JP2016010402A - Amplification method for ultralow volume of nucleic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a production method of a conjugate which can be targeted to a substrate DNA of an ultralow volume of several molecules level, the conjugate containing a DNA synthetase and silica based nano-pore material, in nucleic acid amplification reactions, such as PCR.SOLUTION: A DNA synthetase-BSA-silica based nano-pore material conjugate is produced by once or more washing process with a serum albumin (BSA)-containing buffer solution after immobilizing DNA synthetase to a silica based nano-pore material. The contamination during nucleic acid amplification reaction is inhibited, the amplification sensitivity of target DNA can be improved, and the micro reactor concerned can withstand repeated use of two or more times, by using a DNA synthetase-silica based nano-pore material conjugate-supported micro reactor in which a DNA synthetase used for LAMP method is immobilized in a silica based nano-pore material-supported micro channel.

Description

  The present invention relates to a technique for improving a nucleic acid amplification method using a DNA synthase-silica nanopore material complex. More specifically, in the process of complexing DNA synthase and silica-based nanoporous material, DNA synthase-BSA that actively promotes complexation of DNA synthase and bovine serum albumin (BSA). -Method for forming silica-based nanoporous material complex, and extremely small amount of DNA capable of targeting template DNA at several molecular levels by using the DNA synthase-BSA-silica-based nanoporous material complex The present invention relates to an amplification technique.

In genetic diagnosis for environmental samples, illness / health, and criminal investigations based on DNA sequence analysis, the target sample is a rare sample, so a very small amount of DNA, ultimately 1 There is a need for a rapid and simple analysis method for molecular-level DNA, and it is necessary to develop an extremely small amount of nucleic acid amplification technology that enables such analysis.
In other words, non-specific DNA amplification reaction can be suppressed by a simple method. As a result, specific and highly sensitive amplification of a very small amount of substrate DNA is possible, and DNA amplification products in the reaction solution can be easily recovered. Proposal and development of new technologies that are possible is eagerly desired.

  As a rapid and simple nucleic acid amplification method, a DNA amplification method using a DNA synthesizing enzyme such as a polymerase chain reaction (PCR method) can be considered. However, conventional nucleic acid amplification techniques such as the PCR method accidentally occur from outside the reaction system. Because there were problems such as a small amount of DNA different from the contaminated target DNA or non-specific DNA amplification derived from primers, it was difficult to specifically and sensitively amplify a very small amount of DNA at several molecular levels. It was. In general, in the case of the PCR method, the amount of substrate DNA in a 50 μL reaction system needs to be in the order of 1 ng (10 7th molecule), and the detection limit is about 10 pg (10 5th molecule). It is said.

As a prior art in amplifying DNA from a single molecule level, a digital PCR method has been proposed which enables accurate quantification of trace genes. Specifically, this method is a technique for performing PCR after limiting dilution of a nucleic acid sample to the level of one molecule in a well of a titer plate and evaluating the absolute amount of a DNA amplification product by fluorescence detection (Non-patent Document 1). ). Furthermore, in recent years, development of digital PCR devices using microdroplets (emulsions) has progressed (Non-Patent Document 2).
However, the above-mentioned digital PCR method has also pointed out a problem of non-specific DNA amplification derived from a trace amount of DNA different from the target DNA accidentally mixed from outside the reaction system or a primer. This method is mainly a technique for evaluating the expression level of a gene, and a technique for easily recovering a DNA amplification product from a droplet or the like has not been established.

  On the other hand, conventionally, protein immobilization technology related to an artificial protein complex that adsorbs proteins inside the pores of silica-based nanoporous materials such as MCM, SBA, and FSM type and retains the activity has been applied to enzymes. In addition, there has been known a method in which an enzyme is immobilized inside the pores of these silica-based nanoporous materials and reacted with a substrate (Patent Documents 1 and 2 and Non-Patent Document 3). Recently, in order to selectively amplify a small amount of DNA, the present inventors have used the silica-based nanoporous material, and the DNA synthesizing enzyme is immobilized on the silica-based nanoporous material to form a complex. A method for producing an enzyme-silica nanoporous material composite and amplifying a target minute amount of DNA was developed and applied for a patent (Patent Document 3, Non-Patent Document 4). However, by using this method, it has been confirmed that selective amplification can be performed up to the amplification of a minute amount of DNA at the 1 ng level, but it has been difficult to apply to a very small amount of DNA sample.

  In addition, the prior art relating to the immobilization of DNA synthetase has other features such as immobilizing the DNA synthetase on a porous titania membrane, a gold surface-treated glass substrate, etc., and expressing the enzyme activity with high efficiency. Although an immobilized enzyme has been developed (Non-Patent Documents 5, 6, and 7), there is no report example in which the technique is applied to a DNA amplification reaction targeting a trace amount of DNA.

  Therefore, in the conventional DNA amplification method using DNA synthase, the side reaction during the DNA amplification reaction is further suppressed as much as possible, and the technology for optimizing the DNA amplification reaction environment is developed. There has been a strong demand to provide a highly accurate DNA amplification method that can improve the performance and sensitivity and can be applied to a very small amount of DNA at several molecular levels.

By the way, in recent years, especially in the field of diagnostic technology where specificity is regarded as important, the LAMP method in which an amplification reaction is performed with only one type of DNA synthase having isothermal and strand displacement activity is a rapid, simple and accurate amplification of nucleic acids. -It has attracted attention as a detection method (Non-patent Document 8).
However, in the LAMP method, non-specific DNA amplification in negative control experiments often occurs due to more serious template contamination (contamination) as compared with the PCR method, and the presence or absence of the amplified target gene sequence is accurately determined. The determination may be difficult (Non-Patent Document 9).
Therefore, in the DNA amplification reaction by the LAMP method, there has been a strong demand for technical development for suppressing side reactions due to contamination and optimizing the DNA amplification reaction environment.

Japanese Patent No. 4785174 JP 2000-139459 A JP 2014-103924 A (released on June 9, 2014) Japanese Patent No. 4963117

B. Vogelstein et al. , Proc. Natl. Acad. Sci. USA, vol. 96, pp. 9236-9241 (1999) M.M. Baker, Nat. Methods, vol. 9, pp. 541-544 (2012) Toyota R & D Review Vol. 36, no. 2 (2001.6) 57-62 Shunichi Matsuura et al., Construction of high-efficiency DNA amplification system using nanopore reaction field, Abstract of Molecular Biology (December 11, 2012) M.M. G. Bellino et al. , Small, vol. 6, pp. 1221-1225 (2012) G. Lim et al. , Anal. Biochem. , Vol. 419, pp. 205-210 (2011) G. Lim et al. , Anal. Biochem. , Vol. 432, pp. 139-141 (2013) Virus Vol. 54, no. 1, pp. 107-112 (2004) Modern Media Vol. 54, no. 10, pp. 283-301 (2008) Toyota R & D Review Vol. 29, no. 2 (19944.6) pp. 11-22 T. T. et al. Kimura et al. , Adv. Funct. Mater. , Vol. 19, pp. 511-527 (2009) S. Inagaki et al. , J .; Chem. Soc. Chem. Commun. , Pp. 680-682 (1993) D. Zhao et al. , Science, vol. 279, pp. 548-552 (1998) N. Wang et al. , Microporous Mesoporous Mater. , Vol. 91, pp. 156-160 (2006)

The present invention improves the technique (patent document 3, non-patent document 4) for amplifying a trace amount of DNA using the DNA synthase-silica nanoporous material complex previously developed by the present inventors. The present invention provides a method for amplifying with high accuracy using a very small amount of substrate DNA as a target. Specifically, the DNA synthesis reaction environment of the DNA synthase-silica nanoporous material complex is prepared, and various reaction substrates (DNA, primers, dNTPs) that interact with the DNA synthase during the DNA amplification reaction are affected. DNA amplification method applicable to a very small amount of DNA amplification that suppresses non-specific DNA amplification reaction caused by an excessive amount of primer as much as possible and enhances optimization of the reaction substrate concentration around the enzyme to the maximum without giving And an improved method for producing a DNA synthase-silica nanoporous material composite used in the method.
Another object of the present invention is to provide a technique for preventing contamination in the LAMP method and performing a DNA amplification reaction more efficiently and accurately.

  In order to suppress a side reaction during a DNA amplification reaction in a method for amplifying a trace amount of DNA using a DNA synthase-silica nanopore material composite (Patent Document 3, Non-Patent Document 4), The present inventors recalled that DNA contaminants and the like mixed by an immobilization operation or the like were removed from the DNA synthase-silica nanoporous material complex by a washing step using a buffer solution. At that time, if a general immobilized enzyme washing method is used, a buffer solution such as a normal phosphate buffer solution or borate buffer solution will be used. Expected to stabilize the enzyme by serum albumin and suppress the adsorption of DNA to the regular pore surface of silica-based nanoporous material, which is known to promote the stabilization of the resin and the prevention of adhesion to the inner wall of the plastic container. The idea was to use a buffer containing bovine serum albumin (BSA). However, BSA certainly has a high enzyme stabilization and DNA adsorption suppression effect, but because of its property of adsorbing to the hydrophobic surface of silica-based nanoporous materials, it is adsorbed on silica-based nanoporous materials. There is a concern that even the DNA synthase may be excluded from the system by competitive adsorption. In addition, nonspecific DNA amplification derived from a small amount of nucleic acid contained in a BSA purified product may inhibit selective amplification of a very small amount of DNA at several molecular levels.

In spite of such serious concern, the present inventors dared to include a buffer solution containing bovine serum albumin (BSA) for the DNA synthase-silica nanoporous material complex. As a result of performing the washing step according to the above, and recovering and subjecting it to a DNA amplification reaction, it was surprisingly possible to obtain an experimental result that side reactions were suppressed and the efficiency of the amplification reaction was increased.
Therefore, in order to further enhance the accuracy of the amplification reaction, the DNA synthase is immobilized on the silica-based nanoporous material in order to promote the complexation of the DNA synthase-silica-based nanoporous material complex with BSA. Also in the operation, the BSA-containing buffer was positively immobilized. Moreover, the washing | cleaning and collection | recovery processes by the BSA containing buffer solution after fixation were repeated several times. As described above, when the “DNA synthase-BSA-silica nanoporous material complex” was reliably formed, the substrate DNA was amplified by a typical PCR method. In the case of a very small amount of substrate DNA at the molecular level, specific and sensitive amplification was successful.
Four types of long-chain DNA (616, 1272, 2566, 5027 base pairs) inserted into a circular plasmid DNA (T-Vector pMD20) together with double-stranded and single-stranded linear DNA of 100 base pairs as substrate DNA These specific and highly sensitive DNA amplification effects were observed when the substrate DNA was circular, single- or double-stranded linear DNA, short-chain or long-chain DNA. But it doesn't change. Furthermore, selective amplification of trace amounts of DNA was also successful in a state where background DNA was mixed with the target substrate DNA in the reaction system.
Moreover, the range of the preferable pore diameter about each of FSM, SBA, and SBA microsphere of a silica-type nanoporous material was found. In addition, the optimum composition of the salt contained in the BSA-containing cleaning solution according to the type of each silica-based nanoporous material was examined, and the reaction of background DNA in the reaction system for each silica-based nanoporous material. The optimum salt composition with high exclusion ability out of the system could be determined.

The present inventors have previously developed a microreactor in which lipase is immobilized on a silica-based nanoporous material and supported on a microfluidic device (Patent Document 4). In the lipase-silica nanoporous material composite-supported microreactor system, the enzyme reaction product is quickly discharged out of the system, so that side reactions are suppressed and the reaction efficiency is increased. In addition, the microreactor can be used repeatedly.
The present inventors have conceived of applying this microreactor technology for suppressing contamination in the DNA amplification method by the LAMP method. Therefore, a DNA synthase (Bst DNA polymerase) for the LAMP method is immobilized on a microfluidic device supporting a silica-based nanoporous material, and a DNA reactor supporting a DNA synthase-silica-based nanoporous material complex is prepared. did.
Specifically, the DNA synthase was immobilized by filling the inside of the microchannel carrying the silica-based nanoporous material with a buffer solution containing the target DNA and the fluorescent reagent together with the DNA synthase for the LAMP method. The inside of the microchannel was heated to 65 ° C., the LAMP method reagent reaction solution containing the target template DNA and the primer set was continuously fed, and the DNA amplification product-containing solution was recovered 9 times in 25 μL, and the amplification reaction It was possible to suppress internal contamination and improve the amplification sensitivity of the target DNA. Further, no decrease in the DNA amplification effect was observed even in the ninth collection solution. This is because the enzyme complex in the microchannel is in contact with and interacted with nine new reagent reaction solutions in succession, and it can be said that the enzyme complex is repeatedly used nine times. That is, the enzyme complex for LAMP method applied to the microreactor was confirmed to have excellent performance that the amplification effect was not lowered even after repeated use 9 times.

