Table 1, # 1Ab to # 3Ab did not induce IL-2 production. From this, it was confirmed that # 1Ab to # 3Ab do not induce activation of T cells.

(Example 2) Determination of target molecule of # 1 Ab (1) Analysis by J.RT3-T3.5 cells
100 μl of PE-labeled OKT3 antibody (anti-human CD3ε antibody, eBioscience, 400-fold diluted) was added to 100 μl (1 × 10 ⁵ cells) of Jurkat cells (human T cell line, ATCC TIB152) and stained at 4 ° C. for 20 minutes. . After washing with Hanks' solution, the degree of labeling with PE-labeled OKT3 antibody was measured by FACSCanto II (Becton Dickinson). Since Jurkat cells expressed the TCR-CD3 complex, they were strongly stained with PE-labeled OKT3 antibody (left figure in FIG. 3 (a), labeled P). The indication O indicates unstained.
On the other hand, the Jurkat cell sub-strain J.RT3-T3.5 (ATCC TIB-153, J. Exp. Med. 160: 1284-1299, 1984) does not express the TCR-CD3 complex, so that the PE-labeled OKT3 antibody (The right figure in FIG. 3A, indicated as Q).
Next, these cell lines were treated with 100 μl of the # 1 Ab culture supernatant, washed, and then stained with PE-labeled anti-rat IgG antibody (BD Biosciences, Cat ^# 558067). As in the case of PE-labeled OKT3 antibody, The staining pattern was shown (shown as P and Q in FIG. 3 (b)). This result suggests that the target molecule of # 1Ab may be either TCR or CD3 molecule.

(2) Analysis by hCD3ε-Yac-1 cells CD3ε molecules are stably expressed on the surface of T cells by forming a complex with CD3γ molecules. Mouse lymphoma Yac-1 (ATCC TIB-160) expresses a complex of mouse CD3ε and mouse CD3γ. When a gene of human CD3ε molecule is introduced here, a complex of human CD3ε and mouse CD3γ is also expressed simultaneously with a complex of mouse CD3ε and mouse CD3γ. Therefore, a human CD3ε molecule gene (NM_000733) was introduced into Yac-1 cells by electroporation to prepare hCD3ε-Yac-1 cells. Subsequently, hCD3ε-Yac-1 cells were stained with PE-labeled OKT3 antibody or treated with # 1Ab and then with PE-labeled anti-rat IgG antibody, and the amount of labeling was measured by FACS, as in (1) above. As a result, PE-labeled OKT3 antibody and # 1Ab did not stain Yac-1 cells, but both stained hCD3ε-Yac-1 cells (FIGS. 4 (a) and 4 (b)). In FIG. 4, PE-labeled OKT3 antibody (U), # 1 Ab (T), and unstained (S) are shown. This result indicates that the target molecule of # 1Ab is hCD3ε.

(3) Biochemical analysis
Yac-1 cells (not expressing human CD3ε molecule), hCD3ε-Yac-1 cells expressing human CD3ε molecule and Jurkat cells (originally expressing human CD3ε molecule) were each solubilized with 10% Triton 5 × 10 ⁵ equivalents were separated by SDS-PAGE (Ato), transferred to a membrane according to a conventional method, fixed, treated with 3 ml of # 1 Ab culture supernatant, washed, and then labeled with HRP (horseradishperoxidase). Western blotting was performed using a rat IgG antibody (Jackson ImmunoResearch, Cat ^# 212-036-082). As a result, a band recognized by # 1Ab was not observed in Yac-1 cells, but was observed in hCD3ε-Yac-1 cells containing human CD3ε molecules and Jurkat cells (indicated by arrows in FIG. 5).
From these results, it was confirmed that the target molecule of # 1Ab is a CD3ε molecule.

