JP2016064989A - Pharmaceutical composition for treating cancer, and method for evaluating sensitivity to treatment by pd-1 inhibitor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a pharmaceutical composition for treating cancer, and to provide a method for evaluating the sensitivity to the treatment by a PD-1 inhibitor.SOLUTION: The invention provides a pharmaceutical composition for treating cancer comprising miR-197, a precursor thereof, or a variant thereof, or a vector which expresses miR-197, a precursor thereof, or a variant thereof. The invention also provides a method for evaluating the sensitivity to the treatment by a PD-1 inhibitor in a patient with PD-L1 related disease, the method comprising (i) measuring a miR-197 level in an organism sample sampled from the patient, and (ii) evaluating that the patient has a high sensitivity to the treatment by a PD-1 inhibitor, when the miR-197 level is lower than a standard value.SELECTED DRAWING: None

Description

  The present invention relates to a pharmaceutical composition for treating cancer. The invention also relates to a method for assessing sensitivity to treatment with a PD-1 inhibitor.

  PD-1 (Programmed cell death 1) is one of the CD28 family molecules, is expressed on activated B cells, T cells and bone marrow cells, and is involved in the introduction of inhibitory signals. PD-1 is known to induce a decrease in tumor-infiltrating lymphocytes, a decrease in cell proliferation via T cell receptors, and immune evasion of cancer cells as a result of interaction with its ligand, PD-L1. It has been. Anti-PD-1 antibodies can treat PD-L1-related diseases including cancer by inhibiting the interaction between PD-1 and PD-L1. Nivolumab and pembrolizumab, which are anti-PD-1 antibodies, have been approved as therapeutic agents for malignant melanoma, and have also been reported to have therapeutic effects on non-small cell lung cancer and renal cell carcinoma. Yes.

  It is known that the therapeutic effect of anti-PD-1 antibody correlates with the expression of PD-L1 in tumors (Non-patent Documents 26 and 27). However, there are no other known biomarkers for predicting the therapeutic effect of anti-PD-1 antibodies.

JP 2006-340714 A

S. S. Ramalingam et al., Lung cancer: New biological insights and recent therapeutic advances.CA Cancer J Clin 61, 91-112 (2011). M. Inui et al., MicroRNA control of signal transduction. Nat Rev Mol Cell Biol 11, 252-263 (2010). J. Shen et al., Applications of MicroRNAs in the Diagnosis and Prognosis of Lung Cancer. Expert Opin Med Diagn 6, 197-207 (2012). J. R. Brahmer et al., Safety and activity of anti-PD-L1 antibody in patients with advanced cancer.N Engl J Med 366, 2455-2465 (2012). D. M. Pardoll, The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer 12, 252-264 (2012). T. Haraguchi et al., Vectors expressing efficient RNA decoys achieve the long-term suppression of specific microRNA activity in mammalian cells.Nucleic Acids Res 37, e43 (2009). A. Onn et al., Development of an orthotopic model to study the biology and therapy of primary human lung cancer in nude mice.Clin Cancer Res 9, 5532-5539 (2003). Y. S. Tsai et al., RNA silencing of Cks1 induced G2 / M arrest and apoptosis in human lung cancer cells.IUBMB Life 57, 583-589 (2005). L. Shi, et al., Over-expression of CKS1B activates both MEK / ERK and JAK / STAT3 signaling pathways and promotes myeloma cell drug-resistance.Oncotarget 1, 22-33 (2010). V. Liberal et al., Cyclin-dependent kinase subunit (Cks) 1 or Cks2 overexpression overrides the DNA damage response barrier triggered by activated oncoproteins.Proc Natl Acad Sci U S A 109, 2754-2759 (2012). M. Marzec et al., Oncogenic kinase NPM / ALK induces through STAT3 expression of immunosuppressive protein CD274 (PD-L1, B7-H1) .Proc Natl Acad Sci U S A 105, 20852-20857 (2008). G. B. Ehret et al., DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites.J Biol Chem 276, 6675-6688 (2001). L. Du, et al., MiR-93, miR-98, and miR-197 regulate expression of tumor suppressor gene FUS1. Mol Cancer Res 7, 1234-1243 (2009). X. M. Keutgen et al., A panel of four miRNAs accurately differentiates malignant from benign indeterminate thyroid lesions on fine needle aspiration.Clin Cancer Res 18, 2032-2038 (2012). T. S. Wong et al., Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. Clin Cancer Res 14, 2588-2592 (2008). S. Hamada et al., MiR-197 induces epithelial-mesenchymal transition in pancreatic cancer cells by targeting p120 catenin.J Cell Physiol 228, 1255-1263 (2013). J. Zhou et al., 5-Fluorouracil and oxaliplatin modify the expression profiles of microRNAs in human colon cancer cells in vitro.Oncol Rep 23, 121-128 (2010). Y. Dai et al., MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance.Head Neck 33, 786-791 (2011). J. Konishi et al., B7-H1 expression on non-small cell lung cancer cells and its relationship with tumor-infiltrating lymphocytes and their PD-1 expression.Clin Cancer Res 10, 5094-5100 (2004). A. T. Parsa et al., Loss of tumor suppressor PTEN function increases B7-H1 expression and immunoresistance in glioma. Nat Med 13, 84-88 (2007). V. Velcheti et al., Programmed death ligand-1 expression in non-small cell lung cancer.Lab Invest 94, 107-116 (2013). H. Ghebeh et al., Doxorubicin downregulates cell surface B7-H1 expression and upregulates its nuclear expression in breast cancer cells: role of B7-H1 as an anti-apoptotic molecule.Breast Cancer Res 12, R48 (2010). X. Jiang et al., The activation of MAPK in melanoma cells resistant to BRAF inhibition promotes PD-L1 expression that is reversible by MEK and PI3K inhibition. Clin Cancer Res 19, 598-609 (2013). T. Ohmori et al., The mechanism of the difference in cellular uptake of platinum derivatives in non-small cell lung cancer cell line (PC-14) and its cisplatin-resistant subline (PC-14 / CDDP). Jpn J Cancer Res 84, 83-92 (1993). P. S. Mitchell et al., Circulating microRNAs as stable blood-based markers for cancer detection.Proc Natl Acad Sci U S A 105, 10513-10518 (2008). Suzanne L. Topalian, M.D. et al., Safety, Activity, and Immune Correlates of Anti-PD-1 Antibody in Cancer, N Engl J Med 366, 2443-2454 (2012). Antoni Ribas and Paul C. Tumeh, The future of cancer therapy: Selecting patients who respond to PD-1 / L1 blockade.Clin Cancer Res, Published OnlineFirst June 26, 2014.

  An object of this invention is to provide the pharmaceutical composition for treating cancer. Another object of the present invention is to provide a method for evaluating the sensitivity of a PD-L1-related disease to treatment with a PD-1 inhibitor.

  The inventors have shown that there is a negative correlation between the expression of PD-L1 in cancer tissue and the level of microRNA-197 (miR-197) in cancer tissue or blood, miR-197 is The present invention was completed by suppressing the expression of PD-L1 and further finding that miR-197 suppresses drug resistance of cancer cells.

  The present invention provides a pharmaceutical composition for treating cancer comprising miR-197 or a precursor thereof, or a variant thereof, or a vector expressing the miR-197, precursor or variant.

The present invention is a method for assessing susceptibility to treatment with a PD-1 inhibitor in a patient with a PD-L1-related disease, comprising:
(I) measuring miR-197 levels in a biological sample taken from said patient; and
(Ii) when the miR-197 level is lower than a reference value, the patient evaluates that the patient is highly sensitive to treatment with a PD-1 inhibitor;
A method comprising:

  The present invention provides a new cancer therapeutic agent. In addition, the present invention makes it possible to evaluate the sensitivity to treatment with a PD-1 inhibitor.