As described above, in the present invention, when the DNA synthase is immobilized on the silica-based nanoporous material carrier, it is immobilized in a BSA-containing solution, and then washed once or more with a BSA-containing washing solution. A DNA synthase-BSA-silica nano-space that positively forms a complex with BSA for the DNA synthase that binds to the silica-based nanoporous material carrier by performing a step and a recovery step by centrifugation. A method for producing a porous material composite is provided. As a result, side reactions in the DNA amplification reaction can be suppressed as much as possible, and the specificity and sensitivity of the DNA amplification reaction can be increased. We succeeded in amplifying to sensitivity.
In addition, it has been found that the specificity and sensitivity can be improved by preparing a silica-based nanoporous material that interacts with the DNA synthase to the optimum pore size according to the type and adjusting the environment surrounding the DNA enzyme. The optimum salt composition in the buffer solution used as the BSA-containing washing solution in the production process of the DNA synthase-BSA-silica nanoporous material complex could be determined.

Furthermore, by using a microreactor carrying a DNA synthase-silica nanoporous material complex for LAMP, side reactions during DNA amplification reaction due to contamination can be suppressed as much as possible, and optimal DNA amplification reaction By setting the conditions, the specificity and sensitivity of the DNA amplification reaction can be increased. It has also been found that the composite supported on the microreactor exhibits excellent performance in that the sensitivity does not decrease even when it is repeatedly used a plurality of times.
By obtaining the above knowledge, the present invention was completed.

That is, the present invention for solving the above-described problems is composed of the following technical means.
[1] A method for producing a DNA synthase-BSA-silica nanoporous material composite,
(1) A step of bringing a buffer solution containing a DNA synthase into contact with a silica-based nanoporous material to adsorb the DNA synthase into the silica pores;
(2) A production method, comprising a step of resuspending the obtained precipitate one or more times in a buffer solution containing bovine serum albumin (BSA) and collecting the precipitate by centrifugation.
[2] The production method according to [1], wherein the buffer solution used in the step (1) is a buffer solution containing BSA.
[3] The production method according to [1] or [2], wherein the silica-based nanoporous material is selected from any one of FSM, SBA, and SBA microsphere.
[4] The central pore diameter of the selected FSM is 2 to 4 nm, the central pore diameter of the selected SBA is 4 to 9 nm, or the central pore diameter of the selected SBA microsphere is 10 The production method according to [3], which is ˜20 nm.
[5] The above [3] or [4], wherein the silica-based nanoporous material is FSM, and the buffer solution containing BSA used in at least step (2) further contains a magnesium salt and a surfactant. The manufacturing method as described in.
[6] The production method according to [5], wherein the buffer containing the DNA synthase used in the step (1) is a buffer containing a magnesium salt and a surfactant together with BSA.
[7] The silica-based nanoporous material is SBA or SBA microsphere, and the buffer solution containing at least BSA used in the step (2) does not contain a magnesium salt but contains a surfactant. 3] or the production method according to [4].
[8] The production according to [7], wherein the buffer solution containing the DNA synthase used in the step (1) is a buffer solution containing BSA, containing no magnesium salt, and containing a surfactant. Method.
[9] A DNA synthase-BSA-silica nanoporous material composite produced by the production method according to any one of [1] to [8].
[10] The target DNA is allowed to act on the DNA synthase-BSA-silica nanoporous material complex according to [9] together with a target DNA amplification primer and dNTPs in a buffer containing BSA. A method for amplifying a target DNA, which comprises amplifying the target DNA.
[11] A method for detecting or identifying target DNA in a test sample, comprising the following (1) to (3);
(1) A step of diluting a test sample with a buffer containing BSA,
(2) a step of amplifying the target DNA by allowing the DNA synthase-BSA-silica nanoporous material complex according to [9] above to act together with the target DNA amplification primer and dNTPs;
(3) A step of detecting the target DNA.
[12] The method according to [11] above, wherein the content of the target DNA in the test sample is 0.01 fg / ml to 1.0 μg / ml.
[13] A microreactor in which a DNA synthase-silica nanoporous material complex is supported inside a microchannel,
The DNA synthesizing enzyme is a DNA synthesizing enzyme for use in a DNA amplification reaction by the LAMP method, and the enzyme is immobilized inside the pores of the silica-based nanoporous material, and the DNA synthesizing enzyme-silica-based nanoporous A microreactor characterized by forming a material composite.
[14] BSA is further adsorbed to the DNA synthase-silica nanoporous material composite supported inside the microchannel, and the DNA synthase-BSA-silica nanoporous material composite is The microreactor according to [13], wherein the microreactor is formed.
[15] The microreactor according to [13] or [14] above, wherein the silica-based nanoporous material is selected from any of FSM, SBA, and SBA microsphere.
[16] A method for amplifying a nucleic acid using the LAMP method, which comprises the following steps (1) to (5);
(1) A step of washing the inside of the microchannel of the microreactor according to [13] or [14] with a buffer,
(2) A step of heating so that the inside of the flow path becomes 65 ° C.,
(3) sending a reaction solution containing a nucleic acid sample containing or possibly containing a target nucleic acid and a target nucleic acid amplification primer set;
(4) A step of isothermally amplifying the target nucleic acid inside the flow path,
(5) A step of successively and successively collecting the solution containing the obtained nucleic acid amplification product.
[17] The method according to [16] above, wherein the steps (1) to (5) are further repeated after recovering the nucleic acid amplification product.

In the present invention, when a DNA synthase is immobilized on the silica-based nanoporous material carrier and / or in the washing step, a buffer solution containing BSA is actively used, so that the silica-based nanoporous A DNA synthase that binds to a material carrier is positively formed into a complex with BSA to provide a DNA synthase-BSA-silica nanoporous material complex. As a result, side reactions in the DNA amplification reaction can be suppressed as much as possible, and the specificity and sensitivity of the DNA amplification reaction can be increased. For the first time, a very small amount of DNA sample of several molecular levels can be amplified specifically and with high sensitivity. I succeeded in making it happen. These specific and highly sensitive DNA amplification effects are the same regardless of whether the substrate DNA is circular, single- or double-stranded linear DNA, short-chain or long-chain DNA, and back-up in the reaction system. It was proved that selective amplification was possible even when ground DNA was contaminated.
Also, for each type of silica-based nanoporous material that interacts with DNA synthase, determine the optimal pore size and the optimal salt composition in the BSA-containing cleaning solution to enhance the specificity and sensitivity of the DNA amplification reaction. I was able to.
In addition, by immobilizing a DNA synthase for the LAMP method in a microreactor carrying a silica-based nanoporous material composite, side reactions during DNA amplification reaction due to contamination in the LAMP method can be suppressed as much as possible. The specificity and sensitivity of the DNA amplification reaction could be increased. Moreover, the complex supported by the microreactor exhibits excellent performance that the DNA amplification ability by the LAMP method does not decrease even when it is used repeatedly several times.

It comprises DNA synthase and BSA immobilized on silica pores by suppressing adsorption of reaction substrate DNA, primers, and dNTPs to the surface of regular pores (silica pores) of silica-based nanoporous material (mesoporous silica) DNA synthase-BSA-silica nanoporous material complex and appropriate amount of reaction substrate (DNA, primer, dNTPs) interact, and further, non-specific DNA amplification can be suppressed by optimizing the enzyme reaction environment It is explanatory drawing which shows typically a mode that trace amount DNA is amplified specifically and highly sensitively as a result. It is explanatory drawing which shows typically the procedure until the preparation method of a DNA synthetase-BSA-silica-type nanopore material composite, and the start of polymerase chain reaction (PCR method). DNA amplification product (molecular size: 100 base pairs) after polymerase chain reaction (PCR method) using free DNA synthase and DNA synthase immobilized on 7 kinds of silica-based nanopore materials It is the result of analyzing by electrophoresis and evaluating the enzyme activity. In the figure, (a) shows the case where 100-base-pair double-stranded DNA was used as the substrate DNA, and (b) shows the case where 100-base single-stranded DNA was used as the substrate DNA. . The amount of substrate DNA (100 base pair double-stranded DNA) in 50 μL of the reaction solution is diluted stepwise in the range of 5 ng to 0.05 fg and subjected to polymerase chain reaction (PCR method), followed by DNA amplification product (molecular size) : 100 base pairs) was analyzed by polyacrylamide gel electrophoresis, and the enzyme activity was evaluated. In the figure, (a) is when free DNA synthase is used, and (b) is when DNA synthase-FSM type mesoporous silica (pore diameter: 2.6 nm) complex is used. . A DNA amplification product (molecular size: 100 base pairs) was subjected to polyacrylamide gel electrophoresis after polymerase chain reaction (PCR method) with different number of cycles using 100 base pairs of double-stranded DNA (5 fg) as substrate DNA. It is the result of having analyzed and evaluating an enzyme activity. In the figure, (a) shows the case of using a free DNA synthase and a DNA synthase-FSM type mesoporous silica (pore size: 2.6 nm) complex, and (b) does not contain only substrate DNA. When a free DNA synthase reaction solution is used. Four kinds of long-chain DNA (616, 1272, 2566, 5027 base pairs) inserted into a circular plasmid DNA (T-Vector pMD20, 2736 base pairs) are amplified using free DNA synthase, and each DNA amplification product It is the result of having analyzed by agarose gel electrophoresis. It is the result of having analyzed the DNA amplification product after the polymerase chain reaction (PCR method) using a DNA synthetase-BSA-silica nanopore material complex by agarose gel electrophoresis, and evaluating the enzyme activity. In the figure, (a) to (d) were amplified using four types of long-chain DNA (616, 1272, 2566, 5027 base pairs) inserted into a circular plasmid DNA (T-Vector pMD20, 2736 base pairs). In this case, (a): about 800 base pairs, (b): about 1500 base pairs, (c): about 2800 base pairs, (d): about 5200 base pairs. Moreover, (e) is a figure which shows the difference in DNA amplification efficiency in (a)-(d) in the figure. The substrate DNA (circular plasmid DNA (T-Vector pMD20) into which 616 base pairs of DNA was inserted) in 50 μL of the reaction solution was diluted stepwise in the range of 1 ng to 0.01 fg, and polymerase chain reaction (PCR method) This is a result of analyzing a DNA amplification product (molecular size: about 800 base pairs) by agarose gel electrophoresis after performing the above and evaluating the enzyme activity. In the figure, (a) is when free DNA synthase is used, and (b) is when DNA synthase-FSM type mesoporous silica (pore diameter: 2.6 nm) complex is used. . DNA synthetase immobilized on free DNA synthetase and seven kinds of silica nanopore materials using circular plasmid DNA (T-Vector pMD20, 0.01 fg) with 616 base pair DNA inserted as substrate DNA This is a result of analyzing a DNA amplification product (molecular size: about 800 base pairs) by agarose gel electrophoresis after performing a polymerase chain reaction (PCR method) using, and evaluating the enzyme activity. A DNA synthase-BSA-silica nanoporous material complex precursor was obtained using eight types of PCR buffer solutions containing DNA synthase (1 unit) having different reaction compositions, and then background DNA. As described above, a circular plasmid DNA (3354 base pairs, 1 ng) into which 616 base pairs of DNA were inserted was added, and then the complex was washed with 100 μL of the same buffer solution for PCR, followed by 1272 base pairs of DNA. DNA polymerase product (molecular size: about) after carrying out polymerase chain reaction (PCR method) by adding 50 μL of the PCR buffer solution containing circular plasmid DNA (4010 base pairs, 1 ng) as a target into which DNA was inserted (1500 base pairs) was analyzed by agarose gel electrophoresis, and the enzyme activity was evaluated. In the figure, (a) is a DNA synthase immobilized on FSM-22 (central pore diameter: 4.2 nm), and (b) is SBA-15 (central pore diameter: 5.4 nm). In the case of immobilized DNA synthase. Eight kinds of PCR buffer solutions with different reaction compositions containing a DNA synthase (1 unit) containing a circular plasmid DNA (3354 base pairs, 0.1 pg) inserted with 616 base pairs of DNA as background DNA To obtain a DNA synthase-BSA-silica-based nanoporous material complex precursor, and then wash the complex with 100 μL of the same buffer solution for PCR, followed by insertion of 1272 base pair DNA. DNA amplification product (molecular size: about 1500) after carrying out polymerase chain reaction (PCR method) by adding 50 μL of the above PCR buffer solution containing the target circular plasmid DNA (4010 base pairs, 0.1 pg) (Base pair) is analyzed by agarose gel electrophoresis, and the enzyme activity is evaluated. In the figure, (a) is a DNA synthetase immobilized on FSM-16 (central pore diameter: 2.6 nm), and (b) is SBA-15 (central pore diameter: 5.4 nm). In the case of the immobilized DNA synthetase, (c) is the case of the DNA synthetase immobilized on SBA-15 microsphere (central pore diameter: 18.5 nm). It is explanatory drawing which shows the microfluidic device which carry | supported the DNA synthetase-SBA-15 (center pore diameter: 5.4 nm) composite_body | complex to the glass-made flow path. In the figure, (a) is a top view of the microfluidic device and a drawing showing the dimensions of the microchannel, (b) is a photograph of the microfluidic device as viewed from above, and (c) ) Is an infrared thermograph image when the microchannel is heated. Isothermal DNA amplification (LAMP method) using free DNA synthase and DNA synthase-SBA-15 (central pore diameter: 5.4 nm) complex using koi herpesvirus (KHV) genomic DNA as substrate DNA It is the result of measuring the fluorescence intensity of the fluorescence-labeled DNA amplification product after the execution and evaluating the enzyme activity. In the figure, (a) shows a case where a DNA synthase immobilized on SBA-15 (central pore diameter: 5.4 nm) is repeatedly used in a batch reaction, and (b) shows a DNA synthase. This is the case where a flow-type continuous reaction is carried out using a microfluidic device in which a SBA-15 (central pore diameter: 5.4 nm) complex is supported in a flow path. The amount of substrate DNA (circular plasmid DNA inserted with 1272 base pairs of DNA (T-Vector pMD20)) in 50 μL of a reaction solution containing 0.001% BSA was diluted stepwise in the range of 1 ng to 0.01 fg. The results are obtained by analyzing the DNA amplification product (molecular size: about 1500 base pairs) by agarose gel electrophoresis after performing the polymerase chain reaction (PCR method) and evaluating the enzyme activity. In the figure, (a) is when free DNA synthase is used, and (b) is when DNA synthase-FSM type mesoporous silica (pore diameter: 2.6 nm) complex is used. . DNA synthase immobilized on 7 kinds of silica-based nanoporous materials using a circular plasmid DNA (T-Vector pMD20, 0.1 fg) into which DNA of 1272 base pairs is inserted as substrate DNA This is a result of analyzing a DNA amplification product (molecular size: about 1500 base pairs) by agarose gel electrophoresis after performing a polymerase chain reaction (PCR method) using, and evaluating the enzyme activity. Four types of PCR buffer solutions with different reaction compositions (1 unit) containing DNA synthase (1 unit) containing circular plasmid DNA (3354 base pairs, 0.1 fg) with 616 base pairs of DNA inserted as background DNA. The reaction composition of lanes (1), (3), (5), and (7) in FIG. 11 is used to obtain a DNA synthase-BSA-silica nanoporous material composite precursor, After washing the complex with 100 μL of PCR buffer solution, 50 μL of the PCR buffer solution containing the target circular plasmid DNA (4010 base pairs, 0.1 fg) into which 1272 base pair DNA was inserted was added. After the polymerase chain reaction (PCR method) was performed, the DNA amplification product (molecular size: about 1500 base pairs) was analyzed by agarose gel electrophoresis, and the enzyme activity was evaluated. This is the result of In the figure, (a) is an electrophoretic image, and (b) is a table summarizing together with the experimental results of FIG.

