JP2016052301A - Primer reagent for amplifying alk fusion gene, amplification reagent kit of alk fusion gene comprising it, and amplification method and analytical method of alk fusion gene using it - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel primer reagent for simply detecting a plurality of ALK fusion gene variants using one reaction system by gene amplification.SOLUTION: The invention provides a primer reagent of ALK fusion genes comprising a forward primer group and reverse primer group consisting of oligonucleotides: a forward primer consisting of oligonucleotides of (F_V1/6), a forward primer consisting of oligonucleotides of (F_V2), a forward primer consisting of oligonucleotides of (F_V 3a), a forward primer consisting of oligonucleotides of (F_V 3b), a reverse primer consisting of oligonucleotides of (R_V/multi), and a reverse primer consisting of oligonucleotides of (R_V6).SELECTED DRAWING: Figure 1

Description

  The present invention relates to a primer reagent for amplifying an ALK fusion gene, an ALK fusion gene amplification reagent kit containing the primer reagent, an ALK fusion gene amplification method using the same, and an analysis method.

  ALK (Anaplastic Limphoma Kinase) is a kind of kinase. When the ALK gene encoding the ALK is rearranged or translocated with other genes, an ALK fusion gene is formed. It is known that The ALK fusion gene is known to be involved in lung cancer, and it is known that a kinase inhibitor is effective as an anticancer agent for lung cancer having the ALK fusion gene. Therefore, by analyzing whether or not the patient's ALK gene is an ALK fusion gene, for example, the possibility of suffering from lung cancer in the patient is determined, or when the patient is a lung cancer patient, The use of kinase inhibitors, the amount used, switching to other therapeutic agents, etc. can be determined.

  Examples of the ALK fusion gene include a fusion gene (EML4-ALK) with an EML4 (Echinoderm Microtubule-associated protein-Like 4) gene, a fusion gene (KIF5B-ALK) with a KIF5B (Kinesin Family member 5B) gene, and KLC1. Examples include a fusion gene (KLC1-ALK) with a (Kinesin Light Chain 1) gene and a fusion gene (TFG-ALK) with a TFG gene (TRK-fused gene) (Patent Documents 1 to 4). Among these, EML4-ALK variants V1, V2, V3a, V3b and V6 account for about 70% of lung cancer patients having an ALK fusion gene. And useful in therapy.

  As a method of genetic testing, generally, nucleic acid amplification such as PCR (Polymerase Chain Reaction) is performed using a primer that anneals to a specific region in a detection target gene, and the detection target gene is detected depending on the presence or absence of amplification. There is a method of judging the presence or absence. However, as described above, when a plurality of variants exist for a gene to be detected, it takes time and effort to prepare each reaction system using primers for each variant and confirm the presence or absence of each variant. .

Japanese Patent No. 4303303 Special table 2010-501175 WO2011 / 087709 International Publication Pamphlet Japanese Unexamined Patent Publication No. 2012-1000062

  Accordingly, an object of the present invention is to provide a new primer reagent for easily detecting a plurality of variants of an ALK fusion gene in a single reaction system by gene amplification.

In order to achieve the object, the primer reagent of the present invention is an ALK fusion gene primer reagent,
Forward primer consisting of the following oligonucleotide (F_V1 / 6),
Forward primer consisting of the following oligonucleotide (F_V2),
Forward primer consisting of the following oligonucleotide (F_V3a),
Forward primer consisting of the following oligonucleotide (F_V3b),
It comprises a reverse primer composed of the following oligonucleotide (R_V / multi) and a reverse primer composed of the following (R_V6) oligonucleotide.

(F_V1 / 6) Oligonucleotide consisting of the base sequence of SEQ ID NO: 1 (F_V2) Oligonucleotide consisting of the base sequence of SEQ ID NO: 2 (F_V3a) Oligonucleotide consisting of the base sequence of SEQ ID NO: 3 (F_V3b) Base sequence of SEQ ID NO: 4 An oligonucleotide consisting of the base sequence of SEQ ID NO: 5 (R_V6) An oligonucleotide consisting of the base sequence of SEQ ID NO: 6

  The amplification reagent kit of the present invention is an amplification reagent kit for the ALK fusion gene and is characterized by including the primer reagent for the ALK fusion gene of the present invention.

  The amplification method of the present invention is an amplification method of an ALK fusion gene, and includes a step of amplifying a template nucleic acid in one reaction system including the primer reagent for the ALK fusion gene of the present invention.

  The analysis method of the present invention is an analysis method of an ALK fusion gene, the step of amplifying a template nucleic acid in a test sample by the ALK fusion gene amplification method of the present invention, and the detection of the amplification of the template nucleic acid The method further comprises a step of detecting an ALK fusion gene in the test sample.

  The analysis reagent kit of the present invention is an analysis reagent kit for the ALK fusion gene, and includes the primer reagent for the ALK fusion gene of the present invention.

  The method for testing the efficacy of the drug of the present invention comprises the steps of analyzing the ALK fusion gene by the analysis method of the present invention, and testing the resistance or sensitivity to the drug based on the presence or absence of the ALK fusion gene. It is characterized by including.

  According to the primer reagent of the present invention, variants V1, V2, V3a, V3b and V6 of the ALK fusion gene can be amplified simultaneously in the same reaction system. For this reason, according to the present invention, by using one reaction system, it is possible to easily detect a plurality of variants of the ALK fusion gene. Therefore, the present invention is useful, for example, in diagnosis of morbidity of lung cancer and treatment of lung cancer.

FIG. 1 is a graph showing the results of Tm analysis in Example A1 of the present invention. FIG. 2 is a graph showing the results of Tm analysis in Example A2 of the present invention. FIG. 3 is a graph showing the results of Tm analysis in Example A3 of the present invention. FIG. 4 is a graph showing the results of Tm analysis in Example A4 of the present invention.

The primer reagent of the present invention further includes, for example,
Forward primer consisting of the following oligonucleotide (F_V8a),
Forward primer consisting of the following oligonucleotide (F_V8b),
Forward primer consisting of the following oligonucleotide (F_V4),
Forward primer consisting of the following oligonucleotide (F_V4 '),
A reverse primer composed of the following oligonucleotide (R_V8a / b) and a reverse primer composed of the following (R_V4 / 4 ′) oligonucleotide are included.

(F_V8a) Oligonucleotide consisting of the base sequence of SEQ ID NO: 7 (F_V8b) Oligonucleotide consisting of the base sequence of SEQ ID NO: 8 (F_V4) Oligonucleotide consisting of the base sequence of SEQ ID NO: 9 (F_V4 ') From the base sequence of SEQ ID NO: 10 Oligonucleotide (R_V8a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 11 (R_V4 / 4 ') oligonucleotide consisting of the base sequence of SEQ ID NO: 12

The primer reagent of the present invention further includes, for example,
Forward primer consisting of the following oligonucleotide (F_V5a / b),
Forward primer consisting of the following oligonucleotide (F_V7),
Forward primer consisting of the following oligonucleotide (F_V9),
The reverse primer which consists of the said (R_V / multi) oligonucleotide and the reverse primer which consists of the following (R_V5b) oligonucleotide are included.

(F_V5a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 13 (F_V7) oligonucleotide consisting of the base sequence of SEQ ID NO: 14 (F_V9) oligonucleotide consisting of the base sequence of SEQ ID NO: 15 (R_V / multi) of SEQ ID NO: 5 Oligonucleotide consisting of a base sequence (R_V5b) Oligonucleotide consisting of the base sequence of SEQ ID NO: 16

The primer reagent of the present invention further includes, for example,
Forward primer consisting of the following oligonucleotide (F_KIF / e24),
Forward primer consisting of the following oligonucleotide (F_KIF / e15),
Forward primer consisting of the following oligonucleotide (F_KIF / e17),
Forward primer consisting of the following oligonucleotide (F_KLC1),
A forward primer composed of the following oligonucleotide (F_TFG) and a reverse primer composed of the above-mentioned (R_V / multi) oligonucleotide.

(F_KIF / e24) oligonucleotide consisting of the base sequence of SEQ ID NO: 17 (F_KIF / e15) oligonucleotide consisting of the base sequence of SEQ ID NO: 18 (F_KIF / e17) oligonucleotide consisting of the base sequence of SEQ ID NO: 19 (F_KLC1) SEQ ID NO: Oligonucleotide consisting of 20 base sequences (F_TFG) Oligonucleotide consisting of the base sequence of SEQ ID NO: 21 (R_V / multi) Oligonucleotide consisting of the base sequence of SEQ ID NO: 5

  In the ALK fusion gene analysis method of the present invention, for example, in the detection step, the detection of amplification of the template nucleic acid is detection using a probe.

  In the method for analyzing an ALK fusion gene of the present invention, for example, detection using the probe is melting curve analysis.

  The analysis reagent kit of the present invention further includes, for example, a probe that hybridizes to the amplification product of the primer reagent.

  In the present invention, hereinafter, the forward primer is also referred to as “F primer” and the reverse primer is also referred to as “R primer”.

  An ALK fusion gene generally refers to a fusion gene that results from rearrangement or translocation of the ALK gene. Examples of the ALK fusion gene include a fusion gene of the ALK gene and the EML4 gene (EML4-ALK), a fusion gene of the ALK gene and the KIF5B gene (KIF5B-ALK), and a fusion gene of the ALK gene and the KLC1 gene. (KLC1-ALK) and a fusion gene (TFG-ALK) of the ALK gene and the TFG gene.

  Examples of EML4-ALK, which is the ALK fusion gene, include the variants shown in the following table. In the table below, E and number indicate the number of exon of the fused EML4 gene, and A and number indicate the number of exon of the fused ALK gene. For example, “E13; A20” in V1 means that exon 13 of the EML4 gene and exon 20 of the ALK gene are fused. Moreover, ins and a number indicate that an insertion sequence exists upstream of exon 20 of the ALK gene and the length (base length) of the insertion sequence. For example, “E6; ins69 A20” in V6 means that exon 6 of the EML4 gene and exon 20 of the ALK gene are fused through an insertion of 69 bases in length. Further, del and the number indicate that the upstream side of exon 20 of the ALK gene is deleted and the length (base length) of the deleted sequence. For example, “E14; del12 A20” in V7 means that exon 14 of the EML4 gene is fused with exon 20 of the ALK gene from which the upstream 12-base length has been deleted. Each variant is specified in various papers, for example, as shown in Tables 1 to 3 below, or registered with the following accession number in the database Genbank. Among the variants of the ALK fusion gene, five types of V1, V2, V3a, V3b and V6 are major marker groups that occupy about 70% of lung cancers involving the ALK fusion gene.

  In the present invention, the description of the numerical range represented by the maximum value and the minimum value discloses, for example, all the numerical values that belong between the maximum value and the minimum value. For example, the description “1 to 5 bases” means all disclosures of “1, 2, 3, 4, 5 bases”.

(1) Primer reagent The primer reagent of the present invention is as described above.
F primer comprising the oligonucleotide (F_V1 / 6),
F primer comprising the oligonucleotide (F_V2),
F primer comprising the oligonucleotide (F_V3a),
F primer comprising the oligonucleotide (F_V3b),
It comprises an R primer composed of the oligonucleotide (R_V / multi) and an R primer composed of the oligonucleotide (R_V6).

(F_V1 / 6) oligonucleotide consisting of the base sequence of SEQ ID NO: 1 (SEQ ID NO: 1) 5'-cctgggaaaggacctaaag-3 '
(F_V2) oligonucleotide consisting of the base sequence of SEQ ID NO: 2 (SEQ ID NO: 2) 5'-gggagactatgaaatattgtacttg-3 '
(F_V3a) oligonucleotide consisting of the base sequence of SEQ ID NO: 3 (SEQ ID NO: 3) 5'-ataaagatgtcatcatcaaccaag-3 '
(F_V3b) oligonucleotide consisting of the base sequence of SEQ ID NO: 4 (SEQ ID NO: 4) 5'-gcgaaaaaaacagccaag-3 '
(R_V / multi) Oligonucleotide consisting of the base sequence of SEQ ID NO: 5 (SEQ ID NO: 5) 5'-gctccatctgcatggc-3 '
(R_V6) oligonucleotide consisting of the base sequence of SEQ ID NO: 6 (SEQ ID NO: 6) 5'-tggcagcctggccc-3 '

  According to the primer reagent of the present invention, for example, V1, V2, V3a, V3b and V6 which are main variants of the ALK fusion gene can be simultaneously amplified in the same reaction system containing the primer reagent. For this reason, according to the primer reagent of the present invention, it is possible to analyze at least five kinds of the main variants only by an amplification reaction of one reaction system using the primer reagent.

  Primers for amplifying fusion gene variants are generally designed to amplify regions of about 1000 bases in length. In contrast, the F primer and the R primer in the primer reagent of the present invention are each designed to amplify a relatively short region (for example, 50 to 150 bases long) including the fusion points of various variants. ing. The lower limit of the relatively short region is, for example, 10 bases or more, 20 bases or more, 30 bases or more, 40 bases or more, 50 bases or more, 60 bases or more, 70 bases or more, and the upper limit thereof is, for example, 200 bases or less, 170 bases or less, 160 bases or less, 150 bases or less, 140 bases or less, 130 bases or less, 120 bases or less. Therefore, for example, when RNA in a sample is targeted, the RNA is easily degraded in the sample, but even when the RNA is fragmented, the F primer and the R primer are Since it is designed to amplify a relatively short region as described above, the region including the target fusion point can be amplified while avoiding the influence of the fragmentation.