(Example 3) Inhibition of T cell activation induction by # 1 Ab (1) Inhibition of T cell activation induction by OKT3 antibody The anti-human CD3ε antibody OKT3 is known to induce activation of human T cells. (Hum Antibodies Hybridomas. 1994; 5 (1-2): 41-7). Therefore, OKT3 antibody (eBioscience) 250 to 0.0025 ng / ml was added to 100 μl (7 × 10 ⁴ ) of total lymphocytes prepared from human peripheral blood in the same manner as in Example 1 (1), and the temperature was 37 ° C. The cells were cultured for 3 days under 5% CO ₂ conditions. ³ H-thymidine (NET027X, PerkinElmer) 37 MBq / well was added for the final 4 hours of the culture period, and the amount of ³ H-thymidine incorporated into the cells was measured with a liquid scintillation counter. As a result, the cells proliferated in proportion to the added amount of the OKT3 antibody. This indicates that OKT3 induced T cell activation and T cells proliferated (FIG. 6, F).

In the above culture system, 0.5 μg / ml of # 1Ab was further added and cultured in the same manner, and the amount of ³ H-thymidine incorporated into the cells was measured. As a result, the proliferation of cells was substantially suppressed by adding # 1Ab. This indicates that the induction of T cell activation by the OKT3 antibody was suppressed, and as a result, no proliferation of T cells was observed (FIG. 6, G).

(2) Inhibition of T cell activation induction by mitogen In the above (1), instead of the OKT3 antibody, phytohemagglutinin (PHA) or pork weed mitogen (PWM) having mitogenic activity is used alone or in combination with them. The cells were cultured in the same manner except that # 1Ab was used in combination, and the amount of ³ H-thymidine incorporated into the cells was measured with a liquid scintillation counter. As a result, when # 1 Ab was not used in combination, cells proliferated by PHA and PWM (FIG. 7, H). This indicates that T cell activation was induced by PHA and PWM, and T cells proliferated. On the other hand, when these were used in combination with # 1Ab, cell proliferation was suppressed (FIG. 7, I). This indicates that the induction of T cell activation by mitogen was suppressed by # 1 Ab.

  In the case of the combined use of PWM and # 1Ab, cell proliferation is not substantially suppressed as in the case of the combined use of PHA and # 1Ab. It is presumed that cell proliferation was observed because it also had the ability to induce cell activation and the cells used were all lymphocytes. That is, it is presumed that B cells in lymphocytes were activated and proliferated by PWM.

  From the results of (1) and (2) above, it was confirmed that # 1Ab not only does not activate the T cell by the antibody itself but also suppresses T cell activation by the T cell activator. In addition, these results indicate that # 1Ab suppresses the induction of T cell activation by competing with OKT3 antibody and # 1Ab, and does not suppress T cell proliferation (# 1Ab and OKT3 antibody , Indicating a different mechanism of action).

(Example 4) Induction of cytokine production in vivo by # 1Ab Since # 1Ab is an antibody that acts on T cells, side effects when administered in vivo may be a problem. Therefore, the side effect of # 1Ab in vivo, particularly whether to induce cytokine production, was examined. In order to evaluate the action in vivo, humanized mice were used.

400 μl (1 × 10 ⁵ ) of human hematopoietic stem cells (human CD34 ⁺ cells, POIETICS) were transferred into the vein of a 6-week-old NOG mouse (NOD.Cg-Prkdcscid Il2rgtm1Sug / Jic) . Thereafter, at 20-30 weeks when human lymphocytes differentiate in the NOG mouse, 20 μg of mouse IgG _2a (BDBiosciences) (control antibody), rat IgG (BDBiosciences) (control) 20 μg of antibody), 20 μg of OKT3 antibody (eBioscience) (control antibody) or 20 μg of # 1 Ab were intravenously administered. Blood was collected immediately before administration (0), 2 hours after administration (2) and 6 hours after administration (6), and then IFN-γ, IL-2, IL-17, IL-6, TNF-α and IL in the blood The concentration of −10 was measured using a measurement kit (BIO-RAD, Bio-Plex Pro Assays).