1. “Silica-based nanoporous material” used in the present invention (1-1) Types of silica-based nanoporous material (mesoporous silica) Silica-based nanoporous material (mesoporous silica) used as an immobilized enzyme carrier in the present invention is , A porous material having uniform pores made of silicon dioxide (silica) and having a pore having a central pore diameter of 2 to 50 nm (mesopore: IUPAC), The pore volume is 0.1 to 2.0 ml / g, and the specific surface area is 200 to 1500 m ² / g (Non-patent Document 12, etc.). There are two general synthesis methods for regularly forming pores in mesoporous silica: (a) liquid crystal template method and (b) sheet deformation method. In (a), the surfactant is silica. Or, it is mixed with sodium silicate and self-assembled by condensation, and the surfactant is removed by baking. In (b), the surfactant is converted into layered kanemite (NaHSi ₂ O ₃ .3H ₂ O). There is a method (Non-patent Document 11) of adding and causing sheet deformation by ion exchange to form a honeycomb structure and firing and removing the surfactant. Typical examples obtained by the method (a) include “MCM (MCM-41 etc.)”, “SBA (SBA-15)” and the like, and typical examples obtained by the method (b) “FSM (FSM-16, etc.)” and the like. The “silica-based nanoporous material” obtained by both methods usually has a “hexagonal” type crystal structure of a honeycomb structure. “MCM” and “SBA” obtained by the method (a) may adopt a “cubic” type crystal structure.
The “silica-based nanoporous material” used in the present invention is a “silica-based nanoporous material” having a regular pore structure synthesized by any of the above methods, and more preferably “FSM”. “SBA” or “MCM”, particularly preferably “SBA-microsphere” in which the pore diameter is expanded by mixing a swelling agent with a surfactant in the synthesis process of “FSM”, “SBA” or “SBA” is there.

(1-2) Method for synthesizing silica-based nanoporous material used in the present invention In the examples of the present invention, among the “silica-based nanoporous material” having a typical regular pore structure, the above ( In addition to the typical “FSM (FSM-16, 22)” of type b) and the typical “SBA (SBA-15)” of type (a) above, “SBA (SBA− 15) “microsphere”, “FSM” is the method of Inagaki et al. (Non-Patent Document 12), “SBA” is the method of Zhao et al. (Non-patent Document 13), and “SBA microsphere” is the method of Wang et al. They were synthesized with reference to the description of Non-Patent Document 14).
Specifically, “FSM” performs dehydration polycondensation reaction of silica in a weak alkaline solution using a cationic surfactant as a template and kanemite, which is a layered silicate, as a silica source. “SBA (SBA-15)” is a dehydration polycondensation reaction of silica in an acidic solution using a nonionic surfactant as a template and tetraethyl orthosilicate as a silica source. Obtained by a method of removing the surfactant by baking, and “SBA (SBA-15) microsphere” is a swelling agent (mesitylene) using a nonionic surfactant as a template and tetraethyl orthosilicate as a silica source. The silica was dehydrated and polycondensed in the presence and in an acidic solution, and the surfactant was removed by calcination.

(1-3) About the pore diameter of the silica-based nanoporous material The general pore diameter of the silica-based nanoporous material is 2 to 50 nm (mesopore) in the central pore diameter. Among them, the preferable numerical range of the pore diameter is different, for example, in the case of FSM, the central pore diameter is in the range of 2 to 4 nm, preferably in the range of 2 to 3 nm, particularly FSM-16 (central pore diameter: 2.6 nm) is preferred. In the case of SBA, the central pore diameter is in the range of 4 to 11 nm, preferably 4 to 9 nm, more preferably 5 to 8 nm, especially SBA-15 (central pore diameter: 5.4 nm) and SBA-15 ( Center pore diameter: 7.1 nm) is preferred. In the case of SBA microsphere, the central pore diameter is 10 to 20 nm, preferably 13 to 19 nm, more preferably 15 to 19 nm, and particularly SBA-15 microsphere (central pore diameter: 18.5 nm) is suitable. is there.

2. Method for Producing “DNA Synthetase-BSA-Silica Nanoporous Material” Complex of the Present Invention Next, the DNA synthesis of the present invention comprising bovine serum albumin (BSA) together with the DNA synthetase-silica nanoporous material The production of the enzyme-BSA-silica nanoporous material composite will be described.

(2-1) Immobilization of DNA synthesizing enzyme on silica-based nanoporous material In the present invention, as a method for immobilizing DNA synthesizing enzyme on silica-based nanoporous material, a normal enzyme immobilization method can be applied, By mixing the DNA synthase and the buffer solution with the silica-based nanoporous material powder, the precursor of the DNA synthase-silica-based nanoporous material complex can be obtained as a precipitate. At this time, in the present invention, it is preferable to use a buffer solution containing bovine serum albumin (BSA) as a buffer solution for immobilization. For example, a DNA synthase is dissolved or suspended in 50 μL of a buffer solution containing 0.001% BSA, mixed with 0.5 mg of silica nanoporous material powder, and stirred at room temperature for about 1 second. After leaving it on ice for 5 to 10 minutes, it is stirred at room temperature for about 5 seconds and centrifuged to obtain a precursor of a DNA synthase-silica nanoporous material complex as a precipitate. it can.
The BSA-containing buffer solution used as the buffer solution for immobilization is preferably a buffer solution containing BSA in an amount of 0.0001 to 0.1% by mass, preferably 0.001 to 0.01% by mass. More preferably, it has the same composition as the BSA-containing washing buffer used in the washing step performed on the precipitate. Further, it may have the same composition as the BSA-containing buffer for the reaction medium used in the DNA amplification step.
Such a buffer solution is a general phosphate buffer solution, an inorganic salt buffer solution such as a borate buffer solution, or an organic substance-containing buffer solution such as a Tris-HCl buffer solution, physiological saline, and BSA in a concentration of 0.0001 to 0.00. It can be prepared by blending 1% by mass, preferably 0.001 to 0.01% by mass. Further, a BSA-containing buffer solution that is commercially available as a commercially available reaction solution for DNA synthesis (such as Toyobo Co., Ltd.) can also be used. In particular, when FSM is used as the silica-based nanoporous material, it is preferable that a magnesium salt such as magnesium chloride and a surfactant are present, so that the magnesium salt and surfactant essential for starting DNA amplification are present. A commercially available reaction solution for DNA synthesis containing can be used as it is. However, when SBA or SBA microsphere is used as the silica-based nanoporous material, it is better to contain a surfactant, but it is better not to contain a magnesium salt. It is preferable to prepare by blending necessary salts together with BSA without using.
Here, as the surfactant blended in the BSA-containing buffer of the present invention, ether type and ester ether type nonionic surfactants such as Triton X-100, Nonidet P-40, Brij35, and Tween 20 are preferable. In particular, Triton X-100 is preferably used. The blending ratio is 0.01 to 0.5% by weight, preferably 0.05 to 0.1% by weight, based on the total amount of the buffer solution. Can be used together.
In the present invention, BSA is used as the most readily available serum albumin. However, since the adsorption property to various substances shows almost the same property as albumin derived from mammals, human serum is substituted for BSA. Serum albumin derived from other mammals such as albumin (HSA) can also be used.

(2-2) Production of DNA synthase-BSA-silica nanopore material composite In the present invention, a precursor of the DNA synthase-silica nanopore material composite obtained as a precipitate is then used. Then, a washing treatment including a step of resuspending with a buffer solution containing BSA is performed, and the supernatant is removed to produce a DNA synthase-BSA-silica nanoporous material composite. The cleaning step may be performed once, but it is preferable to perform the cleaning step twice or more when the concentration of BSA is low. For example, the precipitate is washed by resuspending with 100 μL of a buffer solution containing 0.001% BSA, and the supernatant is completely removed after centrifugation. Repeat these steps as necessary.

Here, the BSA-containing buffer used for washing preferably has the same composition as the BSA-containing buffer used when immobilizing the DNA synthase on the silica-based nanoporous material, but may be different. . In both cases, a buffer solution having the same composition as the BSA-containing reaction solution used in the DNA synthase reaction can also be used.
The BSA-containing buffer solution used in the washing step of the present invention is prepared by adding BSA to a general phosphate buffer solution, an inorganic salt buffer solution such as a borate buffer solution, an organic substance-containing buffer solution such as a Tris-HCl buffer solution, or physiological saline. 0.0001 to 0.1% by mass, preferably 0.001 to 0.01% by mass, or 0.01 to 0.5% by mass, preferably 0.05 to 0.1% by mass of a surfactant. Can be prepared. Also, commercially available BSA-containing buffers can be used as commercially available reaction solutions for DNA synthesis (manufactured by Toyobo Co., Ltd.). The optimum salt composition in these buffers is the type of silica-based nanoporous material. Therefore, it is preferable to prepare BSA together with a salt having a buffering action. Here, the kind of surfactant used and the preferable blending ratio are the same as described in (2-1).
Specifically, in the case of FSM, it is preferable that magnesium salt such as magnesium chloride is present in addition to BSA as well as a surfactant in addition to 1 to 5 mM, preferably 1 to 3.5 mM. The reaction solution for DNA synthesis can be used as it is. For example, a buffer solution having a composition of 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.1% Triton X-100, 0.001% BSA, and 1 mM magnesium chloride can be used.
On the other hand, in the case of SBA, the addition of a surfactant is preferable, but the presence of a magnesium salt is not preferable, so it is preferable to prepare with BSA and other buffer components. For example, with respect to 0.0001 to 0.1% by mass, preferably 0.001 to 0.01% by mass of BSA and 0.01 to 0.5% Triton X-100, 10 to 150 mM Tris-HCl ( pH 7-9) A buffer prepared by combining salts such as 2 to 10 mM ammonium sulfate and 5 to 15 mM potassium chloride can be used.
Similarly, in the case of SBA microsphere, the presence of a magnesium salt is not preferable, and thus it is preferable to prepare with BSA and other buffer components as in the case of SBA.

The precipitate after washing is centrifuged at 1000-1500 G for 25 seconds, etc., separated from the supernatant, and recovered as a “DNA synthase-BSA-silica nanoporous material complex”.
If necessary, the washing step and the centrifugation step are repeated.

(2-3) DNA synthase used in the present invention The DNA amplification method targeted in the present invention is typically the general-purpose and most simple polymerase chain reaction (PCR method). (LAMP method), Rolling Circle Amplification (RCA method), and Multiple Displacement Amplification (MDA method) are also applicable.
Therefore, the DNA synthetase that can be used in the present invention is not limited to an enzyme for PCR, and any enzyme having an ability to synthesize and amplify an arbitrary DNA sequence or a specific gene sequence. The present invention can be applied without being limited to the type.
As a DNA synthase for polymerase chain reaction (PCR method), DNA polymerase such as Taq DNA polymerase can be used in addition to KOD DNA polymerase which is a high heat-resistant DNA synthase used in the examples of the present invention. In addition, phi29 DNA polymerase, Bst DNA polymerase, and the like can be used for the MDA method, the RCA method, and the LAMP method.