  The F primer (F_V1 / 6) is a primer that anneals to exon 13 of the EML4 gene, and the F primer (F_V2) is the 23rd base counted upstream from the fusion point of exon 20 of the EML4 gene. And a primer that anneals to the region between the second base counted from the fusion point of exon 20 of the ALK gene, and the F primer (F_V3a) is the fusion point of exon 6 of the EML4 gene. Is a primer that anneals to the region between the 24th base counted from the upstream side to the upstream side and the first base counted from the fusion point of exon 20 of the ALK gene toward the downstream side, and the F primer ( F_V3b) is the 18th base counted upstream from the fusion point of exon 6 of the EML4 gene and the ALK gene. Counted toward the downstream side from the fusion point of the song 20 is a primer that anneals to the region between the first base. The R primer (R_V / multi) is a primer that anneals to the exon 20 of the ALK gene, and the R primer (R_V6) is a primer that anneals to the insertion region adjacent to the upstream of the exon 20 of the ALK gene. is there.

  According to the F primer (F_V1 / 6) and the R primer (R_V / multi), the region including the fusion point of the EML4 gene and the ALK gene in the V1 can be amplified. The length is about 64 bases including the region of each primer. According to the F primer (F_V2) and the R primer (R_V / multi), the region including the fusion point of the EML4 gene and the ALK gene in the V2 can be amplified. The length is about 88 bases including According to the F primer (F_V3a) and the R primer (R_V / multi), the region including the fusion point of the EML4 gene and the ALK gene in the V3a can be amplified. The length is about 69 bases including According to the F primer (F_V3b) and the R primer (R_V / multi), the region including the fusion point of the EML4 gene and the ALK gene in the V3b can be amplified. The length is about 63 bases including this region. According to the F primer (F_V1 / 6) and the R primer (R_V6), it is possible to amplify a region including the fusion point of the EML4 gene and the ALK gene in V6. The length is about 63 bases including this region.

  According to the primer reagent of the present invention, for example, in one reaction system in which all of these primers coexist, five types of variants of the ALK fusion gene, namely, V1, V2, V3a, V3b and V6 can be amplified simultaneously. For this reason, by performing amplification using the primer reagent of the present invention and confirming the presence / absence or amount of amplification, at least five major variants of the ALK fusion gene can be analyzed.

  In the primer reagent of the present invention, the addition amounts of the four types of F primers and the two types of R primers are not particularly limited. The ratio (molar ratio F: R) between the molar amount (F) of the F primer and the molar amount (R) of the R primer is, for example, 1: 1 to 1 for one variant to be detected. : 6. As a specific example, the molar amount is 1: 6. The total addition amount of the four types of F primers and the total addition amount of the two types of R primers are not particularly limited.

  The four types of F primer and the two types of R primer can be used to amplify one type of variant alone, for example, by using a primer set as follows, and a variant to be detected: By combining the following primer sets according to the above, for example, two, three, four, or five variants can be amplified. As a specific example, when amplifying V1 and V2, for example, a reagent that combines the following V1 primer set and the following V2 primer set may be used. In this case, since the R primer is common, two types of primers are used. A combination of an F primer and one type of R primer can be used.

Primer set for V1 F primer (F_V1 / 6)
R primer (R_V / multi)
Primer set for V2 F primer (F_V2)
R primer (R_V / multi)
Primer set for V3a F primer (F_V3a)
R primer (R_V / multi)
Primer set for V3b F primer (F_V3b)
R primer (R_V / multi)
Primer set for V6 F primer (F_V1 / 6)
R primer (R_V6)

  In the primer reagent of the present invention, the combination of the four types of F primer and the two types of R primer capable of amplifying the five types of variants (V1, V2, V3a, V3b and V6) is, for example, “Pack 1 Also referred to as “primer reagent”.

  The primer reagent of the present invention may contain, for example, only the Pack1 primer reagent as a primer, or may further contain other primers.

  Examples of the other primer include the following Pack2 primer reagent, the following Pack3 primer reagent, and the following Pack4 primer reagent.

The Pack2 primer reagent is, for example,
A forward primer comprising the oligonucleotide (F_V8a),
A forward primer comprising the oligonucleotide (F_V8b),
A forward primer comprising the oligonucleotide (F_V4),
A forward primer comprising the oligonucleotide (F_V4 ′),
A reverse primer composed of the oligonucleotide (R_V8a / b) and a reverse primer composed of the oligonucleotide (R_V4 / 4 ′).

(F_V8a) oligonucleotide consisting of the base sequence of SEQ ID NO: 7 (SEQ ID NO: 7) 5'-ataggaacgcactcaggc-3 '
(F_V8b) oligonucleotide consisting of the base sequence of SEQ ID NO: 8 (SEQ ID NO: 8) 5'-aaatgtggaatgctgccag-3 '
(F_V4) oligonucleotide consisting of the base sequence of SEQ ID NO: 9 (SEQ ID NO: 9) 5'-gagatatgctggatgagcc-3 '
(F_V4 ′) oligonucleotide consisting of the base sequence of SEQ ID NO: 10 (SEQ ID NO: 10) 5′-gaaggaaaggcagatcaatttttag-3 ′
(R_V8a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 11 (SEQ ID NO: 11) 5'-tacactgcaggtgggtg-3 '
(R_V4 / 4 ′) oligonucleotide consisting of the base sequence of SEQ ID NO: 12 (SEQ ID NO: 12) 5′-tgtagtcggtcatgatgg-3 ′

  The F primer (F_V8a) is the 21st base counted upstream from the fusion point of exon 17 of the EML4 gene and the 4th base counted downstream from the fusion point of exon 20 of the ALK gene. The F primer (F_V8b) is a primer that anneals to the region of the insertion sequence between the EML4 gene and the ALK gene in variant 8b of the EML4-ALK fusion gene, and the F primer (F_V8b) The primer (F_V4) consists of a third base counted from the fusion point of exon 14 of the EML4 gene toward the upstream side and a 16th base counted from the fusion point of exon 20 of the ALK gene toward the downstream side. The F primer (F_V4 ′) is an exo of the EML4 gene. 15 and 30 th bases counted toward the upstream side from the fusion point of a primer that anneals to the region between the fusion point and the sixth base counted toward the downstream side of exon 20 of the ALK gene. The R primer (R_V8a / b) is a primer that anneals to the insertion region adjacent to the upstream of exon 20 of the ALK gene, and the R primer (R_V4 / 4 ′) is annealed to exon 20 of the ALK gene. Primer.

  According to the F primer (F_V8a) and the R primer of the R primer (R_V8a / b), the region containing the fusion point of the EML4 gene and the ALK gene in the V8a can be amplified. The length is about 54 bases including the region of each primer. According to the F primer (F_V8b) and the R primer (R_V8a / b), a region including the fusion point of the EML4 gene and the ALK gene in the V8b can be amplified. About 53 bases in length. According to the F primer (F_V4) and the R primer (R_V4 / 4 ′), a region including the fusion point of the EML4 gene and the ALK gene in the V4 can be amplified. The length is about 78 bases including the primer region. According to the F primer (F_V4 ′) and the R primer (R_V4 / 4 ′), the region including the fusion point of the EML4 gene and the ALK gene in the V4 ′ can be amplified. The length is about 64 bases including the region of each primer.

  When the primer reagent of the present invention contains the Pack2 primer reagent in addition to the Pack1 primer reagent, for example, in one reaction system in which all these primers coexist, at the same time, five variants of the ALK fusion gene (V1, In addition to V2, V3a, V3b and V6), four additional variants (V8a, V8b, V4 and V4 ′) can be amplified. Therefore, in the case where the primer reagent of the present invention includes the Pack1 primer reagent and the Pack2 primer reagent, the presence or amount of amplification or the amount of amplification is confirmed, so that at least a total including five major types of the ALK fusion gene. Nine types of variants can be analyzed.

  In the Pack2 primer reagent, the addition amounts of the four types of F primers and the two types of R primers are not particularly limited. The ratio (molar ratio F: R) of the total molar amount (F) of the F primer to the total molar amount (R) of the R primer is, for example, 1: 1 to 1: 6. 1: 6. The total addition amount of the four types of F primers and the total addition amount of the two types of R primers are not particularly limited. In the primer reagent of the present invention, the addition amount of the Pack1 primer reagent and the Pack2 primer reagent is not particularly limited.

  The four types of F primers and the two types of R primers contained in the Pack2 primer reagent can be used to amplify one type of variant by using, for example, the following primer set: Further, by combining the following primer sets corresponding to the variants to be detected, for example, two, three, or four types of multiple variants can be amplified. As a specific example, when amplifying V8a and V8b, for example, the following V8a primer set and the V8b primer set may be combined. In this case, since the R primer is common, two types of primers are used. A combination of an F primer and one type of R primer can be used. The primer reagent of the present invention is, for example, at least one selected from the group consisting of the following V8a primer set, the following V8b primer set, the following V4 primer set, and the following V4 ′ primer set in addition to the Pack1 primer reagent. A primer set may be included.

Primer set for V8a F primer (F_V8a)
R primer (R_V8a / b)
Primer set for V8b F primer (F_V8b)
R primer (R_V8a / b)
Primer set for V4 F primer (F_V4)
R primer (R_V4 / 4 ')
Primer set for V4 'F primer (F_V4')
R primer (R_V4 / 4 ')

The Pack3 primer reagent is, for example,
A forward primer comprising the oligonucleotide (F_V5a / b),
A forward primer comprising the oligonucleotide (F_V7),
A forward primer composed of the oligonucleotide (F_V9), a reverse primer composed of the oligonucleotide (R_V / multi), and a reverse primer composed of the oligonucleotide (R_V5b).

(F_V5a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 13 (SEQ ID NO: 13) 5'-gtgaaaaaatcagtctcaagtaaag-3 '
(F_V7) oligonucleotide consisting of the base sequence of SEQ ID NO: 14 (SEQ ID NO: 14) 5'-gatctgaatsctgaaagagaaatag-3 '
s is g (guanine) or c (cytosine)
(F_V9) oligonucleotide consisting of the base sequence of SEQ ID NO: 15 (SEQ ID NO: 15) 5'-tgtgatgcgctactcaatag-3 '
(R_V / multi) Oligonucleotide consisting of the base sequence of SEQ ID NO: 5 (SEQ ID NO: 5) 5'-gctccatctgcatggc-3 '
(R_V5b) oligonucleotide consisting of the base sequence of SEQ ID NO: 16 (SEQ ID NO: 16) 5'-cctggatctccatatcctcc-3 '

  The F primer (F_V5a / b) is a primer that anneals to exon 2 of the EML4 gene, and the F primer (F_V7) is the 25th base counted upstream from the fusion point of exon 14 of the EML4 gene. And a primer that anneals to a region between the first base counted from the fusion point of exon 20 of the ALK gene and the F primer (F_V9) is a fusion point of exon 18 of the EML4 gene. Is a primer that anneals to the region between the 20th base counted from the upstream to the upstream side and the first base counted from the fusion point of exon 20 of the ALK gene toward the downstream side. Further, as described above, the R primer (R_V / multi) is a primer that anneals to the exon 20 of the ALK gene, and the R primer (R_V5b) is an insertion region adjacent to the upstream of the exon 20 of the ALK gene. Primer that anneals to

  According to the F primer (F_V5a / b) and the R primer (R_V / multi), a region including the fusion point of the EML4 gene and the ALK gene in the V5a can be amplified. The length is about 70 bases including the region of each primer. According to the F primer (F_V5b) and the R primer (R_V5b), a region including the fusion point of the EML4 gene and the ALK gene in the V5b can be amplified, and the length of the amplified fragment is, for example, the region of each primer About 59 bases in length. According to the F primer (F_V7) and the R primer (R_V / multi), the region including the fusion point of the EML4 gene and the ALK gene in V7 can be amplified. About 58 bases in length. According to the F primer (F_V9) and the R primer (R_V / multi), it is possible to amplify a region including the fusion point of the EML4 gene and the ALK gene in the V9. The length is about 65 bases including this region.

  When the primer reagent of the present invention includes the Pack3 primer reagent in addition to the Pack1 primer reagent, for example, in one reaction system in which all of these primers coexist, five types of variants of the ALK fusion gene (V1, In addition to V2, V3a, V3b and V6), four additional variants (V5a, V5b, V7 and V9) can be amplified. Therefore, when the primer reagent of the present invention includes the Pack1 primer reagent and the Pack3 primer reagent, the presence or amount of amplification or the amount of amplification is confirmed, so that the ALK fusion gene contains at least a total of five major types. Nine types of variants can be analyzed.

  In the Pack3 primer reagent, the addition amounts of the three types of F primers and the two types of R primers are not particularly limited. The ratio (molar ratio F: R) of the total molar amount (F) of the F primer to the total molar amount (R) of the R primer is, for example, 1: 1 to 1: 6. 1: 6. The total addition amount of the three types of F primers and the total addition amount of the two types of R primers are not particularly limited. In the primer reagent of the present invention, the addition amount of the Pack1 primer reagent and the Pack3 primer reagent is not particularly limited.

