JP2015519355A - TLR3 binding agent - Google Patents

Abstract

The present invention provides anti-TLR3 antibodies and methods of making and using them. This antibody is particularly suitable for the treatment of autoimmune or inflammatory diseases using anti-TLR3 antibodies.

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is based on US Provisional Patent Application No. 61 / 653,652, filed May 31, 2012, US Provisional Patent Application 61/653, filed July 11, 2012. No. 670,289 and US Provisional Patent Application No. 61 / 679,923, filed August 6, 2012, are claimed. All of these applications are incorporated herein by reference in their entirety, including all drawings.

Reference to Sequence Listing This application is filed with a sequence listing in electronic format. This sequence listing is provided as a file named “PCT Sequence Listing TLR3-4_ST25” created on May 29, 2013 with a size of 46 KB. Information in the electronic format of the sequence listing is incorporated herein by reference.

  The present invention relates to antibodies (eg, monoclonal antibodies), antibody fragments, and derivatives thereof that bind to TLR3 and inhibit TLR3 signaling. The present invention also provides cells that produce such antibodies; methods for making such antibodies; fragments, variants, and derivatives of said antibodies; pharmaceutical compositions comprising them; The present invention relates to a method for diagnosing, treating or preventing autoimmune diseases, inflammatory diseases and the like.

  The Drosophila tall protein is thought to control dorsal ventral patterning and present a primitive host defense mechanism. In humans, TLR is thought to be an important component of innate immunity. Human and Drosophila tall protein sequences show homology over the entire length of the protein chain. The family of human toll-like receptors is composed of ten highly conserved receptor proteins, TLR1-TLR10. Similar to Drosophila toll, human TLR is a type I transmembrane protein containing an extracellular domain, which includes a leucine-rich repeat (LRP) domain that recognizes a pathogen-associated molecular pattern (PAMP). , Composed of a cytoplasmic domain homologous to the cytoplasmic domain of the human interleukin-1 (IL-1) receptor. Similar to signaling for both Drosophila toll and IL-1 receptors, human toll-like receptors signal through the NF-κB pathway.

  Although various mammalian TLRs have many common features and signaling mechanisms, their biological functions are very different. This is partly because four different adapter molecules (MyD88, TIRAP, TRIF and TRAF) mediate different signaling pathways associated with TLRs in various combinations. Furthermore, various ligands of one TLR are thought to preferentially activate different signaling pathways. Furthermore, the expression of TLRs in various hematopoietic and non-hematopoietic cells is also different. Thus, the response to a TLR ligand depends not only on the signal transduction pathway activated by the TLR, but also on the nature of the cell in which the individual TLR is expressed.

  Toll-like receptor 3 (TLR3) has attracted considerable interest as a therapeutic target because TLR3 signaling is associated with inflammatory and autoimmune conditions. Patent Document 1 provides the nucleic acid and amino acid sequences of hTLR3 protein. Non-Patent Document 1 discloses the use of anti-TLR3 antibodies for binding to cell surface TLR3. Antibody C1130 has been shown to be active against TLR3 and is described in US Pat. Non-patent document 2 describes a polyclonal antibody that inhibits TLR3. Patent Document 3 and Non-Patent Document 3 bind to and inhibit cell surface TLR3, but have not been reported to bind to cell compartment TLR3 or to bone marrow cell lineage DC. Antibody clone TLR3.7 The antibody corresponding to (eBioScience Inc., San Diego) is described. Patent Document 4 describes antibody C1068, which is reported to inhibit cytokine production in epithelial cells that are reported to express TLR3 on the cell surface. U.S. Patent No. 6,099,077 provides additional anti-TLR3 antibodies. Other anti-TLR3 antibodies for use in research include R & D Systems Corp. Polyclonal anti-TLR3 antibody manufactured by Abcam, antibody 40C1285 manufactured by Abcam, and antibodies 619F7, 713E4, 716G10, IMG-5563, and -IMG-5348 (all manufactured by Imgenex Corp).

  However, among the currently available anti-TLR3 antibodies, they are not optimal for use as therapeutics, for example, aimed at modulating TLR3 in vivo. For example, many have the disadvantage of lack of potency or affinity for the epitope. Accordingly, there is a need to provide improved antibodies against TLR3.

  The present invention stems from the discovery of novel compositions, including monoclonal antibodies that specifically bind to human TLR3 and inhibit its function, including but not limited to antibody fragments and derivatives, and methods of using the same. It was.

  The present invention provides antibodies with new properties useful in targeting TLR3 in vivo. Since TLR3 binds to its natural ligand (dsRNA) and signals only in endosomes in macrophages and dendritic cells (DC) (at acidic pH), antibodies have so far been signaled Selection has been based on high affinity at endosomal pH. However, little is known about the mechanism by which anti-TLR3 antibodies enter cells. The present invention provides an antibody having strong binding to exposed TLR3 on the cell surface in a pH neutral environment and exhibiting improved efficacy in inhibiting TLR3. Thus, optimization of binding of TLR3 expressed on the cell surface can be an important criterion for cellular (endosomal) uptake by cells, thereby allowing conditioning of downstream (or total) biological activity. Become. The antibody exhibits strong binding to human cell surface TLR3 as observed in assays where TLR3 is expressed only on the cell surface at neutral pH conditions. In this way, antibodies with improved cell surface binding were selected. Thus, the inhibitory activity of an anti-TLR3 antibody can be controlled by recirculating the endosomal TLR3 polypeptide involved in endocytosis to the cell surface once the receptor is separated from its ligand.

In one aspect of the invention, the invention provides an antibody that inhibits TLR3-mediated signaling in a TLR3-expressing cell, wherein the antibody is a human that is expressed only on the surface of the cell, optionally at neutral pH. It specifically binds to a TLR3 polypeptide. Optionally, the antibody has an EC ₅₀ of 0.3 μg / ml or less, optionally 0.2 μg / ml or less, optionally 0.1 μg / ml or less, for binding to cells that express TLR3 only on the cell surface.

  In one form, the present invention is directed at least in part (or primarily or exclusively) on the glycan-free outer surface (surface bound by dsRNA) of a TLR3 polypeptide, and optionally further at least partially human. An antibody is provided that binds to the N-terminal portion of a TLR3 protein within the N-terminal dsRNA binding site of the TLR3 polypeptide. Optionally, the antibody further binds to TLR3 at least partially within the backbone of the N-terminal portion of the TLR3 polypeptide.

  Although several previous epitopes on TLR3 have been shown to be useful for effective inhibition of TLR3, the epitopes are not necessarily present in non-human primates. In one aspect, the invention provides an antibody that inhibits TLR3 polypeptide activity by binding to the N-terminal portion of a human TLR3 protein and also binds to non-human primate TLR3. In one aspect, the invention provides an antibody that binds to the N-terminal portion of a TLR3 protein and does not compete with dsRNA for binding to human TLR3, wherein the antibody is a non-human primate TLR3 polypeptide. (In non-human primate TLR3-expressing cells). In one aspect, the invention provides an antibody that binds to the N-terminal portion of a TLR3 protein and competes with dsRNA for binding to the N-terminal dsRNA binding site of a human TLR3 polypeptide, wherein the antibody is It also binds to non-human primate TLR3 polypeptides (in non-human primate TLR3-expressing cells). In one embodiment, an antibody that is at least partially (or predominantly or exclusively) on the glycan-free outer surface (the surface bound to dsRNA) of a TLR3 polypeptide. In one embodiment, the antibody binds to TLR3 at least partially within the N-terminal dsRNA binding site of a human TLR3 polypeptide. In one embodiment, the non-human primate is a cynomolgus monkey (macaca fascicularis). In one embodiment, the non-human primate TLR3 polypeptide comprises the amino acid sequence set forth in NCBI accession number BAG55033 (SEQ ID NO: 2).

  In one aspect, the present invention specifically relates to human TLR3 protein within residues 41-251 of human TLR3 of SEQ ID NO: 1, optionally at least partially within residues 41-139, 41-120 or residues 41-89. An antibody that binds to the N-terminal portion of is provided.

  In one aspect, the invention provides an antibody that binds to the N-terminal portion of a human TLR3 protein, wherein the antibody is compared to the binding between this antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1. Has reduced binding to a TLR3 polypeptide having a mutation at the N-terminal portion in the segment corresponding to residues 41-139 of SEQ ID NO: 1.

  Optionally, the antibodies of the invention interfere with the binding of dsRNA to the terminal dsRNA binding site of human TLR3 polypeptide. Optionally, the antibody binds to one or more amino acid residues in the glycan-free outer surface of the TLR3 polypeptide involved in binding of the TLR3 polypeptide and dsRNA, and / or residues adjacent thereto.

  Optionally, the antibody binds to an epitope comprising residue 64 and / or residue 65 of SEQ ID NO: 1 and / or has a mutation at residue 64 and / or residue 65 of SEQ ID NO: 1 With reduced binding. Optionally, the antibody binds to an epitope comprising residue 86 and / or residue 89 of SEQ ID NO: 1 and / or has a mutation at residue 86 and / or residue 89 of SEQ ID NO: 1 With reduced binding. Optionally, the antibody binds to an epitope comprising residues 117 and / or residue 120 of SEQ ID NO: 1 and / or has a mutation at residues 117 and / or residue 120 of SEQ ID NO: 1 With reduced binding. Optionally, the antibody binds to an epitope comprising residues 137 and / or residue 139 of SEQ ID NO: 1 and / or has a mutation at residues 137 and / or residue 139 of SEQ ID NO: 1 With reduced binding. Optionally, the antibody binds to an epitope comprising residues 112, 113 and / or residue 115 of SEQ ID NO: 1 and / or has a mutation in residues 112, 113 and / or 115 of SEQ ID NO: 1. Has reduced binding to the polypeptide.

  In one embodiment, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residues 117 and / or residue 120 of SEQ ID NO: 1, and residues 137 and / or residue 139 of SEQ ID NO: 1. Has reduced binding to a TLR3 polypeptide having a mutation. Optionally, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residue 117 and / or residue 120 of SEQ ID NO: 1, and wherein residues 137 and / or residues of SEQ ID NO: 1 It does not have reduced binding to a TLR3 polypeptide with a mutation at 139.

  In one embodiment, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residue 64 and / or residue 65 of SEQ ID NO: 1, and at residue 137 and / or residue 139 of SEQ ID NO: 1. Has reduced binding to a TLR3 polypeptide having a mutation. Optionally, the antibody is mutated at residues 137 and / or 139 of SEQ ID NO: 1 and reduced binding to a TLR3 polypeptide having a mutation at residue 86 and / or residue 89 of SEQ ID NO: 1. Having reduced binding to a TLR3 polypeptide having Optionally, the antibody does not have reduced binding to a TLR3 polypeptide having a mutation at residue 117 and / or residue 120 of SEQ ID NO: 1. Optionally, the antibody does not have reduced binding to a TLR3 polypeptide having a mutation at residues 112, 113 and / or 115 of SEQ ID NO: 1.

  Optionally, the antibody is a TLR3 polypeptide having a mutation at residue 64 and / or residue 65 of SEQ ID NO: 1, a TLR3 polypeptide having a mutation at residue 86 and / or residue 89 of SEQ ID NO: 1, Has reduced binding to a TLR3 polypeptide having a mutation at residues 137 and 139 of SEQ ID NO: 1. As evidenced by binding to TLR3 mutants, antibodies differ in their epitopes from previously described antibodies.

  In one embodiment, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residues 112, 113 and / or 115 of SEQ ID NO: 1, and at residues 137 and / or 139 of SEQ ID NO: 1. Has reduced binding to a TLR3 polypeptide having a mutation. In one embodiment, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residues 112, 113, and / or 115 of SEQ ID NO: 1, and at residues 117 and / or residue 120 of SEQ ID NO: 1. Has reduced binding to a TLR3 polypeptide having a mutation. In one embodiment, the antibody abruptly binds to a TLR3 polypeptide having a mutation at residues 112, 113 and / or 115 of SEQ ID NO: 1, residues 117 and / or residues 120 of SEQ ID NO: 1. It has reduced binding to a TLR3 polypeptide having a mutation and reduced binding to a TLR3 polypeptide having a mutation at residues 137 and / or 139 of SEQ ID NO: 1. In one embodiment, the antibody has reduced binding to a TLR3 polypeptide having a mutation at residues 112 and / or 113 of SEQ ID NO: 1, and a TLR3 polypeptide having a mutation at residue 137 of SEQ ID NO: 1. Having reduced binding. Optionally, the antibody does not have reduced binding to a TLR3 polypeptide having a mutation at residue 86 and / or residue 89 of SEQ ID NO: 1. Optionally, the antibody does not have reduced binding to a TLR3 polypeptide having a mutation at residues 64 and / or 65 of SEQ ID NO: 1.

  Optionally, in any of the embodiments described herein, the antibody maintains binding to a TLR3 polypeptide having a mutation at residues 116, 145, 182, 196 and / or 171 of SEQ ID NO: 1. (Has no reduced binding to the TLR3 polypeptide).

  In one aspect, the invention provides an antibody that interferes with the binding of dsRNA to a human TLR3 polypeptide. In one aspect, the invention provides an antibody that interferes with the binding of dsRNA to the N-terminal dsRNA binding site of a human TLR3 polypeptide. Optionally, the antibody competes with dsRNA for binding to a human TLR3 polypeptide, eg, a dsRNA binding site of a human TLR3 polypeptide. Competition is determined by standard methods, eg, whether the antibody binds to immobilized TLR3 in the presence of dsRNA and / or whether the dsRNA binds to immobilized TLR3 in the presence of the antibody under acidic conditions. Evaluation can be made using the Biacore assay to evaluate.

  Optionally, the following: (i) contacting an anti-TLR3 antibody with a TLR3 polypeptide to obtain an antibody bound to the TLR3 polypeptide; (ii) contacting the antibody-bound TLR3 polypeptide of step (i) with a dsRNA And then allowing the antibody to compete with the dsRNA for binding to the human TLR3 polypeptide in an in vitro assay comprising assessing whether the dsRNA reduces binding of the TLR3 polypeptide to the antibody, wherein If the binding is reduced, it indicates competition with dsRNA for the human TLR3 polypeptide. Optionally, the following: (i) contacting the anti-TLR3 polypeptide with dsRNA to obtain a dsRNA bound to the TLR3 polypeptide; (ii) the dsRNA-binding TLR3 polypeptide of step (i) with an anti-TLR3 antibody; After contacting, the antibody competes with dsRNA for binding to human TLR3 polypeptide in an in vitro assay comprising assessing whether the TLR3 polypeptide binds to the dsRNA-TLR3 polypeptide complex, wherein And lack of substantial binding indicates competition with dsRNA for human TLR3 polypeptide. Optionally, the following: (i) binding an anti-TLR3 antibody to a solid support (eg, via a constant domain), (ii) contacting the antibody with a TLR3 polypeptide and binding to the TLR3 polypeptide And (iii) contacting the antibody-bound TLR3 polypeptide of step (ii) with the dsRNA, and then evaluating whether the dsRNA reduces binding of the TLR3 polypeptide to the antibody. In an in vitro assay, the antibody is allowed to compete with dsRNA for binding to the human TLR3 polypeptide, where reduced binding indicates competition with the dsRNA for the human TLR3 polypeptide.

  In one form of any of the embodiments of the invention, the antibody binds to a human TLR3 polypeptide expressed on the surface of the cell and optionally evaluated in cells that express TLR3 only on the cell surface under neutral pH. As such, it is internalized into a cell that expresses TLR3 to inhibit TLR3 signaling within the cell (eg, a TLR3 expressing human dendritic cell).

In one form, the antibody binds to human TLR3 polypeptide under neutral conditions, particularly those typical of those found in the cytosol. Such neutral conditions are generally characterized by a pH of 6.6 to 7.4, for example a slightly alkaline pH of 7.2 found in the cell cytosol. Optionally, the antibody has the binding to TLR3 polypeptides at neutral pH, ^{10 -9} M or less, optionally ^{10 -10} M or less, the following _{K D} of optionally ^{10 -11} M. Optionally, the binding of the neutral condition, is of better affinity than acidic conditions, e.g., K _D for binding to TLR3 at neutral compared to acidic conditions is at least 0.5 1.0-, 1.5- or 2.0-log ₁₀ lower.

  The present invention further provides specific antibodies with increased activity compared to previously reported antibodies. In one form of any of the embodiments of the invention, the antibody is optionally any one or any of monoclonal antibodies 11E1, 7G11, 31F6, 32C4 and 37B7, under acidic and / or neutral conditions. The combination competes for binding with a TLR3 polypeptide (eg, a human TLR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 1). In one embodiment, the antibody of the invention is optionally under acidic and / or neutral conditions, the VH and VL regions of SEQ ID NOs: 3 and 4 (11E1), the VH and VL regions of SEQ ID NOs: 14 and 15 (31F6 ), An antibody having the VH and VL regions (32C4) of SEQ ID NOs: 25 and 26, the VH and VL regions of SEQ ID NOs: 36 and 37 (37B7), or the VH and VL regions (7G11) of SEQ ID NOs: 47 and 48, and TLR3 Compete for binding to the polypeptide. In one form of any of the embodiments of the invention, the antibody may have a heavy and / or light chain having one, two or three CDRs of antibodies 11E1, 7G11, 31F6, 32C4 and 37B7. Good.

In one form, an antibody that specifically binds to TLR3 has one or more of the following properties (any combination or all thereof):
a. Binds to a TLR3 polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and / or 2:
b. The antibody specifically binds to a human TLR3 polypeptide expressed only on the cell surface, wherein the antibody binds to a cell that expresses TLR3 only on the cell surface, and is 0.3 μg / ml or less, optionally 0. Have an EC ₅₀ of 2 μg / ml or less, optionally 0.1 μg / ml or less;
c. Internalize in cells expressing TLR3 on its surface;
d. Has sub-nanomolar affinity for TLR3 polypeptide at neutral pH, eg, pH of about pH 7.2;
e. Have sub-nanomolar affinity for TLR3 polypeptides at acidic pH, eg, pH below about pH 6.5, or at about 4.5-6.5 or about pH 5.6;
f. Inhibits TLR3 signaling in the presence of TLR3 ligand;
g. Inhibit TLR3 signaling in the inflammatory background, for example in the presence of inflammatory cytokines such as IFNα;
h. Competes with antibody 11E1, 7G11, 31F6, 32C4 or 37B7 for binding to a TLR3 polypeptide;
i. Competes with dsRNA for binding to the N-terminal portion of the TLR3 polypeptide;
j. Reduced binding to a TLR3 polypeptide having a mutation at residue 64 and / or residue 65 of SEQ ID NO: 1 and / or a TLR3 poly having a mutation at residue 86 and / or residue 89 of SEQ ID NO: 1 Having reduced binding to the peptide;
k. Reduced binding to a TLR3 polypeptide having a mutation at residue 117 and / or residue 120 of SEQ ID NO: 1, and / or a TLR3 poly having a mutation at residue 137 and / or residue 139 of SEQ ID NO: 1 Have reduced binding to the peptide and / or reduced binding to a TLR3 polypeptide having a mutation at residues 112, 113 and / or residue 115 of SEQ ID NO: 1; and / or l. At least 1, 2, 3, 4, 5, 6, 7 or 8 or more residues in the segment corresponding to residues 41-251, 41-89, 41-120 or 41-139 of the TLR3 polypeptide of SEQ ID NO: 1 Bind to the group.

  In one aspect, the invention relates to at least 1, 2, 3, in segments corresponding to residues 1-251, optionally 41-251, 41-89, 41-120 or 41-139 of the TLR3 polypeptide of SEQ ID NO: 1. Monoclonal antibodies that specifically bind to 4, 5, 6, 7 or 8 or more residues are provided. Optionally, the antibody inhibits signal transduction by the TLR3 polypeptide. Optionally, the antibody does not bind to residue 116, residue 145 and / or residue 182 of the TLR3 polypeptide of SEQ ID NO: 1. Optionally, the antibody does not bind to residue 171 and / or residue 196 of the TLR3 polypeptide of SEQ ID NO: 1. Optionally, binding of the antibody to a TLR3 polypeptide having a mutation at residues 116, 145, 182, 196 and / or residue 171 of the TLR3 polypeptide of SEQ ID NO: 1 results in the wild-type TLR3 polypeptide of SEQ ID NO: 1. Preferably, the mutation is a K145E, D116R, K182E, N196A and / or E171A mutation. Such antibodies further have any of the properties described herein, such as sub-nanomolar affinity for TLR3 polypeptides at acidic pH, in the presence of TLR3 ligand, or inflammatory background. Inhibits TLR3 signaling (eg, in the presence of inflammatory cytokines such as IFNα) and competes with 11E1, 7G11, 31F6, 32C4 or 37B7 for binding to the TLR3 polypeptide; C-terminal site of the TLR3 polypeptide Does not compete with dsRNA for binding to, or inhibits IP-10 secretion on DC (eg, in human bone marrow DC). Such antibodies can also be used in any of the methods of the invention.