FIG. 1A is an illustration of patient selection in a cohort study for a microRNA (miRNA) microarray. FIG. 1B shows a heat map of miRNA microarray analysis showing miRNA differentially expressed in tumors and adjacent normal tissues in responding and non-responding groups. FIG. 1C shows the results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of miR-197 expression levels in lung tumors and adjacent normal tissues. * P <0.05, ** P <0.01 (same for the following figures). FIG. 1D shows the results of qRT-PCR analysis of miR-197 expression levels in human lung cancer cell lines. FIG. 1E shows the results of hematoxylin / eosin (HE) staining of lung adenocarcinoma tissue and in situ hybridization of lung adenocarcinoma tissue with miR-197 specific probe or scrambled control probe. Magnification: x100. FIG. 1F shows IC ₅₀ after transient transfection of pre-miR-197 or LNA-miR-197 and cisplatin (CDDP) or paclitaxel (TXL) treatment. The columns in each graph show the results of NC, pre-miR-197, LNA-NC, and LNA-miR-197 from the left. NC: Negative control (same for the following figures). FIG. 2A shows the luciferase activity of A549-miR-197-TuD, PC14-miR-197-TuD, and PC14CDDP-miR-197 cells against the miR-197 sensor vector or its mutant vector compared to the respective control cell lines. The results are shown. FIG. 2B shows the growth rate of PC14-miR-197-TuD and PC14CDDP-miR-197 cells and their respective control cells. FIG. 2C shows representative images and quantitative results showing the effect of miR-197 on cell invasion. In the graph, for A549 and PC14 cells, the left column shows the results of negative control cells (TuD-NC), the right column shows the results of miR-197-TuD-expressing cells (miR-197-TuD), and the PC14CDDP cells The left column shows the result of the negative control cell (Vector), and the right column shows the result of the miR-197 overexpressing cell (miR-197). Values were normalized to control cell values. FIG. 2D shows representative images and quantification results showing the effect of miR-197 on cell migration. In the graph, for A549 and PC14 cells, the left column shows the results of negative control cells (TuD-NC), the right column shows the results of miR-197-TuD-expressing cells (miR-197-TuD), and the PC14CDDP cells The left column shows the result of the negative control cell (Vector), and the right column shows the result of the miR-197 overexpressing cell (miR-197). Values were normalized to control cell values. FIG. 3A shows changes in bioluminescence from the whole body of mice transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells. FIG. 3B shows representative photographs of whole lungs of mice transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells. Arrows indicate primary lung nodules and triangles indicate the surface of metastatic nodules. The scale bar is 100 μm. FIG. 3C shows a representative photograph of HE staining of the right lung of a mouse transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells. The scale bar is 100 μm. FIG. 3D shows visible surface metastatic lesions in mice transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells (10 mice per group). FIG. 3E shows the ratio of lung weight per total body weight of mice transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells (10 mice in each group). FIG. 3F shows the protocol for the repeated dose test of CDDP (10 mice in each group). FIG. 3G shows a representative bioluminescent image of lung tumor growth after repeated administration of CDDP. FIG. 3H shows the results of evaluating the overall survival rate of mice transplanted with PC14-miR-197-TuD cells or PC14-TuD-NC cells by the Kaplan-Meier method. FIG. 4A shows the results of a dual-luciferase assay showing target gene repression by miR-197. FIG. 4B shows the results of qRT-PCR analysis of CKS1B mRNA levels in cells transfected with pre-miR-197 or LNA-miR-197. The column for each cell in the graph shows the results of NC, pre-miR-197, LNA-NC, and LNA-miR-197 from the left. FIG. 4C shows the results of a cell proliferation assay in A549 cells in which CKS1B was knocked down. FIG. 4D shows IC ₅₀ (CDDP or TXL) in cells in which CKS1B was knocked down. FIG. 4E shows the quantification results of the effect on cell invasion by CKS1B knockdown. FIG. 4F shows the quantification results of the effect on cell migration by CKS1B knockdown. FIG. 4G (top) shows the PD-L1 promoter regulatory module. The STAT3 binding site is shown in bold. This region was cloned into a pGL-luciferase vector (pGL4-PD-L1p). FIG. 4G (bottom) shows the analysis result of pGL4-PD-L1p luciferase activity in PC14CDDP cells treated with STAT3-siRNA, LNA-miR-197, or each negative control. FIG. 4H shows the results of Western blot analysis of target genes related to CKS1B / STAT3 signaling after LNA-miR-197 treatment in PC14CDDP cells. FIG. 5A shows the results of qRT-PCR analysis of PD-L1 mRNA levels in cells transfected with pre-miR-197 or LNA-miR-197. The column for each cell in the graph shows the results of NC, pre-miR-197, LNA-NC, and LNA-miR-197 from the left. FIG. 5B shows the results of flow cytometry (FCM) analysis of PD-L1 expression induced by miR-197 knockdown or overexpression in PC14 or PC14CDDP cells. FIG. 5C shows the results of qRT-PCR analysis of PD-L1 mRNA levels in lung tumors of a cohort study. FIG. 5D shows FCM cell sorting to purify PD-L1 ^high and PD-L1 ^low cells from PC14CDDP cells, after transfection of pre-miR-197 into PD-L1 ^high and PD-L1 ^low cells. IC ₅₀ (CDDP or TXL). In each graph, the columns at both ends show the results for PD-L1 ^high cells, and the center column shows the results for PD-L1 ^low cells. FIG. 5E shows the relationship between miR-197 expression and survival in a validation cohort study (P = 0.0149, n = 177). FIG. 5F shows a scatter plot between miR-197 and PD-L1 expression (P = 0.026, n = 177). FIG. 5G is an explanatory diagram of a novel signaling pathway for cancer progression and drug resistance in NSCLC. The miR-197 / CKS1B / STAT3 pathway controls not only various oncogenic genes, but also PD-L1 as a putative biomarker for this signaling. FIG. 6A is an explanatory diagram of statistical analysis of miRNA microarrays in a cohort test. FIG. 6B shows Kaplan-Meier curves showing the correlation between miR-197 or miR-1260 and overall survival (miR-197; P = 0.014, miR-1260; P = 0.037). The median miRNA expression was used to distinguish between high (High) and low (Low) patients. FIG. 7A shows representative images and quantification results of cells grown in the 3D spheroid assay. In the graph, for A549 and PC14 cells, the left column shows the results of negative control cells (TuD-NC), the right column shows the results of miR-197-TuD-expressing cells (miR-197-TuD), and the PC14CDDP cells The left column shows the result of the negative control cell (Vector), and the right column shows the result of the miR-197 overexpressing cell (miR-197). The scale bar is 100 mm. FIG. 7B shows the results of qRT-PCR analysis of the expression of lung cancer initiation-related genes in PC14-miR-197-TuD cells and PC14CDDP-miR-197 cells. In the upper graph, the left column for each gene shows the results for PC14-miR-197-TuD cells, and the right column shows the results for negative control cells. In the lower graph, the left column for each gene shows the results for PC14CDDP-miR-197 cells, and the right column shows the results for negative control cells. Experiments were performed at least three times with similar results. Error bars indicate mean ± SD. FIG. 8 is an explanatory diagram of miR-197 target candidate prediction. Two types of algorithms and in silico database were used for predictive analysis. FIG. 9A shows the putative target site of miR-197 in the 3′UTR of CTNND1, ERLIN2, CKS1B, and CEP55, and the sequence of the 3′UTR variant. FIG. 9B shows the results of a luciferase reporter assay in A549 cells co-transfected with pre-miR-197 and wild type (Wt) or mutant (Mut) psiCHECK2 ™ vectors for each gene. In the graph, the column for each gene shows the results of Wt + NC, Wt + pre-miR-197, Mut + NC, and Mut + pre-miR-197 from the left. Experiments were performed at least three times with similar results. Error bars indicate mean ± SD. FIG. 10 shows the results of Western blot analysis of targets downstream of CKS1B after CKS1B knockdown. Experiments were performed at least three times with similar results. FIG. 11 shows the results of FCM analysis of PD-L1 levels in A549, PC14, and PC14CDDP cells. Experiments were performed at least three times with similar results. FIG. 12 shows a scatter plot between intratumoral PD-L1 and plasma miR-197 in NSCLC patients.

1. Pharmaceutical composition of the present invention
miRNA is a non-coding RNA of about 20-25 bases and is involved in regulation of gene expression. miRNAs are generated from genes present on the genome that are transcribed into miRNA precursors. First, the primary transcript pri-miRNA is transcribed from the gene, and then the pri-miRNA is processed in the nucleus by RNase III called Drosha to produce a pre-miRNA having a hairpin structure of about 70 bases. . Thereafter, the pre-miRNA is transported to the cytoplasm and processed by RNase III called Dicer to produce a mature miRNA of about 20-25 bases.

  In the present specification, the “precursor” of miRNA means both the pri-miRNA and the pre-miRNA. That is, “the precursor of miR-197” means both the pri-miRNA and pre-miRNA of miR-197. In the present specification, the pri-miRNA and pre-miRNA of miR-197 are also described as “pri-miR-197” and “pre-miR-197”, respectively. “Pri-miR-197” and “pre-miR-197”, when administered to a living body, are processed in vivo as described above to produce miR-197 and exert the same function as miR-197.