  The three types of F primers and the two types of R primers contained in the Pack3 primer reagent can be used to amplify one type of variant alone, for example, by using the following primer set: Further, by combining the following primer sets corresponding to the variants to be detected, for example, two, three, or four types of multiple variants can be amplified. As a specific example, when amplifying V5a and V5b, for example, a reagent combining the following primer set for V5a and the primer set for V5b may be used. A combination of an F primer and two types of R primers can be used. The primer reagent of the present invention is, for example, at least one primer selected from the group consisting of the following V5a primer set, the following V5b primer set, the following V7 primer set, and the following V9 primer set in addition to the Pack1 primer reagent A set may be included. In addition, the primer reagent of the present invention further includes, for example, at least one primer set selected from the group consisting of the V8a primer set, the V8b primer set, the V4 primer set, and the V4 ′ primer set. May be included.

Primer set for V5a F primer (F_V5a / b)
R primer (R_V / multi)
Primer set for V5b F primer (F_V5a / b)
R primer (R_V5b)
Primer set for V7 F primer (F_V7)
R primer (R_V / multi)
Primer set for V9 F primer (F_V9)
R primer (R_V / multi)

The Pack4 primer reagent is, for example,
F primer comprising the oligonucleotide (F_KIF / e24),
F primer comprising the oligonucleotide (F_KIF / e15),
F primer comprising the oligonucleotide (F_KIF / e17),
F primer comprising the oligonucleotide (F_KLC1),
An F primer composed of the oligonucleotide (F_TFG) and an R primer composed of the oligonucleotide (R_V / multi).

(F_KIF / e24) oligonucleotide consisting of the base sequence of SEQ ID NO: 17 (SEQ ID NO: 17) 5'-ggcattctgcacagattg-3 '
(F_KIF / e15) oligonucleotide consisting of the base sequence of SEQ ID NO: 18 (SEQ ID NO: 18) 5'-agaaataggaattgctgtggg-3 '
(F_KIF / e17) oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 19 (SEQ ID NO: 19) 5'-ccagcttcgagcacaag-3 '
(F_KLC1) oligonucleotide consisting of the base sequence of SEQ ID NO: 20 (SEQ ID NO: 20) 5'-gggagtttggttctgtagatg-3 '
(F_TFG) Oligonucleotide consisting of the base sequence of SEQ ID NO: 21 (SEQ ID NO: 21) 5'-ttccaccaatattcctgaaaatg-3 '
(R_V / multi) Oligonucleotide consisting of the base sequence of SEQ ID NO: 5 (SEQ ID NO: 5) 5'-gctccatctgcatggc-3 '

  The F primer (F_KIF / e24) is a primer that anneals to exon 24 of the KIF5B gene, and the F primer (F_KIF / e15) is a primer that anneals to exon 15 of the KIF5B gene, and the F primer (F_KIF / e24) e17) is a primer for annealing to exon 17 of the KIF5B gene, the F primer (F_KLC1) is a primer for annealing to exon 9 of the KLC1 gene, and the F primer (F_TFG) is to exon 3 of the TFG gene. Primer for annealing. The R primer (R_V / multi) is a primer that anneals to exon 20 of the ALK gene as described above.

  According to the F primer (F_KIF / e24) and the R primer (R_V / multi), the region including the fusion point of the KIF5B gene and the ALK gene in the KIF5B exon24-ALK can be amplified. For example, the length is about 63 bases including the region of each primer. According to the F primer (F_KIF / e15) and the R primer (R_V / multi), the region including the fusion point of the KIF5B gene and the ALK gene in the KIF5B exon15-ALK can be amplified. For example, the length is about 68 bases including the region of each primer. According to the F primer (F_KIF / e17) and the R primer (R_V / multi), a region including the fusion point of KIF5B and ALK gene in the KIF5B exon17-ALK can be amplified. The length is about 62 bases including the region of each primer. According to the F primer (F_KLC1) and the R primer (R_V / multi), the region including the fusion point of the KLC1 gene and the ALK gene in the KLC1-ALK can be amplified. The length is about 66 bases including the region of each primer. According to the F primer (F_TFG) and the R primer (R_V / multi), a region including the fusion point of the TFG gene and the ALK gene in the TFG-ALK can be amplified. The length is about 68 bases including the region of each primer.

  When the primer reagent of the present invention contains the Pack4 primer reagent in addition to the Pack1 primer reagent, for example, in one reaction system in which all these primers coexist, at the same time, five variants of the ALK fusion gene (V1, In addition to V2, V3a, V3b and V6), five variants of the ALK fusion gene (KIF5B-ALK exon24, KIF5B-ALK exon15, KIF5B-ALK exon17, KLC1-ALK and TFG-ALK) can be amplified. Therefore, when the primer reagent of the present invention includes the Pack1 primer reagent and the Pack4 primer reagent, by confirming the presence or absence of amplification or the amount of amplification, the ALK fusion gene includes at least a total of five major types. Ten variants of the analysis can be performed.

  In the Pack4 primer reagent, the amount of each of the five types of F primer and the one type of R primer added is not particularly limited. The ratio (molar ratio F: R) of the total molar amount (F) of the F primer to the molar amount (R) of the R primer is, for example, 1: 1 to 1: 6. 1: 6. The total addition amount of the five types of F primer is not particularly limited. In the primer reagent of the present invention, the addition amount of the Pack1 primer reagent and the Pack4 primer reagent is not particularly limited.

  The five types of F primer and the one type of R primer included in the Pack4 primer reagent can be used for amplification of one type of variant by using, for example, the following primer set, In addition, by combining the following primer sets according to the variants to be detected, for example, two, three, four, or five variants can be amplified. As a specific example, when amplifying the KIF5B-ALK exon24 and the KIF5B-ALK exon15, for example, the following KIF5B-ALK exon24 primer set and the following KIF5B-ALK exon15 primer set may be combined. In this case, since the R primer is common, a combination of two types of F primer and one type of R primer can be used. The primer reagent of the present invention includes, for example, the following KIF5B exon24-ALK primer set, the following KIF5B exon15-ALK primer set, the following KIF5B exon17-ALK primer set, and the following KLC1-ALK primer set in addition to the Pack1 primer reagent At least one primer set selected from the group consisting of: The primer reagent of the present invention further includes, for example, at least one primer set selected from the group consisting of the V5a primer set, the V5b primer set, the V7 primer set, and the V9 primer set, and It may also include at least one primer set selected from the group consisting of the V8a primer set, the V8b primer set, the V4 primer set, and the V4 ′ primer set.

KIF5B exon24-ALK primer set F primer (F_KIF / e24)
R primer (R_V / multi)
Primer set for KIF5B exon15-ALK F primer (F_KIF / e15)
R primer (R_V / multi)
KIF5B exon17-ALK primer set F primer (F_KIF / e17)
R primer (R_V / multi)
Primer set for KLC1-ALK F primer (F_KLC1)
R primer (R_V / multi)
Primer set for TFG-ALK F primer (F_TFG)
R primer (R_V / multi)

As described above, the primer reagent of the present invention may contain only the Pack1 primer reagent as a primer. In addition to the Pack1 primer reagent, for example, the Pack2 primer reagent, the Pack3 primer reagent, and the Pack4 primer reagent. Among these, any one type may be included, any two types may be included, and all three types may be included. Examples of combinations in the primer reagent of the present invention include the following 1 to 8.
1. Pack1 primer reagent2. Pack1 primer reagent / Pack2 primer reagent3. Pack1 primer reagent / Pack3 primer reagent4. 4. Pack1 primer reagent / Pack4 primer reagent Pack1 primer reagent / Pack2 primer reagent / Pack3 primer reagent6. Pack1 primer reagent / Pack2 primer reagent / Pack4 primer reagent7. Pack1 primer reagent / Pack3 primer reagent / Pack4 primer reagent8. Pack1 primer reagent / Pack2 primer reagent / Pack3 primer reagent / Pack4 primer reagent

  When the primer reagent of the present invention is any combination of 2 to 8, the Pack1 primer reagent and the other primer reagent may be in the form of one reagent system that is used simultaneously in one reaction system, for example. However, it may be in the form of a multi-reagent system used separately in each separate reaction system. In the case of the former one reagent system, for example, a form in which all primers are mixed can be exemplified. In this case, a primer overlapping between each Pack primer reagent may be included, for example, as a primer in each Pack primer reagent, or may be used in combination as a primer for each Pack primer reagent. In the case of the latter multi-reagent system, for example, each Pack primer reagent may be a single reagent system, and each may be individually independent.

  In the primer reagent of the present invention, each primer described above includes, for example, the meanings of oligonucleotides shown below.

  That is, the primer comprises, for example, a nucleotide sequence in which one or several bases are deleted, substituted, inserted and / or added in an oligonucleotide having the nucleotide sequence of the SEQ ID NO. The meaning of an oligonucleotide that anneals to a region substantially identical to the annealing region of the oligonucleotide consisting of The one or several is, for example, 1 to 5, 1 to 4, 1 to 3, or 1 or 2. Annealing to the substantially the same region, for example, in addition to annealing to the same region as the annealing region, at least one of the 5 ′ side and the 3 ′ side of the annealing region is a region shorter by several bases, This includes the meaning of annealing to a region in which at least one of 5 ′ side and 3 ′ side is longer by several bases than the annealing region (hereinafter the same). The number of bases is, for example, 1 to 5, 1 to 4, 1 to 3, 1, or 2.

  Further, the primer is composed of, for example, a nucleotide sequence having a predetermined identity with respect to the oligonucleotide consisting of the nucleotide sequence of the SEQ ID NO., And substantially the annealing region of the oligonucleotide consisting of the nucleotide sequence of the SEQ ID NO. Includes the meaning of oligonucleotides that anneal to the same region. The predetermined degree of identity is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more. The identity can be calculated with default parameters using analysis software such as BLAST and FASTA (hereinafter the same).

  Examples of the structural unit of the oligonucleotide constituting the primer include a nucleotide residue and an artificial nucleic acid residue. Examples of the nucleotide include deoxyribonucleotide and ribonucleotide, and the nucleotide may be, for example, an unmodified type or a modified type. Examples of the artificial nucleic acid include PNA (Peptide Nucleic Acid) that is a peptide nucleic acid, LNA (Locked Nucleic Acid) that is an RNA analog, BNA (Bridged Nucleic Acid) and ENA (2′-O, 4 ′) that are cross-linked nucleic acids. -C-Ethylenebridged Nucleic Acid). The primer in the present invention is, for example, an oligonucleotide (DNA) primer containing a deoxyribonucleotide residue or consisting of a deoxyribonucleotide residue.

  The primer reagent of the present invention may contain, for example, a solvent and other components used for amplification reaction, reverse transcription reaction and the like. For example, the other components described below can be cited as the other components.

(2) Amplification reagent kit The amplification reagent kit of the present invention is an amplification reagent kit for the ALK fusion gene as described above, and includes the primer reagent of the present invention. The amplification reagent kit of the present invention is characterized by including the primer reagent of the present invention, and other configurations and conditions are not particularly limited. According to the amplification reagent kit of the present invention, for example, a plurality of variants of the ALK fusion gene can be amplified simultaneously in the same reaction system. The amplification reagent kit of the present invention can incorporate the description of the primer reagent of the present invention, unless otherwise specified.

  The amplification reagent kit of the present invention may contain only the Pack1 primer reagent as a primer, or may further contain other primers. As described above, examples of the other primer include the Pack2 primer reagent, the Pack3 primer reagent, and the Pack4 primer reagent. As a specific example, any one kind or any two kinds may be used. All three types may be used. The other primer may be, for example, a primer set included in each primer reagent.

  In the amplification reagent kit of the present invention, it is preferable that the F primer and R primer of the Pack1 primer reagent are all included in the same reaction system when used.

  When the amplification reagent kit of the present invention further includes at least one selected from the group consisting of the Pack2 primer reagent, the Pack3 primer reagent and the Pack4 primer reagent, the F primer and R primer of the Pack1 primer reagent, The F primer and R primer of the other Pack primer reagents may be in a form in which all are included in the same reaction system at the time of use.

  In addition, the amplification reagent kit of the present invention may be configured such that, for each Pack primer reagent, all of the F primer and R primer are included in the same reaction system when used. That is, the Pack1 primer reagent and the other Pack primer reagents can be exemplified as separate reagent systems. In this case, each reaction system is prepared using each Pack primer reagent, and amplification reaction can be performed separately. As a form which became the said separate reagent type | system | group, the form accommodated in the same container and each reagent isolated may be sufficient, for example, and the form accommodated in another container may be sufficient.

  The amplification reagent kit of the present invention may contain, for example, a solvent and other components used for amplification reaction, reverse transcription reaction and the like. For example, the other components described below can be cited as the other components. Further, the amplification reagent kit of the present invention may further include instructions for use.