  In one embodiment, the invention provides an antibody that binds to a TLR3 polypeptide, wherein the antibody is (i) SEQ ID NO: 5, 6 or 7 (HCDR1), 8 or 9 (HCDR2) and 10 (HCDR3). ) Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acid sequences, and (ii) light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 11, 12, and 13, respectively. 1, 2, 3, 4, or 5 or more amino acids in any of the above sequences may be substituted with a different amino acid. In one embodiment, the antibody comprises (i) the heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids set forth in SEQ ID NOs: 16, 17 or 18 (HCDR1), 19 or 20 (HCDR2) and 21 (HCDR3) And (ii) the light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 22, 23 and 24, respectively; Five or more amino acids may be substituted with different amino acids. In one embodiment, the antibody comprises (i) the heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 27, 28 or 29 (HCDR1), 30 or 31 (HCDR2) and 32 (HCDR3) And (ii) the light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 33, 34 and 35, respectively; Five or more amino acids may be substituted with different amino acids. In one embodiment, the antibody comprises (i) the heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 38, 39 or 40 (HCDR1), 41 or 42 (HCDR2) and 43 (HCDR3) And (ii) the light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 44, 45, and 46, respectively; Five or more amino acids may be substituted with different amino acids. In one embodiment, the antibody comprises (i) the heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 49, 50 or 51 (HCDR1), 52 or 53 (HCDR2) and 54 (HCDR3) And (ii) the light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 55, 56, and 57, respectively; Five or more amino acids may be substituted with different amino acids.

  In another embodiment, the antibody of any of the embodiments described herein can be internalized by cells that express a TLR3 polypeptide on their surface.

  In one embodiment, the antibody is a chimeric antibody, eg, comprising a non-mouse, optionally human constant region. In one embodiment, the antibody is a human antibody or is humanized. In another embodiment, the antibody is a mouse or rat antibody (eg, comprising a CDR from a rat or rat gene or a rat Ig locus gene segment). In another embodiment, the antibody does not substantially bind to other human TLRs (eg, TLR4).

  In one form of any of the embodiments of the invention, the antibody isotype is IgG, optionally IgG1 or IgG3. In one embodiment, the antibody is of an isotype comprising an Fc domain or conjugated with FcγR.

  In one form of any of the embodiments of the invention, the antibody is Fab, Fab ′, Fab′-SH, F (ab ′) 2, Fv, diabody, single chain antibody fragment, or multiple different antibody fragments. An antibody fragment selected from multiple antibodies comprising In one form of any of the embodiments of the invention, the antibody is of an isotype (eg, human CD16) that does not include an Fc domain or is substantially free of FcγR binding. In one embodiment, the antibody is of human IgG4 or IgG2 isotype. Human IgG4 isotypes or other IgG isotypes that have been modified to reduce their FcγR binding are advantageous pharmacological agents such as serum half-life while modulating TLR3 signaling without inducing cell death in DCs, for example. Can be used for specific properties. In one form of any of the embodiments of the invention, the anti-TLR3 antibody inhibits TLR3 signaling and comprises a constant region of a human IgG4 or IgG2 isotype. In one form of any of the embodiments of the invention, the anti-TLR3 antibody comprises a constant region (heavy chain constant region) that inhibits TLR3 signaling and does not substantially bind to FcγRIIIa.

  In a preferred embodiment, the anti-TLR3 antibody comprises a heavy chain of a human IgG4 isotype. In one embodiment, the anti-TLR3 antibody comprises a human IgG4 heavy chain constant region and complies with the EU index (Kabat et al., “Sequences of proteins of immunological interest”, 5th ed., NIH, Bethesda, ML, 1991). Residue 241 corresponding to position contains a serine to proline mutation. A composition comprising such an antibody is less than about 15% of an IgG4 “half antibody” (including a single heavy / light chain pair), such as less than about 10% (eg, less than about 5%, about 4 % Or less, about 3% or less, or about 1% or less). Such IgG4 “half-antibody” byproducts are formed by the heterogeneity of inter-heavy chain disulfide bridges at the hinge region in a portion of secreted human IgG4 (IgG4 “half-antibody”, the S241P mutation, and related For the principle, see Angal et al., Molecular Immunology, 30 (1): 105-108, 1993). This effect is typically detectable only under denaturing, non-reducing conditions.

  In another embodiment, the antibody is conjugated or covalently attached to a detectable or toxic moiety.

  In one form, the antibody optionally inhibits TLR3 signaling without blocking dsRNA TLR3 ligand binding to the major (ie, C-terminal) dsRNA binding site of the TLR3 polypeptide.

  In one form, the antibody also binds to human TLR3 under acidic conditions, particularly under conditions typical of those found in the acidified intracellular compartments of cells (eg, endosomal, lysosomal endocytic pathway compartments). Join. Such acidic conditions are generally characterized by a pH of less than about pH 6.5, or about pH 4.5-6.5 or pH 5.6.

  In one form of any of the embodiments of the invention, the antibody modulates and optionally inhibits TLR3 signaling in the acidified intracellular compartment of the cell (eg, endosomal, lysosomal endocytic pathway compartment). .

  In one form of any of the embodiments of the invention, the antibody modulates and optionally inhibits TLR3 signaling in dendritic cells (DC) (eg, bone marrow DC, monocyte-derived DC).

In other forms of any of the embodiments herein, the bivalent binding affinity of the TLR3 antibody, optionally under neutral and / or acidic conditions, is optionally no more than about 100, 50, 10, 5, or 1 nanomolar. (i.e., they more excellent affinity), preferably, be less than nanomolar, or optionally from about 500,200,100 or wherein mean _{K D} of 10 picomolar or less.

  In other forms of any of the embodiments described in the invention, the antibody inhibits TLR3 signaling by at least partially (or completely) blocking the binding of the TLR3 ligand and the TLR3 polypeptide. The TLR3 ligand is generally a ligand other than an anti-TLR3 antibody, and is a natural or non-natural TLR3 ligand, optionally a dsRNA-based ligand, such as polyAU (polyadenylic acid: polyuridine acid) or polyIC (polyinosinic acid: polycytidylic acid). It's okay.

In another form, there is provided a method for identifying, screening and / or generating an antibody that specifically binds to and inhibits a TLR3 polypeptide in a mammalian subject, said method comprising: a) optionally, TLR3 poly Providing a plurality of antibodies that bind to a human TLR3 polypeptide by a method comprising immunizing a non-human mammal with an immunogen comprising the peptide; and (b) in a cell that expresses human TLR3 only on the cell surface, Assessing the binding affinity of the antibody for a TLR3 polypeptide. Optionally, the method further comprises 0.3 μg / ml or less, optionally 0.2 μg / ml or less, optionally 0.1 μg for binding of the plurality of antibodies to cells expressing human TLR3 only on the cell surface. The method further comprises selecting an antibody having an EC _{50 of} / ml or less.

  Any of the methods of the present invention is further characterized in that it includes any of the steps described in this application, particularly including those described in “DETAILED DESCRIPTION”. The invention further relates to an antibody obtainable by any of the methods. The invention further relates to pharmaceutical or diagnostic formulations of the antibodies of the invention. The invention further relates to methods of using the antibody in therapy or diagnosis, optionally in combination with a second therapeutic agent (eg, corticoid, DMARD, anti-cytokine or anti-cytokine receptor agent, anti-TNFα agent, etc.).

  The foregoing and other advantageous aspects and features may be further described anywhere in this specification.

Figures 1A, 1B, 1C and 1D show that antibodies 11E1, 7G11, 31F6, and 32C4, respectively, were transiently transfected with a TLR3 ECD construct and in vitro for binding to HEK293T cells that express human TLR3 only on the cell surface. Dose effects are shown. Each antibody is compared to standard antibody 31C3; binding to cell surface TLR3 is improved for antibodies 11E1, 7G11, 32C4 and 31F6. Figures 2A, 2B, 2C, 2D and 2E show dose-dependent inhibition of TLR3 signaling using a 293T human TLR3 luciferase assay with human anti-TLR3 antibodies. Each antibody is compared to standard antibody 31C3; inhibition of dsRNA-induced TLR3 signaling is improved for antibodies 11E1, 7G11, 32C4, 31F6 and 37B7. Figures 2F, 2G and 2H show N-terminal views of TLR3 polypeptides, which are mutated amino acid residues displayed in black and gray, adjacent to residues that form part of the major epitope. Residues are shown. FIG. 2F shows a view of the glycan-free outer surface of the TLR3 polypeptide with the N-terminus of the TLR3 polypeptide on the right side of the diagram; FIG. 2G shows that the TLR3 polypeptide is in the foreground (left side of the diagram) Figure 2 shows a view of the polypeptide and backbone glycan-free outer surface. FIG. 2H shows a view of the TLR3 polypeptide and backbone glycan-free outer surface with the N-terminus of the TLR3 polypeptide in the foreground (right side of the figure). The result of a rheumatoid arthritis mouse model is shown. FIG. 3A shows the results of a prophylactic rheumatoid arthritis mouse model. FIG. 3B shows the results of a curative rheumatoid arthritis mouse model. FIG. 3C shows the results of a curative rheumatoid arthritis mouse model when mice were treated with PBS, control antibody, 28G7 and anti-TNFα antibody (Humira ™). The result of a mouse colitis model is shown. FIG. 4A shows mice treated with saline (black circles), TNBS only (black squares), anti-TNFα antibody and TNBS (black triangles), 28G7 and TNBS (white circles), and control Ab and TNBS (white squares). The measured thickness is shown. FIG. 4B shows mice treated with saline (black circles), TNBS alone (black squares), anti-TNFα antibody and TNBS (black triangles), 28G7 and TNBS (white circles), and control Ab and TNBS (white squares). The damage score with the naked eye is shown. The anti-TLR3 antibody of the present invention improves the onset of disease under stringent conditions ( ^* p <0.05, ^* p <0.001 vs. saline). The result of a COPD mouse model is shown. FIG. 5A shows BAL cell fractions for macrophages, eosinophils, neutrophils and lymphocytes. Anti-TLR3 antibody strongly reduced neutrophil infiltration into the respiratory tract, but did not substantially affect macrophages, eosinophils or lymphocytes. FIG. 5B shows venous blood saturation oxygen (%) for LPS / elastase alone and LPS / elastase, respectively, in combination with anti-TLR3 antibody or roflumilast. FIG. 5C shows IL17A in BAL fluid (BALF), where anti-TLR3 antibody substantially reduced IL17A (pg / ml) and was comparable to roflumilast. FIG. 5D shows IP-10 in BALF, where the -TLR3 antibody substantially reduced IP-10 (pg / ml). FIG. 5E shows BAL cell fractions of macrophages, neutrophils and lymphocytes for a second study comparing anti-TLR3 antibody (28G7), roflumilast (Rofu) and a combination of roflumilast and anti-TLR3 antibody (combo). (Differential cell counts) is shown. The result of CLP (cecal ligation puncture-sepsis) mouse model is shown. In this acute model, mice exhibit an acute infection that mimics septic shock. FIGS. 7A and 7B show the results of drug combinations containing anti-human TLR3 mAb (labeled IPH33.1) in combination with dexamethasone or Humira®, respectively. Each of the antibodies, when used in combination with dexamethasone or Humira®, further substantially reduces in vitro IP-10 production by PBMC in response to polyIC.

Overview The present invention is based, at least in part, on the discovery of high affinity monoclonal antibodies that specifically and effectively inhibit the TLR3 signaling pathway. The present invention also provides novel epitopes present on human TLR3, such as epitopes recognized by antibodies 11E1, 7G11, 31F6, 32C4 and / or 37B7, which inhibit TLR3 signaling and by TLR3 ligands It is particularly effective in inhibiting cytokine release in response to stimulation.

  The antibodies can be used to treat autoimmune or inflammatory diseases in a subject in need of treatment. The present invention also provides a method for treating relapse, stroke, or acute phase that occurs during the course of inflammatory or autoimmune disease in a subject in need of treatment using an anti-TLR3 antibody that inhibits TLR3 signaling. To do. The present invention also provides a novel method for treating established inflammatory or autoimmune disease in a subject in need of treatment using an anti-TLR3 antibody that inhibits TLR3 signaling. The invention also provides therapeutic and / or combination therapies that can be used to treat inflammatory or autoimmune diseases in a subject in need of treatment with an anti-TLR3 antibody that inhibits TLR3 signaling.

  An antibody of the invention that binds to TLR3 under acidic and neutral conditions will generally be useful in any situation where it is useful to target (eg, modulate) TLR3 (eg, treatment or prevention of a disease) It binds to both cell surface TLR3 and endosomal TLR3 with high affinity. TLR3 has been found on the surface of macrophages in some cases of inflammation, but neutralizing endosomal acidification with chloroquine to block TLR3 exhibited some anti-inflammatory effect (Cavasani et al. 2008, supra). However, the antibodies of the present invention are most advantageous over other antibodies in the treatment or prevention of diseases where modulation (eg, inhibition) of signaling by TLR3 in the cytosolic (eg, endosomal) compartment is useful or necessary. The relative importance of modulating the signaling of such compartment TLR3 can vary depending on the disease. An example of such a disease is rheumatoid arthritis; treatment with chloroquine, an inhibitor of endosomal oxidation, inhibits TLR3 signaling and inflammatory cytokines from synovial fluid cultures from patients with rheumatoid arthritis It is thought that endosomal compartment-expressed TLR3 plays an important role in rheumatoid arthritis (Sacre et al. (2008) J. Immunol. 181: 8002-8809). In some other diseases where DC (eg, medullary DC) is involved in disease outbreak, endosomal compartment-expressed TLR3 is thought to play an important role. This is because mDC has the ability to take up antigens from apoptotic or necrotic cells, such as during tissue necrosis during acute inflammation (this is described in detail in the literature).

  Since this antibody is specific for TLR3, purification of TLR3 or TLR3-expressing cells, modulation of TLR3 receptor in vitro, ex vivo, or in vivo (eg, activation or inhibition), destruction in vivo Can also be used for other purposes such as targeting TLR3-expressing cells for, or specific labeling / binding of TLR3 in vivo, ex vivo, or in vitro, such as immunoblotting, IHC analysis, That is, it is used for methods such as frozen biopsy, FACS analysis, and immunoprecipitation.

Definitions As used herein, a “TLR3 ligand” refers to any compound that can specifically bind to TLR3 and alter its activity in vitro, ex vivo, or in vivo. The compound may be a naturally occurring ligand, for example, generally a dsRNA or viral dsRNA, or a synthetic ligand such as polyIC or polyAU. The compound may be any type of molecule, such as an inorganic or organic compound or element, such as a protein (such as an antibody), a nucleic acid, a carbohydrate, a lipid, or other molecular entity. Furthermore, such compounds may be activated in any manner, such as activation or inhibition, as well as natural ligands, by any mechanism such as binding to the receptor and triggering or stopping activity, or with the receptor. The TLR3 receptor can be modulated by binding to and blocking access to other ligands. Preferably, the ligand activates the receptor and thus can be used to induce cytokine production by TLR3-expressing cells.

  As used herein, the term “antibody” refers to polyclonal and monoclonal antibodies. Depending on the type of constant domain in the heavy chain, antibodies are assigned to one of five major classes: IgA, IgD, IgE, IgG, and IgM. Some of these are further divided into subclasses or isotypes such as IgG1, IgG2, IgG3, IgG4. An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” chain (about 25 kDa) and one “heavy” chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids that is primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called “α”, “δ”, “ε”, “γ”, and “μ”, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known. IgG and / or IgM are the most common antibodies in physiological situations and are the preferred class of antibodies used in the present invention because they are most easily made in a laboratory environment, with IgG being particularly preferred. Preferably, the antibody of the present invention is a monoclonal antibody. In particular, antibodies suitable for humanized, chimeric, human, or other humans are preferred. “Antibody” also includes any fragment or derivative of the antibodies described herein.

  The term “specifically binds to” as evaluated using any recombinant form of the protein, an epitope therein, or a native protein present on the surface of an isolated target cell, It means that an antibody can bind to a binding partner, such as TLR3, preferably in a competitive binding assay. Competitive binding assays and other methods for determining specific binding are described in detail below and are also known in the art.

  When an antibody is said to “compete” with a particular monoclonal antibody (eg, 11E1, 7G11, 31F6, 32C4 or 37B7) or other TLR3 ligand (eg, dsRNA), either a recombinant TLR3 molecule or a surface expressed TLR3 molecule Means that the antibody competes with a monoclonal antibody (or other TLR3 ligand). For example, if a test antibody reduces the binding of 11E1, 7G11, 31F6, 32C4 or 37B7 to a TLR3 polypeptide or TLR3 expressing cell in a binding assay, the antibody is expressed as 11E1, 7G11, 31F6, 32C4 or 37B7 and “ "I will compete."

As used herein, the term “affinity” refers to the strength of binding between an antibody and an epitope. The affinity of the antibody is shown by the dissociation constant, _{K D,} which is defined as [Ab] x [Ag] / [Ab-Ag], where, [Ab-Ag] is the antibody - molar concentration of the antigen complex [Ab] is the molar concentration of unbound antibody and [Ag] is the molar concentration of unbound antigen. The affinity constant Ka is defined by 1 / Kd. A preferred method for determining mAb affinity is described in Harlow, et al. , Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N .; Y. 1988), Coligan et al. , Eds. , Current Protocols in Immunology, Greene Publishing Assoc. Wiley Interscience, N.A. Y. (1992, 1993), Muller, Meth. Enzymol. 92: 589-601 (1983), the references of which are incorporated herein by reference in their entirety. One preferred and standard method known for determining mAb affinity is the use of a Bicore instrument.

  As far as the present invention is concerned, “determinant” means an interaction or binding site on a polypeptide.

  The term “epitope” is defined as an antigenic determinant and is a compartment or region on an antigen to which an antibody binds. Protein epitopes may include amino acid residues that are directly involved in binding, as well as amino acid residues that are effectively blocked by a particular antigen-binding antibody or peptide, ie, within the “footprint” of an antibody. This is, for example, the simplest form on a complex antigen molecule that can bind to an antibody or receptor, or the smallest structural compartment. The epitope may be linear or steric / structural. A “linear epitope” is defined as an epitope composed of consecutive amino acid residues on a linear sequence of amino acids (primary structure). A “steric or structural epitope” refers to a discrete portion of a linear sequence of amino acids that are not all contiguous and are therefore placed in close proximity to each other by molecular folding (secondary, tertiary and / or quaternary). (Next structure) Defined as an epitope composed of amino acids. The steric epitope varies depending on the three-dimensional structure. Thus, the term “stereoscopic” is often used interchangeably with “structural”.

  “Immunogenic fragment” refers herein to any form of a molecule (a membrane-bound receptor and a mutant derived therefrom) that binds to and / or contains the fragment: Production of antibodies that bind to, (ii) stimulation of T cell responses associated with T cells that react to bimolecular complexes comprising MHC molecules and peptides derived from said fragments, (iii) encoding mammalian immunoglobulins By any polypeptide or peptide fragment capable of eliciting an immune response such as the binding of a transfected vehicle such as a bacteriophage or bacteria expressing the gene. Alternatively, an immunogenic fragment also refers to any construct capable of eliciting an immune response as defined above, such as, for example, a peptide fragment covalently linked to a carrier protein, said amino acid sequence in said amino acid sequence Examples include chimeric recombinant polypeptide constructs containing peptide fragments, particularly cells transfected with cDNA whose sequence includes the portion encoding the fragment.

  “Human suitable” antibody refers to any antibody, derivatized antibody, or antibody fragment that can be used safely in humans, for example, for the therapeutic methods described herein. Suitable antibodies for baboons are all types of humanized, chimeric, or fully human antibodies, or immune responses that are commonly caused when at least some of the antibodies are derived from humans or when using native non-human antibodies. Any antibody that is modified to avoid

  For the purposes of the present invention, a “humanized” or “human” antibody is one in which the constant and variable framework regions of one or more human immunoglobulins are fused to a binding region of an animal immunoglobulin, eg, a CDR. Such antibodies are designed to maintain the binding specificity of the non-human antibody from which the binding region is derived, but avoid immune responses to the non-human antibody. Such antibodies can be obtained from transgenic mice or other animals that have been “modified” to produce specific human antibodies in response to antigenic attack (see, eg, Green et al. (1994) Nature). Genet 7:13; Lonberg et al. (1994) Nature 368: 856; Taylor et al. (1994) Int Immun 6: 579, the entire teachings of which are incorporated herein by reference) . Fully human antibodies can also be constructed by gene or chromosomal transfection methods, as well as phage display techniques, all of which are known in the art (eg, McCafferty et al. (1990) Nature 348: 552). -553). Human antibodies can also be produced by in vitro activated B cells (see, eg, US Pat. Nos. 5,567,610 and 5,229,275; Which are incorporated herein by reference in their entirety).

  “Chimeric antibody” refers to (a) another or modified class, effector function and / or species, or completely different molecule in which the antigen binding site (variable region) confers new properties on the chimeric antibody (eg, The constant region, or part thereof, has been modified, substituted or exchanged to be linked to an enzyme, toxin, hormone, growth factor, drug, etc.); or (b) the variable region, or part thereof, is another, Or an antibody molecule that has been altered, substituted or exchanged with a variable region having altered antigen specificity.

  “Fc domain”, “Fc portion”, and “Fc region” include, for example, a human γ (γ) heavy chain around amino acid (aa) 230 to about aa450 or another type of antibody heavy chain (eg, human antibody In the case, α, δ, ε, and μ) refer to their corresponding subsequences in C), or C-terminal fragments of antibody heavy chains from their naturally occurring allotypes. Unless otherwise stated, throughout the present disclosure, the generally accepted Kabat amino acid numbering (Kabat et al. (1991) Sequence of Protein of Immunological, 5th ed., United States Public Health Health, Bethesda, MD).