3. Amplification method of very small amount of DNA in the present invention “DNA synthase-BSA-silica nanoporous material complex” in the present invention is a conventional DNA amplification method (PCR method, LAMP method, RCA method, MDA method, etc.) "Synthesis of immobilized DNA synthesized in a state of" DNA synthase-BSA-silica nanopore material complex "by a specific immobilization treatment on silica nanopore material with respect to DNA synthase used in Since it can be said that it is an “enzyme”, the “DNA synthase-BSA-silica nanoporous material complex” of the present invention is used in a general DNA amplification method as in the case of an ordinary immobilized DNA synthase. It can be used as a substitute for DNA synthase as appropriate.
Therefore, the amplification means itself of the DNA amplification of the present invention can basically be applied as it is with the conventional DNA amplification method, particularly the DNA amplification method using the immobilized DNA synthase. The same applies to the type of target DNA.
In the method for amplifying a very small amount of DNA in the present invention, in the DNA amplification, the “DNA synthase-BSA-silica nanoporous material complex” is used, and a BSA-containing buffer is used as a reaction solution for DNA synthesis. As a result, even if the amount of target DNA is extremely small, especially when the amount of DNA in the test sample is extremely small, side reactions are suppressed, and target DNA is specific and highly sensitive. Can be amplified.
That is, the DNA amplification method targeted by the present invention is not limited to the PCR method, but in the following description, the case where the PCR method using a typical KOD DNA polymerase is mainly used will be described in detail. To do.

(3-1) Target DNA The reaction substrate DNA in the present invention is not limited in its base length, and may be appropriately selected from circular and linear, single-stranded and double-stranded. The DNA can be applied.
In the case of double-stranded DNA, it is preferable to amplify using a PCR amplification method by inserting the target DNA into a known cloning site for DNA amplification.
In addition, as described in detail in (3-3) below, in the present invention, even a very small amount of substrate DNA at several molecular levels can be amplified, and environmental samples with many contaminants, biological samples such as blood, pathogenic microorganisms For example, a very small amount of target DNA in a cell-derived sample can be amplified. For example, it is possible to target the amplification of a trace amount of DNA contained in 0.01 ml to 0.1 pg in 1 ml of a sample. This value is 1 to 10 levels in 1 ml of an environmental sample or a biological sample. This means that pathogen-derived DNA contained in a trace amount can be detected.
Therefore, the target DNA of the present invention generally refers to a DNA to be detected or identified, which is contained in a very small amount in a test sample, in addition to a substrate DNA to be amplified.

(3-2) Method for Amplifying Ultratrace DNA in the Present Invention The present invention relates to a DNA synthase-BSA-silica nano-space in a buffer solution containing BSA for target DNA or various samples containing the target DNA. The DNA amplification reaction is carried out in contact with the pore material complex. For example, the polymerase chain reaction (PCR method) using the DNA synthase-BSA-silica nanoporous material complex is reacted with the precipitate of the DNA synthase-BSA-silica nanoporous material complex. After adding 50 μL of an enzyme reaction solution containing substrate DNA, two types of primers, dNTPs, and BSA, the precipitate can be resuspended. In the present invention, the washing step described above removes as much of the host-derived contaminating DNA that may be contained in the purified recombinant DNA synthase product as possible and nucleic acids that are different from the target DNA accidentally mixed from outside the reaction system. Therefore, a small amount of target DNA can be specifically amplified.
The enzyme reaction solution containing BSA used here preferably contains 0.0001 to 0.1% by mass of BSA, more preferably 0.001 to 0.01% by mass. As described above, a BSA-containing buffer solution used as a washing solution or a buffer solution having the same composition as the BSA-containing buffer solution used for immobilization may be used, but a divalent cation is used to start DNA amplification. Is essential, so at least 1 to 5 mM of magnesium salt is added here even if no magnesium salt is added in the cleaning solution. Considering DNA amplification efficiency, there are reaction solutions containing BSA among commercially available DNA synthesis reaction solutions (for example, a reaction solution for KOD DNA polymerase manufactured by Toyobo Co., Ltd.). The DNA amplification efficiency is considered to be the highest and can be preferably used as the reaction solution of the present invention.
As such a preparation example, 0.0001 to 0.1% by mass, preferably 0.001 to 0.01% by mass of BSA, and magnesium salt such as magnesium chloride is 1 to 5 mM, preferably 1 to 3.5 mM. And a surfactant such as Triton X-100 such as 0.01-0.5% is preferably present. For example, 10 to 150 mM Tris-HCl (pH 7 to 9), 2 to 10 mM ammonium sulfate, 5 to 15 mM potassium chloride, 0.01 to 0.5% Triton X-100, 0.0001 to 0.1% by mass, preferably Can be exemplified by a BSA-containing buffer solution containing 0.001 to 0.01% by mass of BSA, 5 to 15 mM magnesium chloride, and the like.

(3-3) Detection and identification method of trace amount DNA in sample Since the amplification method of trace amount DNA of the present invention enables amplification with high specificity and sensitivity, a virus mixed in a blood biological sample, DNA detection for pathogenic bacteria, detection of target DNA contained in environmental samples, DNA amplification for unknown base sequence analysis of one-cell genomic DNA of difficult-to-cultivate microorganisms, etc. It is extremely effective in the detection and identification of trace amounts of DNA in many contaminants such as DNA identification.
In the method for detecting and identifying an extremely small amount of DNA in the present invention, the DNA content in the target test sample is 1.0 μg / ml or less, and the detection limit amount of the target DNA is 0.01 fg / ml. Preferably they are 0.05 fg / ml-0.2 microgram / ml, More preferably, they are 0.1 fg-0.5 pg / ml, Most preferably, they are 0.2 fg-0.1 pg / ml.
A specific method for detecting and identifying target DNA in a test sample is as follows.
(1) A step of diluting a test sample with a buffer containing BSA,
The test sample can be directly subjected to the DNA amplification step, but is preferably diluted with a buffer containing BSA.
Here, as a buffer solution containing BSA, a reaction solution containing BSA among commercially available reaction solutions for DNA synthesis (for example, a reaction solution for KOD DNA polymerase manufactured by Toyobo Co., Ltd.) can be used. It is preferable to use a commercially available reaction solution for DNA synthesis as it is. Alternatively, magnesium salt for starting DNA amplification with respect to 0.0001 to 0.1% by mass, preferably 0.001 to 0.01% by mass of BSA and 0.01 to 0.5% Triton X-100 It is diluted with a buffer prepared by combining salts such as 10 to 150 mM Tris-HCl (pH 7 to 9), 2 to 10 mM ammonium sulfate, and 5 to 15 mM potassium chloride together with 1 to 5 mM. In this case, the dilution ratio is preferably 1/10 to 1/100.
(2) a step of amplifying the target DNA by allowing the aforementioned DNA synthase-BSA-silica nanoporous material complex of the present invention to act together with a target DNA amplification primer and dNTPs;
Specifically, together with the DNA synthase-BSA-silica nanopore complex of the present invention, primer DNA and dNTPs for target DNA amplification are diluted in a buffer solution for PCR (for example, 50 μL) of the test sample. After addition, the reaction can be started by stirring at room temperature for about 5 seconds using a Vortex Mixer or the like.
(3) Step of detecting target DNA Here, as a method for confirming that the DNA amplified specifically by applying the DNA amplification method of the present invention is the target DNA, a general DNA is used. Although the identification method can be applied, for example, the following method can be exemplified.
(A) Electrophoresis, turbidity, and fluorescence of a target DNA-specific amplification product in polymerase chain reaction (PCR method) and isothermal DNA amplification method (LAMP method) obtained by applying a sequence-specific primer DNA (B) In a real-time PCR method or the like, a method of using an intercalator as a fluorescent substance for staining DNA and a method of detecting by a probe method using a TaqMan probe or the like (c) a DNA sequencer or the like And (d) PCR-restriction fragment length polymorphism method (PCR-Restri) method for analyzing the base sequence of DNA amplified by PCR, Rolling Circle Amplification (RCA method), and Multiple Displacement Amplification (MDA method) a method for detecting a target DNA by, for example, a fragmentation length polymorphism (RFLP method) and a DNA microarray method.

(3-4) Repetitive use of DNA synthase-BSA-silica nanoporous material complex The DNA synthase-BSA-silica nanoporous material complex of the present invention is obtained by the above-described washing step and recovery method. In addition, the enzyme can be stably adsorbed, fixed and held in the silica pores of the silica-based nanoporous material, and any buffer solution or appropriate substrate DNA such as circular and linear, single-stranded and double-stranded can be used. Since the reaction solution can be easily exchanged, the complex can be used a plurality of times in a minute DNA amplification reaction.
In addition to polymerase chain reaction (PCR method), DNA amplification methods to be used repeatedly for the complex include isothermal DNA amplification method (LAMP method), Rolling Circle Amplification (RCA method), and Multiple Displacement Amplification (MDA method). Etc. In addition to the conventional batch reaction, the complex can be used repeatedly in a flow reaction using a microfluidic device or the like.

4). LAMP Method DNA Synthesizing Enzyme-Silica-based Nanopore Material Composite-Supported Microreactor Using the microfluidic device (Patent Document 4) that was previously developed by the present inventors and supported on a silica-based nanopore material, the LAMP method A DNA synthesizing enzyme (Bst DNA polymerase; Non-Patent Document 8, etc.) is immobilized to prepare a DNA synthesizing enzyme-silica nanoporous material complex-supporting microreactor.
Here, as the silica-based nanoporous material supported in the microfluidic device, the center pore diameter is 2 to 50 nm (mesopore: made of silicon dioxide (silica) shown in (1-1) above. (IUPAC) is a porous material having uniform pores, and in the synthesis process of “FSM”, “SBA” or “SBA”, a swelling agent is mixed with a surfactant to expand the pore diameter, “SBA-microsphere” Is preferred.

A method for supporting a silica-based nanoporous material in a microchannel is as described in Patent Document 4, and a silica-based material particle such as SBA particles is provided on a glass or plastic substrate. By curing on the polydimethylsiloxane (PDMS) layer forming the surface, it is covalently bonded to the surface of the PDMS layer while directly forming uniform pores.
For example, a part of a glass substrate having a thickness of about 1 mm is masked, and nanoporous material (SBA) particles are deposited on the glass substrate surface having a PDMS layer surface attached to a groove formed by etching with hydrofluoric acid. Then, this is allowed to stand at a temperature of about 85 ° C. for several hours to be cured, thereby supporting the nanoporous material SBA on the surface of the glass substrate. After spraying compressed air to remove non-specifically adsorbed nanoporous material SBA particles, a PDMS film is applied and sealed from above.

The microreactor supporting the DNA synthase-nanopore material composite for LAMP method of the present invention is prepared as follows.
It can be immobilized by filling a microchannel carrying a silica-based nanoporous material with a buffer solution containing a fluorescent reagent together with Bst DNA polymerase or a buffer solution containing a target DNA and a fluorescent reagent together with Bst DNA polymerase. Next, the inside of the microchannel is heated to the reaction temperature (65 ° C.) in the LAMP method, the LAMP reagent reaction solution containing the target DNA and the primer set is fed, and nucleic acid amplification (LAMP) is carried out isothermally in the channel. The obtained amplified DNA product-containing solution is continuously recovered.

  Note that the microreactor carrying the DNA synthase-nanopore material complex is used after first cleaning the inside of the flow path with a buffer solution. In the buffer solution at that time, it is preferable to contain about 0.001% of BSA. By providing a plurality of washing steps, the DNA synthase-nanopore material complex becomes a DNA synthase-BSA-nanopore material complex, and a microreactor carrying the complex is provided.

  When the microreactor is applied to the LAMP method, the effect is extremely great, not only can the contamination during the amplification reaction be suppressed and the amplification sensitivity of the target DNA can be greatly improved, but also the complex supported by the microreactor is In the continuous interaction with the reagent reaction solution, the recovered solution after the ninth contact has a surprising performance that there is no decrease in specific activity (FIG. 13b). This is because the enzyme complex in the microchannel can be continuously contacted and interacted with nine new reagent reaction solutions, so that the enzyme complex for LAMP method can be used nine times. Can be expressed. In view of the effect of maintaining the DNA amplification activity over the 9 repeated use, a microreactor that interrupts the continuous feeding of the reagent reaction solution and inserts a new continuous feeding solution by washing with a buffer solution. It is fully suggested that the effect does not change even after repeated use.

EXAMPLES Next, although this invention is demonstrated concretely based on an Example, this invention is not limited at all by the following Examples.
Other terms and concepts in the present invention are based on the meanings of terms that are conventionally used in the field, and various techniques used to implement the present invention include those that clearly indicate the source. Except for this, it can be easily and reliably carried out by those skilled in the art based on known documents and the like. In addition, various analyzes were performed by applying the methods described in the analytical instruments or reagents used, kit instruction manuals, catalogs, and the like.
In addition, the description content in the technical literature, the patent gazette, and the patent application specification cited in this specification shall be referred to as the description content of the present invention.