(3) Amplification method As described above, the amplification method of the present invention is an amplification method of an ALK fusion gene, and a step of amplifying a template nucleic acid in one reaction system containing the primer reagent of the ALK fusion gene of the present invention. It is characterized by including. The present invention is characterized by using the primer reagent of the present invention, and other conditions and steps are not limited at all. Unless otherwise indicated, the description of the primer reagent of the present invention can be used for the amplification method of the present invention.

  In the amplification step, the template nucleic acid amplification method is not particularly limited as long as it uses a primer. Examples of the amplification method include PCR (Polymerase Chain Reaction) method, NASBA (Nucleic Acid Sequence Based Amplification) method, TMA (Transcription-Mediated Amplification) method, SDA (Strand Displacement Amplification) method and the like. In the present invention, the primer reagent of the present invention is used as a primer for the amplification step. In the amplification method of the present invention, for example, the amplification reagent kit of the present invention may be used instead of the primer reagent of the present invention.

  The conditions for the amplification method are not particularly limited, and for example, general conditions can be adopted. When the amplification method is PCR, for example, (1) dissociation of a template nucleic acid that is double-stranded DNA into single-stranded DNA, (2) annealing of the primer into the single-stranded DNA, (3) The extension may be repeated. In the PCR, when (1) to (3) are 1 cycle, the number of cycles is not particularly limited, and the lower limit is, for example, 20 cycles, 25 cycles, 30 cycles, the upper limit is, for example, 100 cycles, There are 70 cycles and 50 cycles, and the range is, for example, 30 to 100 cycles, 30 to 70 cycles, and 30 to 50 cycles. The conditions of each step are not particularly limited, and the dissociation step (1) is, for example, 1 to 120 seconds at a temperature of 90 to 99 ° C., 1 to 60 seconds at a temperature of 92 to 95 ° C., and (2) The annealing step is, for example, a temperature of 40 to 70 ° C. for 1 to 300 seconds and a temperature of 50 to 70 ° C. for 5 to 60 seconds, and the extension step (3) is, for example, 50 to 80 ° C. for 1 to 300 seconds. , 5 to 60 seconds at 50 to 75 ° C.

In the amplification step, examples of the reaction system include a reaction solution. The volume of the reaction system is not particularly limited and is, for example, 1 to 500 μL or 1 to 100 μL. The reaction system includes, for example, the primer reagent of the present invention and the template nucleic acid, and further includes a solvent and other components used for the amplification reaction. Examples of the solvent include buffers such as water, Tris-HCl, Tricine, MES, MOPS, HEPES, and CAPS. Specific examples include commercially available PCR buffers and commercially available PCR kit buffers. can give. Examples of the other components include polymerase, nucleotide triphosphate, heparin, betaine, KCl, MgCl ₂ , MgSO ₄ , glycerol, and albumin. Examples of the albumin include bovine serum albumin (BSA), human serum albumin, rat serum albumin, horse serum albumin and the like. When the amplification method of the present invention includes a reverse transcription step described later, the reaction system may include, as other components, a reverse transcriptase such as an RNase inhibitor, an RNA-dependent DNA polymerase, a reducing agent, and the like. Examples of the RNase inhibitor include RNase Inhibitor Recombinant type (trade name, TOYOBO). Examples of the reverse transcriptase include SuperScript III (trade name, Invitrogen), ReverTra Ace (trade name, TOYOBO) and the like. Examples of the reducing agent include DTT. In the reaction system, the ratio of each component and the order of addition are not particularly limited.

The polymerase is not particularly limited, and for example, a general DNA polymerase can be used. Examples of the polymerase include non-human-derived polymerases, and specifically, polymerases derived from heat-resistant bacteria. Specific examples of the polymerase include, for example, GeneTaq (trade name, Nippon Gene), PrimeSTAR Max DNA Polymerase (trade name, Takara Bio), DNA polymerase derived from Thermus aquaticus (US Pat. No. 4, 889,818 and 5,079,352) (trade name, Taq polymerase), DNA polymerase derived from Thermus thermophilus (Wo91 / 09950) (rTth DNA polymerase), Pyrococcus furiosus DNA polymerase (WO92 / 9689) (Pfu DNA polymerase: manufactured by Stratagene), DNA polymerase (EP0455430) derived from Thermococcus litoralis (trademark Vent: N w England Biolabs, Inc.), and the like. In the reaction system, the amount of the polymerase added is not particularly limited. As a specific example, the lower limit per 50 μL of the reaction system is, for example, 0.001 U, 0.005 U, 0.01 U, 0.05 U, 0. 1U, 1U, and 5U, upper limits are, for example, 50U, 80U, 100U, and 150U, and ranges are, for example, 0.001 to 150U and 0.01 to 100U. The activity unit (U) of the polymerase generally has an activity of incorporating 10 nmol of all nucleotides into an acid-insoluble precipitate in an activity measurement reaction solution at 74 ° C. for 30 minutes using activated salmon sperm DNA as a template primer. It is. The composition of the reaction solution is, for example, 25 mmol / L TAPS buffer (pH 9.3, 25 ° C.), 50 mmol / L KCl, 2 mmol / L MgCl ₂ , 1 mmol / L mercaptoethanol, 200 μmol / L dATP, 200 μmol / L dGTP. , 200 μmol / L dTTP, 100 μmol / L “α- ³² P” dCTP, 0.25 mg / mL activated salmon sperm DNA.

  Examples of the nucleotide triphosphates generally include dNTPs (dATP, dCTP, dGTP, and dTTP or dUTP). In the reaction system, the addition amount of the nucleotide triphosphate is not particularly limited, and as specific examples, the lower limit is, for example, 0.01 mmol / L, 0.05 mmol / L, 0.1 mmol / L, and the upper limit. Is, for example, 1 mmol / L, 0.5 mmol / L, 0.3 mmol / L, and ranges are, for example, 0.01-1 mmol / L, 0.05-0.5 mmol / L, 0.1-0. .3 mmol / L.

  Examples of the template nucleic acid in the amplification step include DNA. The DNA is, for example, a nucleic acid derived from a living body. The biological DNA may be, for example, DNA contained in a biological sample or cDNA generated by reverse transcription from RNA contained in the biological sample. Examples of RNA contained in the biological sample include total RNA and mRNA. Examples of the template nucleic acid include a template nucleic acid that may contain the ALK fusion gene.

  Examples of the biological sample include blood (for example, blood cells such as whole blood and leukocytes, plasma, serum, etc.), tissues (for example, large intestine, lung, etc.), oral cells (for example, oral mucosa, etc.), somatic cells ( For example, nails and hair), germ cells, sputum, amniotic fluid, peritoneal fluid, urine, gastric juice and the like. In addition, examples of the biological sample include biological samples such as gastric lavage fluid, paraffin-embedded tissue, and cultured cells. Nucleic acids (eg, DNA, RNA) contained in the biological sample can be isolated from, for example, cells contained in the biological sample. For example, a general method can be adopted as the isolation method. Examples of the origin of the biological sample include humans.

  In the amplification step, the template nucleic acid may be added to the reaction system as a test sample containing the template nucleic acid, for example.

  The test sample may be, for example, the biological sample as it is, a diluted solution obtained by dissolving, suspending or mixing the biological sample in a solvent, or pretreatment of the biological sample. You may use what you did. The pretreatment is not particularly limited, and examples thereof include a treatment for releasing nucleic acid from cells contained in the biological sample. As a specific example, when the biological sample is blood, for example, a hemolyzed sample subjected to hemolysis as a pretreatment can be mentioned. The hemolyzed sample can be prepared, for example, by diluting whole blood with a solvent. Examples of the solvent include water and a buffer solution. The dilution rate (volume) of the whole blood is not particularly limited, and is, for example, 100 to 2000 times or 200 to 1000 times.

  The amount of the template nucleic acid in the reaction system is not particularly limited.

  The amount of the primer reagent of the present invention in the reaction system is not particularly limited. As specific examples, the amounts of F primer and R primer corresponding to a specific variant are, for example, 0.1 to 4 μmol / L and 0.25 to 1.5 μmol / L per 50 μL of the reaction system, respectively. That is, in the case of the Pack1 primer reagent, the F primer (F_V1), (F_V2), (F_V3a), (F_V3b) and (F_V6) can be exemplified by the above-mentioned amount per 50 μL of the reaction system, for example. Since the R primer (R_V / multi) is common to the four variants, for example, an amount of 4 times the above amount can be exemplified per 50 μL of the reaction system, and the R primer (R_V6) The amount described above can be exemplified per 50 μL of the reaction system. Further, the ratio of the F primer and the R primer in the reaction system is not particularly limited, and examples thereof include the molar ratios exemplified in the primer reagent of the present invention.

  As described above, the primer reagent of the present invention has, in addition to the Pack1 primer reagent, at least one primer reagent selected from the group consisting of the Pack2 primer reagent, the Pack3 primer reagent, and the Pack4 primer reagent. Also good. The other primer reagent may be, for example, a primer set included in each primer reagent. Regarding the Pack primers other than the Pack1 primer reagent, the amount of each F primer and R primer is not particularly limited, and examples thereof include the same amount as that of the Pack1 primer reagent.

  When the Pack1 primer reagent and the other Pack primer reagent are mixed in the same reaction system, for example, by performing the amplification reaction of the one reaction system, the amplification of the variant of the ALK fusion gene targeted by each Pack primer reagent It can be performed. In addition, when the Pack1 primer reagent and other Pack primer reagents are added to separate reaction systems, for example, each Pack primer reagent is targeted in each reaction system by performing an amplification reaction of each reaction system. The ALK fusion gene variant can be amplified.

  As described above, when the template nucleic acid of the amplification reaction in the amplification step is cDNA, the amplification method of the present invention may further include, for example, a reverse transcription step of generating cDNA from RNA by reverse transcription. In this case, for example, the RNA is a template nucleic acid (Rt) for the reverse transcription reaction in the reverse transcription step, and the cDNA obtained in the reverse transcription step is a template nucleic acid (Am) for the amplification reaction in the amplification step. Become. Examples of the RNA include RNA contained in a biological sample, as described above.

  The reverse transcription step and the amplification step may be performed in separate reaction systems, for example, or in the same reaction system. In the former case, for example, a reverse transcription reaction is performed using a reaction system containing the template nucleic acid (Rt) for the reverse transcription reaction and an optional reverse transcription primer, and then the reaction system for the reverse transcription reaction is The amplification reaction can be carried out using a test sample containing the template nucleic acid (Am) for the amplification reaction and a new reaction system containing the test sample and the primer reagent of the present invention. In the latter case, for example, using the reaction system containing the template nucleic acid (Rt) of the reverse transcription reaction, the reverse transcription primer, and the primer reagent of the present invention, the reverse transcription reaction and the amplification reaction are performed. May be performed. In this case, for example, in the reaction system, cDNA is generated based on the template nucleic acid (Rt) by the reverse transcription reaction, and the generated cDNA becomes the template nucleic acid (Am) of the amplification reaction, and the amplification reaction is performed. Is called.

  The reaction system of the reverse transcription step includes, for example, the optional reverse transcription primer and the template nucleic acid (Rt), and further includes a solvent and other components used for the reverse transcription reaction. For example, the solvent may be exemplified in the amplification step. Examples of the other components include reverse transcriptase such as RNA-dependent DNA polymerase, the nucleotide triphosphate, the RNase inhibitor, the reducing agent, and the like. In the reaction system, the ratio of each component and the order of addition are not particularly limited.

  In the reaction system of the reverse transcription step, the amount of the template nucleic acid (Rt) for the reverse transcription reaction is not particularly limited.

  According to the amplification method of the present invention, as described above, in one reaction system, among the ALK fusion genes, at least five major variants highly relevant to lung cancer can be amplified. For this reason, whether or not any one of the five variants is present can be analyzed by confirming whether or not an amplification product is generated by the amplification reaction using the primer reagent of the present invention. For this reason, the amplification method of the present invention includes, for example, a step of amplifying the template nucleic acid in a test sample, and further detecting an ALK fusion gene in the test sample by detecting the amplification of the template nucleic acid. But you can. The analysis of the ALK fusion gene by detecting the amplification will be described later in the analysis method of the present invention.

(4) Analysis method The analysis method of the present invention is an ALK fusion gene analysis method as described above, and the step of amplifying a template nucleic acid in a test sample by the ALK fusion gene amplification method of the present invention. And detecting the ALK fusion gene in the test sample by detecting amplification of the template nucleic acid. The present invention is characterized in that the ALK fusion gene is amplified using the primer reagent of the present invention, and other conditions and steps are not limited at all. Unless otherwise indicated, the description of the primer reagent of the present invention and the amplification method of the present invention can be used for the analysis method of the present invention. Since the analysis method of the present invention can detect an ALK fusion gene, it can also be referred to as, for example, a method for detecting an ALK fusion gene.

  In the present invention, for the amplification step, for example, the description of the amplification method of the present invention can be incorporated.

  In the detection step, detection of amplification of the template nucleic acid may be, for example, detection of the presence or absence of an amplified product or detection of the amount of amplified product. In the former case, for example, it can also be referred to as qualitative analysis, and in the latter case, for example, quantitative analysis.

  In the detection step, a method for detecting amplification of the template nucleic acid is not particularly limited, and a general method can be adopted. Examples of the detection method for amplification include a detection method using a probe and a detection method using an intercalator.