  The terms “isolated”, “purified” or “biologically pure” refer to material that is substantially or substantially free of components that normally accompany it as found in its native state. . Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The major species present in the preparation is substantially purified.

  The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein and refer to a polymer of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding natural amino acids, as well as natural and non-natural amino acid polymers.

  The term “recombinant” when used with respect to, for example, a cell, or a nucleic acid, protein, or vector, the cell, nucleic acid, protein, or vector is modified by introduction of a heterologous nucleic acid or protein or modification of a native nucleic acid or protein. Or the cell is derived from a cell so modified. Thus, for example, a recombinant cell expresses a gene that is not found within the native (non-recombinant) form of the cell, or is otherwise abnormally expressed, underexpressed, or not expressed at all. Expresses native genes that are not.

  In the context of the present invention, the term antibody that "binds" to a common determinant means an antibody that binds to said determinant with specificity and / or affinity.

Generation of anti-TLR3 antibodies Antibodies suitable for the methods of the invention specifically bind to TLR3. The antibodies of the present invention further bind to TLR3 with high affinity under conditions corresponding to those found on the cell surface. The antibodies of the present invention can inhibit the TLR3 signaling pathway. Because of the ability of an inhibitory antibody to specifically inhibit the TLR3 signaling pathway, the antibody treats or prevents a variety of uses, particularly diseases in which inhibition of the TLR3 signaling pathway is desirable, ie, described herein. As such, it is useful in avoiding further cytokine and chemokine secretion and cell activation.

  In one embodiment, the present invention provides a method using an antibody that binds to human TLR3 and that competes with monoclonal antibody 11E1, 7G11, 31F6, 32C4 or 37B7 for binding to human TLR3.

  As used herein, “TLR3”, “TLR3 polypeptide” and “TLR3 receptor” are used herein to refer to Toll-like receptor 3 which is a member of the Toll-like receptor (TLR) family. Point to. The amino acid sequence of human TLR3 is shown in SEQ ID NO: 1 (NCBI accession number NP_003256, the disclosure of which is incorporated herein by reference). The human TLR3 mRNA sequence is described in NCBI accession number NM_003265. Human TLR3 sequences are also described in PCT Patent Publication: WO 98/50547, the disclosure of which is incorporated herein by reference. The non-human primate (macaca fascicularis) TLR3 amino acid sequence is shown in NCBI Accession No. BAG55033 (SEQ ID NO: 2).

  In one aspect, the invention competes with monoclonal antibody 11E1, 7G11, 31F6, 32C4 or 37B7 and is substantially or substantially the same as monoclonal antibody 11E1, 7G11, 31F6, 32C4 or 37B7, or the same epitope or “epitopic site Is provided on the TLR3 molecule, and provides an antibody having or binding immunospecificity thereto. In other embodiments, the monoclonal antibody consists of the antibody 11E1, 7G11, 31F6, 32C4 or 37B7, or a derivative or fragment thereof.

  TLR3, but not limited, preferably any fragment of human TLR3, or any combination of TLR3 fragments can be used as an immunogen to propagate antibodies, and antibodies of the invention can be used as described herein. As long as it is possible on TLR3-expressing cells, such as MdDC or MoDC, the epitope can be recognized at any position within the TLR3 polypeptide. In one embodiment, the recognized epitope can be contacted with an antibody present on the cell surface, ie outside the cell. Most preferably, the epitope is an epitope specifically recognized by antibody 11E1, 7G11, 31F6, 32C4 or 37B7. In addition, antibodies that recognize individual epitopes within TLR3 can be used in combination, for example, to bind to a TLR3 polypeptide with maximum efficacy and maximum range among various individuals.

  The antibodies of the present invention can be generated by various techniques known in the art. Typically, these are produced by immunizing a non-human animal, preferably a mouse, with an immunogen comprising a TLR3 polypeptide, preferably a human TLR3 polypeptide. A TLR3 polypeptide is a full-length sequence of a human TLR3 polypeptide, or a fragment or derivative thereof, typically an immunogenic fragment, ie a portion of a polypeptide comprising an epitope exposed on the surface of a cell that expresses the TLR3 polypeptide. Preferably, the epitope is recognized by the 11E1, 7G11, 31F6, 32C4 or 37B7 antibody. Such fragments typically comprise at least about 7 consecutive amino acids of the mature polypeptide sequence, more preferably at least about 10 consecutive amino acids. Fragments are typically derived from the extracellular domain of the receptor. In a preferred embodiment, the immunogen comprises wild type human TLR3 polypeptide in the lipid membrane, typically on the surface of a cell. In a specific embodiment, the immunogen comprises intact cells, particularly intact human cells, which are optionally treated or lysed. In another preferred embodiment, the polypeptide is a recombinant TLR3 polypeptide.

  The step of immunizing a non-human mammal with an antigen may be performed in a known manner to stimulate antibody production in mice (eg, E. Harlow and D. Lane, Antibodies: A Laboratory Manual., Cold). Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988), the entire disclosures of which are incorporated herein by reference). The immunogen is optionally suspended or dissolved in a buffer with an adjuvant, such as complete or incomplete Freund's adjuvant. Methods for determining the amount of immunogen, type of buffer and amount of adjuvant are well known to those skilled in the art and are in no way limiting with respect to the present invention. These parameters can be different for different immunogens, but are easily elucidated.

  Similarly, the location and frequency of immunity sufficient to stimulate antibody production is also known in the art. In a typical immunization protocol, non-human animals are injected intraperitoneally with antigen on day 1 and reinjected after about 1 week. This is followed by a recall injection of the antigen around day 20 optionally with an adjuvant, such as incomplete Freund's adjuvant. The recall injection may be performed intravenously and repeated over several consecutive days. Subsequently, a booster injection is performed on day 40, either intravenously or intraperitoneally, typically without adjuvant. This protocol results in the production of antigen-specific antibody-producing B cells after about 40 days. Other protocols may be used as long as they result in the production of B cells expressing antibodies to the antigen used for immunization.

  For the preparation of polyclonal antibodies, serum is obtained from the immunized non-human animal and the antibodies present therein are isolated by known techniques. Antibodies that react with the TLR3 polypeptide can be obtained by affinity purification of the serum using any of the aforementioned immunogens linked to a solid support.

  In another embodiment, lymphocytes from a non-immune non-human mammal are isolated and grown in vivo before exposure to the immunogen in the cell culture. The lymphocytes are then collected and the fusion step described below is performed.

  For the preferred monoclonal antibody, the next step is to isolate spleen cells from the immunized non-human mammal and then fuse these spleen cells with immortalized cells to form antibody-producing hybridomas. is there. Isolation of splenocytes from non-human mammals is known in the art and typically involves removing the spleen from an anesthetized non-human mammal, cutting it into strips, and a cell strainer Squeeze the splenocytes from the spleen through a nylon mesh into an appropriate buffer to produce a single cell suspension. Cells are washed, centrifuged and resuspended in buffer, which lyses all red blood cells. The solution is centrifuged again and the lymphocytes remaining in the pellet are finally resuspended in fresh buffer.

  Once isolated and present in a single cell suspension, lymphocytes can be fused with an immortalized cell line. This is typically a mouse myeloma cell line, but many other immortalized cell lines useful for generating hybridomas are known in the art. Preferred mouse myeloma lines include, but are not limited to, the Silk Institute Cell Distribution Center, San Diego, U.S.A. S. A. MOPC-21 and MPC-11 mouse tumors available from US, American Type Culture Collection, Rockville, Maryland U. S. A. X63 Ag8653 and SP-2 cells available from The fusion is performed using polyethylene glycol or the like. The resulting hybridoma is then grown in a selective medium containing one or more substances that inhibit the growth or survival of unfused parent myeloma cells. For example, if the parent myeloma cell lacks the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for hybridomas is typically hypoxanthine, aminopterin, and thymidine (HAT medium). These substances prevent the growth of HGPRT-deficient cells.

  Hybridomas are typically grown on a macrophage feeder layer. Macrophages are preferably derived from littermates of non-human mammals used to isolate spleen cells, and are typically primed with incomplete Freund's adjuvant or the like several days before plating hybridomas. The fusion method is described in Goding, “Monoclonal Antibodies: Principles and Practice,” pp. 59-103 (Academic Press, 1986), the disclosure of which is incorporated herein by reference.

  Cells are grown in selective media for sufficient time for colony formation and antibody production. This is usually about 7 to about 14 days.

  The hybridoma colonies are then assayed for production of antibodies that specifically bind to an epitope that is specifically recognized by the TLR3 polypeptide gene product, optionally antibody 11E1, 7G11, 31F6, 32C4 or 37B7. The assay is typically a colorimetric ELISA type assay, but any assay that can be adapted to the wells in which the hybridoma is growing may be used. Other assays include radioimmunoassay or fluorescence activated cell sorting. Determine if one or more colonies are present by examining wells that are positive for the production of the desired antibody. If more than one colony is present, the cells are recloned and grown to ensure that only single cells form colonies that produce the desired antibody. Typically, the antibodies are also tested for the ability to bind to a TLR3 polypeptide, eg, a TLR3 expressing cell, in a paraffin-embedded tissue section, as described below.

  Hybridomas that have been confirmed to produce the monoclonal antibodies of the present invention can be grown in larger quantities in an appropriate medium such as DMEM or RPMI-1640. Alternatively, the hybridoma cells can be grown in vivo as ascites tumors in animals.

  After sufficient growth to produce the desired monoclonal antibody, the growth medium (or ascites fluid) containing the monoclonal antibody is separated from the cells and the monoclonal antibodies present therein are purified. Purification is typically accomplished by gel electrophoresis, dialysis, chromatography using protein A or protein G-Sepharose, or anti-mouse Ig coupled to a solid support such as agarose or Sepharose beads (all, for example, , Antibody Purification Handbook, Biosciences, publication No. 18-1037-46, Edition AC, the disclosure of which is incorporated herein by reference). The bound antibody is typically eluted from the Protein A / Protein G column by using a low pH buffer (glycine or acetate buffer at pH 3.0 or less) with immediate neutralization of the antibody-containing fraction. These fractions are pooled, dialyzed and then concentrated as necessary.

  Positive wells containing a single distinct colony are typically recloned and reassayed to ensure that only one monoclonal antibody is detected and produced.

  For example, antibodies can be obtained by selection of immunoglobulin combinatorial libraries, as disclosed in (Ward et al. Nature, 341 (1989) p. 544, the entire disclosure of which is incorporated herein by reference). It may be generated.

  Identification of one or more antibodies that bind to substantially or substantially the same epitope as TLR3, in particular monoclonal antibody 11E1, 7G11, 31F6, 32C4 or 37B7, can be used to evaluate antibody competition. It can be readily determined using any one of the screening assays. Many such assays are routinely performed and are known in the art (see, eg, US Pat. No. 5,660,827 issued Aug. 26, 1997; see As expressly incorporated herein). It is not absolutely necessary to actually determine the epitope to which the antibody described herein binds in order to identify an antibody that binds to substantially or approximately the same epitope as the monoclonal antibody described herein. Will be understood.

  For example, if the test antibody to be examined is obtained from various sources of animals, or if they are different Ig isotypes, a simple competition assay may be used, in which a control (eg, 11E1, 7G11, 31F6, 32C4 or 37B7) and test antibody are mixed (or pre-adsorbed) and applied to the sample containing the TLR3 polypeptide. Protocols based on Western blotting and BIACORE analysis are suitable for use in such competitive tests.

  In certain embodiments, a control antibody (eg, 11E1, 7G11, 31F6, 32C4 or 37B7) is preliminarily taken over a period of time with various amounts of a test antibody (eg, about 1:10 or about 1: 100). After mixing, apply to the TLR3 antigen sample. In another embodiment, the control and various amounts of test antibody can simply be mixed during exposure to the TLR3 antigen sample. Identify bound antibody from free antibody (eg, by using a separation or wash technique to eliminate unbound antibody) and identify 11E1, 7G11, 31F6, 32C4 or 37B7 from test antibody (eg, species specific The test antibody can be 11E1, 7G11, as long as it is possible to use a specific or isotype specific secondary antibody or by specifically labeling 11E1, 7G11, 31F6, 32C4 or 37B7 with a detectable label). It can be determined whether the binding of 31F6, 32C4 or 37B7 to antigen is reduced, indicating that the test antibody recognizes substantially the same epitope as 11E1, 7G11, 31F6, 32C4 or 37B7 ing. Binding of the (labeled) control antibody in the absence of a completely irrelevant antibody can serve as a high value for the control. The low value of the control can be obtained by incubating the labeled (11E1, 7G11, 31F6, 32C4 or 37B7) antibody with the exact same type of unlabeled antibody (11E1, 7G11, 31F6, 32C4 or 37B7). Where competition occurs and reduces the binding of labeled antibodies. In a test assay, if the reactivity of the labeled antibody is significantly reduced in the presence of the test antibody, the test antibody that recognizes substantially the same epitope, ie, a labeled (11E1, 7G11, 31F6, 32C4 or 37B7) antibody is “crossed”. Reacting "or indicating competing antibodies. At least 50% binding of 11E1, 7G11, 31F6, 32C4 or 37B7 to TLR3 antigen at any 11E1, 7G11, 31F6, 32C4 or 37B7: test antibody ratio ranging from about 1:10 to about 1: 100, for example, Any test antibody that reduces by at least about 60%, or more preferably at least about 80% or 90% (eg, about 65-100%) is substantially the same epitope or determinant as 11E1, 7G11, 31F6, 32C4 or 37B7 It is considered that the antibody binds to. Preferably, such a test antibody reduces binding of 11E1, 7G11, 31F6, 32C4 or 37B7 and TLR3 antigen by at least about 90% (eg, about 95%).

  Competition can also be assessed by, for example, flow cytometry testing. In such a test, cells bearing a given TLR3 polypeptide are first incubated with, for example, 11E1, followed by a test antibody labeled with a fluorescent dye or biotin. The binding obtained by preincubation with a saturating amount of 11E1 is about 80%, preferably about 50%, about 40% or less of the binding obtained with the antibody without preincubation with 11E1 (measured using fluorescence). (Eg, about 30%, 20% or 10%), the bound antibody can be said to compete with 11E1. Alternatively, the binding obtained using labeled 11E1 antibody (with fluorescent dye or biotin) on cells preincubated with a saturating amount of test antibody is approximately 80 of the binding obtained without preincubation with the test antibody. %, Preferably about 50%, about 40%, or less than 40% (eg, about 30%, 20% or 10%), the bound antibody is said to compete with 11E1.

  A simple competitive assay can be used in which the test antibody is pre-adsorbed and applied to the surface on which the TLR3 antigen is immobilized at a saturating concentration. The surface in a simple competition assay is preferably a BIACORE chip (or other medium suitable for surface plasmon resonance analysis). A control antibody (eg, 11E1) is then contacted with the surface at a TLR3 saturation concentration, and the TLR3 and surface binding of the control antibody is measured. The binding of the control antibody is compared to the binding of the control antibody to the TLR3-containing surface in the absence of the test antibody. In a test assay, if the binding of the TLR3-containing surface by the control antibody is significantly reduced in the presence of the test antibody, the test antibody recognizes substantially the same epitope as the control antibody, thereby causing the test antibody to And “cross react”. Any test antibody that reduces the binding of a control antibody (eg, 11E1) to a TLR3 antigen by at least about 30%, preferably about 40%, binds to substantially the same epitope or determinant as the control (eg, 11E1) Can be considered. Preferably, such test antibodies reduce the binding of a control antibody (eg, 11E1) and TLR3 antigen by at least about 50% (eg, at least about 60%, at least about 70%, or more). It will be appreciated that the order of the control and test antibodies may be reversed: that is, the control antibody can be first bound to the surface and then the test antibody can be contacted with the surface in a competitive assay. Preferably, an antibody having a high affinity for the TLR3 antigen is first bound to the surface since it is expected that the degree of reduction in binding observed for the second antibody (assuming that the antibody is cross-reactive) will be greater. . Another example of such an assay is described, for example, in Saunal (1995) J. MoI. Immunol. Methods 183: 33-41, the disclosure of which is incorporated herein by reference.

  Determination of whether an antibody binds within the epitope region can be performed by methods known to those skilled in the art. As an example of such a mapping / characterization method, an epitope region for an anti-TLR3 antibody may be determined by an epitope “footprint method” using chemical modification of exposed amine / carboxyl in TLR3 protein. One specific example of such a footprint is the use of HXMS (hydrogen-deuterium exchange detected by mass spectrometry), where hydrogen-deuterium exchange, binding and reverse exchange of receptor and ligand protein amide protons. And backbone amine groups that participate in protein binding remain deuterated because they are protected from reverse exchange. At this point, the relevant region can be identified by digestible proteolysis, high performance microbore high performance liquid chromatography separation, and / or electrospray ionization mass spectrometry. For example, Ehring H, Analytical Biochemistry, Vol. 267 (2) pp. 252-259 (1999) Engen, J. et al. R. And Smith, D .; L. (2001) Anal. Chem. 73, 256A-265A. Another example of a suitable epitope identification method is nuclear magnetic resonance epitope mapping (NMR), in which case typically a two-dimensional NMR spectrum of free antigen and antigen complexed with an antigen-binding peptide such as an antibody. Compare the position of the signal in. Typically, the antigen is selectively isotopically labeled with 15N so that only the signal corresponding to the antigen is seen in the NMR spectrum and no signal from the antigen-binding peptide is seen. Antigen signals derived from amino acids involved in interaction with the antigen-binding peptide typically shift position to the spectrum of the complex relative to the spectrum of free antigen, thus Can be identified. For example, Ernst Schering Res Found Worksshop. 2004; (44): 149-67; Huang et al. , Journal of Molecular Biology, Vol. 281 (1) pp. 61-67 (1998); Saito and Patterson, Methods. 1996 Jun; 9 (3): 516-24.

  Epitope mapping / characterization can also be performed using mass spectrometry. See, for example, Downard, J Mass Spectrom. (2000) 35 (4): 493-503, and Kiselar and Downard, Anal Chem. (1999) 71 (9): 1792-801. Protease digestion methods can also be useful in connection with epitope mapping and identification. Antigenic determinant related regions / sequences are analyzed by mass spectrometry for peptide identification after protease digestion (eg, using trypsin at a ratio of about 1:50 to TLR3, or o / n digestion at pH 7-8). It can be determined by method (MS) analysis. Subsequently, peptides protected from trypsin cleavage by anti-TLR3 binding agents are identified by comparing samples that have been subjected to trypsin digestion with, for example, samples that have been incubated with antibodies and then subjected to digestion with trypsin. (This reveals the binder footprint). Additionally or alternatively, other enzymes such as chymotrypsin, pepsin can be used in similar epitope characterization methods. Furthermore, yeast digestion determines whether a promising antigenic determinant sequence is in the region of a TLR3 polypeptide that is not exposed to the surface and is therefore very likely not relevant for immunogenicity / antigenicity. It can provide a quick way to analyze. For a discussion of similar techniques, see, for example, Manca, Ann 1st Super Sanita. 1991; 27: 15-9.

  Site-directed mutagenesis is another technique useful for elucidating binding epitopes. For example, in “alanine scanning”, each residue in a protein segment is replaced with an alanine residue, and the binding affinity result is measured. If the mutation causes a significant reduction in binding affinity, it is very likely that it is involved in binding. Monoclonal antibodies specific for structural epitopes (ie, antibodies that do not bind to denatured proteins) can be used to confirm that alanine substitutions do not affect the overall protein folding. See, for example, Clackson and Wells, Science 1995; 267: 383-386; and Wells, Proc Natl Acad Sci USA 1996; 93: 1-6.

  Electron microscopy can also be used for the epitope “footprint method”. For example, Wang et al. , Nature 1992; 355: 275-278, to determine the physical footprint of Fab fragments on the capsid surface of native cowpea mosaic virus, cryoelectron microscopy, three-dimensional image reconstruction, and X It uses a coordinated application of line crystallography.

  Other forms of “label-free” assays for epitope assessment include surface plasmon resonance (SPR, BIACORE) and reflection interference spectroscopy (RifS). For example, see: Fagerstam et al. , Journal Of Molecular Recognition 1990; 3: 208-14; Nice et al. , J .; Chroma-togr. 1993; 646: 159-168; Leipert et al. , Angew. Chem. Int. Ed. 1998; 37: 3308-3311; Kroger et al. , Biosensors and Bioelectronics 2002; 17: 937-944.

  It should also be noted that antibodies that bind to the same or substantially the same epitope of the invention can be identified in one or more of the exemplary competition assays described herein.

  Once an antibody capable of binding to TLR3 and / or having other desired properties is identified, typically an unrelated polypeptide and other TLR family members (eg, human TLR1, 2,. Alternatively, these antibodies are evaluated using standard methods, including those described herein, for their ability to bind to other polypeptides such as 4-10). Ideally, the antibody binds with substantial affinity only to TLR3, eg, human TLR3, and is an unrelated polypeptide or other TLR family member (eg, human TLR2 or TLR4; amino acid residues 1-23 The amino acid sequence of the human precursor TLR4 containing the signal peptide at is found in NCBI Accession No. NP — 612564, the disclosure of which is incorporated herein by reference) at a significant level. However, the affinity for TLR3 is substantially higher than for other TLR family members (or other unrelated polypeptides) (eg, 5x, 10x, 50x, 100x, 500x, 1000x, 10,000x, or As long as this is the case, antibodies will be recognized as suitable for use in the present invention.