式（I）

pri-miR-197：ggcugugccggguagagagggcagugggagguaagagcucuucacccuucaccaccuucuccacccagcauggcc（配列番号４）
Examples of miR-197, pre-miR-197, and pri-miR-197 sequences are shown below, but are not limited thereto. In addition, pre-miR-197 may be a sequence including miR-197, and pri-miR-197 may be a sequence including pre-miR-197.

miR-197: uucaccaccuucuccacccagc (SEQ ID NO: 1)

pre-miR-197: cggguagagagggcagugggagguaagagcucuucacccuucaccaccuucuccacccagc (SEQ ID NO: 2); or
A precursor having the secondary structure of the following formula (I) by uucaccaccuucuccacccagc (SEQ ID NO: 1) and cggguagagagggcagugggagg (SEQ ID NO: 3)

Formula (I)

pri-miR-197: gggugugccggguagagagggcagugggagguaagagcucuucacccuucaccaccuucuccacccagcauggcc (SEQ ID NO: 4)

  As used herein, a “mutant” of miR-197 or a precursor thereof includes the miR-197, pri-miR-197, or pre-miR-197 sequence and 60%, 70%, 80%, 85% , 90%, or 95% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, and RNA molecules that retain miR-197 function are included. . “Sequence identity” is determined by comparing two sequences that are optimally aligned over the entire region of the sequence to be compared. Here, the sequence to be compared may have an addition or a deletion (for example, a gap) in the optimal alignment of the two sequences. Sequence identity can be calculated using programs such as FASTA, BLAST, CLUSTAL W, etc. provided in public databases (for example, DDBJ (http://www.ddbj.nig.ac.jp)). Alternatively, it can be determined using commercially available sequence analysis software (for example, Vector NTI (registered trademark) software, GENETYX (registered trademark) ver. 12). The “mutant” of miR-197 or a precursor thereof includes one to several, preferably 1 to 3, in the sequence of miR-197, pri-miR-197, or pre-miR-197. Included are RNA molecules that have sequences with base deletions, substitutions, insertions or additions and that retain the function of miRNA-197. In the present specification, “miR-197 or a precursor thereof, or a variant thereof” is also referred to as “miRNA of the present invention”.

  The miRNA of the present invention can be synthesized using a known method. The nucleic acid constituting the miRNA of the present invention may be a natural nucleic acid or a non-natural nucleic acid such as a nucleic acid derivative with improved stability. Examples of nucleic acid derivatives include methyl phosphonate, phosphorothioate, phosphorodithioate, phosphoramidate, phosphotriester, sulfone, siloxane, carbonate, carboxymethyl ester, acetamidate, carbamate, thioether, cross-linked phosphoramidate, cross-linked type Nucleic acids containing internucleoside linkages of methylene phosphonate, bridged phosphorothioate, dimethylene-sulfide, dimethylene-sulfoxide, dimethylene-sulfone, 2'-O-alkyl, or 2'-deoxy-2'-fluorophosphorothioate, LNA (Locked Nucleic Acid ), ENA (2′-O, 4′-C-Ethylene-bridged Nucleic Acid). Nucleic acid derivatives also include nucleic acids containing 2 ′ or 3 ′ sugar modifications, such as 2′-O-methyl (2′-O-Me) ylated nucleotides or 2′-deoxynucleotides, or 2′-fluoro, difluorotoluyl. , 5-Me-2'-pyrimidine, 5-allylamino-pyrimidine, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2 ' -ON-Methylacetamide (2'-O-NMA), 2'-O-dimethylaminoethyloxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-dimethylaminopropyl (2′-O-AP), 2′-hydroxy nucleotide, phosphorothioate, 4′-thionucleotide, 2′-O-trifluoromethyl nucleotide, 2′-O-ethyl-trifluoromethoxy nucleotide, Nucleic acids containing 2'-O-difluoromethoxy-ethoxy nucleotides, or 2'-ara-fluoro nucleotides, and the like are included.

  The pharmaceutical composition of the present invention contains a DNA encoding the miRNA of the present invention, and may contain a vector that expresses the miRNA of the present invention in vivo. The vector may be a viral vector or a non-viral vector. Examples of the viral vector include vectors derived from adenovirus, adeno-associated virus (AAV), retrovirus, Sendai virus, lentivirus, vaccinia virus, chicken pox virus, papova virus typified by SV40, and the like. Preferably, the vector is a virus derived from an adenovirus or an adeno-associated virus. Examples of non-viral vectors include vectors having Pol I promoter, Pol II promoter, Pol III promoter, bacteriophage (RNA polymerase recognition sequence of T4 phage or T7 phage), and the like. Pol II promoters include CMV promoter and β-globulin promoter, and Pol III promoters include U6 promoter, H1 promoter, tRNA promoter, 7SK promoter, 7SL promoter, Y3 promoter, 5S rRNA promoter, Ad2 VAI and VAII promoter Is exemplified. Vectors having these promoters are commercially available and can be easily obtained.

  The miRNA and vector of the present invention may be administered to a patient as they are, and may be administered using liposomes, atelocollagen, self-assembling peptides, nanoparticles, cationic polymers, dendrimers, and the like as carriers. Examples of the liposome include N- [2,3- (dioleoyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA), dioleoylphosphatidylethanolamine (DOPE), and the like. The miRNA and the vector of the present invention may be administered as a conjugate with cholesterol or an antibody. Examples of the administration method include oral administration and parenteral administration, but parenteral administration is preferred. Examples of parenteral administration include intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, mucosal administration, and rectal administration. In addition to the miRNA or vector of the present invention, the pharmaceutical composition of the present invention comprises a pharmaceutically acceptable carrier (for example, sterile water, physiological saline, etc.), a stabilizer (for example, a nuclease inhibitor, etc.), a chelating agent (for example, For example, EDTA), and other auxiliaries.

The dosage and administration frequency of the pharmaceutical composition of the present invention can be appropriately determined in consideration of the purpose of use, patient age, weight, sex, medical history, severity of disease, type of active ingredient, and the like. . For example, in the case of miRNA, the dosage is 1.0 μg / kg to 1.0 g / kg, preferably 10 μg / kg to 100 mg / kg per adult. In the case of a viral vector, the final titer of the virus is 10 ⁷ to 10 ¹³ pfu / mL, preferably 10 ⁹ to 10 ¹² pfu / mL. The frequency of administration is, for example, once a day to once every several months.

  PD-1 inhibitors exert a therapeutic effect on PD-L1-related diseases including cancer by inhibiting the interaction between PD-1 and its ligand PD-L1. On the other hand, the present inventors have found that miR-197 suppresses the expression of PD-L1 in cancer cells. Therefore, the pharmaceutical composition containing the miRNA or vector of the present invention can treat cancer by suppressing PD-L1 expression and inhibiting signal transduction from PD-1 and PD-L1. In certain embodiments, the cancer is a PD-L1 positive cancer. In another embodiment, the cancer is a cancer in which a decrease in miR-197 or its precursor is observed in a patient's cancer tissue or blood. As described later, miR-197 or its precursor in cancer tissue or blood can be measured by qRT-PCR method, microarray method or the like.

  Specific cancers include lung cancer (eg, non-small cell lung cancer), melanoma (eg, metastatic malignant melanoma), renal cancer (eg, clear cell carcinoma), prostate cancer (eg, hormone refractory prostate adenocarcinoma) , Colon cancer (eg colon cancer), breast cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or intraorbital malignant melanoma, uterine cancer, ovarian cancer, anal cancer, stomach cancer, testicular cancer, uterine cancer, egg Ductal carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma (eg, diffuse large B-cell lymphoma, follicular lymphoma), esophageal cancer, small intestine cancer, endocrine Systemic cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, hepatocellular carcinoma, acute myeloid leukemia, chronic myelogenous leukemia, acute lymph Blastic leukemia, chronic or acute leukemia including chronic lymphocytic leukemia, childhood solid cancer, lymphocytic lymphoma, bladder cancer, renal or ureteral cancer, renal pelvic carcinoma, central nervous system (CNS) tumors (eg, glial Blastoma), primary CNS lymphoma, tumor angiogenesis, spinal tumor, brainstem glioma, pituitary adenoma, caposhi sarcoma, squamous cell carcinoma, squamous cell carcinoma, T cell lymphoma, asbestos-induced cancer Is done. The cancer is preferably lung cancer, melanoma, renal cancer, prostate cancer, esophageal cancer, head and neck cancer, glioblastoma, diffuse large B cell lymphoma, follicular lymphoma, chronic myelogenous leukemia, hepatocellular carcinoma, breast cancer Stomach cancer, pancreatic cancer, bladder cancer and colon cancer, more preferably non-small cell lung cancer.