  First, the former method using a probe is, for example, a method using a probe capable of hybridizing to a target amplification product (hereinafter also referred to as “test nucleic acid”). According to this method, for example, the amplified product can be detected based on the presence or absence of hybridization of the probe to the amplified product or the amount of the probe hybridized to the amplified product.

  The sequence of the probe is not particularly limited, and can be set to a sequence complementary to a region amplified by the primer reagent of the present invention, for example. The sequence of the probe may be complementary to the sense strand of the ALK fusion gene or may be complementary to the antisense strand of the ALK fusion gene, for example. When the template nucleic acid is ALK fusion gene cDNA, the probe sequence may be complementary to the cDNA or may be in the same direction as the cDNA.

  The probe includes, for example, an oligonucleotide as a nucleic acid. Examples of the structural unit of the oligonucleotide include a nucleotide residue and an artificial nucleic acid residue, and the description of the structural unit in the primer can be cited. The probe in the present invention is, for example, an oligonucleotide (DNA) probe containing a deoxyribonucleotide residue or consisting of a deoxyribonucleotide residue.

  The length of the probe is not particularly limited, and the lower limit is, for example, 5 base length, 10 base length, the upper limit is, for example, 50 base length, 30 base length, and the range is, for example, 5-50 base length. 10 to 30 bases in length.

  The probe may contain a labeling substance in addition to the oligonucleotide, for example. In this case, examples of the probe include a labeled probe in which the oligonucleotide is labeled (modified) with the labeling substance.

  In the labeled probe, the labeling site of the oligonucleotide by the labeling substance is not particularly limited. As a specific example, the labeling site may be, for example, the 5 'terminal region, 3' terminal region, or both the 5 'terminal region and the 3' terminal region of the oligonucleotide. Examples of the 5 ′ end region include the region of the first to fifth bases counted from the 5 ′ end of the oligonucleotide, and any of the first, second, third, fourth, and fifth bases. It may be labeled and, as a specific example, is the first base (5 ′ terminal base). The 3 ′ end region is, for example, the region of the first to fifth bases counted from the 3 ′ end of the oligonucleotide, and includes the first, second, third, fourth and fifth bases. Any of them may be labeled. As a specific example, it is the first base (3 ′ terminal base).

  The labeling method of the labeling substance is not particularly limited, and for example, the base in the oligonucleotide may be directly labeled, or the base may be indirectly labeled. In the latter case, for example, the base can be indirectly labeled by labeling any part of the nucleotide residue containing the base.

  Examples of the labeling substance include fluorescent substances such as fluorophores. Examples of the fluorescent substance include fluorescein, phosphor, rhodamine, polymethine dye derivative and the like. Commercially available fluorescent substances include, for example, Pacific Blue (trade name, Molecular Probe), BODIPY FL (trade name, Molecular Probe), FluorePrime (trade name, Amersham Pharmacia), Fluoredite (trade name, Millipore), FAM (Trade name, ABI), Cy3 and Cy5 (trade name, Amersham Pharmacia), TAMRA (trade name, Molecular Probe). The detection conditions for the fluorescent substance are not particularly limited, and can be determined as appropriate depending on, for example, the type of fluorescent substance used. As specific examples, Pacific Blue can be detected at a detection wavelength of 450 to 480 nm, TAMRA can be detected at a detection wavelength of 585 to 700 nm, and BODIPY FL can be detected at a detection wavelength of 515 to 555 nm, for example.

  The labeled probe is preferably one that emits a signal due to the labeling substance depending on whether it is alone or forms a hybrid. The type of the signal is not particularly limited, and examples thereof include fluorescence and coloration. The coloration may be, for example, color development or discoloration. When the signal is fluorescent, the signal value is, for example, fluorescence intensity. When the signal is colored, examples of the signal value include reflectance, absorbance, and transmittance. The signal may be emitted directly from the labeling substance or indirectly, for example. According to such a labeled probe, for example, by detecting the signal, it can be analyzed whether it is single or hybrid is formed, and thereby the amplification can be analyzed.

  Examples of the labeled probe include a labeled probe that shows a signal alone and does not show a signal by hybridization, or a labeled probe that does not show a signal alone and shows a signal by hybridization. When the labeling substance is a fluorescent substance, the labeling probe is, for example, a probe that is labeled with the fluorescent substance, exhibits fluorescence alone, and decreases in fluorescence (for example, quenches) by hybridization. Such a phenomenon is generally called a fluorescence quenching phenomenon, and a probe using this phenomenon is generally called a fluorescence quenching probe. According to such a fluorescence quenching probe, for example, the probe hybridizes to the hybridizing region and the probe from the hybridizing region due to fluctuations in the signal intensity of the fluorescent substance (for example, fluctuations in fluorescent intensity). Can be confirmed.

  When the labeled probe is a so-called fluorescence quenching probe, for example, at least one of the 5 ′ end region and the 3 ′ end region has a cytosine base complementary to a guanine base in the hybridizing region of the probe in the test nucleic acid. Specifically, for example, the 5 ′ terminal base or the 3 ′ terminal base is a cytosine base. In the labeled probe, for example, the cytosine base is preferably labeled with the fluorescent substance. Such a labeled probe is generally called a guanine quenching probe among fluorescent quenching probes, and is known as a so-called QProbe (registered trademark). The guanine quenching probe, for example, when the cytosine base of the probe approaches the guanine base of the hybridizing region by hybridization to the test nucleic acid, the fluorescence of the fluorescent substance becomes weak, that is, the fluorescence intensity becomes high. Decrease. Therefore, according to the guanine quenching probe, for example, due to a change in the signal intensity of the fluorescent substance (for example, a change in the fluorescence intensity), the hybridization of the probe to the hybridizing region, and the hybridization from the hybridizing region The dissociation of the probe can be confirmed.

  In the probe, for example, a phosphate group may be added to the 3 'end. As will be described later, the amplification step using the primer reagent and the detection step using the probe may be performed, for example, in the same reaction system in which the primer reagent and the probe coexist. In this case, by using the probe with a phosphate group added to the 3 'end, for example, the probe itself can be sufficiently prevented from extending in the amplification step. In addition, the same effect can be obtained by adding the labeling substance to the 3 ′ end of the probe.

  In the detection step, for example, each probe may be used for each variant, or a common probe may be used for two or more types of variants. When there is one kind of probe, for example, the detection step may be performed in a reaction system including the one kind of probe. When there are two or more types of probes, for example, the detection step may be performed using a separate reaction system for each probe, or the detection step may be performed using a reaction system including all probes. Also good.

  When a plurality of the labeled probes are used as the probes, the labeling substances in the respective labeled probes may be the same or different, for example. In the latter case, for example, different labeling substances detected under different conditions, specific examples include different labeling substances detected at the different detection wavelengths. Thus, when the different labeling substances are used, for example, even in the same reaction system, the amplification product of each variant can be detected separately by changing the detection conditions.

  Although the specific example of the said probe is shown below, this invention is not restrict | limited to these illustrations.

  An example of a probe set for V1, V2, V3a, V3b and V6 (hereinafter referred to as Pack1 probe reagent) amplified with the Pack1 primer reagent is shown below. P1-1 is a probe that detects V1, V2, V3a, and V3b, and P1-2 is a probe that detects V6. Each probe in the Pack1 probe reagent can be used alone, for example.

P1-1 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 (SEQ ID NO: 22) 5'-caccaggagctgca-3 '
P1-2 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 (SEQ ID NO: 23) 5'-cctgtgtagtgcttcaa-3 '

  An example of a probe set for V8a, V8b, V4 and V4 ′ (hereinafter referred to as Pack2 probe reagent) amplified with the Pack2 primer reagent is shown below. P2-1 is a probe that detects V4 and V4 ', and P2-2 is a probe that detects V8a and V8b. Each probe in the Pack2 probe reagent can be used alone, for example, and the Pack2 probe reagent can be used independently of, for example, the Pack1 probe reagent.

P2-1 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 (SEQ ID NO: 24) 5'-agctccgcacctc-3 '
P2-2 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 25 (SEQ ID NO: 25) 5'-ccatgttgcagctga-3 '

  An example of a probe set for V5a, V5b, V7 and V9 (hereinafter referred to as Pack3 probe reagent) amplified with the Pack3 primer reagent is shown below. P3-1 is a probe for detecting V5a, V7 and V9, and P3-2 is a probe for detecting V5b. Each probe in the Pack3 probe reagent can be used alone, for example, and the Pack3 probe reagent can be used independently of the Pack1 probe reagent, for example.

P3-1 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 26 (SEQ ID NO: 26) 5'-caccaggagctgca-3 '
P3-2 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 27 (SEQ ID NO: 27) 5'-agtaaaggttcagagctc-3 '

  An example of a probe set (hereinafter referred to as Pack4 probe reagent) for KIF5B exon24-ALK, KIF5B exon15-ALK, KIF5B exon17-ALK, KLC1-ALK and TFG-ALK to be amplified with the Pack4 primer reagent is shown below. P4-1 is a probe that detects KIF5B exon24-ALK, KIF5B exon15-ALK, KIF5B exon17-ALK, KLC1-ALK, and TFG-ALK. The Pack4 probe reagent can be used separately and independently from the Pack1 probe reagent, for example.

P4-1 Oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 28 (SEQ ID NO: 28) 5'-caccaggagctgca-3 '

  The Pack1 probe reagent, the Pack2 probe reagent, the Pack3 probe reagent, and the Pack4 probe reagent are preferably labeled with a labeling substance as described above, for example, at any of the 5 ′ end and the 3 ′ end. It is preferable that one of the cytosine bases is labeled.

  In the analysis method of the present invention, the amplification step using the primer reagent of the present invention and the detection step using the probe may be performed in separate reaction systems, for example, or the same reaction. You may do it in the system. In the former case, for example, after performing the amplification reaction in a reaction system containing the primer reagent, the detection step is newly performed using the amplification product obtained in the reaction system of the amplification reaction and the probe. The reaction system may be prepared. In the former case, the amplification reaction is performed in a reaction system containing the primer reagent, and the detection step is performed by adding the probe to the reaction system of the amplification reaction during or after the amplification reaction. Also good. In the latter case, the amplification reaction may be performed in a reaction system in which the primer reagent and the probe coexist, and the detection step may be performed as it is in the reaction system. According to the latter method, for example, it is not necessary to expose the reaction system to the external environment during or after the amplification reaction due to the addition of the probe, and the amplification reaction and the detection step are performed. Can be done continuously.

  In the reaction system of the detection step, the amount of the probe is not particularly limited. As a specific example, the amount of one type of the probe per 50 μL of the reaction system has a lower limit of, for example, 1 pmol and an upper limit of, for example, 100 μmol. In the reaction system, the concentration of the probe is, for example, 10 to 1000 nmol / L, 20 to 500 nmol / L, respectively.

  When the detection step is detection of the amplification using the probe, it can be performed, for example, by melting curve analysis.

  The melting curve analysis is generally also referred to as “Tm analysis” using a melting temperature (Tm; melting temperature) at which a double-stranded nucleic acid is dissociated. For example, when a solution containing double-stranded nucleic acid such as double-stranded DNA is heated, the absorbance at 260 nm increases. This is because hydrogen bonds between both strands in double-stranded DNA are unwound by heating and dissociated into single-stranded DNA (DNA melting). When all the double-stranded DNAs are dissociated into single-stranded DNA, the absorbance is about 1.5 times the absorbance at the start of heating (absorbance of only the double-stranded DNA). Thereby, it can be determined that the melting is completed. Based on this phenomenon, the melting temperature (Tm) is generally defined as the temperature at which the absorbance reaches 50% of the total increase in absorbance.

  The theoretical value of the Tm value is, for example, the condition of the setting conditions “Oligoconc [μM] 0.2, Na eq. [MM] 50” by software “MELTCALC” (http://www.meltcalc.com/) or the like. It can be calculated by Also, the theoretical value of the Tm value can be determined by, for example, the nearest neighbor method.

In the case of the melting curve analysis, in the analysis method of the present invention, the detection step includes, for example, the following steps (D1) and (D2), and by detecting the formation of the hybrid, the ALK fusion gene in the test sample It may be a step of detecting.
(D1) The temperature of the reaction system containing the amplified product obtained in the amplification step and the probe is changed, and the hybrid state of the amplified product and the probe (for example, non-hybridized state, dissociated state, etc.) A measurement step (D2) of measuring a signal value to be detected: a step of detecting the formation of a hybrid between the amplified product and the probe from the fluctuation of the signal value accompanying the temperature change

  In the step (D1), for example, the double-stranded nucleic acid amplification product (eg, double-stranded DNA) obtained in the amplification step is dissociated into a single-stranded nucleic acid (eg, single-stranded DNA), and the dissociated Hybridization of the single-stranded nucleic acid and the probe is performed. This can be done, for example, by changing the temperature of the reaction system in the presence of the probe. In this case, as described above, it is preferable to change the temperature of the reaction system after performing an amplification reaction on the reaction system to which the probe has been added in advance.