  Binding of the antibody to TLR3 expressing cells can be assessed in other mammals such as non-human primates, eg, rhesus or cynomolgus monkeys, or mice. Accordingly, the present invention provides antibodies, and fragments and derivatives thereof, wherein the antibodies, fragments or derivatives specifically bind to TLR3, which further comprises TLR3 from non-human primates such as rhesus monkeys or cynomolgus monkeys. Binds to the TLR3 polypeptide of SEQ ID NO: 2. Optionally, in order to select an antibody that is readily taken up by the cell and / or cell compartment in which the TLR3 polypeptide is expressed, the cellular uptake or localization, optionally within the intracellular compartment such as the endocytotic pathway, etc. Assess localization. Cell uptake or localization is generally measured in cells that attempt to or are likely to exert their activity on the antibody, eg, DC. Cell uptake or localization can be assessed by standard methods, such as confocal staining with an antibody labeled with a detectable moiety (eg, a fluorescent moiety).

  After immunization and antibody production in vertebrates or cells, certain selection steps may be performed to isolate the claimed antibodies. In this regard, in certain embodiments, the invention also relates to a method of generating an antibody that inhibits TLR3 signaling, the method comprising: (a) providing a plurality of antibodies; and (b) on the cell surface. Selecting an antibody obtained from step (a) that is capable of binding with high affinity to a TLR3 polypeptide that is only expressed. Antibodies can be tested for binding to TLR3 under neutral conditions. In one embodiment, step (a) comprises (i) immunizing a non-human mammal with an immunogen comprising a TLR3 polypeptide; and (ii) preparing an antibody from said immunized animal. In one embodiment, step (a) comprises creating a library of antibody sequences (eg, using phage display).

The divalent binding affinity of the antibody for human TLR3 can be determined under acidic conditions. The antibody is characterized, for example, by an average KD (ie, better affinity) of about 100, 60, 10, 5, or 1 nanomolar, preferably submolar, or optionally about 300, 200, 100, or 10 picomolar or less. can do. _The K _D, for example, the human TLR3 protein recombinantly produced after immobilized on the chip surface, for example, as shown in Examples, it may be determined by applying a solution like test target antibody. To select antibodies that maintain similar binding under acidic and neutral conditions, at neutral pH (eg, 7.2) and acidic pH (eg, pH in the range of 4.5-6.5). May be attempted to minimize the difference observed during binding of, for example, in this case, the binding affinity at acidic pH is substantially lower than that observed at non-acidic pH, e.g., for TLR3 binding of _{the K D,} 0.2-, 0.3 to, 0.5, 1.0-, or reduced in 1.5-log10 or less. In one embodiment, the method can further compete with antibody 11E1, 7G11, 31F6, 32C4 or 37B7 for binding to TLR3, or with dsRNA (eg, polyAU) for binding to TLR3. A step (d) of selecting an antibody from (b) that can (or cannot compete).

  In one form of any of the embodiments, the antibody prepared according to this method is a monoclonal antibody. In another form, the non-human animal used to generate antibodies according to the methods of the invention is a mammal such as a rodent (eg, rat), cow, pig, poultry, horse, rabbit, goat, or sheep. It is. The antibodies of the present invention include 11E1, 7G11, 31F6, 32C4 and 37B7. However, other antibodies can be obtained using the methods described herein, and therefore the antibodies of the invention may be antibodies other than 11E1, 7G11, 31F6, 32C4 and 37B7. Furthermore, the antibodies of the present invention may optionally be designated as antibodies other than any of those listed below: Antibodies 31C3, 29H3, 23C8, 28F11 disclosed in WO 2011/004028 Or 34A3, or antibodies deposited with the numbers CNCM I-4187 (29H3.7) and CNCM I-4186 (31C3.1) (Collectation Nationale de Culture de Microorganisms (CNCM), Institute Pasteur, RrueFure, 25 rue -75724 Paris, July 3, 2009), antibody TLR3.7 (eBioScience Inc., San Diego), WO 06/060513. Antibody C1068 described in Nflet, antibody C1130 described in WO 2007/051164 pamphlet, antibodies disclosed in WO 2010/051470 pamphlet, for example, antibodies 1-19 and F17-F19, And variants thereof such as 15EVQ and 12QVQ / QSV, antibody 40C1285 (Abcam), or antibody 619F7, 713E4, 716G10, IMG-5631, IMG-315 or IMG-5348 (all manufactured by Imgenex. Corp.) or derivatives of these antibodies For example, a derivative containing all or part of the antigen binding region. Each of the above listed disclosures is hereby incorporated by reference.

  According to another embodiment, DNA encoding an antibody that binds to an epitope present in a TLR3 polypeptide is isolated from a hybridoma of the invention and introduced into a suitable expression vector for transfection into a suitable host. . Next, the host is produced as an antibody, or a variant thereof, eg, a humanized form of the monoclonal antibody, an active fragment of the antibody, a chimeric antibody comprising the antigen recognition portion of the antibody, or a recombinant production form comprising a detectable portion. Use for.

  DNA encoding the monoclonal antibody of the present invention can be obtained using conventional methods (eg, by using oligonucleotide probes capable of specifically binding to the genes encoding the heavy and light chains of mouse antibodies) It can be easily isolated and sequenced. Once isolated, the DNA can be introduced into an expression vector, which is then transferred to E. coli cells, monkey COS cells, Chinese hamster ovary (otherwise not producing immunoglobulin proteins) Monoclonal antibody synthesis is achieved in recombinant host cells by transfecting host cells such as CHO) cells, or myeloma cells. As described elsewhere herein, such DNA sequences may be optimized for any of a number of purposes, for example, humanization of antibodies, the purpose of generating fragments or derivatives, or for example, binding specificity of antibodies. Can be modified for the purpose of modifying the sequence of the antibody at the antigen binding site.

  Recombinant expression in bacteria of DNA encoding the antibody is known in the art (see, eg, Skerra et al., Curr. Opinion in Immunol., 5, pp. 256 (1993); and Pluckthun, Immunol. 130, p. 151 (1992)).

Assessing the ability of an antibody to modulate TLR3 signaling In certain embodiments, an antibody of the invention modulates a TLR3 polypeptide (eg, inhibits signal transduction by a TLR3 polypeptide), thereby, in a TLR3-expressing cell. Activity or behavior can be adjusted. For example, antibodies can inhibit activation of TLR3-expressing cells, for example, they can optionally inhibit the TLR3 signaling pathway by blocking the binding of natural or endogenous ligands such as dsRNA to TLR3. Optionally, they can block the ability of the TLR3 protein to form a homodimer in the presence of a TLR3 ligand, thereby preventing the initiation of the signaling cascade. These antibodies are therefore called “neutralizing” or “inhibitory” or “blocking” antibodies. Such antibodies, among others, reduce the above-mentioned condition or its symptoms by reducing the activity of TLR3-expressing immune cells, for example, a state involving excessive TLR3-expressing cell activity or cell number, or reducing TLR3-expressing cell activity, Useful for treating, preventing or preventing conditions that can be prevented, eliminated, or somewhat improved.

  A variety of cellular assays can be used to assess the ability of an antibody to modulate TLR3 signaling. Any of a number of assays including molecular, cellular and animal models can be used to assess the ability of anti-TLR3 antibodies to modulate TLR3-expressing cellular activity. For example, a cellular assay can be used, in which case, after exposing a cell expressing TLR3 to dsRNA, viral dsRNA, polyIC, or polyAU, or another TLR3 ligand, the antibody binds to the ligand or stimulates the receptor. (Eg, measured by examining any of the TLR3 cell activity of interest herein, eg, interferon expression, NFkB activity, NK cell activation, etc.). The TLR3 ligand used in the assay includes, but is not limited to, a purified ligand composition in a mixture with a non-TLR3 ligand, in a naturally occurring composition, in a cell or on the surface of a cell, or a cell (eg, a ligand) Secreted by the cells that produce) in any suitable form, such as in solution or on a solid support.

  The activity of TLR3-expressing cells can also be assessed in the absence of ligand by exposing the cells to the antibody itself and assessing its effect on any form of cell activity or behavior. In such assays, baseline levels of TLR3-expressing cell activity (eg, cytokine production, proliferation, etc., see below) are obtained in the absence of ligand and the ability of the antibody or compound to modify the baseline activity level is detected. To do. In one such embodiment, high throughput screening techniques are used to identify compounds that can affect receptor activation.

Any suitable physiological change that exhibits TLR3 activity can be used to evaluate a test antibody or antibody derivative. For example, gene expression (eg, NFkB responsive gene), protein secretion (eg, interferon), cell growth, cell proliferation, pH, intracellular second messenger, eg, Ca ²⁺ , IP3, cGMP, or cAMP, or NK cells Various effects such as changes in the ability to activate can be measured. In one embodiment, receptor activity is assessed by detecting the production of cytokines, eg, TLR3-responsive cytokines, inflammatory cytokines.

  TLR3 modulation can be assessed using any of several possible reading systems, most of which are TLR / IL-1R signaling pathways (eg, MyD88 including IRF3, IRF7, IKKε and / or TBK1). Independent / TRIF-dependent signaling pathways, etc.) (Akira and Takeda (2004) Nature Review Immunol. 4: 499-511). These pathways activate kinases such as the KB kinase complex. TLR3 activation can be assessed by examining any form of TLR signaling. For example, activation of TLR signaling can include protein-protein binding (eg, TRIF and TBK and / or IKKε), intracellular localization of proteins (eg, NF-kB translocation into the nucleus), and gene expression. Triggers alterations (eg, expression of NF-kB sensitive genes) and cytokine production (eg, production and secretion of IFN-γ, IL-6, IP10, MCP-1). Any such modification can be detected and used to detect TLR3 activation. In one embodiment, supernatant is collected after 18-20 hours of culture and TLR3 stimulation is detected by measuring IFN-γ, IL-6, IP-10 and / or MCP-1 levels by sandwich ELISA . In another embodiment, TLR3 stimulation is detected by collecting the supernatant after 18-20 hours of culture and measuring the levels of IFN-γ, IL-6, IP-10 and / or MCP-1 by sandwich ELISA To do.

  In one embodiment, cells that naturally express TLR3, eg, DC (eg, bone marrow DC or monocyte-derived DC) are used. In another embodiment, cells containing a reporter construct that causes expression of a detectable gene product upon TLR3 stimulation as well as the resulting activation of a signaling pathway are used. Reporter genes and reporter gene constructs that are particularly useful in assays include, for example, promoters that are sensitive to NF-kB or, in particular, signal transduction mediated by TRIF, IRF3, IRF7, IKKε, TBK1 Reported reporter genes. Examples of such promoters include, but are not limited to, promoters for IL-1α, IL-6, IL-8, IP-12p40, IP-10, CD80, CD86, and TNF-α. Reporter genes operably linked to a TLR sensitive promoter include, but are not limited to, enzymes (eg, luciferase, alkaline phosphatase, β-galactosidase, chloramphenicol acetyltransferase (CAT), etc.), bioluminescent markers (eg, green Fluorescent proteins (GFP, eg, US Pat. No. 5,491,084), blue fluorescent proteins (BFP, eg, US Pat. No. 6,486,382), surface expressed molecules (eg, CD25 , CD80, CD86), and secreted molecules (eg, IL-1, IL-6, IL-8, IP-12p40, TNF-α). For example, Hcker H et al. (1999) EMBO J. et al. 18: 693-82; Murphy TL et al. (1995) Mol Cell Biol 15: 5258-67, the disclosure of which is incorporated herein by reference. Reporter plasmids suitable for use are commercially available (InvivoGen, San Diego, CA). In one embodiment, the assay is performed in a host cell engineered to express a human TLR3 polypeptide wherein the test composition is of a promoter responsive to TLR3 signaling (eg, ISRE, IFN stimulation response element). Determining whether to induce luciferase expression (or other reporter) under control.

  In assays that utilize enzyme activity readings, the substrate can be supplied as part of the assay and detection can be chemiluminescence, fluorescence, chromogenic, incorporation of radioactive labels, drug resistance, optical density, or other markers of enzyme activity Measurement may be included. For assays that utilize surface expression of molecules, detection can be achieved using flow cytometry (FACS) analysis or functional assays. Secreted molecules can be assayed using an enzyme linked immunosorbent assay (ELISA) or bioassay. Many of the above or other suitable reading systems are known in the art and are commercially available. Preferably, any reporter system can be quantified.

  In another embodiment, the effect of an antibody on TLR3-expressing cells can be assessed in vivo in non-human primates. For example, a pharmaceutical composition comprising an anti-TLR3 antibody of the present invention is administered to a non-human primate that is healthy or suffers from a condition such as an autoimmune disease or inflammation, and the number of TLR3-expressing cells in the primate Alternatively, the effect of administration on activity, the presence and / or level of cytokines, or progression of the disease state is assessed. Any antibody or antibody derivative or fragment that affects a detectable change in any of these TLR3-related parameters is a candidate for use in the methods described herein.

  In any of the assays described herein, 5%, 10%, 20%, preferably 30%, 40%, 50%, most preferably 60% of any detectable measure of TLR3-stimulated activity in cells. An increase or decrease of%, 70%, 80%, 90%, 95% or more is suitable for use in the present invention.

  When evaluating inhibitory anti-TLR3 antibodies, the antibodies can be advantageously selected to modify any parameter associated with inflammation or autoimmunity. For example, antibodies can be selected to suppress activation in cells, particularly inflammatory cytokine production. The cell may be, for example, a cell obtained from an individual suffering from an inflammatory or autoimmune disease.

Antibodies The antibodies of the present invention bind to human TLR3 polypeptides. In one embodiment, the antibody is an antagonist TLR3 antibody. In another embodiment, the antibody blocks signal transduction induced by human TLR3.

The antibody optionally has an affinity (K _D ) of less than 10 ⁻⁹ M, preferably less than 10 ⁻¹⁰ M, at an acidic pH, ie a pH of about 5.6. In another embodiment, the antibody has an affinity (K _D ) at neutral pH, ie, a pH of about 7.2, less than 10 ⁻⁹ M, preferably less than 10 ⁻¹⁰ M. In another embodiment, the antibody has an affinity of less than 10 ⁻⁹ M, preferably less than 10 ⁻¹⁰ M, at an acidic pH, ie, a pH of about 5.6, and a neutral pH, ie, a pH of about 7.2. (K _D ). The affinity may be, for example, monovalent or divalent binding to TLR3.

  In another embodiment, the antibody can inhibit TLR3 signaling in the presence of a TLR3 ligand, ie dsRNA (polyAU, polyIC). In another embodiment, the antibody can inhibit TLR3 signaling when administered after a TLR3 ligand. In another embodiment, the antibody can inhibit TLR3 signaling when administered prior to the TLR3 ligand. In another embodiment, the antibody can inhibit TLR3 signaling when administered concurrently with a TLR3 ligand.

  In another embodiment, the antibody competes for binding between the dsRNA and the N-terminal dsRNA binding site of the TLR3 polypeptide. In another embodiment, the antibody competes for binding between the dsRNA and the C-terminal dsRNA binding site of the TLR3 polypeptide.

Antibody epitopes In another embodiment, the antibody binds to substantially the same epitope as antibody 11E1, 7G11, 31F6, 32C4 or 37B7. In one embodiment, all basic residues of the epitope are segments corresponding to residues 1-251 of the TLR3 polypeptide of SEQ ID NO: 1. In one embodiment, the antibody comprises 1, 2, 3, in segments corresponding to residues 1 to 251 (or 41 to 139, 41 to 115, 41 to 120, or 41 to 251) of the TLR3 polypeptide of SEQ ID NO: 1. It binds to an epitope comprising 4, 5, 6, 7 or 8 or more residues. In another embodiment, the antibody binds to one or more amino acids present on the surface of the TLR3 polypeptide within the epitope to which the anti-TLR3 antibody of the invention binds, and optionally the antibody comprises SEQ ID NO: 1. 41, 43, 60, 61, 62, 64, 65, 66, 67, 68, 86, 88, 89, 91, 92, 93, 96, 97, 108, 110, 112, 113, 114, 115, 117 , 120, 121, 132, 134, 137 and residues 139, bind to 1, 2, 3, 4, 5, 6, 7 or 8 or more residues selected from the group consisting of residues 139.

  Optionally, the antibody binds at least in part (or primarily) on the glycan-free outer surface of the N-terminal portion of human TLR3 polypeptide. Optionally, the antibody binds at least in part (or primarily) on the backbone of the N-terminal portion of the human TLR3 polypeptide. Optionally, the antibody binds at least partially (or primarily) on the glycan-free outer surface of the N-terminal portion of human TLR3 polypeptide and partially binds on the backbone of the N-terminal portion of human TLR3 polypeptide. . Optionally, the antibody binds to one or more amino acid residues and / or adjacent residues within the glycan-free outer surface of the TLR3 polypeptide involved in binding the TLR3 polypeptide to dsRNA. Optionally, the antibody binds to an epitope comprising residue 41 and / or residue 43 of SEQ ID NO: 1. Optionally, the antibody binds to an epitope comprising residues 60, 61, 62, 64, 65, 67 of SEQ ID NO: 1 and / or 1, 2, 3, 4, 5, 6 or 7 of residue 68. . Optionally, the antibody binds to an epitope comprising one, two, or three of residues 86, 88 and / or residues 89 of SEQ ID NO: 1. Optionally, the antibody binds to an epitope comprising residues 91, 92, 93, 96, 97 and / or residues 121, 1, 2, 3, 4, 5, or 6 of SEQ ID NO: 1. Optionally, the antibody binds to an epitope comprising 1, 2, 3, 4, 5, 6, 7 or 8 or more of residues 108, 110, 112, 113, 114, 115, 116, 117, 120. Optionally, the antibody binds to an epitope comprising residues 132, 134, 137 and / or residues 139 of 1, 2, 3, or 4 of SEQ ID NO: 1. Optionally, the antibody binds to an epitope comprising 1, 2, 3, or 4 of residues 112, 113, 115, 117, 120, 137 and 139. Optionally, the antibody binds to an epitope comprising residue 117 and residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising residue 120 and residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising residues 117 and / or 120 but not residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising 1, 2, 3, 4, 5 or 6 residues R64, R65, T86 and K89, K137 and K139. Optionally, the antibody binds to an epitope comprising residue 64 and residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising residue 65 and residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising residue 86 and residues 137 and / or 139. Optionally, the antibody binds to an epitope comprising residue 89 and residues 137 and / or 139. In one embodiment, the amino acid residues in the glycan-free outer surface of the TLR3 polypeptide involved in the binding of the TLR3 polypeptide and dsRNA, and / or residues adjacent thereto, are 41, 43, 60, 61, 62, 64, 65, 67, 68, 86, 88, 89, 108, 110, 112, 113, 114, 132, 134, 137 and residue 139. Optionally, the antibody binds to an epitope comprising 1, 2, 3, or 4 of residues 112, 113 and 137 of SEQ ID NO: 1. In one embodiment, the amino acid residues in the backbone of the N-terminal portion of the human TLR3 polypeptide are selected from the group consisting of residues 91, 92, 93, 96, 97, 117, 120 and 121 of SEQ ID NO: 1. . Optionally, the antibody does not bind or primarily binds to the glycan-containing outer surface of the N-terminal portion of the human TLR3 polypeptide.

  Optionally, in any embodiment, the antibody optionally corresponds to residues 174-191, residues 465-619, or residues 116, 145 and / or 182 of the mature TLR3 polypeptide of SEQ ID NO: 1. Further, it may be further characterized by not substantially binding to 1, 2, 3, or 4 or more residues within the segment. In another embodiment, the antibody is residues 177-191, 224-243, 280-286, 295-374, 379-391, 428-459, 461-487, 524-529 of the TLR3 polypeptide of SEQ ID NO: 1. , 533-542, 546-569, 575-581, 583-605, 607-623, 641-657 and / or bind to an epitope comprising one or more residues in the segment corresponding to 670-705 Or optionally not combined.

  In the Examples section herein, the construction of a series of mutant human TLR3 polypeptides is described. Binding of the anti-TLR3 antibody to cells transfected with the TLR3 mutant was measured and compared to the ability of the anti-TLR3 antibody to bind to the wild type TLR3 polypeptide (SEQ ID NO: 1). As used herein, a reduction in binding between an anti-TLR3 antibody and a mutant TLR3 polypeptide is a reduction in binding affinity (eg, a FACS test of a cell expressing a particular mutant, or a mutant polypeptide). And / or a reduction in the total binding capacity of the anti-TLR3 antibody (eg evidenced by a decrease in Bmax in a graph of anti-TLR3 antibody concentration versus polypeptide concentration). It means that there is. A significant reduction in binding indicates that the mutated residue is either directly involved in binding to the anti-TLR3 antibody or is in close proximity to the binding protein if the anti-TLR3 antibody is bound to TLR3. Show. Accordingly, antibody epitopes preferably include such residues and may include additional residues adjacent to such residues.