  The pharmaceutical composition of the present invention can be used in combination with other anticancer agents. Examples of the anticancer agent used in combination include alkylating agents (cyclophosphamide, ifosfamide, thiotepa, melphalan, busulfan, nimustine hydrochloride, ranimustine, dacarbazine, procarbazine hydrochloride, temozolomide, etc.), platinum preparations (for example, cisplatin, carboplatin, Nedaplatin, oxaliplatin, etc.), antimetabolites (eg, methotrexate, pemetrexed, fluorouracil, tegafur, doxyfluridine, capecitabine, cytarabine, enocitabine, gemcitabine hydrochloride, mercaptopurine, fludarabine phosphate, pentostatin, cladribine, hydroxyurea, etc.) Neoplastic antibacterial drugs (eg, doxorubicin hydrochloride, epirubicin, daunorubicin, idarubicin hydrochloride, pirarubicin, mitoxantrone hydrochloride Amrubicin hydrochloride, actinomycin D, bleomycin, pepromycin sulfate, mitomycin C, aclarubicin, dinostatin, etc., microtubule inhibitors (eg, vincristine, vindesine, vinblastine, vinorelbine, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (eg, irinotecan, Topotecan, etoposide, etc.), hormone therapy (eg prednisolone, dexamethasone, tamoxifen, toremifene, medroxyprogesterone acetate, anastrozole, exemestane, letrozole, goserelin acetate, leuprorelin acetate, flutamide, bicalutamide, estramus phosphate Tin, phosfestol, chlormadinone acetate, mepithiostan, methyltestosterone, etc.), immunostimulants (for example, , Interferon α, interferon α-2a, interferon α-2b, interferon β, interferon γ-1a, interferon γ-n1, picibanil, krestin, GVAX, etc.), molecular target drugs (eg, trastuzumab, rituximab, imatinib, gefitinib, gem Tuzumab ozogamicin, bortezomib, erlotinib, cetuximab, bevacizumab, sunitinib, sorafenib, dasatinib, panitumbab, pegaptanib, batalanib, ranibitumab, SU-6268, SU-11248, neobastabetum Examples include immune checkpoint inhibitors (nivolumab, ipilimumab, etc.) and the like. The pharmaceutical composition of the present invention and the other anticancer agent may be contained in a single preparation or in another preparation. That is, the pharmaceutical composition of the present invention may further contain another anticancer agent in addition to the miRNA or vector of the present invention.

  The present inventors have found that miR-197 suppresses drug resistance of cancer cells. Therefore, the pharmaceutical composition containing the miRNA or vector of the present invention can be used for the treatment of drug-resistant cancer. Examples of drug-resistant cancer include alkylating agents (cyclophosphamide, ifosfamide, thiotepa, melphalan, busulfan, nimustine hydrochloride, ranimustine, dacarbazine, procarbazine hydrochloride, temozolomide, etc.), platinum preparations (for example, cisplatin, carboplatin, nedaplatin) , Oxaliplatin, etc.), antimetabolites (eg, methotrexate, pemetrexed, fluorouracil, tegafur, doxyfluridine, capecitabine, cytarabine, enocitabine, gemcitabine hydrochloride, mercaptopurine, fludarabine phosphate, pentostatin, cladribine, hydroxyurea, etc.) Antibacterial agents (eg, doxorubicin hydrochloride, epirubicin, daunorubicin, idarubicin hydrochloride, pirarubicin, mitoxantrone hydrochloride, hydrochloric acid Murubicin, actinomycin D, bleomycin, pepromycin sulfate, mitomycin C, aclarubicin, dinostatin, etc., microtubule inhibitors (eg, vincristine, vindesine, vinblastine, vinorelbine, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (eg, irinotecan, topotecan) ), Hormone therapy (eg prednisolone, dexamethasone, tamoxifen, toremifene, medroxyprogesterone acetate, anastrozole, exemestane, letrozole, goserelin acetate, leuprorelin acetate, flutamide, bicalutamide, estramustine phosphate , Phosfestol, Chlormadinone acetate, Mepithiostan, Methyltestosterone, etc.), immunostimulants (for example, Terferon α, interferon α-2a, interferon α-2b, interferon β, interferon γ-1a, interferon γ-n1, picibanil, krestin, GVAX, etc.), molecular target drugs (eg, trastuzumab, rituximab, imatinib, gefitinib, gemts Zumabu ozogamicin, bortezomib, erlotinib, cetuximab, bevacizumab, sunitinib, sorafenib, dasatinib, panitumbab, pegaptanib, batalanib, ranibitumab, SU-6668, SU-11248, neovastat, rimde Examples include cancer resistant to anticancer agents such as checkpoint inhibitors (nivolumab, ipilimumab, etc.). Preferably, the drug resistant cancer is a cancer resistant to cisplatin or paclitaxel. In addition, the pharmaceutical composition of the present invention is an anticancer agent causing drug resistance, such as an alkylating agent (cyclophosphamide, ifosfamide, thiotepa, melphalan, busulfan, nimustine hydrochloride, ranimustine, dacarbazine, procarbazine hydrochloride, temozolomide, etc.) , Platinum preparations (eg, cisplatin, carboplatin, nedaplatin, oxaliplatin, etc.), antimetabolites (eg, methotrexate, pemetrexed, fluorouracil, tegafur, doxyfluridine, capecitabine, cytarabine, enocitabine, gemcitabine hydrochloride, mercaptopurine, pentofludarabine phosphate Statins, cladribine, hydroxyurea, etc.), antitumor antibacterial drugs (eg, doxorubicin hydrochloride, epirubicin, daunorubicin, idarubicin hydrochloride, pyra Bicine, mitoxantrone hydrochloride, amrubicin hydrochloride, actinomycin D, bleomycin, pepromycin sulfate, mitomycin C, aclarubicin, dinostatin, etc., microtubule inhibitors (eg, vincristine, vindesine, vinblastine, vinorelbine, paclitaxel, docetaxel, etc.), topoisomerase Inhibitors (eg, irinotecan, topotecan, etoposide, etc.), hormone therapy agents (eg, prednisolone, dexamethasone, tamoxifen, toremifene, medroxyprogesterone acetate, anastrozole, exemestane, letrozole, goserelin acetate, leuprorelin acetate, flutamide , Bicalutamide, estramustine phosphate, phosfestol, chlormadinone acetate, mepithiostane, methyl test Teron, etc.), immunostimulants (eg, interferon α, interferon α-2a, interferon α-2b, interferon β, interferon γ-1a, interferon γ-n1, picibanil, krestin, GVAX, etc.), molecular targeted drugs (eg, Trastuzumab, rituximab, imatinib, gefitinib, gemtuzumab ozogamicin, bortezomib, erlotinib, cetuximab, bevacizumab, sunitinib, sorafenib, dasatinib, panitumbab, pegaptanib, pegaptanib, U , Temsirolimus, everolimus, sirolimus, etc.), immune checkpoint inhibitors (nivolumab, ipilimumab, etc.), especially cisplatin or paclitaxe Suitable for use in combination with anticancer agents such as The pharmaceutical composition of the present invention can be used in combination with other anticancer agents both for cancer that has not acquired drug resistance and for drug-resistant cancer.

2. Method for assessing susceptibility to treatment with PD-1 inhibitor The method of the present invention is a method for assessing susceptibility to treatment with a PD-1 inhibitor in patients with PD-L1-related diseases, comprising:
(I) measuring miR-197 levels in a biological sample taken from said patient; and
(Ii) when the miR-197 level is lower than a reference value, the patient evaluates that the patient is highly sensitive to treatment with a PD-1 inhibitor;
including.

  The PD-1 inhibitor inhibits the interaction between PD-1 and its ligand PD-L1, and inhibits signal transduction from PD-1 and PD-L1. Examples of PD-1 inhibitors include anti-PD-1 antibodies (nivolumab, pembrolizumab, ANA-011, MEDI-0680, etc.), anti-PD-L1 antibodies (MSB-0010718C, MEDI-4736, MPDL-3280A, MDX-1105 Etc.), B7-DC Fc (AMP224 etc.) and the like. The PD-1 inhibitor is preferably an anti-PD-1 antibody or an anti-PD-L1 antibody, and more preferably an anti-PD-1 antibody.

  Anti-PD-1 antibody inhibits the interaction between PD-1 and its ligand PD-L1 and inhibits signal transduction from PD-1 and PD-L1, thereby treating PD-L1-related diseases An effect is demonstrated (patent document 1). Examples of PD-L1-related diseases include cancer, infectious diseases, and diseases that are treated by induction of an immune response against self-antigens.