  The dissociation into the single-stranded nucleic acid can be performed by heat treatment, and the heating temperature includes, for example, a temperature at which the double-stranded nucleic acid can be dissociated into the single-stranded nucleic acid. The heating temperature is not particularly limited, and is, for example, 85 to 95 ° C. The heating time is not particularly limited, and is usually 1 second to 10 minutes, preferably 1 second to 5 minutes.

  Hybridization of the dissociated single-stranded nucleic acid and the probe can be performed, for example, by lowering the heating temperature in the dissociation step after the dissociation step. The temperature condition is, for example, 40 to 50 ° C., and the treatment time at the lowered temperature is not particularly limited, and is, for example, 1 to 600 seconds.

  And about the said reaction system which hybridized the said single-stranded nucleic acid and the said probe, temperature is changed and the signal value which shows the fusion | melting state of the hybrid of the said amplified material and the said probe is measured. Specifically, for example, the reaction system is heated, that is, the hybrid of the single-stranded nucleic acid and the probe is heated, and the fluctuation of the signal value accompanying the temperature rise is measured. As described above, when the probe is the fluorescence quenching probe labeled with the cytosine (c) at the end, the fluorescence of the probe is reduced (or quenched) in a state of being hybridized with the single-stranded nucleic acid. In the state dissociated from the single-stranded nucleic acid, the probe emits fluorescence. Therefore, for example, the hybrid in which the fluorescence is reduced (or quenched) may be gradually heated, and the increase in the fluorescence intensity associated with the temperature increase may be measured.

  When measuring the variation of the fluorescence intensity, the temperature range is not particularly limited. The start temperature is, for example, room temperature to 85 ° C, preferably 25 to 70 ° C, and the end temperature is, for example, 40 to 105 ° C. The rate of temperature rise is not particularly limited, and is, for example, 0.1 to 20 ° C./second, and preferably 0.3 to 5 ° C./second.

  The step (D1) in the detection step is a step of measuring a signal value indicating the melting state of the hybrid of the amplification product and the probe as described above. The measurement of the signal may be, for example, the above-described absorbance measurement at 260 nm or the measurement of the signal of the labeling substance. Specifically, a labeled probe labeled with the labeling substance may be used as the probe, and the signal of the labeling substance may be measured. Examples of the labeled probe include a labeled probe that shows a signal alone and does not show a signal by hybridization, or a labeled probe that does not show a signal alone and shows a signal by hybridization. In the case of the former probe, the signal decreases (or disappears) when forming a hybrid (double-stranded DNA) with the amplified product, and shows a signal when the probe is dissociated from the amplified product by heating. In the latter probe, a signal is shown by forming a hybrid (double-stranded DNA) with the amplified product, and the signal decreases (or disappears) when the probe is released from the amplified product by heating. For this reason, by detecting the signal of the labeling substance, for example, detection of the progress of melting of the hybrid and determination of the Tm value can be performed in the same manner as the absorbance measurement at 260 nm.

  The signal detection of the labeling substance may be performed, for example, under conditions specific to the signal of the labeling substance. Examples of the detection condition include an excitation wavelength and a detection wavelength. The labeling probe and the labeling substance are as described above.

  The (D2) step in the detection step, as described above, forms a hybrid between the amplified product and the probe from the fluctuation of the signal value accompanying the temperature change, which is the measurement result of the (D1) step. This is a detecting step. Detection of the formation of the hybrid from the fluctuation of the signal value can be performed by a general method. As a specific example, when the change of the signal value can be confirmed, it can be determined that, for example, a hybrid is formed, and when the change of the signal value cannot be confirmed, for example, it can be determined that the hybrid is not formed. And based on this result, when no hybrid is formed, there is no amplified product of the variant for detection, that is, the variant is not amplified and the variant is not present in the test sample. I can judge. When a hybrid is formed, it can be determined that an amplification product of a variant for detection exists, that is, the variant is amplified and the variant is present in the test sample.

  In the step (D2), for example, the Tm value is determined by analyzing the fluctuation of the signal value. Specifically, the amount of change in fluorescence intensity per unit time at each temperature (−d fluorescence intensity change amount / dt or d fluorescence intensity change amount / dt) is calculated from the obtained fluorescence intensity, and the most changed value is calculated. The indicated temperature can be determined as the Tm value. When the labeled probe is the fluorescence quenching probe, for example, the amount of increase in fluorescence intensity is measured, and the temperature at which the amount of increase in fluorescence intensity per unit time (−d fluorescence intensity increase / dt) shows the lowest value, or The temperature at which the amount of increase in fluorescence intensity per unit time (d increase in fluorescence intensity / dt) is the highest can also be determined as the Tm value. On the other hand, when a probe that does not show a signal alone and shows a signal by hybridization is used as the probe, on the contrary, the decrease in fluorescence intensity may be measured.

  Next, the latter method using an intercalator is, for example, a method using an intercalator that intercalates between base pairs of a double-stranded nucleic acid. According to this method, for example, the amplified product can be detected based on the presence or absence of the intercalator that intercalates with the amplified product, or the amount of the intercalator that intercalates with the amplified product.

  The intercalator is not particularly limited, and a general one such as SYBR (trademark) Green can be used.

When using the intercalator, in the analysis method of the present invention, the detection step includes, for example, the steps (D3) and (D4), and by detecting the intercalator intercalated into a double-stranded nucleic acid, The step of detecting the ALK fusion gene in the test sample may be used.
(D3) A measurement step (D4) for measuring a signal value of the intercalator indicating a state intercalated with a double-stranded nucleic acid in a reaction system including the amplification product obtained in the amplification step and the intercalator. Detecting the intercalator intercalated into the amplified product from the value

  In the analysis method of the present invention, the amplification step using the primer reagent of the present invention and the detection step using the intercalator may be performed in separate reaction systems, for example, or the same You may carry out by reaction system. In the former case, for example, after the amplification reaction is performed in a reaction system containing the primer reagent, the amplification product obtained in the reaction system of the amplification reaction and the intercalator are used to newly detect the detection. You may prepare the reaction system of a process. In the former case, the amplification reaction is performed in a reaction system containing the primer reagent, and the detection step is performed by adding the intercalator to the reaction system of the amplification reaction during or after the amplification reaction. May be. In the latter case, the amplification reaction may be performed in a reaction system in which the primer reagent and the intercalator coexist, and the detection step may be performed as it is in the reaction system. According to the latter method, for example, it is not necessary to expose the reaction system to the external environment during or after the amplification reaction due to the addition of the intercalator, and the amplification reaction and the detection step are performed. Can be done continuously. When the amplification step is PCR, the latter method is also called real-time PCR, for example.

  In the reaction system of the detection step, the amount of the intercalator is not particularly limited.

  What is necessary is just to detect the signal of the said intercalator on the conditions peculiar to the signal of the said intercalator, for example. Examples of the detection condition include an excitation wavelength and a detection wavelength.

(5) Analysis Reagent Kit As described above, the analysis reagent kit of the present invention is an analysis reagent kit for the ALK fusion gene, and includes the primer reagent of the present invention. The amplification reagent kit of the present invention is characterized by including the primer reagent of the present invention, and other configurations and conditions are not particularly limited. According to the amplification reagent kit of the present invention, for example, a plurality of variants of the ALK fusion gene can be amplified simultaneously in the same reaction system, whereby the ALK fusion gene can be analyzed. Unless otherwise indicated, the description of the primer reagent of this invention, the amplification reagent kit, the amplification method, and the analysis method can be used for the analysis reagent kit of this invention.

  The analysis reagent kit of the present invention may further include, for example, a probe that hybridizes to the amplification product of the primer reagent. The probe is not particularly limited, and examples thereof include the probes described above. For the Pack1 primer reagent which is the primer reagent, the Pack1 probe reagent, for the Pack2 primer reagent, the Pack2 probe reagent, for the Pack3 primer reagent, the Pack3 probe reagent and the Pack4 primer reagent. On the other hand, it is preferable that the Pack4 probe reagent is included in combination.

  When the analysis reagent kit of the present invention includes the probe, for example, the primer reagent and the probe reagent in the combination are included in the same reaction system when used.

  Further, when the analysis reagent kit of the present invention includes the Pack1 primer reagent and the other Pack reagent, the analysis reagent kit of the present invention includes, for example, a combination of the Pack1 primer reagent and the Pack1 probe reagent, and another Pack Combinations of primer reagents and other Pack probe reagents may also be in a form where all are included in the same reaction system at the time of use.

  In addition, the analysis reagent kit of the present invention may have, for example, a form in which a Pack primer reagent and a Pack probe reagent are included in the same system when used for each Pack probe reagent. That is, a mode in which the combination of the Pack1 primer reagent and the Pack1 probe reagent and the combination of the other Pack primer reagent and the Pack probe reagent are respectively separate reagent systems can be exemplified. In this case, each reaction system can be prepared using a combination of each Pack primer reagent and each Pack probe reagent, and the amplification step and the detection step can be performed separately.

In the present invention, hereinafter, for example, a reagent containing Pack1 primer reagent and Pack1 probe reagent is referred to as Pack1 analysis reagent, and a reagent containing Pack2 primer reagent and Pack2 probe reagent is referred to as Pack2 analysis reagent, and Pack3 primer reagent A reagent containing the Pack3 probe reagent is called a Pack3 analysis reagent, and a reagent containing the Pack4 primer reagent and the Pack4 probe reagent is called a Pack4 analysis reagent. Examples of the combination in the analysis reagent of the present invention include the following 1 to 8.
1. Pack1 analysis reagent Pack1 analysis reagent / Pack2 analysis reagent3. Pack1 analysis reagent / Pack3 analysis reagent4. Pack1 analysis reagent / Pack4 analysis reagent5. Pack1 analysis reagent / Pack2 analysis reagent / Pack3 analysis reagent6. Pack1 analysis reagent / Pack2 analysis reagent / Pack4 analysis reagent7. Pack1 analysis reagent / Pack3 analysis reagent / Pack4 analysis reagent8. Pack1 analysis reagent / Pack2 analysis reagent / Pack3 analysis reagent / Pack4 analysis reagent

(6) Drug efficacy determination method The drug efficacy determination method of the present invention is a method for testing drug efficacy as described above, and the step of analyzing an ALK fusion gene by the ALK fusion gene analysis method of the present invention, and And a step of testing sensitivity based on the presence or absence of the ALK fusion gene. The medicinal efficacy determination method of the present invention is characterized in that an ALK fusion gene is analyzed by the analysis method of the present invention, and other conditions and steps are not particularly limited. Unless otherwise indicated, the above-described primer reagent of the present invention, the amplification method of the present invention, the analysis method of the present invention, etc. can be used as the method for determining the efficacy of the present invention.

  According to the method for determining the efficacy of the present invention, by using the amplification reaction using the primer reagent of the present invention, the ALK fusion gene can be analyzed with high sensitivity and the efficacy can be determined from the analysis result. The drug efficacy determination method of the present invention can be used, for example, to determine a treatment policy for a disease, for example, because it is possible to reduce or increase the dose of a drug, change to another therapeutic drug, etc. by determining the drug efficacy. Useful. Examples of the drug for which the drug efficacy is determined include an anticancer agent containing an ALK inhibitor as an active ingredient. The anticancer agent is, for example, an anticancer agent for treating lung cancer, and specific examples include crizotinib.

(7) Lung cancer morbidity test method The lung cancer morbidity test method of the present invention is a method for testing the possibility of lung cancer morbidity. A biological sample of a subject is subjected to the ALK fusion of the present invention. The method comprises the steps of analyzing an ALK fusion gene by a gene analysis method, and testing the possibility of lung cancer based on the presence or absence of the ALK fusion gene. The test method of the present invention is characterized in that an ALK fusion gene is analyzed by the analysis method of the present invention, and other conditions and steps are not particularly limited. Unless otherwise indicated, the primer reagent of the present invention, the amplification method of the present invention, the analysis method of the present invention, etc. can be used as the test method of the present invention.

  According to the test method of the present invention, by using the amplification reaction using the primer reagent of the present invention, the ALK fusion gene is analyzed with high sensitivity and the possibility of lung cancer is tested based on the analysis result. it can.

  Examples of the subject include a human. The above-mentioned explanation can be used for the biological sample, for example.

  In the test method of the present invention, a method for evaluating the possibility of lung cancer is not particularly limited. For example, when the ALK fusion gene is present in the subject's biological sample, the subject suffers from lung cancer. It can be evaluated that it is likely or likely. In addition, when the ALK fusion gene is not present in the biological sample of the subject, the subject can be evaluated as having no or low possibility of suffering from lung cancer.

(8) Others As the primer reagent, the amplification reagent kit, the amplification method, the analysis method, the analysis reagent kit, and the drug efficacy determination method of the present invention have been described with respect to the form in which the Pack1 primer reagent is essential. Instead of the Pack1 primer reagent, the Pack2 primer reagent, the Pack3 primer reagent, the Pack4 primer reagent, or a combination thereof may be used.

  Moreover, the analysis method, analysis reagent kit, and drug efficacy determination method of the present invention are not limited to, for example, the type of primer or the amplification step using the primer, and the probe may be used.

  In this case, the analysis method of the present invention includes a step of amplifying a template nucleic acid in a test sample, and a step of detecting an ALK fusion gene in the test sample by detecting amplification of the template nucleic acid using a probe. It is characterized by including. Unless otherwise indicated, the above description can be used for the analysis method of the present invention. Moreover, the description of the above-mentioned drug efficacy determination method can be used for the drug efficacy determination method of this invention except for analyzing an ALK fusion gene by this analysis method of this invention.