  In certain embodiments, the significant reduction in binding is such that the binding affinity and / or binding capacity between the anti-TLR3 antibody and the mutant TLR3 polypeptide is such that the anti-TLR3 antibody and wild-type TLR3 polypeptide (eg, SEQ ID NO: 1 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90% Or, it means a reduction of more than 95%. In certain embodiments, binding is below the detection limit. In certain embodiments, the binding between an anti-TLR3 antibody and a mutant TLR3 polypeptide is the binding observed when the anti-TLR3 antibody and a wild-type TLR3 polypeptide (eg, the extracellular domain shown in SEQ ID NO: 1) are binding. When below 50% (eg below 45%, 40%, 35%, 30%, 25%, 20%, 15% or 10%), a significant reduction in binding is demonstrated. Such binding measurements can be performed using various binding assays known in the art. Specific examples of such assays are described in the Examples section.

  In certain embodiments, the anti-TLR3 antibody provides an anti-TLR3 antibody that exhibits significantly lower binding to a mutant TLR3 polypeptide in which residues of the wild-type TLR3 polypeptide (SEQ ID NO: 1) are substituted. In the shorthand notation used herein, the organization is as follows: wild type residue: position in polypeptide: mutant residue, residue numbering is as shown in SEQ ID NO: 1. To do.

  Optionally, the antibody comprises residues 41, 43, 60, 61, 62, 64, 65, 67, 68, 86, 88, 89, 91, 92, 93, 96, 97, 108, 110, SEQ ID NO: 1. Has reduced binding to TLR3 polypeptides having substitutions at 112, 113, 114, 115, 117, 120, 121, 132, 134, 137 and / or residue 139.

  In certain embodiments, the anti-TLR3 antibody binds to a wild type TLR3 polypeptide having the sequence of SEQ ID NO: 1, but the following mutations: R64Q, R65Q, T86S, K89Q, K117Q, A120V, K137S and / or K139A ( Has reduced binding to a mutant TLR3 polypeptide having one or more (eg, 1, 2, 3 or 4) of SEQ ID NO: 1. Preferably, binding to mutant TLR3 is significantly reduced compared to binding to wild type TLR3.

  In another embodiment, the antibody can inhibit cytokine (eg, IP-10) secretion in bone marrow dendritic cells (MdDC). In another embodiment, the antibody can be quickly and effectively internalized into TLR3-expressing cells. In another embodiment, the antibody can be internalized without inducing or requiring downregulation of hTLR3.

Antibody CDR Sequence In one aspect of any of the embodiments of the invention, the antibody comprises a heavy chain having CDR1, 2, and / or 3 sequences according to respective formulas selected from formulas (I)-(VII) and / or A light chain may be included. In any of the embodiments described herein, a particular LCDR1 or LCDR2 or HCDR1 or HCDR2 may be designated as having a sequence of formula (I)-(VII). In any of the embodiments described herein, certain LCDRs 1-3 or HCDRs 1-3 may be designated as having the sequences of formulas (I)-(VII). In a preferred embodiment, the antibody comprises a light chain comprising 3 LCDRs and a heavy chain comprising 3 HCDRs. Optionally, an antibody is provided wherein either the light chain and / or heavy chain variable region is fused to an IgG type immunoglobulin constant region, optionally a human constant region, optionally an IgG1 or IgG4 isotype.

In one embodiment, LCDR1 has the formula (I):
_{Xaa 1 -A-S-E-} Xaa 2 -I-Xaa 3 -Xaa 4 -Xaa 5 -L-A (I) ( SEQ ID NO: 58)
Contains an array of
In which Xaa _{1 to} Xaa ₅ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₁ may be Leu or Gln and / or Xaa ₂ may be Asp Or Gaa and / or Xaa ₃ may be Ser or Tyr and / or Xaa ₄ may be Asn or Ser and / or Xaa ₅ may be Asp, Tyr or Gly. It may be.

In one embodiment, LCDR2 has the formula (II):
A-A-Xaa ₆ -RL-Xaa ₇ -D (II) (SEQ ID NO: 59)
Contains an array of
In which Xaa _{6 to} Xaa ₇ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₆ may be Ser or Asn and / or Xaa ₇ may be Glu Or it may be Gln.

In one embodiment, LCDR3 has the formula (III):
_{Xaa 8 -Q-Xaa 9 -Xaa 10} -Xaa 11 -Xaa 12 -P-Xaa 13 -T (III) ( SEQ ID NO: 60)
Contains an array of
Wherein Xaa _{8 to} Xaa ₁₃ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₈ may be Leu or Gln and / or Xaa ₉ may be Ser , Asn or Gly and / or Xaa ₁₀ may be Tyr, Ser or Val and / or Xaa ₁₁ may be Lys or Glu and / or Xaa ₁₂ may be Phe or It may be Tyr and / or Xaa ₁₃ may be Asn, Tyr, Leu or Val.

In one embodiment, HCDR1 has the formula (IV):
Xaa ₁₄ -Xaa ₁₅ -Y-Xaa ₁₆ -Xaa ₁₇ (IV) (SEQ ID NO: 61)
Contains an array of
Wherein Xaa _{14 to} Xaa ₁₇ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₁₄ may be Tyr or Ser and / or Xaa ₁₅ may be Thr Alternatively, it may be Asn and / or Xaa ₁₆ may be Met or Ile and / or Xaa ₁₇ may be Tyr or His.

In one embodiment, HCDR1 has the formula (V):
G-Y-Xaa ₁₈ -Xaa ₁₉ -Xaa ₂₀ -Xaa ₂₁ (V) (SEQ ID NO: 62)
Contains an array of
Wherein Xaa _{18 to} Xaa ₂₁ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₁₈ may be Thr or Asn and / or Xaa ₁₉ may be Phe. Alternatively, it may be Ile and / or Xaa ₂₀ may be Arg, Trp or Thr; and / or Xaa ₂₁ may be Tyr or Ser.

In one embodiment, HCDR2 has the formula (VI):
_{Xaa 22 -I-Xaa 23 -P-} Xaa 24 -Xaa 25 -G (VI) ( SEQ ID NO: 63)
Contains an array of
Wherein Xaa _{22 to} Xaa ₂₅ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₂₂ may be Arg or Trp, and / or Xaa ₂₃ may be Asp Or it may be Phe and / or Xaa ₂₄ may be Ala or Gly and / or Xaa ₂₅ may be Asn or Asp. Optionally, the HCDR of formula VI further comprises the sequence -Xaa ₂₆ -Xaa ₂₇ -Xaa ₂₈ , wherein Xaa ₂₆ -Xaa ₂₈ may be conservative or non-conservative substitutions or deletions or insertions; Preferably, Xaa ₂₆ may be Asp or Asn and / or Xaa ₂₇ may be Thr or Ser and / or Xaa ₂₈ may be Asn or Ile.

In one embodiment, HCDR3 is SEQ ID NO: 21, 32, 43, or 54, or formula (VII):
G-Xaa ₂₉ -Xaa ₃₀ -Xaa ₃₁ -YFD (VII) (SEQ ID NO: 64)
Contains an array of
Wherein Xaa _{29 to} Xaa ₃₁ may be conservative or non-conservative substitutions or deletions or insertions, preferably Xaa ₂₉ may be a deletion or Glu, and / or Xaa ₃₀ is Phe or Asp and / or Xaa ₃₁ may be Asp or Trp.

In one embodiment, an antibody of the invention may comprise a light chain comprising:
a. A light chain CDR1 (LCDR1) amino acid sequence selected from SEQ ID NOs: 22, 33, 44, 55 and 58; and / or b. A light chain CDR2 (LCDR2) amino acid sequence selected from SEQ ID NOs: 23, 34, 45, 56 and 59; and / or c. A light chain CDR3 (LCDR3) amino acid sequence selected from SEQ ID NOs: 24, 35, 46, 57 and 60.

In one embodiment, an antibody of the invention may comprise a heavy chain comprising:
a. A heavy chain CDR1 (HCDR1) amino acid sequence selected from SEQ ID NOs: 16-18, 27-29, 38-40, 49-51 and 61-62; and / or b. A heavy chain CDR2 (HCDR2) amino acid sequence selected from SEQ ID NOs: 19, 20, 31, 41, 42, 52, 53 and 63; and / or c. A heavy chain CDR3 (HCDR3) amino acid sequence selected from SEQ ID NOs: 21, 32, 43, 54 and 64.

Antibody 11E1
The amino acid sequence of the heavy chain variable region of 11E1 is set forth as SEQ ID NO: 3, and the amino acid sequence of the light chain variable region is set forth as SEQ ID NO: 4. In a specific embodiment, the invention provides an antibody that binds to approximately the same epitope or determinant as monoclonal antibody 11E1; optionally, the antibody comprises the antigen binding region of antibody 11E1. In any of the embodiments described herein, antibody 11E1 may be characterized by its amino acid sequence and / or the nucleic acid sequence that encodes it. In a preferred embodiment, the monoclonal antibody comprises the 11E1 Fab or F (ab ') 2 moiety. Also provided is a monoclonal antibody comprising the heavy chain variable region of 11E1. According to one embodiment, the monoclonal antibody comprises three CDRs of the heavy chain variable region of 11E1. Also provided are monoclonal antibodies further comprising one, two or three CDRs of the 11E1 variable light chain variable region or the 11E1 light chain variable region. Optionally, any one or more of the light chain or heavy chain CDRs may comprise 1, 2, 3, 4 or 5 amino acid modifications (eg, substitutions, insertions or deletions). Optionally, either the light chain and / or heavy chain variable region comprising part or all of the antigen binding region of antibody 11E1 is an IgG type immunoglobulin constant region, optionally a human constant region, optionally a human IgG1 or IgG4. Antibodies fused to isotypes are provided. In another preferred embodiment, the antibody is 11E1.

  In another aspect, the present invention provides an antibody, or a purified polynucleotide encoding the antibody, wherein the antibody comprises: even if one or more amino acids are replaced with different amino acids. A VHCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 5, 6 or 7; comprising the amino acid sequence set forth in SEQ ID NO: 8 or 9, wherein one or more amino acids may be substituted with different amino acids VHCDR2 region; one or more amino acids may be substituted with different amino acids, VHCDR3 region comprising the amino acid sequence set forth in SEQ ID NO: 10; one or more amino acids are substituted with different amino acids A VLCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 11; wherein one or more amino acids are replaced with different amino acids May, VLCDR2 region comprising the amino acid sequence set forth in SEQ ID NO: 12; one or more amino acids may be substituted with a different amino acid, VLCDR3 region comprising an amino acid sequence set forth in SEQ ID NO: 13.

In another aspect, the invention provides an antibody that binds to human TLR3, the antibody comprising:
a. The heavy chain variable region of SEQ ID NO: 3, wherein one, two, three, or four or more amino acids may be substituted with a different amino acid; or b. The light chain variable region of SEQ ID NO: 4, wherein 1, 2, 3 or 4 or more amino acids may be substituted with a different amino acid; or c. The heavy chain variable region of SEQ ID NO: 3, wherein 1, 2, 3 or 4 or more amino acids may be substituted with different amino acids; A light chain variable region of SEQ ID NO: 4, or d. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 5-10, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or e. Light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acids shown in SEQ ID NOs: 11-13, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or f. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 5-10, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids The light chain CDRs 1, 2 and 3 shown in SEQ ID NOs: 11-13 (LCDR1, LCDR2, wherein 6 or more amino acids may be substituted with different amino acids); LCDR3) amino acid sequence; or g. CDR1, 2, and 3 (HCDR1, HCDR2, each of which is at least 60%, 70%, 80%, 85%, 90%, or 95% identical to CDR1, 2, and 3 of the variable region having the amino acid sequence of SEQ ID NO: 3 HCDR3) a heavy chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with a different amino acid; or h. CDR1, 2, and 3 (LCDR1, LCDR2, each of which is at least 60%, 70%, 80%, 85%, 90%, or 95% identical to CDR1, 2, and 3 of the variable region having the amino acid sequence of SEQ ID NO: 4 LCDR3) A light chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids.

  In some other aspects of the embodiments described herein, any of the heavy and light chain CDRs 1, 2 and 3 is at least a specific CDR or set of CDRs set forth in the corresponding SEQ ID NO. It may be characterized by having an amino acid sequence having 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence identity.

  In another aspect, the present invention provides antibodies that compete with the monoclonal antibodies of (a)-(h) above for binding to TLR3.

Antibody 31F6
The amino acid sequence of the heavy chain variable region of 31F6 is set forth as SEQ ID NO: 14, and the amino acid sequence of the light chain variable region is set forth as SEQ ID NO: 15. In a specific embodiment, the invention provides an antibody that binds to substantially the same epitope or determinant as monoclonal antibody 31F6; optionally, the antibody comprises the antigen binding region of antibody 31F6. In any of the embodiments described herein, antibody 31F6 may be characterized by its amino acid sequence and / or the nucleic acid sequence that encodes it. In a preferred embodiment, the monoclonal antibody comprises the 31F6 Fab or F (ab ') 2 moiety. Also provided is a monoclonal antibody comprising the heavy chain variable region of 31F6. According to one embodiment, the monoclonal antibody comprises three CDRs of the heavy chain variable region of 31F6. Also provided are monoclonal antibodies further comprising one, two or three CDRs of the variable light chain variable region of 31F6 or 31F6 light chain variable region. Optionally, any one or more of the light chain or heavy chain CDRs may comprise 1, 2, 3, 4 or 5 amino acid modifications (eg, substitutions, insertions or deletions). Optionally, any of the light and / or heavy chain variable regions comprising part or all of the antigen binding region of antibody 31F6 is an IgG type immunoglobulin constant region, optionally a human constant region, optionally human IgG1 or IgG4. Antibodies fused to isotypes are provided. In another preferred embodiment, the antibody is 31F6.

  In another aspect, the present invention provides an antibody, or a purified polynucleotide encoding the antibody, wherein the antibody comprises: even if one or more amino acids are replaced with different amino acids. A VHCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 16, 17 or 18; comprising the amino acid sequence set forth in SEQ ID NO: 19 or 20 wherein one or more amino acids may be substituted with different amino acids VHCDR2 region; one or more amino acids may be substituted with different amino acids, VHCDR3 region comprising the amino acid sequence set forth in SEQ ID NO: 21; one or more amino acids are substituted with different amino acids A VLCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 22; one or more amino acids may be different amino acids A VLCDR2 region comprising the amino acid sequence set forth in SEQ ID NO: 23, optionally substituted with one or more amino acids, comprising the amino acid sequence set forth in SEQ ID NO: 24, wherein one or more amino acids may be substituted with different amino acids VLCDR3 area.

In another aspect, the invention provides an antibody that binds to human TLR3, the antibody comprising:
a. The heavy chain variable region of SEQ ID NO: 14, wherein 1, 2, 3 or 4 or more amino acids may be replaced by different amino acids; or b. The light chain variable region of SEQ ID NO: 15, wherein 1, 2, 3 or 4 or more amino acids may be substituted with a different amino acid; or c. A heavy chain variable region of SEQ ID NO: 14, wherein 1, 2, 3 or 4 or more amino acids may be substituted with different amino acids; 1, 2, 3 or 4 or more amino acids are replaced with different amino acids A light chain variable region of SEQ ID NO: 15, or d. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 16-21, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or e. Light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acids shown in SEQ ID NOs: 22-24, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or f. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 16-21, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids And the light chain CDRs 1, 2 and 3 shown in SEQ ID NOs: 22-24 (LCDR1, LCDR2, wherein 6 or more amino acids may be substituted with different amino acids) LCDR3) amino acid sequence; or g. CDRs 1, 2 and 3 (HCDR1, HCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to each of the variable region CDRs 1, 2 and 3 having the amino acid sequence of SEQ ID NO: 14 HCDR3) a heavy chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with a different amino acid; or h. CDR1, 2, and 3 (LCDR1, LCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to the CDR1, 2, and 3 of the variable region having the amino acid sequence of SEQ ID NO: LCDR3) A light chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids.

  In some other aspects of the embodiments described herein, any of the heavy and light chain CDRs 1, 2 and 3 is at least a specific CDR or set of CDRs set forth in the corresponding SEQ ID NO. It may be characterized by having an amino acid sequence having 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence identity.

  In another aspect, the present invention provides antibodies that compete with the monoclonal antibodies of (a)-(h) above for binding to TLR3.

Antibody 32C4
The amino acid sequence of the heavy chain variable region of 32C4 is set forth as SEQ ID NO: 25, and the amino acid sequence of the light chain variable region is set forth as SEQ ID NO: 26. In a specific embodiment, the invention provides an antibody that binds to approximately the same epitope or determinant as monoclonal antibody 32C4; optionally, the antibody comprises the antigen binding region of antibody 32C4. In any of the embodiments described herein, antibody 32C4 may be characterized by its amino acid sequence and / or the nucleic acid sequence that encodes it. In a preferred embodiment, the monoclonal antibody comprises a 32C4 Fab or F (ab ') 2 moiety. Also provided are monoclonal antibodies comprising the heavy chain variable region of 32C4. According to one embodiment, the monoclonal antibody comprises three CDRs of the 32C4 heavy chain variable region. Also provided are monoclonal antibodies further comprising a 32C4 variable light chain variable region or one, two or three CDRs of a 32C4 light chain variable region. Optionally, any one or more of the light chain or heavy chain CDRs may comprise 1, 2, 3, 4 or 5 amino acid modifications (eg, substitutions, insertions or deletions). Optionally, any of the light and / or heavy chain variable regions comprising part or all of the antigen binding region of antibody 32C4 is an IgG type immunoglobulin constant region, optionally a human constant region, optionally human IgG1 or IgG4. An antibody fused to an isotype is provided. In another preferred embodiment, the antibody is 32C4.

  In another aspect, the present invention provides an antibody, or a purified polynucleotide encoding the antibody, wherein the antibody comprises: even if one or more amino acids are replaced with different amino acids. A VHCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 27, 28 or 29; comprising the amino acid sequence set forth in SEQ ID NO: 30 or 31 wherein one or more amino acids may be substituted with different amino acids VHCDR2 region; one or more amino acids may be substituted with different amino acids, VHCDR3 region comprising the amino acid sequence set forth in SEQ ID NO: 32; one or more amino acids are substituted with different amino acids A VLCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 33; wherein one or more amino acids are different amino acids A VLCDR2 region comprising the amino acid sequence set forth in SEQ ID NO: 34, optionally substituted with one or more amino acids, comprising one or more amino acids optionally substituted with a different amino acid set forth in SEQ ID NO: 35 VLCDR3 area.

In another aspect, the invention provides an antibody that binds to human TLR3, the antibody comprising:
a. The heavy chain variable region of SEQ ID NO: 25, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or b. The light chain variable region of SEQ ID NO: 26, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or c. The heavy chain variable region of SEQ ID NO: 25, wherein 1, 2, 3 or 4 or more amino acids may be substituted with different amino acids; 1, 2, 3 or 4 or more amino acids are replaced with different amino acids A light chain variable region of SEQ ID NO: 26, or d. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 27-32, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or e. Light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acids shown in SEQ ID NOs: 33-35, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or f. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 27-32, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids Light chain CDRs 1, 2 and 3 shown in SEQ ID NOs: 33-35 (LCDR1, LCDR2, wherein 6 or more amino acids may be substituted with different amino acids); LCDR3) amino acid sequence; or g. CDRs 1, 2 and 3 (HCDR1, HCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to each of the variable region CDRs 1, 2 and 3 having the amino acid sequence of SEQ ID NO: 25 HCDR3) a heavy chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with a different amino acid; or h. CDR1, 2, and 3 (LCDR1, LCDR2, each of which is at least 60%, 70%, 80%, 85%, 90%, or 95% identical to CDR1, 2, and 3 of the variable region having the amino acid sequence of SEQ ID NO: 26 LCDR3) A light chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids.

  In some other aspects of the embodiments described herein, any of the heavy and light chain CDRs 1, 2 and 3 is at least a specific CDR or set of CDRs set forth in the corresponding SEQ ID NO. It may be characterized by having an amino acid sequence having 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence identity.

  In another aspect, the present invention provides antibodies that compete with the monoclonal antibodies of (a)-(h) above for binding to TLR3.

Antibody 37B7
The amino acid sequence of the heavy chain variable region of 37B7 is set forth as SEQ ID NO: 36, and the amino acid sequence of the light chain variable region is set forth as SEQ ID NO: 37. In a specific embodiment, the invention provides an antibody that binds to approximately the same epitope or determinant as monoclonal antibody 37B7; optionally, the antibody comprises the antigen binding region of antibody 37B7. In any of the embodiments described herein, antibody 37B7 may be characterized by its amino acid sequence and / or the nucleic acid sequence that encodes it. In a preferred embodiment, the monoclonal antibody comprises the Fab or F (ab ′) 2 portion of 37B7. Also provided is a monoclonal antibody comprising the heavy chain variable region of 37B7. According to one embodiment, the monoclonal antibody comprises three CDRs of the heavy chain variable region of 37B7. Also provided are monoclonal antibodies further comprising one, two or three of the CDRs of the 37B7 variable light chain variable region or the light chain variable region of 37B7. Optionally, any one or more of the light chain or heavy chain CDRs may comprise 1, 2, 3, 4 or 5 amino acid modifications (eg, substitutions, insertions or deletions). Optionally, either the light chain and / or heavy chain variable region comprising part or all of the antigen binding region of antibody 37B7 is an IgG type immunoglobulin constant region, optionally a human constant region, optionally a human IgG1 or IgG4. Antibodies fused to isotypes are provided. In another preferred embodiment, the antibody is 37B7.