  In certain embodiments, the cancer is a PD-L1 positive cancer. In another embodiment, the cancer is a cancer in which a decrease in miR-197 or its precursor is observed in a patient's cancer tissue or blood. Specific cancers include lung cancer (eg, non-small cell lung cancer), melanoma (eg, metastatic malignant melanoma), renal cancer (eg, clear cell carcinoma), prostate cancer (eg, hormone refractory prostate adenocarcinoma) , Colon cancer (eg colon cancer), breast cancer, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, skin or intraorbital malignant melanoma, uterine cancer, ovarian cancer, anal cancer, stomach cancer, testicular cancer, uterine cancer, egg Ductal carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma (eg, diffuse large B-cell lymphoma, follicular lymphoma), esophageal cancer, small intestine cancer, endocrine Systemic cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, hepatocellular carcinoma, acute myeloid leukemia, chronic myelogenous leukemia, acute lymph Blastic leukemia, chronic or acute leukemia including chronic lymphocytic leukemia, childhood solid cancer, lymphocytic lymphoma, bladder cancer, renal or ureteral cancer, renal pelvic carcinoma, central nervous system (CNS) tumors (eg, glial Blastoma), primary CNS lymphoma, tumor angiogenesis, spinal tumor, brain stem glioma, pituitary adenoma, Kaposi sarcoma, squamous cell carcinoma, squamous cell carcinoma, T cell lymphoma, asbestos-induced cancer Is done. The cancer is preferably lung cancer, melanoma, renal cancer, prostate cancer, esophageal cancer, head and neck cancer, glioblastoma, diffuse large B cell lymphoma, follicular lymphoma, chronic myelogenous leukemia, hepatocellular carcinoma, breast cancer Stomach cancer, pancreatic cancer, bladder cancer and colon cancer, more preferably non-small cell lung cancer.

  Infectious diseases include HIV, hepatitis (A, B or C), herpes virus (eg, VZV, HSV-1, HAV-6, HSV-II, and CMV, Epstein Barr virus), adenovirus, influenza virus, Flavivirus, Echovirus, Rhinovirus, Coxsackie virus, Coronavirus, Respiratory polynuclear virus, Mumps virus, Rotavirus, Measles virus, Rubella virus, Parvovirus, Vaccinia virus, HTLV virus, Dengue virus, Papillomavirus, Soft genera Pathogenic viruses such as oma virus, poliovirus, rabies virus, JC virus and arbovirus encephalitis virus; Chlamydia, rickettsia bacteria, mycobacteria, staphylococci, streptococci, pneumococcus, meningococci and conococcus Pathogens such as Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Neisseria gonorrhoeae, cholera, Tetanus, Botulism, carbon fungus, plague, restospiosis, and Lyme disease; Candida (albicans, crusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspargillus (Fumigatus, Nigel, etc.), Mucorales (mucor, Absdia, Rhizophas), Sporothrix schenki, Blast myces del matichidis, Paracocchioides brush reensis, Cocciodiides imimitis And pathogenic fungi such as Histoplasma capsatum; and Shigella amoeba parasite, colonic barantidium, Naegleria faureri, Acanteamoeba species, Giardia lambia, Chestnut Listed are infectious diseases caused by pathogenic parasites such as Tospodium species, Pneumocystis carini, Plasmodium vivacs, Babesia microchis, Trypanosoma brucei, Cruz trypanosomes, Ryusmania adnovani, Toxiplasma gondii, and Brazilian helminths It is done.

  Diseases that can be treated by inducing an immune response to self-antigens include Alzheimer's disease with inappropriate accumulation of Aβ protein in brain amyloid deposits, allergic diseases with overproduction of IgE, asthma, and overproduction of TNFα. Examples include rheumatoid arthritis.

  As the biological sample, a cancer tissue sample and a blood sample can be used. A cancer tissue sample is, for example, a cancer tissue sample obtained by surgical excision or biopsy of a tumor. Blood samples include whole blood, plasma, and serum samples. The biological sample can be collected from the patient by a known method. Preferably, the biological sample is taken from the patient prior to receiving treatment with a PD-1 inhibitor (preferably an anti-PD-1 antibody).

  To measure miR-197 levels, total RNA is extracted from biological samples collected from patients. The miR-197 level is measured by using primers and / or probes designed based on the nucleotide sequence of miR-197, for example, by qRT-PCR, microarray method, next-generation sequencer method, single molecule sequencing method, etc. can do. The miR-197 measured in the method of the present invention includes a sequence in which a base has been deleted, substituted, or added due to a naturally occurring mutation in addition to the sequence having the sequence shown in SEQ ID NO: 1. It also includes miR-197.

  The qRT-PCR method uses a primer set that can amplify the sequence of miR-197, and uses a fluorescent probe such as a method using SYBR (registered trademark) Green I, a cycling probe method or a TaqMan (registered trademark) probe method. The method used is exemplified. The miR-197 level can also be measured using a commercially available kit such as TaqMan® MicroRNA Assay (has-miR-197-3p, cat # 4427975).

  The kit of the invention comprises a primer set (and optionally a fluorescent probe) or probe for measuring miR-197 levels in a biological sample taken from a patient. In addition to the primer set or the probe, the kit of the present invention may further contain, for example, a reagent used for RNA extraction from a biological sample, RNA labeling, hybridization, washing, and the like.

  The measured miRNA level is compared to a reference value. The reference value is, for example, in a patient group, the PD-L1 level in the patient's cancer tissue sample, and the PD-1 inhibitor (preferably, the patient's PD-1 inhibitor evaluated by survival or RECIST (Response Evaluation Criteria in Solid Tumors)) From the correlation with sensitivity to treatment with (anti-PD-1 antibody), obtain a lower limit of PD-L1 level that is evaluated to be highly sensitive to treatment with PD-1 inhibitor (preferably anti-PD-1 antibody) Next, from the correlation between the PD-L1 level in the patient's cancer tissue sample and the miR-197 level in the patient's biological sample, the miR-197 level corresponding to the lower limit of the PD-L1 level is obtained. Can be determined. A patient is assessed as being more sensitive to treatment with a PD-1 inhibitor (preferably an anti-PD-1 antibody) if the miR-197 level in the biological sample of the subject patient is lower than a reference value.

  The method of the present invention can be used for predicting the therapeutic effect of a PD-1 inhibitor, selecting patients to be treated with a PD-1 inhibitor, and the like.

  The invention is further illustrated by the following examples, which are not intended to limit the invention in any way.

1. Methods Clinical Lung Cancer Sample The study protocol was approved by the Institutional Review Board of the National Cancer Center (No. 2012-054). All materials were obtained with written consent and were provided by the National Cancer Center Biobank. All human lung tissue samples were obtained from isolated lungs of patients with lung cancer who relapsed after lung resection during respiratory surgery in the National Cancer Center Hospital between 1997 and 2010. 29 lung cancer tissue samples and corresponding normal lung tissue were selected for miRNA microarray analysis according to the clinical database obtained from the National Cancer Center Hospital's Respiratory Medicine and 177 for the validation cohort study. Of lung cancer tissue samples were selected (Tables 1 and 2). In this study, patients diagnosed with non-small cell lung cancer (NSCLC) (adenocarcinoma or squamous cell carcinoma) were enrolled. After removing the surgical specimen, the researchers immediately transported the tissue to the biobank. Tissues were stored at −80 ° C. after immediate freezing in liquid nitrogen. All tumors were reviewed by a pathologist and pathologically diagnosed according to the WHO tumor classification.

Chemotherapy response in clinical lung cancer samples Tumor chemotherapy response to platinum-based chemotherapy was clinically evaluated according to RECIST (Response Evaluation Criteria in Solid Tumors) as follows: 1) Complete response (CR), Elimination of all existing diseases; 2) Partial response (PR), reduction of systemic tumor tissue volume by 30% or more; 3) Disease stability (SD), reduction of systemic tumor tissue volume by less than 30% or less than 20% Increase; and 4) disease progression (PD), more than 20% increase in systemic tumor tissue mass or the appearance of new lesions. In this study, CR and PR patients were included in the response group, and PD patients were included in the non-response group. After recurrence, platinum-based chemotherapy was performed for at least 4 cycles. None of the patients received adjuvant chemotherapy after a radical resection.

Cell Culture Human lung cancer cell lines A549, PC9, PC14, H226, H358, and H69, and the human bronchial epithelial cell line BEAS-2B were purchased from ATCC (Manassas, USA). PC9CDDP, PC14CDDP (Non-patent Document 24), and H69TXL were provided by the National Cancer Center's Supporting Lab. These cells were maintained in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum (FBS) and Antibiotic-Antimycotic (Invitrogen) at 37 ° C., 5% CO ₂ .