  As a result, as shown in FIG. 8, when # 1Ab was administered in an in vivo system, production of IL-10, which is a regulatory cytokine, was observed, but IFN-γ, IL-, which are inflammatory cytokines, were observed. 2. Production of IL-17, IL-6 and TNF-α was low compared to OKT3 antibody.

(Example 5) Graft-versus-host disease (GVHD) onset suppression action # 1Ab does not activate human T cells in an in vitro system (FIG. 2), and can inhibit T cell activation ( FIGS. 6 and 7) further show that the possibility of side effects is very low in the in vivo system (FIG. 8). Therefore, it was examined whether the immunosuppressive action exhibited by # 1 Ab was actually effective against human T cells in an in vivo system. As a model, the onset model of GVHD by human T cells was used.

After 6-week-old NOG mice were irradiated with 2 Gy of gamma rays, 400 μl (2 × 10 ⁶ ) of human total lymphocytes prepared from human peripheral blood in the same manner as in Example 1 (1) were transferred into the vein. GVHD develops and dies about 15-20 days after lymphocyte transfer.
Rat IgG (BD Biosciences) (control) or # 1 Ab was intravenously administered (20 μg / mouse / time) to the gamma-irradiated mice three times at weekly intervals from 2 days after transfer of human lymphocytes. . Mice administered rat IgG developed GVHD on the 15th day and died (FIG. 9, M). On the other hand, in mice administered with # 1 Ab, the onset of GVHD was suppressed and survival was significantly prolonged (FIG. 9, N).

  This result shows that # 1Ab acts immunosuppressively on human T cells even in vivo. In addition, administration of # 1Ab 2 days after transfer, not immediately after transfer of human lymphocytes, suppresses the onset of GVHD. Therefore, # 1Ab also suppresses T cells sensitized with antigen. It has been shown to work.

(Example 6) Measurement of unresponsiveness-inducing action of # 1 Ab on T cells (1) 6-week-old NOG mouse (NOD.Cg-Prkdcscid Il2rgtm1Sug / Jic) (Central Laboratory for Experimental Animals) was irradiated with 2 Gy of gamma rays Thereafter, 400 μl (1 × 10 ⁵ cells) of human hematopoietic stem cells (human CD34 ⁺ cells, POIETICS) were transferred into a vein. Thereafter, at 20-30 weeks when human lymphocytes differentiated in NOG mice, rat IgG (BDBiosciences) (control antibody) 1 mg or # 1 Ab 1 mg was intravenously administered to the humanized NOG mice. Thereafter, 24 hours later, the spleen was taken out to obtain spleen cells. Spleen cells were suspended in RPMI1640 medium (Invitrogen) to prepare a spleen cell suspension. The spleen cells contained CD4 ⁺ T cells (32.3%) and CD8 ⁺ T cells (16.9%).
2 μg / ml of phytohemagglutinin (PHA, SIGMA) was added to the spleen cell suspension prepared above (FIG. 10, horizontal axis), and cultured at 37 ° C. under 5% CO ₂ for 3 days. As a control, the cells were cultured in the same manner for 3 days except that PHA was not added (W). ³ H-thymidine (NET027X, PerkinElmer) 37 MBq / well was added for the final 4 hours of the culture period, and the amount of ³ H-thymidine incorporated into the cells was measured with a liquid scintillation counter.
As a result, when the control antibody was administered (U), proliferation of spleen cells accompanying PHA stimulation was induced (FIG. 10 left). On the other hand, when # 1Ab was administered (V), the proliferation of spleen cells accompanying PHA stimulation was substantially suppressed (FIG. 10 right).