(Synthesis Example) Synthesis of Silica-based Nanoporous Materials Various silica-based nanoporous materials (“FSM”, “SBA”) having a two-dimensional hexagonal pore arrangement structure and different pore diameters used in this example. ”And“ SBA microsphere ”) were synthesized.

(Synthesis Example 1) Synthesis of FSM-16 and -22 Referring to the method of Inagaki et al. (Non-patent Document 12), hexadecyltrimethylammonium chloride (3.2 g, manufactured by Tokyo Chemical Industry Co., Ltd.) or docosyltrimethyl Ammonium chloride (4.24 g, manufactured by Lion Akzo) was added to 100 ml of water at 70 ° C., and after dissolution, 5 g of kanemite (manufactured by Tokuyama Siltec) was further added and heated to 70 ° C. while homogenizing. Stir with a mixer for 3 hours. To this, 2N hydrochloric acid was added over about 1 hour, and the mixture was stirred for about 3 hours at pH 8.5.

  This was subjected to suction filtration, then re-dispersed in hot water at 70 ° C. and filtered four times and then air-dried. This was dried at 45 ° C. for 3 days and then calcined at 550 ° C. for 6 hours to obtain a silica-based nanoporous material having different central pore diameters (FSM; the type of surfactant is hexadecyltrimethylammonium chloride, In addition, in the case of docosyltrimethylammonium chloride). The central pore diameters were 2.6 nm (FSM-16) and 4.2 nm (FSM-22), respectively.

(Synthesis Example 2) Synthesis of SBA-15 Referring to the method of Zhao et al. (Non-patent Document 13), Pluronic P123 (polyoxyethylene (42) polyoxypropylene (67) glycol [manufactured by BASF]) (10 g) Was added to 300 ml of water and stirred overnight at 35 ° C. to dissolve, and 21.87 g of hydrochloric acid and 21.32 g of tetraethyl orthosilicate (manufactured by Wako Pure Chemical Industries, Ltd.) were further added thereto, and a hot stirrer was added. The mixture was stirred for about 20 hours while heating to 35 ° C. This was left still for 24 hours at different synthesis temperatures (a: 35 ° C., b: 80 ° C., or c: 130 ° C.).

  This was subjected to suction filtration, then re-dispersed in hot water at 70 ° C. and filtered four times and then air-dried. This was dried at 45 ° C. for 3 days, then heated to 550 ° C. at a rate of 105 ° C. per hour, and further fired at 550 ° C. for 10 hours. A pore material (SBA-15) was obtained. When the synthesis temperatures were a, b, and c, the central pore diameters were a: 5.4 nm, b: 7.1 nm, and c: 10.6 nm, respectively.

(Synthesis Example 3) Synthesis of SBA-15 microsphere With reference to the method of Wang et al. (Non-Patent Document 14), Pluronic P123 (4 g) was added to 120 ml of water, and further potassium chloride (Wako Pure Chemical Industries, Ltd.) was added. After adding 6.08 g (manufactured by Kogyo Co., Ltd.) and stirring and dissolving at room temperature for 1 hour, 23.6 g of hydrochloric acid (manufactured by Wako Pure Chemical Industries, Ltd.) and 3 g of mesitylene (manufactured by Wako Pure Chemical Industries, Ltd.) were further added. The mixture was added and stirred at room temperature for 2 hours. To this, 8.5 g of tetraethyl orthosilicate was further added, stirred vigorously for 10 minutes, and allowed to stand at 35 ° C. for 24 hours. This was allowed to stand for 24 hours at different synthesis temperatures (a: 100 ° C. and b: 130 ° C.).

  This was subjected to suction filtration, then re-dispersed in hot water at 70 ° C. and filtered four times and then air-dried. This was dried at 45 ° C. for 3 days, then heated to 500 ° C. at a rate of 60 ° C. per hour, and further fired at 500 ° C. for 6 hours. A pore material (SBA-15 microsphere) was obtained. When the synthesis temperatures were a and b, the center pore diameters were a: 18.5 nm and b: 24.5 nm, respectively.

(Example 1) Production and enzyme reaction of DNA synthase-BSA-silica nanoporous material complex In this example, immobilization of DNA synthase on various silica nanoporous materials prepared in the above synthesis examples Enzyme activity was evaluated. FIG. 1 shows DNA synthesizing enzymes immobilized on silica pores by suppressing adsorption of reaction substrate DNA, primers, and dNTPs on the surface of regular pores (silica pores) of silica-based nanoporous material (mesoporous silica). DNA synthase with BSA-BSA-silica nanoporous material complex and appropriate amount of reaction substrate (DNA, primer, dNTPs) interact, and non-specific DNA amplification by optimizing enzyme reaction environment As a result of being able to suppress the above, an explanatory view schematically showing how a minute amount of DNA is amplified specifically and with high sensitivity is shown.

(1-1) Production of DNA Synthetic Enzyme-BSA-Silica-based Nanoporous Material Composite The silica-based nanoporous material includes seven types of silica-based nanoporous materials having different central pore diameters: 1) FSM- 16 (central pore diameter: 2.6 nm), 2) FSM-22 (central pore diameter: 4.2 nm), 3) SBA-15 (central pore diameter: 5.4 nm), 4) SBA-15 ( Central pore diameter: 7.1 nm), 5) SBA-15 (central pore diameter: 10.6 nm), 6) SBA-15 microsphere (central pore diameter: 18.5 nm), 7) SBA-15 microsphere ( Center pore diameter: 24.5 nm), and KOD DNA polymerase (manufactured by Toyobo Co., Ltd., molecular weight: about 86 to 92 kD) was used as the DNA synthase.

  FIG. 2 shows a method for producing silica-based nanoporous material particles on which DNA synthase and BSA are immobilized. As a basic experimental procedure, a buffer solution for PCR (120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.1% Triton X-100) containing DNA synthase (1 to 2.5 units) was used. , 0.001% BSA, 1 mM magnesium chloride) and 0.5 mg of silica-based nanoporous material powder were mixed at room temperature for about 1 second using a Vortex Mixer and allowed to stand on ice for 5 to 10 minutes. Again, using a Vortex Mixer, the mixture was stirred for about 5 seconds at room temperature, centrifuged, and all the supernatant was removed to obtain a DNA synthase-BSA-silica nanoporous material complex precursor. Subsequently, 100 μL of the PCR buffer solution was added and stirred for about 5 seconds at room temperature using a Vortex Mixer to resuspend the DNA synthase-BSA-silica nanoporous material complex precursor. Centrifugation is performed, all the supernatant is removed, and finally DNA synthase-BSA-silica nanospace is a complex in which DNA synthase and BSA are immobilized on silica pores of the silica-based nanopore material. A porous material composite was obtained.

(1-2) Evaluation of DNA synthesis activity (when substrate DNA is linear DNA of 100 base pairs)
DNA synthesizing enzyme-BSA-silica nanoporous material in polymerase chain reaction (PCR method) using 100 base pair linear double stranded DNA and 100 base linear single stranded DNA as substrate DNA The DNA synthesis activity of the complex was examined. The enzymatic reaction is performed by adding a linear DNA (two-particulate sequence of the polylinker site of the pcDNA3 plasmid vector) to the precipitate (enzyme: 2.5 units) of the DNA synthase-BSA-silica nanoporous material complex. For single-stranded DNA: 5 ng, for single-stranded DNA: 2.5 ng, 100 base pairs (bp), 5′-TAATACGACTCACTATAGGGAGACCCAAGCTTGGTACCGAGCTGCGATCCACTAGTAACGGCCGCCCAGTGTGCTGGGATCTCATATGGTCCACCTATP: TP Primer DNA (T7 Promoter Primer, 20mer, 5′-TAATACGACTCACTATAGGGG: SEQ ID NO: No. 2 and SP6 Promoter Primer, 19mer, 5′-GATTTAGGTGACACTATAG: SEQ ID NO: 3) and dNTPs (each 20 nmol) and 50 μL of the PCR buffer solution were added. In the experimental operation using the linear double-stranded DNA, the amount of substrate DNA diluted stepwise (5 ng, 0.5 ng, 0.05 ng, 5 pg, 0.5 pg, 0.05 pg, 5 fg,. 5fg, 0.05fg) was used to evaluate the activity using a trace amount of DNA as a template.

  The reaction conditions were that heating at 94 ° C. for 1 minute, then repeating a temperature cycle of 98 ° C. for 10 seconds, 50 ° C. for 30 seconds, and 74 ° C. for 30 seconds 15 to 55 times. (BioRad, iCycler) was used. In addition, the DNA amplification product after the reaction is electrophoresed using 15% TBE-polyacrylamide gel, and after gel staining with the fluorescent dye SYBR Green I, it is analyzed using a fluorescence image analyzer (manufactured by FUJIFILM, FLA-5100). did.

(1-3) Evaluation of DNA synthesis activity (when substrate DNA is circular plasmid DNA)
PCR amplification products (SEQ ID NO: 4 (616 bp), SEQ ID NO: 5 (1272 bp), SEQ ID NO: 6 (2566 bp), having different lengths, with a base added to adenine (A) derived from λ-phage DNA as a substrate DNA, Polymerase chain reaction using 4 types of circular plasmid DNA (3354 bp, 4010 bp, 5304 bp, 7765 bp) in which SEQ ID NO: 7 (5027 bp)) was inserted into T-Vector pMD20 (SEQ ID NO: 8 (2736 bp, manufactured by Takara Bio Inc.)) In the PCR method, the DNA synthesis activity of the DNA synthase-BSA-silica nanoporous material complex was examined. The enzymatic reaction was carried out by adding the above-mentioned circular plasmid DNA (1 ng) and dNTPs (each 10 nmol), 10 pmol each of 2 to the precipitate (enzyme: 1 unit) of the DNA synthase-BSA-silica nanoporous material complex. Various types of primer DNA (M13 Forward Primer, 24mer, 5′-CGCCAGGGTTTCCCAGTCACGAC: SEQ ID NO: 9 and M13 Reverse Primer, 24mer, 5′-AGCGGATAACATTTCACACAGGA: SEQ ID NO: 10), and 20 dNTPols Started by adding 50 μL of working buffer solution. In the experimental operation using the circular plasmid DNA, the amount of substrate DNA diluted in stages (1 ng, 0.1 ng, 0.01 ng, 1 pg, 0.1 pg, 0.01 pg, 1 fg, 0.1 fg,. 01fg) was used to evaluate the activity using a trace amount of DNA as a template. Furthermore, DNA synthase-silica nanoporous material using 8 kinds of buffer solutions having different reaction compositions containing 1 ng or 0.1 pg of the circular plasmid DNA (background DNA) and DNA synthase (1 unit). After obtaining the complex precursor, and subsequently washing the complex with 100 μL of the same buffer solution, 50 μL of the BSA-containing PCR buffer solution containing 1 ng or 0.1 pg of the circular plasmid DNA (4010 base pairs) The enzyme reaction was started by adding, and background DNA was washed and target DNA was evaluated for amplification.

  The reaction conditions were as follows: heating at 95 ° C. for 1 minute, then repeating a temperature cycle of 98 ° C. for 15 seconds, 65 ° C. for 5 seconds, 74 ° C. for 30 seconds 25 times or 35 times. The reaction was carried out for 1 minute, and a PCR apparatus (BioCycler, iCycler) was used for this reaction. In addition, the amplified DNA product after the reaction was electrophoresed using 1-2% agarose gel, and after gel staining with a fluorescent dye SYBR Green I, it was analyzed using a fluorescence image analyzer (manufactured by FUJIFILM, FLA-5100).

(Example 2) DNA amplification for linear DNA (verification of side reaction suppression effect)
The left figure (a) and the right figure (b) of FIG. 3 show linear double-stranded DNA of 100 base pairs (SEQ ID NO: 1) and 100 by the DNA synthase-BSA-silica nanoporous material complex. The analysis result of the DNA amplification product when the linear single-stranded DNA of the base (SEQ ID NO: 1) is used as the substrate DNA and the temperature cycle is repeated 15 times is shown. In the figure, M is a DNA molecular size marker, PC is a free DNA synthase that is not immobilized on a silica-based nanoporous material, NC is a primer that does not add substrate DNA to the free DNA synthase, This is the case when DNA is added.

  Also, in the figure, circles 1 to 7 indicate 1: FSM-16 (center pore diameter: 2.6 nm), 2: FSM-22 (center fine diameter) of various silica-based nanoporous materials having different center pore diameters. (Pore diameter: 4.2 nm), 3: SBA-15 (central pore diameter: 5.4 nm), 4: SBA-15 (central pore diameter: 7.1 nm), 5: SBA-15 (central pore diameter) 10.6 nm), 6: SBA-15 microsphere (center pore diameter: 18.5 nm), 7: SBA-15 microsphere (center pore diameter: 24.5 nm), It is.