RNA extraction, qRT-PCR, and microarray analysis Total RNA was extracted from cultured cells or human lung using QIAzol® and miRNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. All clinical samples exhibited RIN (RNA Integrity Number)> 6.0. The method of qRT-PCR is as already reported (Non-patent Document 25). All reactions were performed in triplicate. Hsa-miR-197, internal standard RNU6B, RNU44 TaqMan® qRT-PCR kit, human CKS1B, human PD-L1, and human β-actin TaqMan® Gene Expression Assay purchased from Applied Biosystems did. SYBR® Green I qRT-PCR was performed to normalize variations in cDNA levels using the β-actin housekeeping gene. All primer sequences are shown in Table 3. To detect miRNA in lung tissue by microarray, 500 ng of total RNA is labeled and hybridized to 3D-Gene (registered trademark) miRNA Oligo chip (Ver. 17.0) (Toray Industries, Inc.) according to the manufacturer's instructions did. Hybridization signals were detected using 3D-Gene (registered trademark) Scanner 3000 (Toray Industries, Inc.), and the scanned images were analyzed using 3D-Gene (registered trademark) extraction software (Toray Industries, Inc.). To detect intracellular mRNA, 100 ng of total RNA was labeled and hybridized using a SurePrint G3 Human GE v2 8x60K Microarray (Agilent Technologies) according to the manufacturer's instructions. Hybridization signals were detected using a DNA microarray scanner (Agilent Technologies).

Cell survival test
Cell Countign Kit-8 (CCK-8) (Dojindo Laboratories, Inc.) was used for the cell survival test. 3000 cells per well were seeded in a 96 well plate. The next day, the cells were supplemented with fresh medium containing each miRNA or siRNA (25 nM). The cells were used for cell proliferation or cytotoxicity tests. For cell proliferation studies, 10 μl of CCK-8 solution was added to each well after 24, 48, 72, 96, and 120 hours and further incubated at 37 ° C. for 4 hours. Absorbance at 450 nm was measured using Envision (PerkinElmer). For cytotoxicity testing, the medium was aspirated the next day and replaced with fresh medium containing various concentrations of CDDP or TXL. After 3 days of culture, CCK-8 solution (10 μl) was added to each well and further incubated at 37 ° C. for 4 hours. Absorbance at 450 nm was measured using Envision (PerkinElmer). Cell viability was expressed as a percentage of control (untreated) cell values. For each concentration of CDDP and TXL, the average of the average absorbance from 8 wells was calculated. IC ₅₀ (drug concentration required to inhibit cell growth by 50%) was determined from the dose-response curve for each cell line. Each experiment was performed three times independently.

Cell Invasion and Migration Test For the transwell migration test, 50,000 cells were set in the top chamber of each insert (pore size 8 μm; BD Biosciences, Franklin Lakes, NJ) that was not coated with Matrigel. For invasion studies, 1 × 10 ⁵ cells were set on the chamber above each insert in a 24-well BioCoat ™ Matrigel® Invasion Chamber (8 μm pore size; BD Biosciences). In both studies, cells were trypsinized and resuspended in RPMI 1640. Medium (750 μl) supplemented with 10% FBS was injected into the lower chamber. In migration and invasion studies, A549, PC14, and PC14CDDP were incubated at 37 ° C. for 24 hours. Cells remaining in the top chamber or membrane above the insert were then carefully collected. Cells that passed through the membrane and adhered to the lower surface of the membrane were fixed with methanol and stained by Diff-Quick staining. For quantification, cells were counted under a microscope in 4 random fields. All tests were performed in triplicate.

Immunoblot analysis
SDS-PAGE gels were calibrated using Precision Plus ProteinTM Standard (161-0375) (Bio-Rad, Hercules, CA), anti-CKS1B (1: 200), anti-STAT3 (1: 1000), anti- p-STAT3 (1: 2000), anti-PD-L1 (1: 1000), anti-Bcl-2 (1: 200), anti-c-Myc (1: 1000), anti-cyclin D1 (1: 200), and anti-cyclin Actin (1: 1,000) antibody was used as the primary antibody. Two types of secondary antibodies (peroxidase-labeled anti-mouse antibody and anti-rabbit antibody) were used at a dilution of 1: 10,000.

FCM analysis and cell sorting Cells were suspended in culture medium and subjected to a FACSAria ™ II cell sorter (BD Biosciences) for FCM analysis and cell sorting. At least 1 million cells are precipitated by centrifugation (180 xg, 5 min, 4 ° C) and 20 μl of monoclonal mouse anti-human PD-L1-APC antibody (eBioscience) or monoclonal mouse IgG1 K isotype control APC antibody (eBioscience) was resuspended and incubated for 30 minutes at 4 ° C. Three independent experiments were performed.

Animal tests Animal experiments were performed according to the guidelines of the laboratory animal research institute of the National Cancer Center Research Institute (No. T12-004). Male CB-17 / Icr-scid / scidJcl mice (CLEA Japan, Inc.) 6-7 weeks old were used for the experiment. Intrathoracic injection was performed by slightly modifying the reported method (Non-patent Document 7). Mice received 150 mg / kg D-luciferin (Promega) by intraperitoneal injection for in vivo imaging. After 10 minutes, the photon amount from the whole animal was measured by measuring bioluminescence using the IVIS Imaging System (Xenogen, Alameda, CA) according to the manufacturer's instructions. Data was analyzed using LIVINGIMAGE® 4.2 software (Xenogen). The development of lung cancer was observed in vivo by imaging bioluminescence twice a week. In a repeated dose study, 3 mg / kg of CDDP was treated on days 7, 14, and 21 (3 times, once a week for a total of 3 weeks). Data are representative of 3 independent experiments.

Statistical analysis All experiments were repeated at least 3 times and the results were expressed as mean ± SD. Statistical analysis was mainly performed using Student's t test. Analysis of miRNA microarray of clinical samples was performed using ANOVA. Pearson correlation was estimated between miR-197 and PD-L1. The Kaplan-Meier method was used to calculate survival as a function of time, and the difference in survival was analyzed by log rank test. All analyzes were performed using PASW statistics version 18.0 (IBM Inc., Armonk, NY) and STATA version 12.0 (Stata Corp, College Station, TX). A probability value <0.05 indicates a statistically significant difference.

2. result
Down-regulation of miR-197 in NSCLC is associated with drug resistance and survival.
To identify miRNAs that control drug resistance, high-throughput miRNA microarrays were performed in a cohort study of primary NSCLC tissues and adjacent normal tissues (FIG. 1A). 29 patients who received more than 4 courses of platinum-based chemotherapy, which is the first choice after postoperative recurrence, were divided into 2 groups [response group (n = 17) and non-response group (n = 12)] (Table 1). Results of statistical analysis of qRT-PCR results from these two groups of cancer tissues and adjacent normal tissues (FIG. 6A), five miRNAs (miR-197, miR-181c, miR-21, miR-210 and miR -1260) showed a significant expression change (FIG. 1B). To investigate the role of these miRNAs in lung cancer prognosis, we first examined their clinical relevance with patient survival. As a result, miR-197 and miR-1260 expression was identified as a suitable lung cancer prognostic marker for overall survival (FIG. 6B). Of these miRNAs presumed to be prognostic biomarkers, we focused on miR-197, a tumor suppressor miRNA, and used qRT-PCR for miR-197 in lung tumors and adjacent normal tissues in a cohort study. The findings were verified (Figure 1C). Analysis of miR-197 expression levels in a panel of human lung cancer cell lines reveals that miR-197 is significantly suppressed in lung cancer cell lines compared to normal bronchial cell line BEAS-2B became. Furthermore, it was observed that miR-197 expression in three drug resistant cell lines (PC9 / CDDP, PC14CDDP, and H69 / TXL) was lower than its parent lung cancer cell line (FIG. 1D).

  Similar to qRT-PCR analysis, in situ hybridization using miR-197-locked nucleic acid (LNA) probe resulted in miR-197 expression in the non-responding group compared to the non-responding group. It became clear that it was low (FIG. 1E). This suggests that miR-197 may functionally control the response to treatment in addition to its relationship with therapeutic effects. Therefore, focusing on the role of miR-197 in controlling drug resistance of NSCLC, to investigate whether miR-197 is involved in lung cancer progression and drug resistance, LNA-miR-, the antisense of miR-197 197 (miRCURY LNA® Power Inhibitor, product number 426907-00, EXIQON) (CTGGGTGGAGAAGGTGGTGA (SEQ ID NO: 5)) or pre-miR-197 (formula (I)) were added to four independent lung cancer cell lines (A549 , PC9, PC14, and PC14CDDP) Interestingly, knockdown of miR-197 induced significant resistance to CDDP and TXL in these four independent lung cancer cell lines. Furthermore, miR-197 overexpression enhanced sensitivity to these compounds in vitro (FIG. 1F).