  The primer in the amplification step is not particularly limited, and for example, the primer reagent in the present invention can be used, and as the probe, the above-described various probe reagents are used according to the type of variant of the ALK fusion gene for detection purposes. it can.

  Moreover, the analysis reagent kit of the present invention is characterized by including at least one of the probe reagents described above, for example. The probe reagent is, for example, at least one selected from the group consisting of the Pack1 probe reagent, the Pack2 probe reagent, the Pack3 probe reagent, and the Pack4 probe reagent, and may be one type or a combination of two or more types. Good. The analysis reagent kit may further include the various Pack primer reagents described above, for example, depending on the type of the probe reagent.

  Next, examples of the present invention will be described. The present invention is not limited by the following examples.

[Example A1]
In this example, the ALK fusion gene was amplified using the Pack1 primer reagent, and it was confirmed that various variants could be amplified. The amplification was confirmed by Tm analysis using the Pack1 probe.

(1) Sample Each RNA was synthesized using the following oligonucleotides having the same sequence as variants A1, V2, V3a, V3b and V6 of the ALK fusion gene as templates. Each RNA was mixed with RNase Free Water and used as a sample. The concentration of each RNA in the sample was 8000 copies / test.

V1 oligonucleotide (SEQ ID NO: 32)
gggaaatatgaaaagccaaaatttgtgcagtgtttagcattcttggggaatggagatgttcttactggagactcaggtggagtcatgcttatatggagcaaaactactgtagagcccacacctgggaaaggacctaaagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacaggacgaactggatttcctcatggaagccctgatcatcagcaaattcaaccaccagaacattgttcgctgcattggggtgagcctgcaatccctgccc

V2 oligonucleotide (SEQ ID NO: 33)
gggaaatatgaaaagccaaaatttgtgcagtgtttagcattcttggggaatggagatgttcttactggagactcaggtggagtcatgcttatatggagcaaaactactgtagagcccacacctgggaaaggacctaaaggtgtatatcaaatcagcaaacaaatcaaagctcatgatggcagtgtgttcacactttgtcagatgagaaatgggatgttattaactggaggagggaaagacagaaaaataattctgtgggatcatgatctgaatcctgaaagagaaatagaggttcctgatcagtatggcacaatcagagctgtagcagaaggaaaggcagatcaatttttagtaggcacatcacgaaactttattttacgaggaacatttaatgatggcttccaaatagaagtacagggtcatacagatgagctttggggtcttgccacacatcccttcaaagatttgctcttgacatgtgctcaggacaggcaggtgtgcctgtggaactcaatggaacacaggctggaatggaccaggctggtagatgaaccaggacactgtgcagattttcatccaagtggcacagtggtggccataggaacgcactcaggcaggtggtttgttctggatgcagaaaccagagatctagtttctatccacacagacgggaatgaacagctctctgtgatgcgctactcaatagatggtaccttcctggctgtaggatctcatgacaactttatttacctctatgtagtctctgaaaatggaagaaaatatagcagatatggaaggtgcactggacattccagctacatcacacaccttgactggtccccagacaacaagtatataatgtctaactcgggagactatgaaatattgtacttgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaacc ccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatg

V3a oligonucleotide (SEQ ID NO: 34)
tgatgttcaagatcgcctgtcagctcttgagtcacgagttcagcaacaagaagatgaaatcactgtgctaaaggcggctttggctgatgttttgaggcgtcttgcaatctctgaagatcatgtggcctcagtgaaaaaatcagtctcaagtaaaggccaaccaagccctcgagcagttattcccatgtcctgtataaccaatggaagtggtgcaaacagaaaaccaagtcataccagtgctgtctcaattgcaggaaaagaaactctttcatctgctgctaaaagtggtacagaaaaaaagaaagaaaaaccacaaggacagagagaaaaaaaagaggaatctcattctaatgatcaaagtccacaaattcgagcatcaccttctccccagccctcttcacaacctctccaaatacacagacaaactccagaaagcaagaatgctactcccaccaaaagcataaaacgaccatcaccagctgaaaagtcacataattcttgggaaaattcagatgatagccgtaataaattgtcgaaaataccttcaacacccaaattaataccaaaagttaccaaaactgcagacaagcataaagatgtcatcatcaaccaagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacaggacgaactggatttcctcatggaagccctgatcatcagcaa

V3b oligonucleotide (SEQ ID NO: 35)
tgatgttcaagatcgcctgtcagctcttgagtcacgagttcagcaacaagaagatgaaatcactgtgctaaaggcggctttggctgatgttttgaggcgtcttgcaatctctgaagatcatgtggcctcagtgaaaaaatcagtctcaagtaaaggccaaccaagccctcgagcagttattcccatgtcctgtataaccaatggaagtggtgcaaacagaaaaccaagtcataccagtgctgtctcaattgcaggaaaagaaactctttcatctgctgctaaaagtggtacagaaaaaaagaaagaaaaaccacaaggacagagagaaaaaaaagaggaatctcattctaatgatcaaagtccacaaattcgagcatcaccttctccccagccctcttcacaacctctccaaatacacagacaaactccagaaagcaagaatgctactcccaccaaaagcataaaacgaccatcaccagctgaaaagtcacataattcttgggaaaattcagatgatagccgtaataaattgtcgaaaataccttcaacacccaaattaataccaaaagttaccaaaactgcagacaagcataaagatgtcatcatcaaccaagcaaaaatgtcaactcgcgaaaaaaacagccaagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacaggacgaactggatttcctcatggaagccctgatcatcagcaaattcaac

V6 oligonucleotide (SEQ ID NO: 36)
aatctcatattttcttctggacctggagcggcaattcactaacaagaaaacagggaatttttgggaaatatgaaaagccaaaatttgtgcagtgtttagcattcttggggaatggagatgttcttactggagactcaggtggagtcatgcttatatggagcaaaactactgtagagcccacacctgggaaaggacctaaaggaagtggcctgtgtagtgcttcaagggccaggctgccaggccatgttgcagctgaccacccacctgcagtgtaccgccGgaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagca

(2) Reagents Various F primers, R primers and probes were mixed so as to have the following composition to prepare mixed reagent 1 (hereinafter also referred to as “P-mix1”) containing Pack1 primer reagent and Pack1 probe reagent. . In the above composition, the TBP-F2 and TBP-R2 primer sets are control primer sets for confirming whether the amplification reaction is normally occurring, and the 5PB-TBP-F2 probe is A control probe for detecting amplification by a control primer set. In each probe, FL, TAMRA ™ and PB are fluorescent dyes for labeling, FL is BODIPY ™ FL, and PB is Pacific Blue ™. In addition, RT-mix was prepared by mixing the components so as to have the following composition.

  In Table 5, the RNase Inhibitor used was RNase Inhibitor (Recombinant) manufactured by TOYOBO, and the reverse transcriptase used was Superscript (registered trademark) III manufactured by Invitrogen.

(3) RT-PCR and Tm analysis A reaction solution is prepared using each reagent, a commercially available reagent kit (i-densy (trademark) Pack UNIVERSAL, ARKRAY, Inc.), the P-mix1 and the RT-mix. Then, RT-PCR was performed using a gene analyzer (i-densy (trademark)). Specifically, using the gene analyzer, according to the instructions attached to the reagent kit, 36 μL of the reagent kit, 9 μL of the P-mix1, 1 μL of the RT-mix and 4 μL of the sample. A total of 50 μL of the mixture was automatically prepared, and RT-PCR was started. The conditions of RT-PCR were as follows: treatment at 55 ° C. for 900 seconds, treatment at 95 ° C. for 120 seconds, repetition of 50 cycles of 95 ° C. for 1 second and 58 ° C. for 30 seconds, and further 95 ° C. for 1 second Treated at 40 ° C. for 60 seconds. Subsequently, the reaction solution was heated from 40 ° C. to 75 ° C. at a rate of temperature increase of 1 ° C./3 seconds, the change in fluorescence intensity over time was measured, and Tm analysis was performed. Measurement wavelengths were 515 to 555 nm (detection of BODIPY ™ FL), 585 to 700 nm (detection of TAMRA), and 450 to 700 nm (detection of Pacific Blue ™).

  These results are shown in FIG. FIG. 1 is a graph of Tm analysis showing changes in fluorescence intensity with increasing temperature. In FIG. 1, the vertical axis indicates the change in fluorescence intensity at each temperature (hereinafter also referred to as “fluorescence intensity change amount”). The unit of the vertical axis is the differential value “−d fluorescence intensity increase / dt”, which is indicated as “−dF / dt”. In FIG. 1, the horizontal axis indicates the temperature (° C.) at the time of measurement. When an amplification product is generated, in Tm analysis, a hybrid is formed between the amplification product and the probe, whereby the fluorescence of the probe is quenched, and the probe is dissociated from the amplification product by heating. Fluorescence occurs. Then, in the graph showing the change in fluorescence intensity (-dF / dt), the peak peak indicates the dissociation of the probe from the hybrid, so that it can be determined that the amplified product is present.

  As shown in FIG. 1, by using the Pack1 primer reagent and the Pack1 probe reagent, peaks are confirmed for any of the V1, V2, V3a, V3b, and V6 samples. did it. From this, it was found that these variants can be amplified by the Pack1 primer reagent, and the amplified product can be detected by the Pack1 probe.

[Example A2]
In this example, the ALK fusion gene was amplified using the Pack2 primer reagent, and it was confirmed that various variants could be amplified. The amplification was confirmed by Tm analysis using the Pack2 probe.

(1) Sample Each RNA was synthesized using the following oligonucleotides having the same sequence as variants A8 fusion gene variants V8a, V8b, V4 and V4 ′ as templates. Each RNA was mixed with RNase Free Water and used as a sample. The concentration of each RNA in the sample was 8000 copies / test.

V8a oligonucleotide (SEQ ID NO: 37)
acagatgagctttggggtcttgccacacatcccttcaaagatttgctcttgacatgtgctcaggacaggcaggtgtgcctgtggaactcaatggaacacaggctggaatggaccaggctggtagatgaaccaggacactgtgcagattttcatccaagtggcacagtggtggccataggaacgcactcaggcaggccatgttgcagctgaccacccacctgcagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactg

V8b oligonucleotide (SEQ ID NO: 38)
caggcaggtgtgcctgtggaactcaatggaacacaggctggaatggaccaggctggtagatgaaccaggacactgtgcagattttcatccaagtggcacagtggtggccataggaacgcactcaggcaggagacaaaaacatgaagtcaattttcccaaaattaaactcattaaaaaatgtggaatgctgccaggccatgttgcagctgaccacccacctgcagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactg

V4 oligonucleotide (SEQ ID NO: 39)
caaatcaaagctcatgatggcagtgtgttcacactttgtcagatgagaaatgggatgttattaactggaggagggaaagacagaaaaataattctgtgggatcatgatctgaatCctgaaagagaaatagagatatgctggatgagccctgagtacaagctgagcaagctccgcacctcgaCcatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaac

V4 ′ oligonucleotide (SEQ ID NO: 40)
gggaaatatgaaaagccaaaatttgtgcagtgtttagcattcttggggaatggagatgttcttactggagactcaggtggagtcatgcttatatggagcaaaactactgtagagcccacacctgggaaaggacctaaaggtgtatatcaaatcagcaaacaaatcaaagctcatgatggcagtgtgttcacactttgtcagatgagaaatgggatgttattaactggaggagggaaagacagaaaaataattctgtgggatcatgatctgaatcctgaaagagaaatagaggttcctgatcagtatggcacaatcagagctgtagcagaaggaaaggcagatcaatttttagtaggcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacaggacgaactggatttcctcatggaagccctgatcatcagcaaattcaaccaccagaacat

(2) Reagent Various F primers, R primers and probes were mixed so as to have the following composition to prepare mixed reagent 2 (hereinafter also referred to as “P-mix2”) containing Pack2 primer reagent and Pack2 probe reagent. .

(3) RT-PCR and Tm analysis RT-PCR and Tm analysis were performed in the same manner as in Example A1 except that the sample was used and the P-mix2 was used instead of the P-mix1. .

  These results are shown in FIG. FIG. 2 is a graph of Tm analysis showing changes in fluorescence intensity with increasing temperature. In FIG. 2, the vertical axis and the horizontal axis are the same as those in FIG. 1 of Example A1.

  As shown in FIG. 2, by using the Pack2 primer reagent and the Pack2 probe reagent, peaks were confirmed in any of the V4 sample, the V4 'sample, the V8a sample, and the V8b sample. From this, it was found that these variants can be amplified by the Pack2 primer reagent, and the amplified product can be detected by the Pack2 probe.

[Example A3]
In this example, the ALK fusion gene was amplified using the Pack3 primer reagent, and it was confirmed that various variants could be amplified. The amplification was confirmed by Tm analysis using the Pack3 probe.

(1) Sample Each RNA was synthesized using the following oligonucleotides having the same sequence as variants A5 fusion gene variants V5a, V5b, V7 and V9 as templates. Each RNA was mixed with RNase Free Water and used as a sample. The concentration of each RNA in the sample was 8000 copies / test.