(2) In the same manner as in (1) above, 400 μl (1 × 10 ⁵ ) of human hematopoietic stem cells (human CD34 ⁺ cells, POIETICS) were transferred into NOG mice intravenously and after 20-30 weeks, The spleen was removed and spleen cells were obtained. A spleen cell suspension was prepared from the spleen cells in the same manner as in (1) above. 400 μl (2 × 10 ⁷ cells) of these spleen cells were transferred into veins of 6-week-old NOG mice (NOD.Cg-Prkdcscid Il2rgtm1Sug / Jic) (Laboratory Animal Central Laboratory) previously irradiated with 2 Gy of gamma rays. Thereafter, 1 mg of rat IgG (BD Biosciences) (control antibody) or 1 mg of # 1 Ab was intravenously administered. Seven days later, the spleen was removed from the mouse to obtain spleen cells. Spleen cells were suspended in RPMI1640 medium (Invitrogen) to prepare a spleen cell suspension. Further, human CD4 ⁺ T cells (purity 98% or more) were prepared from the spleen cells using anti-human CD4 microbeads (MiltenyiBiotec) according to the protocol. Using these CD4 ⁺ T cells, culture by PHA stimulation was performed in the same manner as in (1) above, and proliferation induction against human CD4 ⁺ T cells was measured.
As a result, when the control antibody was administered, proliferation of human CD4 ⁺ T cells accompanying PHA stimulation was induced (FIG. 11F). On the other hand, when # 1 Ab was administered, proliferation of human CD4 ⁺ T cells accompanying PHA stimulation was substantially suppressed (FIG. 11G). D and E are the results without PHA, D is the control antibody, and E is the result of # 1 Ab.

The results of the above (1) and (2) show that # 1Ab not only activates T cells (FIG. 2) and suppresses activation of T cells (FIGS. 6, 7 and 9), but also It shows that the body induces unresponsiveness to T cells.
In this example, humanized NOG mice were only administered antibodies, but not antigens etc., but T cells were induced to be unresponsive under these conditions. It was shown that coexistence of antigen is not required for induction of unresponsiveness by 1Ab.

(Example 7) # 1 antibody variable region amino acid sequence and gene base sequence (1) heavy chain variable region sequencing
Total RNA was extracted from # 1 antibody-producing hybridoma cells (2 × 10 ⁶ cells) using RNAiso Plus (Takara Bio Inc.) according to the protocol. Using this total RNA as a template, using a rat antibody heavy chain specific primer [5'-TCCAKAGTTCCA-3 '(SEQ ID NO: 1)] (K = G or T), SMARTerRACE cDNA Amplification Kit (Clontech Cat # 634924) Then, cDNA was synthesized.

  Next, using the cDNA synthesized above as a template, a reverse primer specific to rat antibody (IgG) heavy chain [5'-GGGAARTARCCCTTGACCAGGCA-3 '(SEQ ID NO: 2) and 5'-GGGAARTAGCCTTTGACAAGGCA-3' (SEQ ID NO: 3) (R = A or G) and Forward primer [5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3 ′ (SEQ ID NO: 4) and 5′-CTAATACGACTCACTATAGGGC-3 ′ (SEQ ID NO: 5) 1 5: RACE PCR reaction was performed using: These operations followed the protocol attached to the Kit.

The PCR product thus obtained was electrophoresed on an agarose gel, and the expected PCR product of about 700 bp was purified from the gel. The purified PCR product was ligated to pMD20-T vector (Takara Bio Inc.), and Escherichia coli strain DH5α (Takara Bio Inc.) was transformed with this ligation product. After cloning this, sequence analysis was performed using a vector-specific primer [5′-CGCCAGGGTTTTCCCAGTCACGAC-3 ′ (SEQ ID NO: 6)] to determine the base sequence.
Next, the determined nucleotide sequence is used in the immunoglobulin sequence prediction software provided on the IMGT / V-QUEST Search page (URL homepage: http://www.imgt.org/IMGT_vquest/vquest livret = 0 & Option = ratIg). The regions of complementarity determining regions CDR1, CDR2 and CDR3 and frameworks FR1, FR2, FR3 and FR4 were identified.

  DNA sequence encoding heavy chain variable region (from 5'-terminal side to FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4) and amino acid sequence (from N-terminal side to FR1-CDR1-FR2-CDR2-FR3) -CDR3-FR4) was as follows.