  In another aspect, the present invention provides an antibody, or a purified polynucleotide encoding the antibody, wherein the antibody comprises: even if one or more amino acids are replaced with different amino acids. A VHCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 38, 39 or 40; comprising the amino acid sequence set forth in SEQ ID NO: 41 or 42, wherein one or more amino acids may be substituted with different amino acids VHCDR2 region; one or more amino acids may be substituted with different amino acids, VHCDR3 region comprising the amino acid sequence set forth in SEQ ID NO: 43; one or more amino acids are substituted with different amino acids A VLCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 44; wherein one or more amino acids are different amino acids A VLCDR2 region comprising the amino acid sequence set forth in SEQ ID NO: 45, optionally substituted with one or more amino acids, comprising the amino acid sequence set forth in SEQ ID NO: 46, wherein one or more amino acids may be substituted with different amino acids VLCDR3 area.

In another aspect, the invention provides an antibody that binds to human TLR3, the antibody comprising:
a. The heavy chain variable region of SEQ ID NO: 36, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or b. The light chain variable region of SEQ ID NO: 37, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or c. The heavy chain variable region of SEQ ID NO: 36, wherein 1, 2, 3 or 4 or more amino acids may be substituted with different amino acids; 1, 2, 3 or 4 or more amino acids are replaced with different amino acids A light chain variable region of SEQ ID NO: 37; or d. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 38-43, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or e. Light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acids shown in SEQ ID NOs: 44-46, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or f. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 38-43, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids The light chain CDRs 1, 2 and 3 shown in SEQ ID NOs: 44-46 (LCDR1, LCDR2, wherein 6 or more amino acids may be substituted with different amino acids); LCDR3) amino acid sequence; or g. CDRs 1, 2 and 3 (HCDR1, HCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to the variable region CDRs 1, 2 and 3 having the amino acid sequence of SEQ ID NO: 36 HCDR3) a heavy chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with a different amino acid; or h. CDRs 1, 2 and 3 (LCDR1, LCDR2, LCDR3) A light chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids.

  In some other aspects of the embodiments described herein, any of the heavy and light chain CDRs 1, 2 and 3 is at least a specific CDR or set of CDRs set forth in the corresponding SEQ ID NO. It may be characterized by having an amino acid sequence having 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence identity.

  In another aspect, the present invention provides antibodies that compete with the monoclonal antibodies of (a)-(h) above for binding to TLR3.

Antibody 7G11
The amino acid sequence of the heavy chain variable region of 7G11 is set forth as SEQ ID NO: 47, and the amino acid sequence of the light chain variable region is set forth as SEQ ID NO: 48. In a specific embodiment, the invention provides an antibody that binds to substantially the same epitope or determinant as monoclonal antibody 7G11; optionally, the antibody comprises the antigen binding region of antibody 7G11. In any of the embodiments described herein, antibody 7G11 may be characterized by its amino acid sequence and / or the nucleic acid sequence that encodes it. In a preferred embodiment, the monoclonal antibody comprises the Fab or F (ab ′) 2 portion of 7G11. Also provided are monoclonal antibodies comprising the heavy chain variable region of 7G11. According to one embodiment, the monoclonal antibody comprises three CDRs of the heavy chain variable region of 7G11. Also provided are monoclonal antibodies further comprising one, two or three CDRs of the 7G11 variable light chain variable region or the light chain variable region of 7G11. Optionally, any one or more of the light chain or heavy chain CDRs may comprise 1, 2, 3, 4 or 5 amino acid modifications (eg, substitutions, insertions or deletions). Optionally, either the light chain and / or heavy chain variable region comprising part or all of the antigen binding region of antibody 7G11 is an IgG type immunoglobulin constant region, optionally a human constant region, optionally a human IgG1 or IgG4. Antibodies fused to isotypes are provided. In another preferred embodiment, the antibody is 7G11.

  In another aspect, the present invention provides an antibody, or a purified polynucleotide encoding the antibody, wherein the antibody comprises: even if one or more amino acids are replaced with different amino acids. A VHCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 49, 50 or 51; comprising the amino acid sequence set forth in SEQ ID NO: 52 or 53, wherein one or more amino acids may be substituted with different amino acids VHCDR2 region; one or more amino acids may be substituted with different amino acids, VHCDR3 region comprising the amino acid sequence set forth in SEQ ID NO: 54; one or more amino acids are substituted with different amino acids A VLCDR1 region comprising the amino acid sequence set forth in SEQ ID NO: 55; one or more amino acids may be different amino acids A VLCDR2 region comprising the amino acid sequence set forth in SEQ ID NO: 56, optionally substituted with one or more amino acids, comprising the amino acid sequence set forth in SEQ ID NO: 57, wherein one or more amino acids may be substituted with different amino acids VLCDR3 area.

In another aspect, the invention provides an antibody that binds to human TLR3, the antibody comprising:
a. The heavy chain variable region of SEQ ID NO: 47, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or b. The light chain variable region of SEQ ID NO: 48, wherein 1, 2, 3 or 4 or more amino acids are optionally substituted with different amino acids; or c. The heavy chain variable region of SEQ ID NO: 47, wherein 1, 2, 3 or 4 or more amino acids may be substituted with different amino acids; 1, 2, 3 or 4 or more amino acids are replaced with different amino acids A light chain variable region of SEQ ID NO: 48, or d. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 49-54, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or e. Light chain CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acids shown in SEQ ID NOs: 55-57, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids A sequence; or f. Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acids shown in SEQ ID NOs: 49-54, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids Light chain CDRs 1, 2 and 3 shown in SEQ ID NOs: 55-57 (LCDR1, LCDR2,...), Wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids LCDR3) amino acid sequence; or g. CDRs 1, 2 and 3 (HCDR1, HCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to each of the variable region CDRs 1, 2 and 3 having the amino acid sequence of SEQ ID NO: 47 HCDR3) a heavy chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with a different amino acid; or h. CDRs 1, 2 and 3 (LCDR1, LCDR2, each of which is at least 60%, 70%, 80%, 85%, 90% or 95% identical to each of the variable region CDRs 1, 2 and 3 having the amino acid sequence of SEQ ID NO: 48 LCDR3) A light chain variable region having an amino acid sequence, wherein 1, 2, 3, 4, 5 or 6 or more amino acids may be substituted with different amino acids.

  In some other aspects of the embodiments described herein, any of the heavy and light chain CDRs 1, 2 and 3 is at least a specific CDR or set of CDRs set forth in the corresponding SEQ ID NO. It may be characterized by having an amino acid sequence having 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence identity.

  In another aspect, the present invention provides antibodies that compete with the monoclonal antibodies of (a)-(h) above for binding to TLR3.

The CDR sequences of antibodies 7G11 and 32C4 are derived from the VL and VH gene rearrangements of the rat IGKV12s30 ^* 01 and IGHV1s6 ^* 01 genes for the light and heavy chains, respectively. The heavy chain CDR sequence of antibody 31F6 is derived from the VH gene rearrangement of the rat IGHV1s6 ^* 01 gene, and the light chain CDR sequence is derived from the VL gene rearrangement of the rat IGKV12s8 ^* 0 gene. In one aspect of the present invention, the light chain of one antibody of the present invention relates to the V gene and is derived from or derived from a nucleic acid sequence derived from a VL gene rearrangement selected from IGKV12s30 ^* 01 and IGKV12s8 ^* 0 Coded by In one aspect of the invention, the heavy chain of one antibody of the invention relates to the V gene and is obtained from or encoded by a nucleic acid sequence derived from a VH gene rearrangement selected from IGHV1s6 ^* 01 .

  In an antibody of the invention, eg, any of 11E1, 7G11, 31F6, 32C4 or 37B7, the variable regions and CDR sequences described may contain conservative sequence modifications. Conservative sequence modifications refer to amino acid modifications that do not significantly affect or significantly alter the binding properties of the antibody comprising the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies of the present invention by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is typically one in which one amino acid residue is replaced with an amino acid residue having a side chain with similar physicochemical properties. The variable regions and CDR sequences described may contain 1, 2, 3, 4, or 5 or more amino acid insertions, deletions or substitutions. When performing substitution, the preferred substitution is a conservative modification. Families of amino acid residues with similar side chains have been defined in the art. These families include basic side chains (eg lysine, arginine, histidine), acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains (eg glycine, asparagine, glutamine, serine, threonine, tyrosine) Cysteine, tryptophan), non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine) , Phenylalanine, tryptophan, histidine). Thus, using the assays disclosed herein, one or more amino acid residues in the CDR regions of the antibodies of the invention can be replaced with another amino acid residue from the same side chain family, Modified antibodies can be tested for retained function (ie, properties described herein).

  The terms “identity” or “identical”, when used with respect to the relationship between sequences of two or more polypeptides, refer to the degree of sequence relationship between the polypeptides, which means that two or more amino acid residues are present. Determined by the number of matches between the groups of groups. “Identity” is a measure of the percentage (%) of perfect matches (if any) between two or more smaller sequences by gap alignment, which can be determined by a specific mathematical model or computer program ( That is, it is processed by “algorithm”). The identity between related polypeptides can be easily calculated by a known method. Such methods include, but are not limited to, those described below: Computational Molecular Biology, Lesk, A .; M.M. , Ed. , Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D .; W. , Ed. , Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A .; M.M. And Griffin, H .; G. , Eds. , Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G .; , Academic Press, 1987; Sequence Analysis Primer, Gribskov, M .; and Devereux, J. et al. , Eds. , M.M. Stockton Press, New York, 1991; and Carillo et al. , SIAM J. et al. Applied Math. 48, 1073 (1988).

  Preferred methods for determining identity are designed to produce the greatest match between the sequences under test. Methods for determining identity are described in commonly available computer programs. A preferred computer program method for determining the identity of two sequences is the GCG program package, which includes the following: GAP (Devereux et al., Nucl. Acid. Res. 12, 387 (1984). ); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., J. Mol. Biol. 215, 403-410 (1990)). The BLASTX program is available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB / NLM / NIH Bethesda, Md. 20894; previously available from Altschul et al.). The identity can also be determined using the well-known Smith Waterman algorithm.

  According to AbM (Oxford Molecular's AbM antibody modeling software definition), Kabat and Chothia definition system, the CDR sequences of the antibodies of the present invention are summarized in Tables 1 and 2 below. The amino acid sequences described herein are numbered according to the AbM, Kabat and Chothia numbering system. Any suitable numbering system may be used to indicate the CDR regions, but Abm numbering can be used if there is no other indication. Such numbering has been established using the following notation: CDR-L1: Start: about residue 24, previous residue: always Cys, back residue: always Trp (typically Trp-Tyr-Gln, but may also be Trp-Leu-Gln, Trp-Phe-Gln, Trp-Tyr-Leu), length: 10-17 residues; CDR-L2: start: always L1 16 residues after the end, previous residue: generally Ile-Tyr (but sometimes Val-Tyr, Ile-Lys, Ile-Phe), length: always 7 residues; CDR-L3, start : Always 33 residues from L2 end, previous residue: always Cys, back residue: always Phe-Gly-Xaa-Gly, 7-11 residues in length; CDR-H1, start: almost residue 26 (always 4 residues after Cys) (Choth a / AbM definition, Kabat definition starts after 5 residues), previous residue: always Cys-Xaa-Xaa-Xaa, subsequent residue: always Trp (typically Trp-Val but Trp- Ile, Trp-Ala), length: 10-12 residues (AbM definition, Chothia definition excludes the last 4 residues); CDR-H2, start: always Kabat of CDR-H1 15 residues after the end of the / AbM definition, the previous residue: typically Leu-Glu-Trp-Ile-Gly (but Lys / Arg-Leu / Ile / Val / Phe / Thr / Ala-Thr There are several variations, such as residues after / Ser / Ile / Ala), length: 16-19 residues in Kabat definition; 7 residues earlier in AbM (and Chothia) definition; DR-H3, start: always 33 residues after the end of CDR-H2 (always 2 residues after Cys), previous residue: always Cys-Xaa-Xaa (typically Cys-Ala-Arg) , Back residues: always Trp-Gly-Xaa-Gly, length: 3-25 residues.

  In one embodiment, the antibodies of the invention are of human or mouse IgG1 isotype. In another embodiment, the antibody of the invention is of the human IgG4 isotype. In another embodiment, an antibody of the invention is an antibody fragment that retains its binding and / or functional properties.

Fragments and derivatives of the present monoclonal antibodies Fragments and derivatives of the antibodies of the present invention (included by the term “antibody” or “antibodies” as used in this application unless otherwise stated or clearly contradicted by text) Preferably, 11E1, 7G11, 31F6, 32C4 or 37B7-like antibodies can be generated by techniques known in the art. “Fragments” comprise a portion of an intact antibody, generally the antigen binding site or variable region. Examples of antibody fragments include Fab, Fab ′, Fab′-SH, F (ab ′) 2, and Fv fragments; diabodies; polypeptides having a primary structure composed of unbroken sequences of consecutive amino acid residues ( Any antibody fragment that is referred to herein as a “single chain antibody fragment” or “single chain polypeptide” includes, but is not limited to: (1) a single chain Fv molecule , (2) a single-chain polypeptide that does not include the associated heavy chain portion and contains only one light chain variable domain, or a fragment thereof that contains the three CDRs of the light chain variable domain, and (3) the associated light chain portion A single-chain polypeptide containing only one heavy chain variable region, or a fragment thereof containing three CDRs of the heavy chain variable region; Specific antibody. Among others, Nanobodies, domain antibodies, single domain antibodies or “dAbs” are included.

  Fragments of this antibody can be obtained using standard methods. For example, Fab or F (ab ') 2 fragments may be generated by protease digestion of isolated antibodies according to conventional techniques. It will be understood that immunoreactive fragments can be modified using known methods. For example, the fragment may be modified with polyethylene glycol (PEG) to slow in vivo clearance and obtain a more desirable pharmacokinetic profile. Methods for ligating PEG with Fab 'fragments for site-specific attachment are described, for example, in Leong et al, 16 (3): 106-119 (2001) and Delgado et al, Br. J. et al. Cancer 73 (2): 175-182 (1996), the disclosure of which is incorporated herein by reference.

  Alternatively, the DNA of a hybridoma producing an antibody of the present invention, preferably an 11E1, 7G11, 31F6, 32C4 or 37B7-like antibody, may be modified to encode a fragment of the present invention. The modified DNA is then inserted into an expression vector which is used to transform or transfect appropriate cells that will express the desired fragment.

  In certain embodiments, the DNA of a hybridoma producing an antibody of the present invention, preferably a 11E1, 7G11, 31F6, 32C4 or 37B7-like antibody, may be transformed, By replacing the coding sequence of the heavy and light chain constant domains (eg, Morrison et al., PNAS pp. 6851 (1984)) or in the immunoglobulin coding sequence, or all of the coding sequence of the non-immunoglobulin polypeptide Modifications can be made by covalently attaching a portion. In this way, “chimeric” or “hybrid” antibodies are prepared that have the binding specificity of the original antibody. Typically, such non-immunoglobulin polypeptides replace the constant domains of the antibodies of the invention.

  Thus, according to an embodiment, an antibody of the invention, preferably a 11E1, 7G11, 31F6, 32C4 or 37B7-like antibody is humanized. “Humanized” forms of the antibodies of the present invention may include specific chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab) containing minimal sequence derived from mouse or rat immunoglobulin. ') 2 or other antigen-binding subsequence of the antibody). In most cases, the humanized antibody will retain the original antibody (donor) while residues from the recipient's complementarity determining regions (CDRs) maintain the desired specificity, affinity, and ability of the original antibody. Antibody) is a human immunoglobulin (recipient antibody) substituted by residues from the CDRs of the antibody.

  In some cases, Fv framework residues of the human immunoglobulin may be replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not present in either the recipient antibody or the imported CDR or framework sequences. These modifications are made to further improve and optimize antibody performance. In general, humanized antibodies comprise substantially all of at least one, typically two variable domains, in which all or substantially all of the CDR regions are identical to those of the original antibody. In addition, all or substantially all of the FR region is of human immunoglobulin consensus sequence. A humanized antibody may also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically at least a portion of a human immunoglobulin. For further details, see: Jones et al. , Nature, 321 pp. 522 (1986); Reichmann et al, Nature, 332, pp. 323 (1988); Presta, Curr. Op. Struct. Biol. , 2, pp. 593 (1992); Verhoeyen et Science, 239, pp. 1534; U.S. Pat. No. 4,816,567, the entire disclosures of which are incorporated herein by reference. Methods for humanizing the antibodies of the present invention are known in the art.

  The selection of human variable domains (both light and heavy chains) used to make humanized antibodies is very important in reducing antigenicity. According to the so-called “best fit” method, the variable domain sequences of the antibodies of the invention are screened against an entire library of known human variable domain sequences. The human sequence closest to that of the mouse is accepted as the human framework (FR) (Sims et al., J. Immunol. 151, pp. 2296 (1993); Chothia and Lesk, J. Mol. 196, 1987). , Pp. 901). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework can be used for multiple different humanized antibodies (Carter et al., PNAS 89, pp. 4285 (1992); Presta et al., J. Immunol., 151, P. 2623 (1993). )).

  It is further important that antibodies be humanized with retention of high affinity for the TLR3 receptor and other biological properties. To achieve this goal, according to a preferred method, a humanized antibody is prepared by a method of analysis of the parental sequence and various conceptual humanized products using a three-dimensional model of the parental sequence and the humanized sequence. . Three-dimensional immunoglobulin models are commercially available and are well known to those skilled in the art. Computer programs are available that draw and display the predicted three-dimensional structure of selected candidate immunoglobulin sequences. A closer look at these displays allows analysis of the putative role of residues in the function of a candidate immunoglobulin, ie, analysis of residues that affect the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the common and import sequences so that the desired antibody characteristic, such as high affinity for the target antigen (s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding.

  Another method of making “human” monoclonal antibodies is to use XenoMouse (Abgenix, Fremont, Calif.) As the mouse used for immunization. XenoMouse is a mouse host of the present invention whose immunoglobulin gene has been replaced with a functional immune human globulin gene. Thus, the antibody produced by this mouse or in a hybridoma derived from the B cell of this mouse is a human (or already humanized) antibody. XenoMouse is described in US Pat. No. 6,162,963, which is hereby incorporated by reference in its entirety.

  Human antibodies can be produced according to various other techniques, eg, for immunization, other transgenic animals that have been modified to express the human antibody repertoire (Jakobovitz et Nature 362 (1993) 255), phage display methods. It can also be generated by selecting the antibody repertoire used. Such techniques are known to those skilled in the art and are performed starting from the monoclonal antibodies disclosed in this application.

  The antibodies of the present invention, preferably 11E1, 7G11, 31F6, 32C4 or 37B7-like antibodies, may be derivatized into “chimeric” antibodies (immunoglobulins), where these are the desired biological activity and As long as it exhibits binding specificity, part of the heavy / light chain is the same or homologous to the corresponding sequence in the original antibody, and the rest of the chain is from another species Or the same or homologous to the corresponding sequences in antibodies belonging to another antibody class or subclass, and fragments of such antibodies (Cabilly et al., Supra; Morrison et al., Proc. Natl. Acad.Sci.U.S.A., pp. 6851 (1984)).

Dosing schedule Using anti-TLR3 antibodies and based on efficacy data collected during in vivo experiments, we have confirmed that doses as low as 100 μg / mouse produce a therapeutic effect. Such a dose corresponds to 4 mg / kg in mice and thus to 0.5 mg / kg in human subjects. Therefore, in the method of the present invention, the anti-TLR3 antibody is used in humans at 0.05 to 20 mg / kg, preferably 0.1 to 10 mg / kg, more preferably 0.5 to 5 mg / kg (about 25 mg to 500 mg). (Unit dose) can be administered.

  Exemplary treatment regimes include twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every 2-3 months, or 3-6 Includes once-monthly administration. An exemplary administration schedule of anti-TLR3 antibody is 0.05-20 mg / kg (body weight) by intravenous administration or subcutaneous injection (preferably 0.1-10 mg / kg, more preferably 0.5-5 mg / kg). The antibody is administered using one of the following dosing schedules: (i) After multiple doses (eg, 2-4 doses) approximately every 1, 2, 3 or 4 weeks, Administration every 1 to 3 months; (ii) Once a month to once every 2 months; (iii) Every 1 to 2 weeks or any other optimal administration.

  The anti-TLR3 antibody is optionally suitable for inducing substantially complete TLR3 receptor saturation (90%, optionally 95% receptor saturation), eg, saturation of the TLR3 polypeptide expressed in the target cell. Dosage amount. Since TLR3 receptors are thought to dimerize prior to signal transduction, inhibition of receptor saturation at least 20%, 30%, 40%, 50% below full saturation is useful in treating disease. Let's go. In one embodiment, the amount of anti-TLR3 antibody that results in at least about 20%, 30%, 40%, 50%, 90% or 95% receptor saturation is administered from about twice weekly to about once every month. The dose can be administered, for example, at least 3, at least 6, or 7 times or more. For example, the method can receive at least about 20%, 30%, 40%, 50%, 90% or 95% TLR3 receptor for a target cell for at least about 2 weeks, 1 month, 6 months, 9 months or 12 months. Administering the anti-TLR3 antibody at a dose and frequency of administration that achieves body saturation. In one preferred embodiment, a dosing regimen results in substantially complete persistence of receptor saturation. The dose of anti-TLR3 antibody that provides substantially complete receptor saturation is administered at a dose of anti-TLR3 antibody that provides substantially complete receptor saturation over a period of at least about 1 week, 2 weeks, or 1 month.