  3 (a) and 3 (b), the presence of DNA amplification products is recognized for all types of silica-based nanoporous materials. This is because the DNA synthase-BSA-silica-based nanoporous material complex is DNA. It shows that it has synthetic activity. In addition, in both cases where the type of linear template DNA is single-stranded or double-stranded, non-immobilized free DNA synthesizing enzyme is used in addition to the target DNA amplification product. Although amplification of the primer dimer, which is a DNA amplification product, was observed, the immobilized DNA synthesizing enzyme synthesized the target DNA amplification product to the same extent in all seven types of silica nanopore materials. Marked amplification suppression.

(Example 3) DNA amplification for linear DNA (evaluation of amplification reaction of trace amount of DNA)
In the left figure (a) and right figure (b) of FIG. 4, the amount of substrate DNA (100 base pair double-stranded DNA) in 50 μL of the reaction solution is diluted stepwise in the range of 5 ng to 0.05 fg, The analysis result of the DNA amplification product after implementing polymerase chain reaction (PCR method) of the temperature cycle 15 times by a synthetic enzyme-BSA-silica nanopore material composite is shown. In the figure, M is a DNA molecular size marker, and NC is a case where a primer DNA is added without adding a substrate DNA to a free DNA synthase not immobilized on a silica-based nanoporous material. In the figure, (a) is when free DNA synthase is used, and (b) is when DNA synthase-BSA-FSM-16 (center pore diameter: 2.6 nm) complex is used. .

  In the figure, marks 1 to 9 indicate the amount of substrate DNA in the reaction solution 50 μL: 1: 5 ng, 2: 0.5 ng, 3: 0.05 ng, 4: 5 pg, 5: 0.5 pg, 6: 0. When the DNA amplification activity was evaluated by stepwise dilution to 0.05 pg, 7: 5 fg, 8: 0.5 fg, 9: 0.05 fg.

  4 (a) and 4 (b), when free DNA synthase was used, amplification up to 5 pg was shown, and in the case of immobilized DNA synthase, suppression of primer dimer formation was observed and up to 0.05 pg. Amplification was shown. These experimental results indicate that the DNA synthesizing enzyme-BSA-silica nanoporous material composite has the ability to suppress side reactions, and as a result, may have improved DNA amplification activity.

  Further, in the left figure (a) and the right figure (b) of FIG. 5, in the amplification from 5 fg of substrate DNA in which the amplification was not recognized in FIG. The analysis result of a DNA amplification product when adding to is shown. In the figure, M is a DNA molecular size marker, and in the figure, PC in (a) is a free DNA synthase not immobilized on a silica-based nanoporous material, and FSM-16 is DNA synthase-BSA. -When FSM-16 (center pore diameter: 2.6 nm) complex is used, the NC in (b) transfers the substrate DNA to the free DNA synthase that is not immobilized on the silica-based nanoporous material. This is the case when primer DNA is added without addition. The numbers in the figure indicate the number of PCR cycles.

  5 (a) and 5 (b), PC and NC showed non-specific DNA amplification in all temperature cycles. On the other hand, in the DNA synthase-BSA-FSM-16 complex, selective amplification of the target DNA with less non-specific DNA amplification was observed in 35 cycles with an additional 20 cycles of PCR. It was shown that amplification from a trace amount of DNA of 5 fg is possible.

  From the above results, the DNA synthase-BSA-silica nanoporous material complex has the effect of suppressing the formation of non-specific DNA amplification products such as primer dimers in the DNA amplification reaction. It was found that it was possible to amplify from a trace amount of substrate DNA more than the amount of substrate DNA required in the DNA amplification reaction using the free enzyme. That is, it was found that the silica pores of the silica-based nanoporous material are suitable as a side reaction suppression field in the DNA amplification reaction.

  FIG. 6 shows four types of circular shapes in which DNAs of different lengths (616, 1272, 2566, 5027 base pairs) shown in SEQ ID NOs: 4 to 7 to be amplified are inserted into T-Vector pMD20 (SEQ ID NO: 8). Polymerase chain reaction (PCR method) was performed using 1 ng of plasmid DNA (3354, 4010, 5304, 7765 base pairs) with free DNA synthase (1 unit) not immobilized on the silica-based nanoporous material complex. The analysis result of a subsequent DNA amplification product is shown. In the figure, M is a DNA molecule size marker, A is a DNA amplification product (about 800 base pairs) using a circular plasmid DNA (3354 base pairs) inserted with 616 base pairs as a template, and B is 1272 base pairs inserted A DNA amplification product (about 1500 base pairs) using the circular plasmid DNA (4010 base pairs) as a template, and C a DNA amplification product (about 2800 base pairs) using the circular plasmid DNA (5304 base pairs) into which 2566 base pairs are inserted. D) is a DNA amplification product (about 5200 base pairs) using a circular plasmid DNA (7765 base pairs) into which 5027 base pairs are inserted as a template.

  7 (a) to (d), SEQ ID NOS: 4 to 7 inserted into a circular plasmid DNA (T-Vector pMD20, SEQ ID NO: 8) using a DNA synthase-BSA-silica nanoporous material complex. The analysis results of DNA amplification products when the four types of long-chain DNAs shown (616, 1272, 2566, 5027 base pairs) are used as substrate DNA and the temperature cycle is repeated 25 times are shown. In the figure, M is a DNA molecule size marker, and PC is a free DNA synthase that is not immobilized on a silica-based nanoporous material. In the figure, (a) shows a case where DNA of about 800 base pairs is amplified, (b) shows a case where DNA of about 1500 base pairs is amplified, and (c) shows a case where DNA of about 2800 base pairs is amplified. (D) is when a DNA of about 5200 base pairs was amplified. In the figure, (e) shows the degree of DNA amplification efficiency in various DNA synthase-BSA-silica nanoporous material composites as ◎ (amplification: large), ○ (amplification: medium), ▲ (amplification). : Small) and x (amplification: none).

  Also, in the figure, circles 1 to 7 indicate 1: FSM-16 (center pore diameter: 2.6 nm), 2: FSM-22 (center fine diameter) of various silica-based nanoporous materials having different center pore diameters. (Pore diameter: 4.2 nm), 3: SBA-15 (central pore diameter: 5.4 nm), 4: SBA-15 (central pore diameter: 7.1 nm), 5: SBA-15 (central pore diameter) 10.6 nm), 6: SBA-15 microsphere (center pore diameter: 18.5 nm), 7: SBA-15 microsphere (center pore diameter: 24.5 nm), It is.

  From FIG. 7 (a)-(e), the presence of DNA amplification products was observed in 6 types of silica-based nanoporous materials other than SBA-15 microsphere (central pore diameter: 24.5 nm). However, in the case of circular plasmid DNA having 2566 base pairs inserted, amplification was not observed with DNA synthase immobilized on SBA-15 (central pore diameter: 10.6 nm), and 5027 base pairs were inserted. In the case of the circular plasmid DNA, amplification was not observed with DNA synthase immobilized on FSM-22 (central pore diameter: 4.2 nm) and SBA-15 (central pore diameter: 10.6 nm). In addition, in both cases where the silica-based nanoporous material is FSM or SBA type, a tendency that the DNA amplification activity increases as the central pore diameter of the silica-based nanoporous material decreases is observed. In particular, FSM-16 (central pore diameter: 2.6 nm) is suitable. In the case of SBA, SBA-15 (central pore diameter: 5.4 nm) is particularly suitable, and then SBA-15 (central pore diameter). : 7.1 nm), and in the case of SBA microsphere, SBA-15 microsphere (center pore diameter: 18.5 nm) was suitable. The above results indicate that the DNA synthase-BSA-silica nanoporous material complex has amplification activity for insertion DNAs having different lengths of 600 to 5000 base pairs of circular plasmid DNA, This suggests that the DNA amplification activity of the DNA synthase can be controlled by the difference in the central pore diameter of the silica-based nanoporous material.

(Example 4) DNA amplification for circular DNA (evaluation of amplification reaction of trace amount DNA)
The left figure (a) and the right figure (b) of FIG. 8 show the amount of substrate DNA (circular plasmid DNA (T-Vector pMD20) into which 616 base pairs of SEQ ID NO: 4 is inserted) in 1 μg of the reaction solution in 50 μL. To 0.01 fg, and a DNA amplification product (PCR method) after performing polymerase chain reaction (PCR method) 25 times with a DNA synthase-BSA-silica nanoporous material complex. (Analysis results of molecular size: about 800 base pairs). In the figure, M is a DNA molecular size marker, and NC is a case where a primer DNA is added without adding a substrate DNA to a free DNA synthase not immobilized on a silica-based nanoporous material. In the figure, (a) is when free DNA synthase is used, and (b) is when DNA synthase-BSA-FSM-16 (center pore diameter: 2.6 nm) complex is used. .

  In the figure, marks 1 to 9 indicate the amount of substrate DNA in the reaction solution 50 μL: 1: 1 ng, 2: 0.1 ng, 3: 0.01 ng, 4: 1 pg, 5: 0.1 pg, 6: 0. .01 pg, 7: 1 fg, 8: 0.1 fg, 9: 0.01 fg, when diluted stepwise and the DNA amplification activity was evaluated.

  FIG. 8 (a) shows that when free DNA synthase is used, amplification up to 0.01 ng is shown, and thereafter, nonspecific DNA amplification proceeds remarkably at substrate DNA amounts of 1 pg or less. became. On the other hand, from FIG. 8 (b), in the case of the immobilized DNA synthase, a remarkable suppression effect of nonspecific DNA amplification was recognized, and amplification of a trace amount of DNA of 0.1 to 0.01 fg was shown. As a result of these experimental results, the DNA synthase-BSA-silica nanoporous material complex has the ability to suppress side reactions. As a result, a very small amount of substrate DNA (0.01 fg = 2.7 molecules), that is, This shows the possibility that the amplification activity from several molecules of DNA has been improved.

(Example 5) DNA amplification targeting circular DNA (effect of pore diameter in amplification reaction of trace amount DNA)
FIG. 9 shows DNA immobilized on free DNA synthase and seven types of silica-based nanopore materials using the reaction conditions of Maru 9 in FIG. 8B (substrate DNA amount: 0.01 fg). In the polymerase chain reaction (PCR method) using a synthetic enzyme, the analysis result of the DNA amplification product (molecular size: about 800 base pairs) when the number of PCR cycles is further increased to 35 cycles is shown. In the figure, M is a DNA molecular size marker, PC is a free DNA synthase that is not immobilized on a silica-based nanoporous material, and NC does not add substrate DNA to the free DNA synthase. When primer DNA is added.

  Also, in the figure, circles 1 to 7 indicate 1: FSM-16 (center pore diameter: 2.6 nm), 2: FSM-22 (center fine diameter) of various silica-based nanoporous materials having different center pore diameters. (Pore diameter: 4.2 nm), 3: SBA-15 (central pore diameter: 5.4 nm), 4: SBA-15 (central pore diameter: 7.1 nm), 5: SBA-15 (central pore diameter) 10.6 nm), 6: SBA-15 microsphere (center pore diameter: 18.5 nm), 7: SBA-15 microsphere (center pore diameter: 24.5 nm), It is.

  FIG. 9 shows that both PC and NC showed non-specific DNA amplification, and no amplification of target DNA was observed. On the other hand, in the DNA synthase-BSA-silica-based nanoporous material complex, a very small amount of DNA (0.01 fg = 2.7 molecule) in four types out of seven types of silica-based nanoporous materials. Specific amplification from) was observed. Specifically, FSM-22 (central pore diameter: 4.2 nm), SBA-15 (central pore diameter: 10.6 nm), and SBA-15 microsphere (central pore diameter: 24.5 nm) The immobilized DNA synthase did not show non-specific DNA amplification, but the target DNA amplification product could not be obtained. FSM-16 (central pore diameter: 2.6 nm), SBA-15 ( Central pore diameter: 5.4 nm), SBA-15 (central pore diameter: 7.1 nm), and DNA synthetase immobilized on SBA-15 microsphere (central pore diameter: 18.5 nm) A clear DNA amplification product was clearly shown. SBA-15 (center pore diameter: 5.4 nm) showed target DNA amplification, but nonspecific DNA amplification downstream of the target DNA.

  From the above results, the DNA synthase-BSA-silica nanoporous material complex has an effect of significantly suppressing nonspecific DNA amplification in the amplification reaction of long-chain DNA using circular plasmid DNA as a template, This effect shows that it can be amplified from a small amount of substrate DNA that is 1 / 1,000,000 of the amount of substrate DNA that is required for DNA amplification reactions using conventional free enzymes, that is, several molecules of substrate DNA. It has been found that the silica pores of the system nanopore material are suitable as a side reaction suppression field in the DNA amplification reaction. In addition, since each type of silica-based nanoporous material has a different optimum pore size for amplifying a trace amount of DNA, the reaction activity of the immobilized DNA synthase in the amplification of a trace amount of DNA is that of the silica-based nanoporous material. The possibility that it can be controlled by the difference in pore size was suggested.