# 1Ab heavy chain (base sequence) (SEQ ID NO: 7)
GAGGTGCCGCTGGTGGAGTCTGGGGGAGGCCTAGTGCAGCCTGGAAGGTCCCTGAAACTCTCCTGTGCAGCCTCA GGATTCACTTTCAGTAATTATCTC ATGGCCTGGGTCCGCCATCCTCCAAAGAAGGGTCTGGAGTGGGTCGCAACC ATTAGTTCCAGTGGTAGCAGAATT TACTATCCAGACTCCGTGAAAGGCCGATTCACTATCTCCAGAGATAATGCAAGAAGCAGCCTATACCTACAGATGAGCAGTCTGAGGTCTGAGGACACGGCCACTTATTACTGT GCAAGACATCTCCGGGACGGTGGCTTTGATTAC TGGGGCCAAGGAGTCATGGTCACAGTCTCCTCAGCTGAAACAACA [ GCCCCATCTGTCTATCCACTGGCTCCTGGAACTGCTCTCAAAAGTAACTCCATGGTGACCCTGGGATGCCTGGTCAAGGGCTACTTCCC]
The underlined portion represents the CDR portion, and the inside of [] represents the heavy chain constant region portion.

# 1 Ab Heavy chain (amino acid sequence) (SEQ ID NO: 8)
GluValProLeuValGluSerGlyGlyGlyLeuValGlnProGlyArgSerLeuLysLeuSerCysAlaAlaSer GlyPheThrPheSerAsnTyrLeu MetAlaTrpValArgHisProProLysLysGlyLeuGluTrpValAlaThr IleSerSerSerGlySerArgIle TyrTyrProAspSerValLysGlyArgPheThrIleSerArgAspAsnAlaArgSerSerLeuTyrLeuGlnMetSerSerLeuArgSerGluAspThrAlaThrTyrTyrCys AlaArgHisLeuArgAspGlyGlyPheAspTyr TrpGlyGlnGlyValMetValThrValSerSerAlaGluThrThr [ AlaProSerValTyrProLeuAlaProGlyThrAlaLeuLysSerAsnSerMetValThrLeuGlyCysLeuValLysGlyTyrPhe]
The underlined portion represents the CDR portion, and the inside of [] represents the heavy chain constant region portion.

The nucleotide sequence and amino acid sequence of the complementarity determining regions CDR1, CDR2, and CDR3 and the sites of the frameworks FR1, FR2, FR3, and FR4 were as follows.

Heavy chain CDR1 (base sequence): GGATTCACTTTCAGTAATTATCTC (SEQ ID NO: 9)
Heavy chain CDR2 (base sequence): ATTAGTTCCAGTGGTAGCAGAATT (SEQ ID NO: 10)
Heavy chain CDR3 (base sequence): GCAAGACATCTCCGGGACGGTGGCTTTGATTAC (SEQ ID NO: 11)

Heavy chain CDR1 (amino acid sequence): GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12)
Heavy chain CDR2 (amino acid sequence): IleSerSerSerGlySerArgIle (SEQ ID NO: 13)
Heavy chain CDR3 (amino acid sequence): AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14)

Heavy chain FR1 (base sequence): (SEQ ID NO: 15)
GAGGTGCCGCTGGTGGAGTCTGGGGGAGGCCTAGTGCAGCCTGGAAGGTCCCTGAAACTCTCCTGTGCAGCCTCA
Heavy chain FR2 (base sequence): (SEQ ID NO: 16)
ATGGCCTGGGTCCGCCATCCTCCAAAGAAGGGTCTGGAGTGGGTCGCAACC
Heavy chain FR3 (base sequence): (SEQ ID NO: 17)
TACTATCCAGACTCCGTGAAAGGCCGATTCACTATCTCCAGAGATAATGCAAGAAGCAGCCTATACCTACAGATGAGCAGTCTGAGGTCTGAGGACACGGCCACTTATTACTGT
Heavy chain FR4 (base sequence): (SEQ ID NO: 18)
TGGGGCCAAGGAGTCATGGTCACAGTCTCCTCAGCTGAAACAACA