Stable knockdown of miR-197 increases malignancy in vitro.
Since inhibition of miR-197 expression in NSCLC was shown, it was investigated to evaluate another role of this miRNA in vitro. Construction of a Tough Decoy (TuD) vector (Non-patent Document 6) that expresses miR-197-TuD used for miRNA inhibition to stabilize the expression of miR-197 in A549 and PC14 cells Suppressed. In addition, a PC14CDDP cell (PC14CDDP-miR-197) showing overexpression of miR-197 by the CMV promoter was established. A549-miR-197-TuD and PC14-miR-197-TuD cells have negative luciferase activity in the miR-197 sensor assay using psiCHECK2 ™ vector to confirm stable miRNA expression A significant increase was observed compared to the sensor vector, indicating that miR-197 expression was functionally suppressed in these cell lines. The luciferase activity of PC14CDDP-miR-197 cells was significantly reduced, indicating that miR-197 expression in these cells was functionally activated (FIG. 2A). The effects of miR-197 on cell proliferation, cell invasion, cell migration, and spheroid formation were then evaluated. Cell proliferation analysis suggested that decreased or increased miR-197 levels did not affect cancer cell proliferation (FIG. 2B). Conversely, miR-197 loss of function enhanced the invasion and migration rate of A549 and PC14 cells. PC14CDDP cells stably overexpressing miR-197 also showed suppressed invasion and migration rate compared to controls (FIGS. 2C and D). In addition, A549-miR-197-TuD, PC14-miR-197-TuD, and PC14CDDP-miR-197 cells were evaluated for tumor sphere-forming ability. A549-miR-197-TuD and PC14-miR-197-TuD produce 2-3 times more spheres than the corresponding control cells, and the spheroid formation of PC14CDDP-miR-197 cells is compared to control cells It was suppressed (FIG. 7A). PC14-miR-197-TuD cells expressed high levels of various lung cancer initiation-related genes, particularly ABC transporter genes. On the other hand, the expression of these genes was suppressed in PC14CDDP-miR-197 cells compared to control cells (FIG. 7B). These results suggested that miR-197 can regulate not only drug resistance but also malignant phenotype in lung cancer cells.

Effect of miR-197 on tumor formation, lung metastasis, and drug resistance in vivo To establish the role of miR-197 as a regulator of lung cancer progression in vivo, it was established by direct intrathoracic injection (left lung) in scid mice A lung cancer xenograft model (Non-Patent Document 7) was used to test the effect of PC14-miR-197-TuD on tumorigenesis and drug resistance. To facilitate monitoring of miRNA knockdown cells in vivo, PC14-miR-197-TuD or PC14-TuD-NC cells stably transfected with pLuc-Neo plasmid DNA were cloned. In the bioluminescence image, 28 days after transplantation, tumors formed from PC14-miR-197-TuD-luc cells were significantly increased compared to negative control cell transplanted mice (FIG. 3A). In particular, mice bearing PC14-miR-197-TuD-luc tumors showed marked lung metastases, but no visible metastases were observed in mice transplanted with control PC14-TuD-NC-luc cells. (FIG. 3B). Histological analysis also revealed that miR-197 knockdown could promote lung metastasis of this lung cancer cell line (FIG. 3C). Furthermore, the number of tumor nodules and lung weight were significantly increased in the miR-197 reduced group (FIGS. 3D and E). Next, to investigate whether miR-197 downregulation affects drug resistance of PC14 cells to CDDP in vivo, CDDP (3 mg / kg) was administered once a week after tumor initiation in scid mice. Injected intraperitoneally for 3 weeks (FIG. 3F). In the bioluminescence image, tumors formed from PC14-miR-197-TuD-luc mice (n = 10) 28 days after transplantation are compared with mice bearing PC14-TuD-NC-luc tumors (n = 10) Significantly increased (FIG. 3G). In addition, mice bearing PC14-miR-197-TuD-luc tumors showed a low survival rate (FIG. 3H; P = 0.0358). These results indicate that miR-197 plays a central role in cancer progression and drug resistance in vivo.

miR-197 directly targets CKS1B, a cyclin-dependent kinase.
miRNAs regulate gene expression by suppressing translation of their target genes or by promoting degradation. To identify the direct target gene of miR-197, we first performed mRNA microarray analysis of A549, PC14, and PC14CDDP cells transiently transfected with pre-miR-197 or LNA-miR-197 and their controls. went. In all three different lung cancer cell lines, 1037 genes predicted to be target genes were observed to show altered expression. Next, in order to identify the target gene of miR-197, a computer algorithm for predictive analysis was used (FIG. 8). Finally, five candidates are CTNND1 (Catenin delta-1), ERLIN2 (ER lipid raft associated 2), CKS1B (CDC28 protein kinase regulatory subunit 1B), CEP55 (Centrosomal protein of 55 kDa), and PD-L1 (Programmed cell death 1 ligand 1) was found and these 3 ′ untranslated regions (UTRs) were conjugated to luciferase for reporter assays. Among the 1037 genes predicted to be target genes, PD-L1 is one of the genes that is significantly controlled by miR-197 and does not have a predicted binding site in the 3′UTR of the computer database. The 3'UTR of CTNND1, ERLIN2, CKS1B, and CEP55 mRNA has a sequence complementary to the seed sequence of miR-197 (FIG. 9A). To examine whether CTNND1, ERLIN2, CKS1B, CEP55, and PD-L1 are direct targets of miR-197, each 3′UTR was cloned downstream of the luciferase ORF vector. In addition, 3′UTR site-directed mutagenesis was performed to confirm target specificity. When A549 cells were co-transfected with any of the 5 cloned UTRs and pre-miR-197, the CTNND1, ERLIN2, CKS1B, and CEP55 3'UTR luciferase activities were all reduced, but PD- No decrease was observed with L1 (FIG. 4A). On the other hand, luciferase activity did not change significantly even when the 3′UTR mutant was co-transfected with pre-miR-197 (FIG. 9B). Of these direct target genes, only CKS1B has been reported to control cell motility, drug resistance, and cancer progression (Non-Patent Documents 8-10). Because of its effect on drug resistance in lung cancer, CKS1B appears to be an important target for miR-197, and experiments were conducted to test this hypothesis. As a result, CKS1B expression was inhibited by pre-miR-197, and CRT1B expression was significantly increased by transient transfection of LNA-miR-197 in three lung cancer cell lines. Confirmed by PCR (Figure 4B). To investigate whether the biological function of miR-197 is associated with direct targeting of CKS1B signaling, CKS1B silencing based on small interfering RNA (siRNA) is performed, cell proliferation, drug resistance, Cells were evaluated for invasion and migration. Of note, knockdown of CKS1B by siRNA was observed to significantly reduce cell proliferation, invasion, and migration, and to enhance the responses of three lung cancer cell lines to CDDP and TXL. (FIGS. 4C-F). These results suggest that the main function of the miR-197 / CKS1B pathway in NSCLC is to control lung cancer progression and drug resistance.

PD-L1 expression is regulated by STAT3 as an important downstream target of the miR-197 / CKS1B signaling pathway.
miRNA microarray analysis shows that in lung cancer cells, miR-197 expresses PD-L1 (also called CD274 or B7-H1), a member of the B7 family of co-stimulatory / co-inhibitory ligands expressed in various tissues Control was observed (FIG. 8). From the results of the 3 ′ UTR assay, it was considered that miR-197 may indirectly target PD-L1. Therefore, the regulatory relationship between miR-197 and PD-L1 was examined. So far, it has been reported that a constitutive tumorigenic pathway induces PD-L1 expression through a STAT3 (Signal Tranducer and Activator of Transcription 3) signaling pathway in lymphoma cells (Non-patent Document 11). . Furthermore, STAT3 signaling is known to be a downstream target of CKS1B activation in multiple myeloma cells (Non-Patent Document 9). Considering that CKS1B regulates PD-L1 expression by activating STAT3, the effect of CKS1B regulation on PD-L1 was tested. As a result, knockdown of CKS1B with siRNA inhibited phosphorylation (p) -STAT3 (Tyr705) and PD-L1 protein expression, but no significant effect on STAT3 was observed in Western blot (FIG. 10). ). These data suggest that PD-L1 is an important downstream target of CKS1B activated by STAT3 in the miR-197 signaling pathway. To investigate the association between STAT3 and induction of PD-L1 expression, a PD-L1 reporter construct containing a promoter region was used to examine the ability of STAT3 to bind to the PD-L1 promoter. The 5 ′ sequence of PD-L1 (from −319 bp upstream to +56 bp downstream) contains a potential STAT3 binding site (TTCN2-4GAA) (Non-patent Document 12) (FIG. 4G). Co-transfection of STAT3-siRNA and PD-L1 promoter vector resulted in a 0.66 (± 0.1) -fold reduction in PD-L1 promoter-driven luciferase expression compared to control siRNA. Furthermore, LNA-miR-197 induced luciferase activity 1.58 (± 0.4) times higher than that of the negative control (FIG. 4G). That is, STAT3 showed strong binding with the PD-L1 gene promoter downstream of miR-197 down-regulation. As described above, Western blots detected increased CKS1B, p-STAT3, and PD-L1 levels downstream of miR-197 knockdown compared to negative control cells, but were prominent in STAT3 expression. No effect was observed. In addition, LNA-miR-197 is a general STAT3 transcription target gene, Bcl-2 (a typical anti-apoptotic factor), c-Myc (oncogenic transcription factor), and cyclin D1 (cell cycle regulation) Protein) up-regulation was induced (FIG. 4H). These results suggest that miR-197 is involved in tumorigenic activation of STAT3 through multiple targets by upregulation of CKS1B.