V5a oligonucleotide (SEQ ID NO: 41)
ttctgctgcaagtacttctgatgttcaagatcgcctgtcagctcttgagtcacgagttcagcaacaagaagatgaaatcactgtgctaaaggcggctttggctgatgttttgaggcgtcttgcaatctctgaagatcatgtggcctcagtgaaaaaatcagtctcaagtaaagtgtaccgccGgaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaa

V5b oligonucleotide (SEQ ID NO: 42)
atttctgctgcaagtacttctgatgttcaagatcgcctgtcagctcttgagtcacgagttcagcaacaagaagatgaaatcactgtgctaaaggcggctttggctgatgttttgaggcgtcttgcaatctctgaagatcatgtggcctcagtgaaaaaatcagtctcaagtaaaggttcagagctcaggggaggatatggagatccagggaggcttcctgtaggaagtggcctgtgtagtgcttcaagggccaggctgccaggccatgttgcagctgaccacccacctgcagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacaggacgaactggatttcctcatggaagccctgatcatcagcaaattcaaccacca

V7 oligonucleotide (SEQ ID NO: 43)
agcaaaactactgtagagcccacacctgggaaaggacctaaaggtgtatatcaaatcagcaaacaaatcaaagctcatgatggcagtgtgttcacactttgtcagatgagaaatgggatgttattaactggaggagggaaagacagaaaaataattctgtgggatcatgatctgaatCctgaaagagaaatagagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtg

V9 oligonucleotide (SEQ ID NO: 44)
aaagccaaaatttgtgcagtgtttagcattcttggggaatggagatgttcttactggagactcaggtggagtcatgcttatatggagcaaaactactgtagagcccacacctgggaaaggacctaaaggtgtatatcaaatcagcaaacaaatcaaagctcatgatggcagtgtgttcacactttgtcagatgagaaatgggatgttattaactggaggagggaaagacagaaaaataattctgtgggatcatgatctgaatcctgaaagagaaatagaggttcctgatcagtatggcacaatcagagctgtagcagaaggaaaggcagatcaatttttagtaggcacatcacgaaactttattttacgaggaacatttaatgatggcttccaaatagaagtacagggtcatacagatgagctttggggtcttgccacacatcccttcaaagatttgctcttgacatgtgctcaggacaggcaggtgtgcctgtggaactcaatggaacacaggctggaatggaccaggctggtagatgaaccaggacactgtgcagattttcatccaagtggcacagtggtggccataggaacgcactcaggcaggtggtttgttctggatgcagaaaccagagatctagtttctatccacacagacgggaatgaacagctctctgtgatgcgctactcaatagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatcaccctcattcggggtctgggccatggagcctttggggaggtgtatgaaggccaggtgtccggaatgcccaacgacccaagccccctgcaagtggctgtgaagacgctgcctgaagtGtgctctgaacag gacgaactggatttcctcatggaagccctgatcatcagcaaattcaacca

(2) Reagent Various F primers, R primers and probes were mixed so as to have the following composition to prepare mixed reagent 3 (hereinafter also referred to as “P-mix3”) containing Pack3 primer reagent and Pack3 probe reagent. . In the primer (F_V7), s was g and c, and the primer having g and the primer having c were equimolar.

(3) RT-PCR and Tm analysis RT-PCR and Tm analysis were performed in the same manner as in Example A1 except that the sample was used and the P-mix3 was used instead of the P-mix1. .

  These results are shown in FIG. FIG. 3 is a graph of Tm analysis showing changes in fluorescence intensity with increasing temperature. In FIG. 3, the vertical axis and the horizontal axis are the same as those in FIG. 1 of Example A1.

  As shown in FIG. 3, by using the Pack3 primer reagent and the Pack3 probe reagent, a peak could be confirmed for any sample. From this, it was found that these variants can be amplified by the Pack3 primer reagent, and the amplified product can be detected by the Pack3 probe.

[Example A4]
In this example, the ALK fusion gene was amplified using the Pack4 primer reagent, and it was confirmed that various variants could be amplified. The amplification was confirmed by Tm analysis using the Pack4 probe.

(1) Sample Each ALK fusion gene variant KIF5B exon24-ALK, KIF5B exon15-ALK, KIF5B exon17-ALK, KLC1-ALK and TFG-ALK were used as templates to synthesize each RNA. Each RNA was mixed with RNase Free Water and used as a sample. The concentration of each RNA in the sample was 8000 copies / test.

KIF5B exon24-ALK oligonucleotide (SEQ ID NO: 45)
gcgacttcgagctacagctgagagagtgaaagctttggaatcagcactgaaagaagctaaagaaaatgcatctcgtgatcgcaaacgctatcagcaagaagtagatcgcataaaggaagcagtcaggtcaaagaatatggccagaagagggcattctgcacagattgtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacat

KIF5B exon15-ALK oligonucleotide (SEQ ID NO: 46)
ccaaccaccagaaaaaacgagcagctgagatgatggcatctttactaaaagaccttgcagaaataggaattgctgtgggaaataatgatgtaaagccaaccaccagaaaaaacgagcagctgagatgatggcatctttactaaaagaccttgcagaaataggaattgctgtgggaaataatgatgtaaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagt

KIF5B exon17-ALK oligonucleotide (SEQ ID NO: 47)
caaaaaaatggaagaaaatgaaaaggagttagcagcatgtcagcttcgtatctctcaacatgaagccaaaatcaagtcattgactgaataccttcaaaatgtggaacaaaagaaaagacagttggaggaatctgtcgatgccctcagtgaagaactagtccagcttcgagcacaagtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagt

KLC1-ALK oligonucleotide (SEQ ID NO: 48)
aaccagggcaagtatgaagaagtagaatattattatcaaagagccctcgagatctaccagacaaaactgggacctgatgaccccaacgtggctaagacgaaaaataacctggcatcctgctatttgaaacaaggaaagttcaagcaagcagaaacactgtacaaagagattctcactcgtgcacatgaaagggagtttggttctgtagatgtgtaccgccGgaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaag

TFG-ALK oligonucleotide (SEQ ID NO: 49)
tgaaactgacattatttgttaatggccagccaagaccccttgaatcaagtcaggtgaaatatctccgtcgagaactgatagaacttcgaaataaagtgaatcgtttattggatagcttggaaccacctggagaaccaggaccttccaccaatattcctgaaaatgtgtaccgccggaagcaccaggagctgcaagccatgcagatggagctgcagagccctgagtacaagctgagcaagctccgcacctcgaccatcatgaccgactacaaccccaactactgctttgctggcaagacctcctccatcagtgacctgaaggaggtgccgcggaaaaacatca

(2) Reagent Various F primers, R primers and probes were mixed so as to have the following composition to prepare mixed reagent 4 (hereinafter also referred to as “P-mix4”) containing Pack4 primer reagent and Pack4 probe reagent. .

(3) RT-PCR and Tm analysis RT-PCR and Tm analysis were performed in the same manner as in Example A1 except that the sample was used and the P-mix4 was used instead of the P-mix1. .

  These results are shown in FIG. FIG. 4 is a graph of Tm analysis showing changes in fluorescence intensity with increasing temperature. In FIG. 4, the vertical axis and the horizontal axis are the same as in FIG. 1 of Example A1.

  As shown in FIG. 4, by using the Pack4 primer reagent and the Pack4 probe reagent, a peak could be confirmed for any sample. From this, it was found that these variants can be amplified by the Pack4 primer reagent, and the amplified product can be detected by the Pack4 probe.

  Although the present invention has been described above with reference to the exemplary embodiments and examples, the present invention can be modified in various ways that can be understood by those skilled in the art within the scope of the above invention.

  This application claims the priority on the basis of Japanese application Japanese Patent Application No. 2014-177356 for which it applied on September 1, 2014, and takes in those the indications of all here.

As described above, according to the primer reagent of the present invention, variants V1, V2, V3a, V3b and V6 of the ALK fusion gene can be simultaneously amplified in the same reaction system. For this reason, according to the present invention, by using one reaction system, it is possible to easily detect a plurality of variants of the ALK fusion gene. Therefore, the present invention is useful, for example, in diagnosis of morbidity of lung cancer and treatment of lung cancer.

Claims (12)

Forward primer consisting of the following oligonucleotide (F_V1 / 6),
Forward primer consisting of the following oligonucleotide (F_V2),
Forward primer consisting of the following oligonucleotide (F_V3a),
Forward primer consisting of the following oligonucleotide (F_V3b),
A primer reagent for an ALK fusion gene, comprising a reverse primer composed of the following (R_V / multi) oligonucleotide and a reverse primer composed of the following (R_V6) oligonucleotide.
(F_V1 / 6) Oligonucleotide consisting of the base sequence of SEQ ID NO: 1 (F_V2) Oligonucleotide consisting of the base sequence of SEQ ID NO: 2 (F_V3a) Oligonucleotide consisting of the base sequence of SEQ ID NO: 3 (F_V3b) Base sequence of SEQ ID NO: 4 An oligonucleotide consisting of the base sequence of SEQ ID NO: 5 (R_V6) An oligonucleotide consisting of the base sequence of SEQ ID NO: 6 Furthermore, a forward primer comprising the following oligonucleotide (F_V8a),
Forward primer consisting of the following oligonucleotide (F_V8b),
Forward primer consisting of the following oligonucleotide (F_V4),
Forward primer consisting of the following oligonucleotide (F_V4 '),
The primer reagent of Claim 1 containing the reverse primer which consists of the following (R_V8a / b) oligonucleotide and the reverse primer which consists of the following (R_V4 / 4 ') oligonucleotide.
(F_V8a) Oligonucleotide consisting of the base sequence of SEQ ID NO: 7 (F_V8b) Oligonucleotide consisting of the base sequence of SEQ ID NO: 8 (F_V4) Oligonucleotide consisting of the base sequence of SEQ ID NO: 9 (F_V4 ') From the base sequence of SEQ ID NO: 10 Oligonucleotide (R_V8a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 11 (R_V4 / 4 ') oligonucleotide consisting of the base sequence of SEQ ID NO: 12 Furthermore, a forward primer comprising the following oligonucleotide (F_V5a / b),
Forward primer consisting of the following oligonucleotide (F_V7),
The primer reagent according to claim 1 or 2, comprising a forward primer comprising the following oligonucleotide (F_V9) and a reverse primer comprising the (R_V / multi) oligonucleotide and a reverse primer comprising the following (R_V5b) oligonucleotide.
(F_V5a / b) oligonucleotide consisting of the base sequence of SEQ ID NO: 13 (F_V7) oligonucleotide consisting of the base sequence of SEQ ID NO: 14 (F_V9) oligonucleotide consisting of the base sequence of SEQ ID NO: 15 (R_V / multi) of SEQ ID NO: 5 Oligonucleotide consisting of a base sequence (R_V5b) Oligonucleotide consisting of the base sequence of SEQ ID NO: 16 Furthermore, the forward primer consisting of the following oligonucleotide (F_KIF / e24),
Forward primer consisting of the following oligonucleotide (F_KIF / e15),
Forward primer consisting of the following oligonucleotide (F_KIF / e17),
Forward primer consisting of the following oligonucleotide (F_KLC1),
The primer reagent according to any one of claims 1 to 3, comprising a forward primer composed of the following oligonucleotide (F_TFG) and a reverse primer composed of the (R_V / multi) oligonucleotide.
(F_KIF / e24) oligonucleotide consisting of the base sequence of SEQ ID NO: 17 (F_KIF / e15) oligonucleotide consisting of the base sequence of SEQ ID NO: 18 (F_KIF / e17) oligonucleotide consisting of the base sequence of SEQ ID NO: 19 (F_KLC1) SEQ ID NO: Oligonucleotide consisting of 20 base sequences (F_TFG) Oligonucleotide consisting of the base sequence of SEQ ID NO: 21 (R_V / multi) Oligonucleotide consisting of the base sequence of SEQ ID NO: 5 An ALK fusion gene amplification reagent kit comprising the ALK fusion gene primer reagent according to any one of claims 1 to 4. A method for amplifying an ALK fusion gene, comprising the step of amplifying a template nucleic acid in one reaction system comprising the primer reagent for the ALK fusion gene according to any one of claims 1 to 4. A step of amplifying a template nucleic acid in a test sample by the ALK fusion gene amplification method according to claim 6, and
A method for analyzing an ALK fusion gene comprising the step of detecting an ALK fusion gene in the test sample by detecting amplification of the template nucleic acid. The analysis method according to claim 7, wherein in the detection step, detection of amplification of the template nucleic acid is detection using a probe. The analysis method according to claim 8, wherein the detection using the probe is melting curve analysis. An ALK fusion gene analysis reagent kit comprising the ALK fusion gene primer reagent according to any one of claims 1 to 4. The analysis reagent kit according to claim 10, further comprising a probe that hybridizes to an amplification product by the primer reagent. Analyzing the ALK fusion gene by the method for analyzing an ALK fusion gene according to any one of claims 7 to 9, and
A method for testing the efficacy of a drug, comprising a step of testing sensitivity to the drug based on the presence or absence of the ALK fusion gene.

Images