Heavy chain FR1 (amino acid sequence): (SEQ ID NO: 19)
GluValProLeuValGluSerGlyGlyGlyLeuValGlnProGlyArgSerLeuLysLeuSerCysAlaAlaSer
Heavy chain FR2 (amino acid sequence): (SEQ ID NO: 20)
MetAlaTrpValArgHisProProLysLysGlyLeuGluTrpValAlaThr
Heavy chain FR3 (amino acid sequence): (SEQ ID NO: 21)
TyrTyrProAspSerValLysGlyArgPheThrIleSerArgAspAsnAlaArgSerSerLeuTyrLeuGlnMetSerSerLeuArgSerGluAspThrAlaThrTyrTyrCys
Heavy chain FR4 (amino acid sequence): (SEQ ID NO: 22)
TrpGlyGlnGlyValMetValThrValSerSerAlaGluThrThr

(2) Sequencing of light chain variable region Total RNA was extracted from # 1 antibody-producing hybridoma cells (1 × 10 ⁷ cells) using Kit of Sepazole RNA I Super G (Nacalai Tesque). Using this total RNA as a template, 5'RACE CDS Primer A (5 '-(T) ₂₅ VN-3') (N = A, C, G or T; V = A, G or C) attached to Kit Then, cDNA was synthesized by SMARTer RACE cDNA Amplification Kit (Clontech Cat # 634924).
Using the cDNA synthesized above as a template, a reverse primer [5′-GTAAAACTGTTGCGAGATCTCCACTGTTC-3 ′ (SEQ ID NO: 23)] specific to a light chain of a rat antibody (IgG) and a forward primer [5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3 ′ (SEQ ID NO: 24) And 5′-CTAATACGACTCACTATAGGGC-3 ′ (SEQ ID NO: 25) mixed at a molar ratio of 1: 4] were used to carry out 5′RACEPCR reaction. These operations followed the protocol attached to the Kit.
The obtained PCR product was electrophoresed on an agarose gel, confirmed to be a single band of about 700 bp assumed, and purified with a QIAquick PCRpurification kit (QIAGEN). The purified PCR product was ligated to pCR-BluntII-TOPOvector (Invitrogen), and Escherichia coli strain DH5α (Takara Bio) was transformed with this ligation product. After cloning this, sequence analysis was performed using a vector-specific primer [5′-CAGGAAACAGCTATGAC-3 ′ (SEQ ID NO: 26)] to determine the base sequence.
Next, based on the determined base sequence, the immunoglobulin sequence prediction software provided on the IMGT / V-QUESTSearch page (URL homepage: http://www.imgt.org/IMGT_vquest/vquest livret = 0 & Option = ratIg) The regions of complementarity determining regions CDR1, CDR2 and CDR3 and frameworks FR1, FR2, FR3 and FR4 were identified.

  Base sequence of DNA encoding light chain variable region (FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 from 5'-end side) and amino acid sequence (FR1-CDR1-FR2-CDR2-FR3 from N-terminal side) -CDR3-FR4) was as follows.