PD-L1 is a putative biomarker of miR-197 / CKS1B / STAT3 signaling.
Anti-PD-L1 antibodies are a significant breakthrough for patients with advanced solid tumors (Non-Patent Document 4). In particular, inhibition of PD-L1 induced sustained tumor regression and long-term disease stabilization in patients with advanced NSCLC. To investigate the role of PD-L1 in the miR-197-mediated signaling pathway in NSCLC, we investigated the expression of PD-L1 in lung cancer cell lines and lung cancer samples. As a result of confirming the specific regulation of PD-L1 expression by miR-197 by qRT-PCR analysis, pre-miR-197 showed a significant inhibitory effect on PD-L1 expression in A549 and PC14CDDP cells, and It was shown that LNA-miR-197 stimulates PD-L1 expression in lung cancer cell lines (FIG. 5A). FCM analysis revealed that the PD-L1 level in PC14CDDP cells was significantly higher than that of the parent PC14 cells (FIG. 11). Furthermore, PD-L1 expression in PC14 cells was significantly increased after miR-197 knockdown. In contrast, in FCM analysis, miR-197 overexpression induced a decrease in PD-L1 expression in PC14CDDP cells (FIG. 5B). To further investigate whether PD-L1 is a candidate drug resistance marker in NSCLC, compare PD-L1 mRNA levels in the cohort response group (n = 17) with those in the non-response group (n = 12) did. It was observed that PD-L1 expression was higher in non-responding group tumors compared to responding group tumors (FIG. 5C; P = 0.015). Next, cells with high PD-L1 expression (PD-L1 ^high ) and cells with low PD-L1 expression (PD-L1 ^low ) were isolated from PC14CDDP by FCM cell sorting, and PD-L1 We investigated whether the ^high fraction was associated with drug resistance regulated by miR-197-mediated signaling. PD-L1 ^high cells showed significant resistance to CDDP and TXL compared to PD-L1 ^low cells (FIG. 5D). Furthermore, transient transfection of pre-miR-197 enhanced the response of PD-L1 ^high cells to CDDP and TXL (FIG. 5D). These data suggest that PD-L1 has the ability to promote drug resistance and is a biomarker of the miR-197 / CKS1B / STAT3 pathway.

Importance of miR-197 and PD-L1 in the clinic To further understand the biological significance of miR-197 expression decreased in the progression of lung cancer, we experienced miR-197 expression profiles and recurrence after therapeutic resection. The correlation with overall survival in tumor samples from human NSCLC patients was evaluated (Table 2). miR-197 levels were measured by qRT-PCR and Kaplan-Meier analysis showed that decreased miR-197 expression levels were significantly correlated with worse overall survival (FIG. 5E; P = 0.0149) . Next, we investigated the relationship between miR-197 and the putative PD-L1 biomarker of this signaling pathway. Based on tumor data combining mRNA and miRNA expression profiles, a negative correlation was observed between miR-197 and PD-L1 expression (FIG. 5F; P = 0.026). These data suggest the existence of a signaling network linking miR-197 and its downstream target PD-L1, indicating the clinical significance of the miR-197 regulatory pathway in NSCLC (FIG. 5G).

Correlation between intratumoral PD-L1 and blood miR-197 Among patients who underwent radical surgery for NSCLC since June 2014 at the National Cancer Center, comprehensive consent was obtained and cancer A total of 6 patients with tissue samples (frozen samples) and preoperative plasma samples in the National Cancer Center Biobank were examined. Total RNA was extracted from cancer tissue samples and plasma samples using QIAzol® and miRNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The purity and concentration of the RNA samples were evaluated using NanoDrop ND-1000 (Thermo Scientific). The method of qRT-PCR is as already reported (Non-patent Document 25). PCR was performed in 96 well plates using the 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA). All reactions were performed in triplicate. TaqMan® qRT-PCR kit for hsa-miR-197 and hsa-miR-16 as internal standard, human PD-L1 and TaqMan® Gene Expression Assay for human β-actin were purchased from Applied Biosystems . Statistical analysis was performed in the same manner as in Example 1.

  Expression analysis of intratumoral PD-L1, intratumor miR-197, and plasma miR-197 (internal standard: miR-16) showed negative results between intratumoral PD-L1 and plasma miR-197 A correlation was observed (Figure 12).

SEQ ID NO: 1 miR-197
SEQ ID NO: 2: pre-miR-197
SEQ ID NO: 3: SEQ ID NO: 4: pri-miR-197 constituting pre-miR-197 of formula (I)
SEQ ID NO: 5: LNA-miR-197
Sequence number 6: Primer sequence number 7: Primer sequence number 8: Primer sequence number 9: Primer sequence number 10: Primer sequence number 11: Primer sequence number 12: Primer sequence number 13: Primer sequence number 14: Primer sequence number 15: Primer Sequence number 16: Primer sequence number 17: Primer sequence number 18: Primer sequence number 19: Primer sequence number 20: Primer sequence number 21: Primer sequence number 22: Primer sequence number 23: Primer sequence number 24: Primer sequence number 25: Primer Sequence number 26: Primer Sequence number 27: Primer sequence number 28: Primer sequence number 29: Primer

Claims (22)

  A pharmaceutical composition for treating cancer, comprising miR-197 or a precursor thereof, or a variant thereof, or a vector that expresses the miR-197, precursor or variant.   The pharmaceutical composition according to claim 1, comprising miR-197 or a precursor thereof.   The pharmaceutical composition according to claim 1 or 2, wherein the cancer is PD-L1-positive cancer.   The pharmaceutical composition according to claim 1 or 2, wherein the cancer is a cancer in which a decrease in miR-197 or a precursor thereof is observed in a cancer tissue or blood of a patient.   The pharmaceutical composition according to any one of claims 1 to 4, wherein the cancer is non-small cell lung cancer.   The pharmaceutical composition according to claim 1 or 2, wherein the cancer is a drug resistant cancer.   The pharmaceutical composition according to claim 6, wherein the drug-resistant cancer is a cancer resistant to cisplatin or paclitaxel.   The pharmaceutical composition according to claim 6 or 7, wherein the cancer is non-small cell lung cancer.   Furthermore, the pharmaceutical composition in any one of Claims 1-8 containing another anticancer agent.   The pharmaceutical composition according to any one of claims 1 to 8, which is used in combination with another anticancer agent.   The pharmaceutical composition according to claim 9 or 10, wherein the anticancer agent is an anticancer agent that causes drug resistance.   The pharmaceutical composition according to claim 9 or 10, wherein the anticancer agent is cisplatin or paclitaxel.   A pharmaceutical composition for treating non-small cell lung cancer, comprising miR-197 or a precursor thereof. A method for assessing susceptibility to treatment with a PD-1 inhibitor in a patient with PD-L1-related disease comprising:
(I) measuring miR-197 levels in a biological sample taken from said patient; and
(Ii) when the miR-197 level is lower than a reference value, the patient evaluates that the patient is highly sensitive to treatment with a PD-1 inhibitor;
Including methods.   15. The method of claim 14, wherein the PD-1 inhibitor is an anti-PD-1 antibody.   The method according to claim 14 or 15, wherein the PD-L1-related disease is cancer.   The method according to claim 15, wherein the cancer is PD-L1 positive cancer.   The method according to claim 16 or 17, wherein the cancer is non-small cell lung cancer.   The method according to any one of claims 14 to 18, wherein the biological sample is a blood sample or a cancer tissue sample.   The method according to any one of claims 14 to 19, wherein the miR-197 level is measured by a quantitative RT-PCR method or a microarray method.   Primer set or probe for measuring miR-197 level in a biological sample collected from a patient in a PD-L1-related disease patient to evaluate sensitivity to treatment with a PD-1 inhibitor Including kit.   The kit of Claim 21 used for the method in any one of Claims 14-20.

Images