  Receptor occupancy can be assessed for human samples in which labeled cells are present (eg, whole blood, any tissue at the site of inflammation, synovial fluid). Since the TLR3 receptor is present in the cell, the saturation level (%) of the TLR3 receptor can be analyzed by FACS analysis using a known method. Alternatively, the percent saturation can be determined using a cytokine inhibition secretion profile in response to a TLR3 ligand, such as dsRNA (ie, polyAU) in a mononuclear cell (preferred PBMC) obtained from a patient. Since efficient cytokine inhibition correlates with an efficient therapeutic effect, the dosage can be adapted for each patient. Cytokines that can be measured in this assay are, for example, IP-10 or IP-6. In another embodiment, receptor saturation is assessed as receptor occupancy, for example, by performing free site and binding site assays. Briefly, free and bound TLR3 receptor levels are assessed for target cells from a biological sample obtained from an individual treated with an anti-TLR3 antibody, in which case a free site assay is performed on the anti-TLR3 antibody administered to the individual. Unbound TLR3 is assessed by staining with the PE-bound form. The binding site assay is occupied by the anti-TLR3 antibody by staining with a PE-conjugated mouse anti-human IgG4 monoclonal antibody that recognizes the anti-TLR3 antibody bound to the TLR3 polypeptide (when the anti-TLR3 antibody is a human IgG4 isotype). TLR3 polypeptides are evaluated. In one embodiment, the present invention further provides a method of treating an individual comprising: (a) administering an anti-TLR3 antibody to the individual; and (b) determining a TLR3 receptor in the individual; Optionally, further determining the dose of anti-TLR3 antibody to be administered to the individual.

Dosage Forms A therapeutic preparation of an antagonist for use in accordance with the present invention comprises mixing an antagonist having the desired purity with an optional pharmaceutically acceptable carrier, excipient or stabilizer in the form of a lyophilized preparation or an aqueous solution. To prepare for storage. For general information on formulations, see, for example, Gilman et al. (Eds.), The Pharmacological Bases of Therapeutics, 8 th Ed. (Pergamon Press, 1990); ( . Ed) Gennaro, Remington's Pharmaceutical Sciences, 18 th Edition (Mack Publishing Co., Easton, Pa, 1990.); Avis et al. (Eds.), Pharmaceutical Dosage Forms: Parental Medicines (Dekker, New York, 1993); Lieberman et al. (Eds.), Pharmaceutical Dosage Forms: Tables (Dekker, New York, 1990); Lieberman et al. (Eds.) Pharmaceutical Dosage Forms: Disperse Systems (Dekker, New York, 1990);

  Acceptable carriers, excipients or stabilizers are non-toxic to the receptor at the dosages and concentrations used and include the following: buffers such as phosphoric acid, citric acid, and other organic acids; ascorbic acid And antioxidants such as methionine; preservatives (eg octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol Resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptide; protein such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymer such as polyvinylpyrrolidone; Amino acids such as glucose, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates such as glucose, mannose or dextrin; chelating agents such as ethylenediaminetetraacetic acid (EDTA); sucrose, mannitol, trehalose Or a sugar-forming counterion such as sodium; a metal complex (eg, zinc-protein complex); and / or a nonionic surfactant such as TWEEN ™, PLURONICS ™, or PEG. .

  An exemplary antibody formulation is described, for example, in WO 1998/56418, which describes a liquid multiple dose formulation of anti-CD20 antibody, which comprises 40 mg / mL rituximab, 25 mM acetic acid. Salt, 150 mM trehalose, 0.9% benzyl alcohol, and 0.02% polysorbate 20 ™ at pH 5.0 with a minimum shelf life of 2 years at 2-8 ° C. Another anti-CD20 formulation of interest is 9.0 mg / mL sodium chloride, 7.35 mg / mL sodium citrate dihydrate, 0.7 mg / mL polysorbate 80 ™, and sterile Contains 10 mg / mL rituximab in distilled water for injection, pH 6.5.

  Lyophilized formulations adapted for subcutaneous administration are described, for example, in US Pat. No. 6,267,958 (Andya et al.). Such lyophilized formulations can be reconstituted to a high protein concentration using a suitable diluent and the reconstituted formulation can be administered subcutaneously to the mammal to be treated herein.

  Crystallized forms of the antagonist are also contemplated. See, for example, US 2002/0136719 A1 (Shenoy et al.).

  The formulations herein may also contain one or more active compounds (second agents as described above), preferably those with complementary activities that do not adversely affect each other. The type and effective amount of such agents vary depending on, for example, the amount and type of B cell agonist present in the formulation and the clinical parameters of the subject. Such preferred second agents are described above.

  The active ingredient may be encapsulated, for example, in microcapsules prepared by coacervation techniques or interfacial polymerization, such as hydroxymethylcellulose or gelatin-microcapsules and poly (methyl methacrylate) microcapsules, respectively, colloidal drug delivery systems (E.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or macroemulsions. Such techniques are disclosed, for example, in Remington's Pharmaceutical Sciences, supra.

  Sustained release formulations may be prepared. Suitable examples of sustained release formulations include semi-permeable matrices of solid hydrophobic polymers containing antagonists, which are in the form of shaped articles such as films or microcapsules, for example. Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919), L-glutamic acid. And degradable lactic acid-glycolic acid copolymers such as gamma ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, Lupron Depot ™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), And poly-D-(-)-3-hydroxybutyric acid.

  The formulation to be used for in vivo administration must be sterile. This is easily accomplished by filtration through a bacterial filtration membrane. Pharmaceutically acceptable carriers that can be used in these compositions include, but are not limited to: ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, Buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated plant fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, chloride Sodium, zinc salt, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based material, polyethylene glycol, sodium carboxymethylcellulose, polyacrylate, wax, polyethylene-polyoxypropylene-block polymer, polyethylene Glycol and wool fat. The antibody of the present invention can be used in a method of modulating, for example, inhibiting the activity of TL3-expressing cells in a patient. The method includes contacting a patient with the composition (eg, administering the composition to the patient). Such methods are useful for both prophylactic and therapeutic purposes.

  The formulation may be adapted to the nasal or inhalation route. The formulation may include a pharmaceutically acceptable intranasal carrier. For nasal delivery, any known delivery method can be used such as nasal drops, nasal sprays, nasal liquid or powder aerosols, capsules or nasal inserts. For aerosol delivery, any known delivery method such as a nebulizer, inhaler, nebulizer, aerosol dispenser, mist nebulizer, dry powder inhaler, metered dose inhaler, metered dose spray, metered dose mist nebulizer, metered dose nebulizer, etc. Or other suitable delivery device can be used.

  Other aspects and advantages of the present invention are disclosed in the following experimental section, which should be regarded as illustrative and not limiting the scope of the present application.

Treatment of Disease The present invention is a method for the treatment of an individual having an autoimmune or inflammatory disease, the method comprising administering to the individual an anti-TLR3 antibody of the present invention. The antibody may be included in a composition further comprising a pharmaceutically acceptable carrier. Such a composition is also called an “antibody composition” of the present invention. In one embodiment, the antibody composition of the invention comprises an antibody disclosed in the foregoing antibody embodiments.

  The invention also provides a method of modulating TLR3-expressing cell activity in a patient in need, the method comprising administering to the patient a composition of the invention. This method is more particularly caused by a disease in which a reduction in TLR3 cell activity is beneficial (eg autoimmune disease, inflammatory disease, infection, viral infection), or excess TLR3 cell activity, or It relates to reducing TLR3 cell activity in patients with diseases characterized by this. In one embodiment, the activity of TLR3-expressing cells is inhibited, wherein the patient has a disease or disorder, and such inhibition may promote, enhance, and / or induce a therapeutic effect (or Promotes, enhances, and / or induces effects as determined by, for example, clinical trials, in at least a substantial proportion of patients with a disease or disorder, and patients having substantially similar characteristics to the patient) .

  Diseases and disorders in which the present invention can be used include all diseases in which modulation of TLR3 is beneficial, for example by TLR3 signaling or by cytokines produced during said TLR3 signaling, partly or collectively Includes diseases mediated or exacerbated. In particular, when using antibodies that inhibit TLR3 signaling, such disorders include any disorder that is mediated or exacerbated in part or in general by TLR3 signaling or by cytokines produced during said TLR3 signaling. Among others, immune disorders such as inflammatory diseases and autoimmune diseases can be mentioned. More specifically, the methods of the present invention are useful for the treatment of various immune disorders or other diseases such as, but not limited to, autoimmunity, inflammation, allergy, asthma, infection (eg, chronic infection, viral infection) and sepsis. used. Examples of diseases that can be treated with antibodies that inhibit TLR3 signaling include, but are not limited to, arthritis, systemic lupus erythematosus, sepsis, asthma, osteoporosis, autoimmunity to central nervous system antigens, autoimmune diabetes, inflammation Include inflammatory bowel disease, autoimmune carditis and autoimmune hepatitis.

  In another embodiment, an anti-TLR3 antibody of the invention that inhibits signaling by a TLR3 polypeptide is used for the treatment or prevention of graft-versus-host disease (GvHD), for example, in transplantation or infusion. In particular, after bone marrow transplantation, T cells present in the graft, whether present as contaminants or intentionally introduced into the host, after recognizing host tissue as foreign as an antigen, Attack the tissue of the graft recipient. T cells produce excess cytokines, such as TNF-α and interferon γ (IFNγ). The anti-TLR3 antibody can be administered before, during, or after transplantation or transfer, such as allogeneic bone marrow transplantation, particularly in the treatment of cancer, eg, leukemia. The antibody may be any anti-TLR3 antibody that inhibits TLR3 polypeptide signaling. Since GvHD is thought to be driven mainly by antigen presenting cells, anti-TLR3 antibodies that inhibit TLR3 signaling in DC are considered particularly useful.

  Other immune disorders that can be treated with anti-TLR3 antibodies that inhibit TLR3 signaling according to the present invention include, but are not limited to, autoimmune disorders and inflammatory disorders including, among others: : Crohn's disease, celiac disease, ulcerative colitis, irritable bowel syndrome, acute disseminated encephalomyelitis (ADEM), Addison disease, antiphospholipid antibody syndrome (APS), aplastic anemia, autoimmune hepatitis, diabetes , Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), Hashimoto's disease, lupus erythematosus, demyelination, multiple sclerosis, myasthenia gravis, optoclonus-myoclonus syndrome (OMS), optic neuritis, Aude thyroiditis , Pemphigus, cirrhosis, psoriasis, rheumatoid arthritis, Reiter syndrome, Takayasu arteritis, temporal arteritis, wet autoimmune hemolysis Anemia, Wegener's granulomatosis, appendicitis, arteritis, arthritis, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chorioamnionitis, colitis, conjunctivitis, cystitis, Lacrimal inflammation, dermatitis, dermatomyositis, encephalitis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymis, fasciitis, connective tissue inflammation, gastritis, gastroenteritis, gingiva Inflammation, hepatitis, suppurative spondylitis, ileitis, iritis, laryngitis, mastitis, meningitis, myelitis, myocarditis, myositis, nephritis, umbilitis, ovitis, testitis, osteomyelitis, otitis, Pancreatitis, parotitis, pericarditis, peritonitis, laryngitis, pleurisy, phlebitis, pneumonitis, proctitis, prostatitis, pyelonephritis, rhinitis, fallopianitis, sinusitis, stomatitis, synovitis, tendon Inflammation, tonsillitis, uveitis, vaginitis, vasculitis, and vulvitis.

  One aspect of the present invention is to provide a composition capable of treating SIRS, sepsis, severe sepsis or septic shock. Another aspect of the present invention is to provide a method for the prophylactic treatment of patients at risk of developing sepsis. For example, patients who have had their spleen removed by surgery, immunocompromised patients (ie, chemotherapy, immunosuppression), but also long-term steroid therapy, diabetes, AIDS, or cirrhosis, extensive burns or severe trauma, pneumonia, meninges Other causes such as inflammation, peritonitis, appendicitis, cellulitis, urinary tract infection or infection that occurs after major surgery.

  In one embodiment, the individual has an autoimmune or inflammatory disease declared long ago (eg, over a year ago), has an ongoing or active inflammation, and a physical sign of disease (eg, a joint Have swelling, lesions, neurological symptoms, etc., have a chronic disease, have a severe disease (evaluated by applicable criteria, eg, DAS or ACR criteria in the case of rheumatoid arthritis), or Have ongoing disease.

  In one embodiment, the present invention provides a method of treating an individual having established autoimmune or inflammatory disease, the method comprising administering an anti-TLR3 antibody to the individual. In one embodiment, the present invention provides a method for treating an acute phase of an autoimmune or inflammatory disease, or stroke, onset, exacerbation or relapse using a TLR3 antibody (or related composition), preferably Administers said antibody to an individual during the acute phase of autoimmunity or inflammatory disease, or during an episode, onset, exacerbation or relapse. In one embodiment, the disease is rheumatoid arthritis, juvenile idiopathic arthritis, multiple sclerosis, Crohn's disease or colorectal colitis, lupus erythematosus, hepatitis, chronic obstructive pulmonary disease (COPD) or asthma, ankylosing spondylitis and related Selected from the group consisting of diseases. In one embodiment, the disease is characterized by the presence of a TLR3 ligand (eg, extracellular dsRNA). In one embodiment, the disease comprises detectable levels of proteolytic enzymes, inflammatory mediators, markers of ongoing inflammation or inflammatory cytokines (eg, TNF-α and / or interleukin-1 (IL-1)). Features. Preferably, the antibody inhibits signaling by the TLR3 polypeptide, optionally in human dendritic cells, optionally with high binding affinity, even under acidic conditions.

  Treatment is generally for the purpose of preventing the onset or worsening of any symptom or condition, or preventing (eg, preventing or delaying progression), reducing, or reducing such a symptom or condition that has already developed. Delivering an effective amount of a composition comprising an anti-TLR3 antibody for purposes of improvement or cure (curing). Diagnosis, progression and grading (or staging) of disease refers to whether an individual has established disease, is in an acute phase, is ongoing, is chronic, or is chronic for a particular type of disease, It can be established by standard medical criteria for determining whether a person has physical symptoms or is of a certain degree of severity. Similarly, seizures, onset, exacerbations or relapses can be found by any suitable medical criteria.

  In one embodiment, the invention includes performing an assessment or testing step to assess the presence, stage, progression or grading of the disease. Accordingly, in one aspect, the present invention provides a method of treating an autoimmune or inflammatory disease in a patient, comprising: (a) performing an assessment of the disease in the patient; and (b) said patient comprising: If the patient has a disease suitable for treatment with an anti-TLR3 antibody of the present invention, the method comprises the step of administering an effective amount of the anti-TLR3 antibody to the patient. Optionally, such an assessment step may include obtaining a biological sample from a patient suspected of having an autoimmune or inflammatory disease. Methods for assessing (eg, diagnosing, staging) a disease can be accomplished by any suitable technique known in the art, eg, performing a test in the laboratory. Examples of suitable techniques include the following: PCR or RT-PCR assays (eg, for the purpose of detecting nucleic acids or genes associated with disease, commonly referred to as “markers” or “biomarkers”) , Biopsy, endoscopy, stool, any non-invasive laboratory test (eg, liver function tests to screen for anemia and infection, liver and bile duct disorders, tests for bacterial, viral and parasitic infections) ), Ultrasound, CT, MRE, MRI and other imaging techniques, chromosomal analysis, immunoassay / immunocytochemical detection techniques (eg the presence of autoantibodies), histology and / or histopathological assays, serum proteins Electrophoresis, flow cytometry (eg, detection of immune cells, T cells, etc.), arterial blood gas (ABG) analysis (asthma or COPD field ), And physical examination techniques (e.g., if the physical symptoms, the number of joints with synovitis). In one embodiment, the method detects the presence of an autoantibody, eg, rheumatoid factor (RhF), anti-cyclic citrullinated peptide antibody, anti-ssRNA, anti-dsRNA, anti-Smith, antiphospholipid, antinuclear and / or Detecting an anti-actin antibody. In one embodiment, the method comprises evaluating a proteolytic enzyme, an inflammatory mediator, a marker of ongoing inflammation or an inflammatory cytokine. In one embodiment, the method includes determining c-reactive protein (CRP) levels and / or erythrocyte precipitation rate. Individuals may have abnormal results (indicating disease, worsening, ongoing inflammation, etc.), eg, abnormal levels of ABG, autoantibodies, CRP, any proteolytic enzyme, inflammatory mediator or marker of ongoing inflammation. The decision to have indicates that the individual is suitable for treatment with an anti-TLR3 antibody.

  Delivery of anti-TLR3 antibody to a subject (either by direct administration or expression therein from a nucleic acid, eg, a poxvirus gene delivery vector comprising an anti-TLR3 antibody-encoding nucleic acid sequence) and implementation of other methods of the invention It can be used to reduce, treat, prevent, or also ameliorate a disease or disease progression. The methods of the present invention may particularly reduce and / or reduce inflammation and / or tissue damage and any parameters or symptoms associated therewith (eg, presence of markers of inflammation, number of inflammatory cells in the circulation or particular tissue). Useful for improvement.

  Anti-TLR3 antibodies can be advantageously used to treat established diseases. “Filled disease” refers to an autoimmune or inflammatory disease that has been declared long ago, eg, more than a year ago. Depending on the specific disease, established disease means a disease that is not controlled, eg, is still in progress, or the patient has not experienced remission in the presence or absence of treatment. In one aspect, the invention provides a method of treating an autoimmune or inflammatory disease in a patient, the method comprising: (a) determining whether said patient has established disease; and (b) said If the patient has established disease, the method comprises administering to the patient an effective amount of an anti-TLR3 antibody.

  Anti-TLR3 antibodies can be advantageously used to treat chronic diseases. “Chronic disease” refers to a disease that persists over a long period of time. For example, a chronic disease may be a disease that persists for 3 months or more, as defined by the US National Center for Health Statistics. In one aspect, the invention provides a method of treating an autoimmune or inflammatory disease in a patient, the method comprising: (a) determining whether the patient has a chronic disease; and (b) the patient. If the patient has a chronic disease, the method comprises administering an effective amount of an anti-TLR3 antibody to the patient.

  Anti-TLR3 antibodies can be advantageously used to treat individuals with seizures, onset, worsening or relapse. The terms “seizure”, “onset”, “aggravation” and “relapse” mean a more rapid progression of new symptoms associated with inflammatory or autoimmune diseases or an exacerbation of old symptoms associated therewith. Such a stage lasts for hours or days, as opposed to the slow progression of the disease that occurs over months and years. During such attacks, patients experience fever, pain, and inflammatory syndrome (influenza-like syndrome). In RA, the patient's joints expand and are painful. Patients may also experience an influenza-like syndrome. Onset can last from hours to weeks. In the case of multiple sclerosis, rapid relapse may be characterized by new symptoms or exacerbations of existing symptoms, but requires at least 24 hours to recognize as true deterioration, and rapid relapse Or a new lesion formed in the spinal cord, which disrupts neurotransmission. Most rapid relapses last for days or weeks, and can last for months. Actions include, for example, the following: difficulty in movement or spasticity, balance and coordination impairment; visual field impairment, uncoordinated eye movements, blurred or double vision, stigma during relapse; bladder and Intestinal symptoms; sexual disorders, changes in mental function: memory loss, inattention and judgment or depression. In COPD, exacerbations are characterized by changes in the patient's baseline dyspnea, cough, and / or epilepsy that may deviate from normal day-to-day changes and thus justify changes in the patient's medication with potential COPD. Can be defined as an event in the natural course of the disease. Patients who experience exacerbations have one of the following: increased cough and sputum incidence, changes in sputum color and / or thickness, wheezing, chest tightness, fever. In the case of Crohn's disease or colorectal colitis, relapse is mainly the usual Crohn's disease symptoms: diarrhea, convulsive abdominal pain, fever, loss of appetite. In one aspect, the invention provides a method of treating an autoimmune or inflammatory disease in a patient, the method comprising: (a) determining whether the patient is experiencing seizures, onset, worsening or relapse. And (b) administering an effective amount of an anti-TLR3 antibody to the patient if the patient is experiencing onset, worsening or relapse.

  Anti-TLR3 antibodies can be advantageously used to treat individuals with relapse. The term “recurrence” refers to the improvement or stabilization of a patient's symptoms. The disease recurs when the patient's health or condition improves. In one aspect, the invention provides a method of treating an autoimmune or inflammatory disease in a patient, the method comprising: (a) determining whether the patient is experiencing relapse, onset, worsening or relapse. And (b) if the patient is experiencing relapse, the method comprises administering to the patient an effective amount of an anti-TLR3 antibody.