(Example 6) DNA amplification targeting circular DNA (verification of ability to exclude background DNA out of reaction system)
The left figure (a) and the right figure (b) of FIG. 10 show DNA synthase-BSA-silica nano-particles using eight kinds of PCR buffer solutions containing DNA synthase (1 unit) and having different reaction compositions. A porous material complex precursor is obtained, and then circular plasmid DNA (3354 base pairs, 1 ng) into which the 616 base pair DNA shown in SEQ ID NO: 4 is inserted is added as background DNA, followed by After washing the complex with 100 μL of the PCR buffer solution, 50 μL of the PCR buffer solution containing the target circular plasmid DNA (4010 base pairs, 1 ng) into which 1272 base pairs of DNA were inserted was added. This shows the analysis result of the DNA amplification product when the enzyme reaction is started and the temperature cycle is repeated 25 times. In the figure, (a) is a DNA synthase immobilized on FSM-22 (central pore diameter: 4.2 nm), and (b) is SBA-15 (central pore diameter: 5.4 nm). In the case of immobilized DNA synthase.

  In the figure, M is a DNA molecule size marker, and Mull 1 and 5 are 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM as the composition of a buffer solution for enzyme immobilization and background DNA washing. Potassium chloride, 0.1% Triton X-100, 0.001% BSA, Mull 2 and 6 are 120 mM Tris-HCl (pH 8), and Mull 3 and 7 are buffered. The composition of the solution is 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.1% Triton X-100, and Mal 4 and 8 are 120 mM Tris-HCl as the composition of the buffer solution. (PH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.0 A 1% BSA, is the case. Further, in the figure, circles 1 to 4 are when the buffer solution contains 1 mM magnesium chloride, and circles 5 to 8 are when the buffer solution does not contain 1 mM magnesium chloride.

From FIG. 10 (a), in the case of the DNA synthase-BSA-FSM-22 (central pore diameter: 4.2 nm) complex, the DNA amplification reaction proceeds only when the buffer solution of Mull 1 is used. As can be seen, no DNA amplification of both target DNA and background DNA was shown when the buffer solutions from 2 to 8 were used. On the other hand, from FIG. 10 (b), in the case of the DNA synthase-BSA-SBA-15 (central pore diameter: 5.4 nm) complex, when the buffer solutions of Mull 1, 3, 5, 7 are used. Shows nonspecific DNA amplification derived from background DNA together with target DNA. When buffer solutions of 2, 4, 6, and 8 are used, no background DNA is shown and only target DNA is shown. In the case where selective amplification was observed, and when BSA was contained without containing Mg salt (Mal 8), the amplification efficiency was the highest (DNA amplification efficiency was based on the band intensity of the PCR product of Mull 4 ( 1), Mal 8 was 4.6 times, Mal 2 was 3.2 times, and Mal 6 was 2.4 times), but in the case of Mal 8, background DNA appeared. . From the above results, in the case of FSM-22 (center pore diameter: 4.2 nm), a normal PCR buffer solution containing Mg salt, Triton X-100 and the like is preferable together with BSA. In the case of SBA-15 (central pore diameter: 5.4 nm), it was found that a buffer solution containing BSA but not containing Mg salt was suitable.
However, in this experiment, the amount of DNA added is not a very small amount (1 ng), and the background DNA is added after enzyme immobilization, so it can be said that the background DNA can be accurately excluded from the reaction system. Therefore, the following experiment was continuously performed on a very small amount (0.1 pg) of target DNA.

(Example 7) DNA amplification for a very small amount of circular DNA (verification of the ability to exclude background DNA out of the reaction system)
11 (a)-(c), a circular plasmid DNA (3354) in which the DNA of 616 base pairs shown in SEQ ID NO: 4 is inserted by the DNA synthase-BSA-silica nanoporous material complex. DNA synthase-BSA-silica nanoporous material composite using 8 types of PCR buffer solutions with different reaction compositions, including 0.1 pg of base pair, background DNA) and DNA synthase (1 unit) A precursor is obtained, and then the complex is washed with 100 μL of the same buffer solution for PCR, and then contains 0.1 pg of a target circular plasmid DNA (4010 base pairs) into which 1272 base pairs of DNA have been inserted. The results of analysis of the DNA amplification product when the enzyme reaction is started by adding 50 μL of the PCR buffer solution and the temperature cycle is repeated 25 times are shown. The In the figure, M is a DNA molecular size marker, and P1 is a circular plasmid DNA (3354 base pairs, 3354 base pairs, in which DNA of 616 base pairs is inserted using a free DNA synthase not immobilized on a silica-based nanoporous material. When the background DNA is amplified, P2 is when the target circular plasmid DNA (4010 base pairs) into which 1272 base pairs of DNA have been inserted is amplified using free DNA synthase. In the figure, (a) is a DNA synthetase immobilized on FSM-16 (central pore diameter: 2.6 nm), and (b) is SBA-15 (central pore diameter: 5.4 nm). In the case of the immobilized DNA synthetase, (c) is the case of the DNA synthetase immobilized on SBA-15 microsphere (central pore diameter: 18.5 nm).

  Further, in the figure, Mars 1 and 5 are 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.1% Triton as the composition of the buffer solution for enzyme immobilization and background DNA washing. X-100, 0.001% BSA, 2 and 6 are 120 mM Tris-HCl (pH 8) as the composition of the buffer solution, and 3 and 7 are 120 mM Tris- as the composition of the buffer solution. HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride, 0.1% Triton X-100, and Mal 4 and 8 have a buffer solution composition of 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, In this case, 10 mM potassium chloride, 0.001% BSA. Further, in the figure, circles 1 to 4 are when the buffer solution contains 1 mM magnesium chloride, and circles 5 to 8 are when the buffer solution does not contain 1 mM magnesium chloride.

  From FIG. 11 (a), in the case of the DNA synthase-BSA-FSM-16 (central pore diameter: 2.6 nm) complex, the progress of the DNA amplification reaction hardly occurs when the buffer solution of Mull 5 is used. When the buffer solutions of 2, 3, 6, and 8 were used, DNA amplification of both the target DNA and the background DNA was observed, and three types of buffer solutions of 1, 4, and 7 were used. In some cases no background DNA was shown and selective amplification of only the target DNA was observed. In particular, when the buffer solutions of Mull 1 and 4 are used, the amplification efficiency of the target DNA is high. From this, the presence or absence of Triton X-100 is not so much affected, and a buffer solution containing Mg salt together with BSA is used. It was found that the background DNA washing and the target DNA amplification proceeded efficiently (the DNA amplification efficiency was based on the band intensity of the PCR product (P2) by free DNA synthase as a reference (1 time)). In this case, Maru 1 was 1.11 times, Maru 4 was 1.01 times, and Maru 7 was 0.25 times.

  From FIG. 11 (b), in the case of the DNA synthase-BSA-SBA-15 (central pore diameter: 5.4 nm) complex, the target DNA increased in all types of buffer solutions 1 to 8. Efficiency amplification was shown. Although the buffer solutions from 1 to 4 showed amplification of a very small amount of background DNA, the buffer solutions from 5 to 8 showed almost no amplification of the background DNA. When DNA was used, amplification of background DNA was not shown most, and selective amplification of only target DNA was observed. From this, it was found that when a buffer solution not containing magnesium chloride and containing Triton X-100 together with BSA was used, background DNA washing and target DNA amplification proceeded efficiently.

  From FIG. 11 (c), in the case of the DNA synthase-BSA-SBA-15 microsphere (central pore diameter: 18.5 nm) complex, the other of only Tris-HCl (pH 8) of Mull 2 and 6 When a buffer solution containing no additive is used, the progress of the DNA amplification reaction is hardly observed, and when a buffer solution of Mull 1, 3, 4, 7, 8 is used, an extremely small amount of background DNA is amplified. However, the amplification of the target DNA with high efficiency was confirmed, and when the buffer solution of Mull 5 was used, the amplification of the background DNA was hardly exhibited, and the selective amplification of only the target DNA was observed. It was. From this, it was found that, when a buffer solution that does not contain magnesium chloride and contains BSA and Triton X-100 is used, washing of the background DNA and amplification of the target DNA proceed efficiently.

  From the above results, the composition of the immobilization solution and the washing solution optimal for the selective amplification of a small amount of target DNA is high. It was found that each pore material was different.

(Example 8) Application of DNA synthase-silica-based nanoporous material complex to LAMP method In this example, DNA synthase (Bst DNA polymerase) -SBA-15 (central pore diameter: 5.4 nm) Evaluation of isothermal DNA amplification (LAMP method) using a complex and a flow type using a microfluidic device and a batch type was performed. For the DNA amplification reaction and amplification evaluation by the LAMP method, a DNA amplification reagent kit, primer set KHV, and a fluorescence / visual detection reagent (both manufactured by Eiken Chemical Co., Ltd.) were used. As reaction conditions, the reaction volume was set to 25 μL, and after heating at 65 ° C. for 50 to 60 minutes, DNA amplification was evaluated by fluorescence detection. In this enzyme reaction, an aluminum block thermostat (manufactured by Taitec Corp., Cool Thermo Unit) is used, and a fluorescence plate reader (manufactured by Molecular Devices Corp., SpectraMax M2e) is used, and substrate DNA is added (PC) When not added (NC), the fluorescence intensity (excitation wavelength: 320 nm, fluorescence wavelength: 515 nm) of the DNA amplification product was measured, and the enzyme activity was evaluated by using the PC / NC ratio as an index.

  FIG. 13 (a) shows free DNA synthase and DNA synthase-SBA-15 (central pore diameter) which are not immobilized on silica-based nanoporous materials, using koi herpesvirus (KHV) genomic DNA as substrate DNA. : 5.4 nm) Isothermal DNA amplification (LAMP method) (65 ° C., 60 minutes) in a batch reaction using the complex was performed, and the results of evaluation of enzyme activity are shown. In the case of a DNA synthase-SBA-15 (center pore diameter: 5.4 nm) complex, after the first reaction, the mixture is centrifuged, the supernatant is removed, and a new reaction solution is added. Repeated use of the immobilized enzyme up to 3 times.

  From FIG. 13 (a), in the case of the DNA synthase-SBA-15 (central pore diameter: 5.4 nm) complex, DNA amplification activity equivalent to that of the free enzyme is exhibited even after repeated use. It was. This suggested the feasibility of repeated use of the DNA synthase-silica nanoporous material complex in the LAMP method.

  FIG. 13 (b) shows a flow system using a microfluidic device (reaction volume: about 125 μL, FIG. 12) in which a DNA synthase-SBA-15 (central pore diameter: 5.4 nm) complex is supported in a flow path. In the continuous reaction, isothermal DNA amplification (LAMP method) (65 ° C., 50 minutes (residence time)) was performed, and the results of evaluation of enzyme activity are shown. As an experimental operation, first, a reaction solution (50 μL) containing a koi herpesvirus (KHV) genomic DNA, a DNA synthase, a fluorescent / visual detection reagent, etc. is filled in the microchannel, and then no enzyme is contained. 300 μL of the reaction solution (PC: with substrate DNA, NC: without substrate DNA) was fed (flow rate: 2.5 μL / min), and samples were collected in order of 25 μL. In addition, in order to keep the temperature of the reaction solution being sent constant, the inside of the microchannel is heated to 65 ° C. by applying a voltage to the transparent conductive film (made by Blast) installed on the back of the microfluidic device. did.

  From FIG. 13 (b), the microfluidic device in which the DNA synthase-SBA-15 (central pore diameter: 5.4 nm) complex is immobilized is more than twice the free enzyme even after repeated use of 9 degrees. The DNA amplification activity was retained. This suggests the feasibility of repeated use of the DNA synthase-silica nanoporous material complex in a flow-type isothermal DNA amplification (LAMP method) using a microfluidic device.

(Example 9) DNA amplification for circular DNA (evaluation of amplification reaction of trace amount DNA) -2
In this example, except that the DNA of SEQ ID NO: 5 (1272 base pairs) was inserted into a circular plasmid DNA (T-Vector pMD20) as a substrate DNA and the number of PCR cycles was increased to 35 (Examples). The same method as in 4) was applied. Specifically, the amount of substrate DNA in 50 μL of a reaction solution containing 0.001% by weight of BSA was diluted stepwise in the range of 1 ng to 0.01 fg and washed with a BSA-containing buffer solution-BSA- Polymerase chain reaction (PCR method) was performed 35 times with a silica-based nanoporous material composite. FIGS. 14A and 14B show the analysis results of the subsequent DNA amplification product (molecular size: about 1500 base pairs). In the figure, M is a DNA molecule size marker. 14A shows the case where a free DNA synthase is used, and FIG. 14B shows the case where a DNA synthase-BSA-FSM-16 (central pore diameter: 2.6 nm) complex is used. .
In the figure, marks 1 to 9 indicate the amount of substrate DNA in the reaction solution 50 μL: 1: 1 ng, 2: 0.1 ng, 3: 0.01 ng, 4: 1 pg, 5: 0.1 pg, 6: 0. .01 pg, 7: 1 fg, 8: 0.1 fg, 9: 0.01 fg, when diluted stepwise and the DNA amplification activity was evaluated.