# 1 Ab light chain (base sequence) (SEQ ID NO: 27)
CAGTTTGTGCTTACTCAGCCAAACTCTGTGTCTACGAATCTCGGAAGCACAGTCAAACTGTCTTGCAAGCGCAGC ACTGGTAACATTGGAAGCAATTAT GTGAACTGGTACCAACAACATGAGGGAAGATCTCCCACCACTATGATTTAT AGGGATGAT GGGAGACCAGATGGAGTTCCTGACAGGTTCTCTGGCTCCATTGACAGATCTTCCAACTCAGCCCTCCTGACAATCAAAAATGTGCAGAGTGAAGATGAAGCTGACTACTTCTGT CACTCTCACAGTGGTGGTATTAATGTT TTCGGCGGTGGAACCAGCCTCACTGTCCTAGGTCAGCCCAAGTCCACT [ CCCACACTCACAGTATTTCCACCTTCAACTGAGGAGCTCCAGGGAAACAAAGCCACACTGGTGTGTCTGATTTCTGATTTCTACCCGAGTGATGTGGAAGTGGCCTGGAAGGCAAATGGTGCACCTATCTCCCAGGGTGTGGACACTGCAAATCCCACCAAACAGGGCAACAAATACATCGCCAGCAGCTTCTTACGTTTGACAGCAGAACAGTGGAGATCTCGCAACAGTTTTAC]
The underlined portion represents the CDR portion, and [] represents the light chain constant region portion.

# 1 Ab light chain (amino acid sequence) (SEQ ID NO: 28)
GlnPheValLeuThrGlnProAsnSerValSerThrAsnLeuGlySerThrValLysLeuSerCysLysArgSer ThrGlyAsnIleGlySerAsnTyr ValAsnTrpTyrGlnGlnHisGluGlyArgSerProThrThrMetIleTyr ArgAspAsp GlyArgProAspGlyValProAspArgPheSerGlySerIleAspArgSerSerAsnSerAlaLeuLeuThrIleLysAsnValGlnSerGluAspGluAlaAspTyrPheCys HisSerHisSerGlyGlyIleAsnVal PheGlyGlyGlyThrSerLeuThrValLeuGlyGlnProLysSerThr [ ProThrLeuThrValPheProProSerThrGluGluLeuGlnGlyAsnLysAlaThrLeuValCysLeuIleSerAspPheTyrProSerAspValGluValAlaTrpLysAlaAsnGlyAlaProIleSerGlnGlyValAspThrAlaAsnProThrLysGlnGlyAsnLysTyrIleAlaSerSerPheLeuArgLeuThrAlaGluGlnTrpArgSerArgAsnSerPhe]
The underlined portion represents the CDR portion, and [] represents the light chain constant region portion.

The base sequence and amino acid sequence were as follows.

Light chain CDR1 (base sequence): ACTGGTAACATTGGAAGCAATTAT (SEQ ID NO: 29)
Light chain CDR2 (base sequence): AGGGATGAT (SEQ ID NO: 30)
Light chain CDR3 (base sequence): CACTCTCACAGTGGTGGTATTAATGTT (SEQ ID NO: 31)

Light chain CDR1 (amino acid sequence): ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32)
Light chain CDR2 (amino acid sequence): ArgAspAsp (SEQ ID NO: 33)
Light chain CDR3 (amino acid sequence): HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34)

Light chain FR1 (base sequence): (SEQ ID NO: 35)
CAGTTTGTGCTTACTCAGCCAAACTCTGTGTCTACGAATCTCGGAAGCACAGTCAAACTGTCTTGCAAGCGCAGC
Light chain FR2 (base sequence): (SEQ ID NO: 36)
GTGAACTGGTACCAACAACATGAGGGAAGATCTCCCACCACTATGATTTAT
Light chain FR3 (base sequence): (SEQ ID NO: 37)
GGGAGACCAGATGGAGTTCCTGACAGGTTCTCTGGCTCCATTGACAGATCTTCCAACTCAGCCCTCCTGACAATCAAAAATGTGCAGAGTGAAGATGAAGCTGACTACTTCTGT
Light chain FR4 (base sequence): (SEQ ID NO: 38)
TTCGGCGGTGGAACCAGCCTCACTGTCCTAGGTCAGCCCAAGTCCACT

Light chain FR1 (amino acid sequence): (SEQ ID NO: 39)
GlnPheValLeuThrGlnProAsnSerValSerThrAsnLeuGlySerThrValLysLeuSerCysLysArgSer
Light chain FR2 (amino acid sequence): (SEQ ID NO: 40)
ValAsnTrpTyrGlnGlnHisGluGlyArgSerProThrThrMetIleTyr
Light chain FR3 (amino acid sequence): (SEQ ID NO: 41)
GlyArgProAspGlyValProAspArgPheSerGlySerIleAspArgSerSerAsnSerAlaLeuLeuThrIleLysAsnValGlnSerGluAspGluAlaAspTyrPheCys
Light chain FR4 (amino acid sequence): (SEQ ID NO: 42)
PheGlyGlyGlyThrSerLeuThrValLeuGlyGlnProLysSerThr

Claims (16)

Anti-human CD3ε antibody or fragment thereof having the following properties (1) to (5):
(1) binds to human CD4 ⁺ T cell antigen receptor CD3ε;
(2) induces a decrease in the expression of the T cell antigen receptor-CD3 complex of human CD4 ⁺ T cells;
(3) does not induce activation of human CD4 ⁺ T cells;
(4) has human CD4 ⁺ T cell growth inhibitory activity;
(5) Induces unresponsiveness in human CD4 ⁺ T cells regardless of the presence or absence of antigen sensitization. The antibody or fragment thereof according to claim 1, wherein the anti-human CD3ε antibody is an anti-human CD3ε rat antibody. The antibody or fragment thereof according to claim 1 or 2, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region each have the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14). The antibody or fragment thereof according to claim 1 or 2, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the light chain variable region each have the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32);
CDR2: ArgAspAsp (SEQ ID NO: 33);
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34). 3. A heavy chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 of claim 3 and a light chain variable region having the complementarity determining regions CDR1, CDR2 and CDR3 of claim 4. Or an antibody fragment thereof. A humanized antibody or fragment thereof that binds to human CD3ε, wherein the complementarity determining regions CDR1, CDR2, and CDR3 of the heavy chain variable region each have the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14). Humanized antibodies or fragments thereof that bind to human CD3ε, wherein the complementarity determining regions CDR1, CDR2 and CDR3 of the light chain variable region each have the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32);
CDR2: ArgAspAsp (SEQ ID NO: 33);
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34). Binding to human CD3ε comprising the heavy chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 of claim 6 and the light chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 of claim 7. A humanized antibody or fragment thereof. An expression vector comprising DNA encoding a heavy chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 each having the following amino acid sequence:
CDR1: GlyPheThrPheSerAsnTyrLeu (SEQ ID NO: 12);
CDR2: IleSerSerSerGlySerArgIle (SEQ ID NO: 13);
CDR3: AlaArgHisLeuArgAspGlyGlyPheAspTyr (SEQ ID NO: 14). An expression vector comprising DNA encoding a light chain variable region having complementarity determining regions CDR1, CDR2 and CDR3 each comprising the following amino acid sequence:
CDR1: ThrGlyAsnIleGlySerAsnTyr (SEQ ID NO: 32)
CDR2: ArgAspAsp (SEQ ID NO: 33)
CDR3: HisSerHisSerGlyGlyIleAsnVal (SEQ ID NO: 34) An expression vector comprising DNA encoding the heavy chain variable region according to claim 9 and DNA encoding the light chain variable region according to claim 10. A method for producing a humanized antibody or fragment thereof that binds to human CD3ε according to claim 8, comprising: (i) using the expression vector according to claim 9 and the expression vector according to claim 10, or (Ii) A method comprising transforming a host cell with the expression vector according to claim 11, culturing the host cell, and isolating the produced humanized antibody or a fragment thereof. An immunosuppressant comprising the antibody or fragment thereof according to any one of claims 1 to 8 as an active ingredient. The immunosuppressive agent according to claim 13, wherein the fragment is F (ab ') ₂ . A therapeutic agent for autoimmune diseases comprising the antibody or fragment thereof according to any one of claims 1 to 8 as an active ingredient. The therapeutic agent for an autoimmune disease according to claim 15, wherein the fragment is F (ab ') ₂ .