According to FIG. 14 (a), in the case of free DNA synthase, amplification of the target DNA is shown in the amount of substrate DNA of Mal 3 up to 1 pg, and remarkable in the amount of substrate DNA of Mal 4 of 0.1 pg or less. Non-specific DNA amplification reaction was shown. On the other hand, according to FIG. 14 (b), in the case of the immobilized DNA synthase, the non-specific DNA amplification reaction was suppressed, and the amplification of the target DNA was demonstrated up to 0.01 fg trace DNA of mal 9. . These experimental results show that the DNA synthase-BSA-silica nanoporous material complex has the ability to suppress nonspecific DNA amplification reaction, resulting in 100,000 minutes of free DNA synthase. It shows specific and stable amplification from one very small amount of substrate DNA (corresponding to 0.01 fg = 2.3 molecules of Mull 9), ie several molecules of substrate DNA.
In addition, according to the same experiment when BSA is not added to the reaction solution, the stability of the PCR reaction decreases and the amount of non-specific reaction increases. In particular, in the case of free DNA synthase, the substrate DNA could not be amplified with an amount of 0.01 ng or less (not shown).

(Example 10) DNA amplification targeting circular DNA (effect of pore diameter in amplification reaction of trace amount DNA) -2
In this example, seven types of silica-based nanoporous materials similar to (Example 5) were used, and the reaction conditions (substrate DNA amount: 0.1 fg) of FIG. The number of PCR cycles was increased to 35 and a follow-up was performed. Specifically, for 0.1 fg of substrate DNA containing DNA of SEQ ID NO: 5 (1272 base pairs), free DNA synthase and DNA synthase immobilized on 7 types of silica-based nanoporous materials are used. The polymerase chain reaction (PCR method) was performed 35 times.

FIG. 15 shows the analysis result of the obtained DNA amplification product (molecular size: about 1500 base pairs). In the figure, M is a DNA molecular size marker, PC is a free DNA synthase that is not immobilized on a silica-based nanoporous material, and NC does not add substrate DNA to the free DNA synthase. When primer DNA is added.
Also, in the figure, circles 1 to 7 indicate 1: FSM-16 (center pore diameter: 2.6 nm), 2: FSM-22 (center fine diameter) of various silica-based nanoporous materials having different center pore diameters. (Pore diameter: 4.2 nm), 3: SBA-15 (central pore diameter: 5.4 nm), 4: SBA-15 (central pore diameter: 7.1 nm), 5: SBA-15 (central pore diameter) 10.6 nm), 6: SBA-15 microsphere (center pore diameter: 18.5 nm), 7: SBA-15 microsphere (center pore diameter: 24.5 nm), It is.

  According to FIG. 15, both PC and NC showed nonspecific DNA amplification, and no amplification of target DNA was observed. On the other hand, in the DNA synthase-BSA-silica-based nanoporous material complex, in 7 types of silica-based nanoporous materials, in 4 types, a very small amount of DNA (0.1 fg = 23 molecules) at the tens of centimeters level. Specific amplification from was observed. Specifically, FSM-22 (central pore diameter: 4.2 nm), SBA-15 (central pore diameter: 10.6 nm), and SBA-15 microsphere (central pore diameter: 24.5 nm) The immobilized DNA synthase did not show non-specific DNA amplification, but the target DNA amplification product could not be obtained. FSM-16 (central pore diameter: 2.6 nm), SBA-15 ( Central pore diameter: 5.4 nm), SBA-15 (central pore diameter: 7.1 nm), and DNA synthetase immobilized on SBA-15 microsphere (central pore diameter: 18.5 nm) A clear DNA amplification product was clearly shown.

  The above results almost coincide with the results of Example 5 (FIG. 9) in which the length of the target DNA amplification product was 0.8 kb. In other words, the DNA synthase-BSA-silica nanoporous material complex significantly increases non-specific DNA amplification even if the target DNA amplification product is a long chain DNA of 1.5 kb, which is nearly twice as long. It was confirmed that it has the effect of suppressing and amplifying substrate DNA of several tens of centimeters. Moreover, the same tendency was shown about the optimal pore diameter for the micro amount DNA amplification for each type of silica-based nanoporous material even if the length of the amplification product was changed.

(Example 11) DNA amplification for a very small amount of circular DNA (verification of the ability to exclude background DNA out of the reaction system)
This example is an experiment in which the same method as in (Example 6) was applied to a very small amount of target DNA of the tens of centimeters level of 0.1 fg.
Specifically, the target circular plasmid DNA (4010 base pairs) into which the DNA of 1272 base pairs shown in SEQ ID NO: 5 as used in (Example 6) was inserted was used as the substrate DNA, and SEQ ID NO: 4 The circular plasmid DNA (3354 base pairs) into which the DNA of 616 base pairs shown was inserted was used as background DNA, and 0.1 fg each was used. As in (Example 6), four types of PCR buffer solutions having different reaction compositions containing 0.1 fg of background DNA and DNA synthase (1 unit) (lanes (1), (3), (5) and (7) reaction composition), a DNA synthase-BSA-silica nanoporous material complex precursor is obtained, and the complex is added with 100 μL of a PCR buffer solution containing or not containing BSA. After washing, the enzymatic reaction was started by adding 50 μL of the PCR buffer solution containing 0.1 fg of substrate DNA containing 1272 base pair target DNA, and the temperature cycle was repeated 35 times. The analysis result of the obtained DNA amplification product is shown in FIG. (A) is an electropherogram, and (b) is a table summarizing the results of (a) together with the experimental results of FIG.

Here, the enzyme immobilization reaction solution and the background DNA washing buffer solution are the same, and the four types of solutions shown in the figure are 120 mM Tris-HCl (pH 8), 6 mM ammonium sulfate, 10 mM potassium chloride. 0.1% Triton X-100 is a common composition.
In FIG. 16A, M is a DNA molecule size marker. In the figure, the presence or absence of addition of 0.001% BSA to the buffer solution is indicated by + and −, and the presence or absence of addition of 1 mM magnesium chloride is indicated by (+) and (−).
In FIG. 16B, the presence or absence of addition of 0.001% BSA and 1 mM magnesium chloride to the buffer solution is indicated by + and −, and the presence or absence of amplification of background DNA and target DNA is indicated by + and −. did. A thick frame indicates a case where the good uniqueness effect obtained in FIG. 11 is matched, and a case where the effect is weak but shows the same tendency is indicated by a dotted frame.
BSA was added when FSM-16 (central pore diameter: 2.6 nm) was used as the silica-based nanoporous material and when SBA-15 (central pore diameter: 5.4 nm) was used. It was proved that the effect of suppressing the reaction suppression effect with non-specific DNA under conditions was reproducible even at 0.1 fg.

When SBA-15 microsphere (center pore diameter: 18.5 nm) was used as a silica-based nanoporous material, reproducibility at 0.1 fg was not observed in the results of the first DNA amplification experiment. According to the results of the second DNA amplification experiment, when 0.001% of BSA is contained, it is the target DNA (+) and background (−) regardless of the presence or absence of MgCl ₂ , and when BSA is not contained, the presence or absence of MgCl ₂ Regardless of the result, the results of target DNA (+) and background (+) were obtained (not shown). Considering this second result, it can be said that the effect of the addition of BSA in Example 7 (FIG. 11) was almost confirmed even at 0.1 fg.
That is, from the above results, even when the amount of template of background DNA and target DNA is as small as 0.1 fg, overall, the exclusion effect by washing of background DNA is demonstrated when BSA is added. It was done.
In addition, by examining the composition ratio of MgCl ₂ and other components in the immobilization solution and the washing solution that are optimal for selective amplification of a very small amount of target DNA, it is possible to further target the target DNA. It was also suggested that highly specific DNA amplification becomes possible.

  As described above in detail, the present invention relates to a DNA synthesizing enzyme-BSA-silica nanoporous material complex capable of amplifying a trace amount of DNA, and more specifically, a nucleic acid in which the complex is a reaction substrate. Non-specific by a DNA synthase-BSA-silica nanoporous material complex characterized by having a structure in a complex state that can interact with (DNA) and can stably express DNA synthesis ability It is possible to provide a method for amplifying DNA capable of suppressing DNA amplification and a method for amplifying a very small amount of DNA targeting several molecules of template DNA.

  More specifically, the present invention is a technology centered on a technique of applying a DNA synthesizing enzyme immobilized on silica pores of a silica-based nanoporous material to a nucleic acid (DNA) amplification reaction of a reaction substrate. In this method, adsorption of the reaction substrate DNA, primer, and dNTPs to the surface of the regular pores (silica pores) of the silica-based nanoporous material can be suppressed to the limit. Optimization of the immobilization state of various DNA synthases, the supply amount of various reaction substrates (DNA, primers, dNTPs) that can interact with the immobilized DNA synthase and the reaction environment The optimization enables suppression of non-specific DNA amplification by the DNA synthase and specific and highly sensitive amplification of a few molecules of trace DNA.

  Furthermore, the present invention is directed to general-purpose polymerase chain reaction (PCR method), environmental microorganisms and biological genetic diagnosis, and detection of various pathogenic factors in molecular biological techniques such as cloning and gene expression analysis, DNA amplification method for a very small amount of substrate DNA in isothermal DNA amplification (LAMP method), etc., and Rolling Circle Amplification for a very small amount of nucleic acid sample, for example, single-cell genomic DNA of difficult-to-cultivate microorganisms (RCA method) or a novel high-precision DNA amplification method in the field such as Multiple Displacement Amplification (MDA method).

  In addition, a microreactor in which a complex of DNA synthase for LAMP method and a silica-based nanoporous material, and also a complex containing BSA is supported in a microchannel is a more efficient and highly accurate DNA amplification reaction. Therefore, it is possible to provide a reliable and quick DNA diagnosis method and food inspection method.

Claims (17)

A method for producing a DNA synthase-BSA-silica nanopore material composite,
(1) A step of bringing a buffer solution containing a DNA synthase into contact with a silica-based nanoporous material to adsorb the DNA synthase into the silica pores;
(2) A production method, comprising a step of resuspending the obtained precipitate one or more times in a buffer solution containing bovine serum albumin (BSA) and collecting the precipitate by centrifugation.   The manufacturing method of Claim 1 whose buffer solution used at a process (1) is a buffer solution containing BSA.   The manufacturing method according to claim 1 or 2, wherein the silica-based nanoporous material is selected from any of FSM, SBA, and SBA microsphere.   The selected FSM has a central pore diameter of 2-4 nm, a selected SBA has a central pore diameter of 4-9 nm, or a selected SBA microsphere has a central pore diameter of 10-20 nm. The manufacturing method of Claim 3 which exists.   The production method according to claim 3 or 4, wherein the silica-based nanoporous material is FSM, and the buffer solution containing at least BSA used in step (2) further contains a magnesium salt and a surfactant.   The production method according to claim 5, wherein the buffer solution containing the DNA synthase used in the step (1) is a buffer solution containing BSA and a magnesium salt and a surfactant.   The silica-based nanoporous material is SBA or SBA microsphere, and the buffer solution containing at least BSA used in step (2) does not contain a magnesium salt but contains a surfactant. The manufacturing method as described in.   The production method according to claim 7, wherein the buffer solution containing the DNA synthase used in the step (1) is a buffer solution containing BSA, containing no magnesium salt, and containing a surfactant.   A DNA synthase-BSA-silica nanoporous material composite produced by the production method according to claim 1.   The target DNA is amplified by acting the DNA synthase-BSA-silica nanoporous material complex according to claim 9 together with a primer for amplifying the target DNA and dNTPs in a buffer containing BSA. A method for amplifying a target DNA. A method for detecting or identifying target DNA in a test sample, comprising the following (1) to (3);
(1) A step of diluting a test sample with a buffer containing BSA,
(2) A step of amplifying the target DNA by allowing the DNA synthase-BSA-silica nanoporous material complex according to claim 9 to act together with the target DNA amplification primer and dNTPs. (3) Detection of the target DNA Process.   The method according to claim 11, wherein the content of the target DNA in the test sample is 0.01 fg / ml to 1.0 μg / ml. A microreactor in which a DNA synthase-silica nanoporous material complex is supported inside a microchannel,
The DNA synthesizing enzyme is a DNA synthesizing enzyme for use in a DNA amplification reaction by the LAMP method, and the enzyme is immobilized inside the pores of the silica-based nanoporous material, and the DNA synthesizing enzyme-silica-based nanoporous A microreactor characterized by forming a material composite.   Further, BSA is adsorbed to the DNA synthase-silica nanoporous material complex supported inside the microchannel, thereby forming a DNA synthase-BSA-silica nanoporous material complex. The microreactor according to claim 13, wherein   15. A microreactor according to claim 13 or 14, wherein the silica-based nanoporous material is selected from any of FSM, SBA, and SBA microsphere. A method for amplifying a nucleic acid using the LAMP method, which comprises the following steps (1) to (5);
(1) a step of washing the inside of the microchannel of the microreactor according to claim 13 or 14 with a buffer;
(2) A step of heating so that the inside of the flow path becomes 65 ° C.,
(3) sending a reaction solution containing a nucleic acid sample containing or possibly containing a target nucleic acid and a target nucleic acid amplification primer set;
(4) A step of isothermally amplifying the target nucleic acid inside the flow path,
(5) A step of successively and successively collecting the solution containing the obtained nucleic acid amplification product.   The method according to claim 16, wherein the steps (1) to (5) are further repeated after recovering the nucleic acid amplification product.