  Optionally, performing an assessment step comprising assessing the expression of a TLR3 polypeptide in cells from the patient (eg, inflammatory cells, dendritic cells, T cells, etc.) prior to treatment with the anti-TLR3 antibody. be able to. In general, in this step, a cell sample is taken from a patient, typically as a biopsy, and tested using, for example, an immunoassay to express TLR3 polypeptide on the cell, and optionally a relative table. Decide to stand. In one aspect, a determination that a patient has cells that significantly express a TLR3 polypeptide indicates that an anti-TLR3 antibody (and optionally any other therapeutic agent) is suitable for the patient. . In a further step, the patient can subsequently be treated with an anti-TLR3 antibody.

  Optionally, in one embodiment, a TLR3 ligand detection step can be performed that includes detecting the presence of a TLR3 ligand in the patient prior to treatment with the anti-TLR3 antibody. In general, in this step, a biological sample is taken from the patient, which is a sample of synovial fluid, for example in the case of rheumatoid arthritis patients. Biological samples are evaluated for the presence of TLR3 ligand, eg, the presence of extracellular dsRNA. If the biological sample is positive for the presence of TLR3 ligand, the patient is advantageously treated with an anti-TLR3 antibody, preferably with an antibody that inhibits TLR3 signaling in TLR3-expressing cells in the presence of a dsRNA TLR3 ligand.

The anti-TLR3 antibody administered to the individual with the disease can be any monoclonal antibody that specifically binds to the TLR3 polypeptide, and preferably inhibits signal transduction by the TLR3 polypeptide, as described herein. Any antibody that does. For example, the anti-TLR3 antibody is an antibody that specifically binds to TLR3, this antibody for binding to human TLR3 polypeptide has a _{K D} of less than ^{10 -9} M under acidic conditions, optionally also Accordingly, further comprising a _{K D} of less than ^{10 -9} M at neutral conditions.

  In one embodiment, the anti-TLR3 antibody is used as a monotherapy (single therapeutic agent).

  According to another embodiment, the treatment method of the present invention may further comprise treating an individual with an anti-TLR3 antibody and a second therapeutic agent, wherein the second therapeutic agent is a specific therapeutic purpose for which the antibody is administered. Contains drugs that are commonly used for. The anti-TLR3 antibody and the second therapeutic agent can be administered individually, together or sequentially or as a cocktail. The second therapeutic agent is usually administered in the amount typically used for that agent in monotherapy for the particular disease or condition being treated. In one embodiment, the second therapeutic agent is administered at a dose that is less than an acceptable effective dose; for example, in various embodiments, a composition comprising a dose that is generally less than about 10% to 75% of an acceptable effective amount. The thing is administered. In one embodiment, the second therapeutic agent is a corticosteroid such as dexamethasone, hydrocortisone (Cortisol), cortisone acetate, prednisone, prednisolone, methylprednisolone, deflazacoat, betamethasone, triamcinolone, beclomethasone, parameterzone, fluticasone acetate, fludrocortisone acetate A corticosteroid selected from the group consisting of: deoxycorticosterone acetate (DOCA), fluprednisolone, fluticasone propionate, budesonide, beclomethasone dipropionate, flunisolide and triamcinolone acetonide. Preferably, the second therapeutic agent is a proteolytic enzyme, an inflammatory mediator, or an agent that reduces inflammatory cytokines such as TNF-α and / or interleukin-1 (IL-1). Preferably, the second therapeutic agent is DMARD or DMD, and optionally further, the second therapeutic agent is methotrexate (Rheumatrex ™, Trexall ™), hydroxychloroquine (Plaquenil ™), sulfasalazine (Azulfidine) ), Leflunomide (Arava ™), tumor necrosis inhibitors (eg, etanercept (Enbrel ™, adalimumab (Humira ™), and infliximab (Remicade ™)), T cell costimulation An inhibitor (eg, abatacept (Orencia ™), a B cell depleting agent (eg, rituximab (Rituxan ™)), an interleukin-4 (IL-4) antagonist therapeutic agent (eg, an anti-IL4 antibody or anti-I 4 receptor antibody), interleukin-5 (IL-5) antagonist therapy (eg anti-IL5 antibody or anti-IL5 receptor antibody), interleukin-6 (IL-6) antagonist therapeutic (eg anti-IL6 antibody) Or anti-IL6 receptor antibody), interleukin-1 (IL-1) receptor antagonist treatment (anakinra (Kineret ™)), anti-BlyS antibody (Benlysta ™), intramuscular gold, Or another immunomodulatory or cytotoxic agent (eg, azathioprine (Imuran ™), cyclophosphamide, or cyclosporin A (Neoral ™, Sandimmune ™) In one embodiment, the respiratory tract. When treating disease, the second therapeutic agent is PDE-4 inhibition It is.

  In certain embodiments, the anti-TLR3 antibody is administered prior to administration of the second therapeutic agent. For example, the anti-TLR3 antibody can be administered about 0-30 days prior to administration of the second therapeutic agent. In certain embodiments, the anti-TLR3 antibody is about 30 minutes to about 2 weeks, about 30 minutes to about 1 week, about 1 hour to about 2 hours, about 2 hours to about 4 hours, about 2 minutes to about 2 hours after administration of the second therapeutic agent. Administer 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to 1 day, or about 1 day to 5 days later. In certain embodiments, the anti-TLR3 antibody is administered concurrently with the administration of the second therapeutic agent. In certain embodiments, the anti-TLR3 antibody is administered after administration of the second therapeutic agent. For example, the anti-TLR3 antibody can be administered about 0-30 days after administration of the second therapeutic agent. In certain embodiments, the anti-TLR3 antibody is about 30 minutes to about 2 weeks, about 30 minutes to about 1 week, about 1 hour to about 2 hours, about 2 hours to about 4 hours, about 2 minutes to about 2 hours after administration of the second therapeutic agent. Administer 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to 1 day, or about 1 day to 5 days later.

  A composition for administration to a patient is formulated for use in administration to the patient. The compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implantable reservoir. As used in the present invention, there are subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion methods.

  This antibody can be housed in a kit. The kit further optionally includes any number of antibodies and / or other compounds, eg, 1, 2, 3, 4, or any other number of therapeutic antibodies and / or compounds (eg, a second therapeutic agent). But you can. It will be understood that the description of the contents of the kit is not limiting in any way. For example, the kit may include other types of therapeutic compounds. Preferably, the kit also includes instructions for using the antibody, eg, elaborating the methods described herein.

  Other aspects and advantages of the present invention are disclosed in the Examples section that follows, which should be considered exemplary and should not be considered as limiting the scope of the present application.

Materials and Methods Materials 293T human fetal kidney cells (# CRL-1573) were purchased from ATCC. Antibody (antigen, supplier, see): AP-conjugated F (ab ′) ₂ fragment goat anti-mouse IgG (H + L), Jackson Immunoresearch, ref. 115-056-003, PE-conjugated goat anti-mouse IgG Fc, Beckman Coulter, IM0551 Instrumentation: FACSCanto II® flow cytometer (BD Biosciences). TLR3 ligand (name, supplier, see): poly (IC) HMW, InvivoGen, ref. tlrl-pic. PolyAU, also called IPH3102, is an at least partly double-stranded molecule composed of polyadenylic acid and polyuridylic acid, which is prepared as described in WO2009 / 130616 (Innate Pharma), The disclosure of which is incorporated herein by reference. polyAU exceeds the 2000kD _{M n} (also referred to as the "number average molecular weight" or "average molecular weight"), PI of 1.4 to 1.6, and the thermal stability: 62.3-63.2 ° C., 53 to 60 % High molecular weight polyAU having a high coloring property. Antibody 31C3 is described in PCT application: WO 2011/004028, the disclosure of which is incorporated herein by reference.

Surface plasmon resonance (SPR)
General Biacore T100 procedure. SPR measurements were performed on a Biacore T100 instrument (Biacore GE Healthcare) at 25 ° C. In all Biacore experiments, sensorgrams were analyzed using HBS-EP + or HBS-P buffer (Biacore GE Healthcare) as the running buffer and Biavaluation 4.1 and Biacore T100 Evaluation software.

  For bivalent affinity measurement, TLR3-His protein was immobilized on Sensor Chip CM5 (carboxymethylated dextran layer) by an amine coupling method unless otherwise specified. Anti-TLR3 antibody was run at a series of concentrations (0.01 for the affinity in running buffer HBS-EP + (for affinity at neutral pH) or 10 mM acetic acid pH 5.6, 150 mM NaCl (for affinity at acidic pH). Diluted to 100 nM), injected against the immobilized antigen for 2 minutes at a flow rate of 40 μl / min, dissociated for 3 minutes, and then regenerated by 5-30 seconds injection of 0.5 M NaCl, 10 mM NaOH buffer. The obtained sensorgram was analyzed by global fitting using an appropriate model.

Luciferase reporter assay A reporter gene assay was planned using ISRE (IFN stimulation response element) as the promoter and luciferase as the reporter gene and protein. A293T cell line (ATCC, # CRL-1573) is stably transfected with the plSRE-luc plasmid (# 219089-Stratagene) and further selected by cloning to induce an optimal response corresponding to IFN-α stimulation This is referred to as control 293T-ISRE. The cell line was further stably transfected with pUNO-human TLR3 plasmid (# puno-htmlr3-InVivogen), which was designated 293T-TLR3-ISRE.

  Potency assays were performed as described: On day 0, cells were seeded at 4 × 10 5 cells / mL in complete medium in 96-well culture plates (100 μl / well). Cells were first incubated at 37 ° C. for 20 hours, after which 50 μL of media was discarded and activated with a final 25 μl / well quantitative polyAU while increasing the concentration of anti-TLR3 antibody. Cells incubated with fresh medium are used as background luciferase activity (50 μl / well). Cells are incubated for 6 hours at 37 ° C. 100 μL of freshly thawed Steady Glo (Promega) is added to each well, the plate is incubated in the dark at room temperature (RT) for 10 minutes, and then the light emitted in each well is counted as a count per second (CPS) γ counter Quantified with a (TopCount) instrument.

Generation of mutant TLR3 constructs K145E, D116R, K182E, N196A and E171A Generation of TLR3 mutants K145E, D116R, K182E, N196A and E171A using Stratagene's QuikChange (R) Site-Dirt Performed according to manufacturer's instructions. The oligonucleotides used are listed in Table 4A. Mutagenesis was performed on wild type human TLR3 inserted into pcDNA3.1 vector. After sequencing, the vector containing the mutated sequence was prepared as a Maxiprep using Promega PureYield ™ Plasmid Maxiprep System. The vector was then used for HEK-293T cell transfection using Invitrogen's Lipofectamine 2000 according to the manufacturer's instructions.

Construction of N-terminal mutant TLR3 constructs 1-19 Construction of TLR3 mutant (V5-TLR3-CD32 construct) was performed by PCR (see Table 4B below). All Mx-R primers were used with the following 5 ′ primer: ACCCAAGCTGGCTAGCATGAGACAGAACTTTGCCTTG (SEQ ID NO: 121). All Mx-F primers were used in conjunction with the following 3 ′ primer: AGCACAGTGGGCGCCCGCTTAGTTATTACTGTTGACATGG (SEQ ID NO: 122). The amplified sequence was run on an agarose gel and then purified using a Qiagen Gel Extraction kit. The two PCR products generated for each mutant were then ligated into the pcDNA3.1 vector digested with the restriction enzymes NheI and NotI using the InFusion system (Clontech) according to the manufacturer's instructions.

  After sequencing, the vector containing the mutated sequence was prepared as a Maxiprep using Promega PureYield ™ Plasmid Maxiprep System. The vector was then used for HEK-293T cell transfection using Invitrogen's Lipofectamine 2000 according to the manufacturer's instructions.

Preparation of TLR3 cell surface structures De Boutiller et al. (2005) J. Org. Biol. Chem. 280 (46): 38133-38145, the mature wild type or mutant TLR3 sequence was fused with the CD32 transmembrane and intracellular domains. A first round of PCR is performed to introduce a V5 tag at the N-terminal position of the TLR3-CD32 fusion protein, and then a second round is performed (using the first PCR as a template) in the TLR3 in the construct. A leader peptide was introduced. The primers used for these steps are summarized in the following table (Table 5). The PCR product was TA cloned into the pGEMTeasy vector for sequencing, and finally cloned into the pcDNA3.1 vector using NheI and NotI restriction sites.

Titration to cells expressing TLR3 + on the surface HEK293T cell line was transiently transfected with wild type or mutant TLR3 ECD-CD32 constructs using Lipofectamine 2000, followed by 4 with a specific dose range of 11E1 or 31C3. Stained at 30 ° C. for 30 minutes. Bound mAb was revealed by the addition of PE-conjugated goat anti-mouse IgG Fc antibody for an additional 20 minutes at 4 ° C. After two wash cycles, cellular MFI was analyzed on a FACS Canto II cytometer. To test the effect of pH on mAb affinity, staining buffer (0.2% BSA, 2 mM EDTA, 0.02% sodium azide pH 7.4 or citrate-acidified staining buffer pH 5.6). Staining was performed in.

Example 1 Generation of TLR3-specific Monoclonal Mouse and Rat Anti-Human Antibodies A series of immunizations were performed to generate various antibodies that block human TLR3 with improved potency compared to conventional antibodies. The primary and secondary screens were as follows:

Immunity # 1
Primary screen. To obtain anti-human TLR3 antibodies, Balb / c mice (3 mice) were immunized with recombinant human His-tagged TLR3 extracellular domain recombinant protein (R & D systems, # 1487-TR-050). Mice were immunized and splenocytes were fused and then cultured in the presence of irradiated splenocytes. Mice received one primary immunization with an emulsion of 50 μg TLR3 protein and complete Freund's adjuvant by intraperitoneal route and one secondary immunization with an emulsion of 50 μg TLR3 protein and incomplete Freund's adjuvant by intraperitoneal route. And was boosted by 10 μg TLR3 protein by intravenous route. Hybridomas were plated on culture plates and supernatants (SN) were evaluated on the primary screen for TLR3 binding using an ELISA developed for detection of binding to TLR3. Briefly, His-tagged recombinant TLR3 protein (R & D systems, # 1487-TR) was coated on Maxsorb® ELISA plates (Nunc). The supernatant from the hybridoma culture plate is collected and incubated on ELISA in the presence of anti-TLR3 antibody that inhibits TLR3 and binds within the C-terminal portion, followed by AP-conjugated F (ab ′) ₂ fragment goat anti-mouse IgG ( H + L) was used to reveal the presence of TLR3-bound Ig. 358 of 3840 hybridomas were selected for secondary screens.

  Secondary screen; selection of target hybridoma. Retains 358 supernatant and does not lose binding to mutant TLR3 at amino acid position 116 by testing with a further screen by FACS staining with D116R mutant TLR3 that transiently expresses the 293T cell line Identify antibodies. Of 358, 151 hybridomas did not lose binding to D116R. The antagonist activity of the hybridoma was also tested in an ISRE-luciferase gene reporter assay on 293T-huTLR3 cells. Wells from supernatants with an inhibitory effect of more than 60% were selected for further cloning. Twenty-eight hybridomas had antagonist activity and 25 clones had both antagonist activity and binding to D116R.

  Cloning of potential hybridomas of interest. Potentially interesting hybridomas from the initial screen were cloned by limiting dilution in 96-well plates and clones were tested in the same secondary screen series as the hybridomas. 13 hybridoma derived clones had both antagonist activity and binding to D116R.

  In order to compare these 13 hybridomas with our standard anti-TLR3 mAb (especially 31C3), 13 hybridomas were amplified and the supernatant was purified. The purified mAb was tested in a gene-reporter assay. Hybridomas were selected for further characterization based on their ability to block TLR3 signaling compared to a standard anti-TLR3 mAb.

  Two hybridomas were further evaluated for epitope binding with mutants TLR3 K145E and K182E (see also Example 6). None of the antibodies showed any loss of binding of TLR3 to the K145E mutant, one of which showed loss of binding to the mutant K182E. Clone 11E1 bound to TLR3 even in the presence of mutations K145E or K182E.

Immunity # 2
LOU / c rats were immunized with recombinant His-tagged human TLR3, a carrier-free extracellular domain recombinant protein (R & D systems, # 1487-TR). Rats received a single primary immunization with an emulsion of 50 μg human TLR3 protein diluted in PBS and complete Freund's adjuvant on day 0 by the intraperitoneal route and on day 14 PBS and incomplete by the intraperitoneal route. A second immunization was received with an emulsion of 50 μg human TLR3 protein diluted in Freund's adjuvant, followed by a booster immunization with 25 μg human TLR3 protein diluted in PBS by the intravenous route. Immune splenocytes were X63. After fusing with Ag8.653 immortalized B cells, the cells were cultured in the presence of irradiated splenocytes.

  Secondary screening was performed as for immunization # 1 above. Potentially interesting hybridomas were cloned by limiting dilution in 96 well plates and clones were tested in the same secondary screen series as the hybridomas. In order to compare the hybridomas with our standard anti-TLR3 mAb, these hybridomas were amplified and the supernatant purified. The purified mAb was tested in a gene-reporter assay. Hybridomas were selected for further characterization based on their ability to block TLR3 signaling compared to the standard anti-TLR3 mAb 31C3. Hybridomas were further evaluated for epitope binding with mutant TLR3 polypeptides with K145E and K182E. Clones 7G11, 31F6, 32C4 and 37B7 bound to TLR3 even in the presence of mutations K145E or K182E.

Example 2-Production of TLR3-specific monoclonal rat anti-mouse antibodies Primary screen. In order to obtain anti-TLR3 antibodies, LOU / c rats were transformed into recombinant His-tagged mouse TLR3, carrier-free extracellular domain recombinant protein (R & D systems, # 3005-TR) and recombinant His-tagged human TLR3, carrier-free. Immunization with extracellular domain recombinant protein (R & D systems, # 1487-TR). Rats received a single primary immunization with an emulsion of 50 μg mouse TLR3 + 50 μg human TLR3 diluted in PBS and complete Freund's adjuvant on day 0 by the intraperitoneal route, and on day 14 by PBS and Received one secondary immunization with an emulsion of 50 μg mouse TLR3 + 50 μg human TLR3 protein diluted in incomplete Freund's adjuvant and further boosted intravenously with 25 μg mouse TLR3 + 25 μg human TLR3 diluted in PBS intravenously . Immune splenocytes were X63. After fusing with Ag8.653 immortalized B cells, the cells were cultured in the presence of irradiated splenocytes.

  Forty culture plates were obtained and evaluated on the primary screen for mouse TLR3 binding using an ELISA developed for detection of binding to TLR3. Briefly, His-tagged recombinant mouse TLR3 protein (R & D systems, # 1487-TR-050) was coated on Ni-NTA96-well plates (Qiagen). Supernatant (SN) from the hybridoma culture plate was collected and incubated in TLR3-plate, and then the presence of TLR3-binding Ig was revealed using goat anti-mouse F (ab) IgG-HRP.

  Secondary screen: Selection of target hybridoma. The 181 supernatant was retained and tested in a further screen in an inhibition test on 293T-mTLR3 cells. Wells from supernatants with an inhibitory effect greater than 95% were selected for further cloning by limiting dilution.

  Cloning of potential hybridomas of interest. Twenty-seven potentially interesting hybridomas selected from the initial screen were cloned by limiting dilution in 96 well plates and 370 subclones were screened for mouse TLR3 binding using ELISA as before. 178 positive clones were tested in a further screen in an inhibition test on 293T-mTLR3 cells as described above. Of these, the supernatant from the well G7 from the plate 28 (28G7).

Example 3 Binding to Cell Surface TLR3 To examine the possibility that TLR3 is circulated to the cell surface and that cell surface TLR3 contributes to the internalization and efficacy of inhibitory anti-TLR3 antibodies, compared to standard antibody 31C3 Binding to cell surface TLR3 was tested. Furthermore, binding (eg, affinity) to cell surface TLR3 at neutral pH is thought to be different from that of endosomally expressed TLR3 at acidic pH. Since pH may affect the conformation of TLR3, antibody binding to cells expressing human TLR3 only on the cell surface (TLR3 / CD32-expressing 293T cells) under neutral pH conditions Was tested. The results for neutral pH are shown in FIGS. 1A, 1B, 1C and 1D for antibodies 11E1, 7G11, 32C4 and 31F6, respectively. EC50 values are shown in Table 6. Antibodies 11E1, 7G11, 31F6, and 32C4 each had strong binding to surface expressed human TLR3 at neutral pH. The affinity of the antibody for TLR3 was stronger than standard antibody 31C3 at neutral pH.

Example 4-Endosome and bivalent affinity at neutral pH The method described for SPR, clause c) was used to determine the binding properties of antibody 11E1. Neutral (pH 7.2) and binding of TLR3 in an acidic (pH 5.6) conditions, and were calculated _{K D} values. At neutral pH, 11E1 showed a strong bivalent affinity (K _D ) for recombinant human TLR3 (mean K _D (M) at pH 7.2: 8.75 ^* 10 ⁻¹¹ ). Since the average K _D (M) at pH 5.6 was 1 ^* 10 ⁻⁹ , the binding affinity at pH 5.6 was somewhat lower than the affinity at pH 7.2 for antibody 11E1.

Similarly, binding to mouse TLR3 anti-mouse TLR3 antibody determined in neutral (pH 7.2) and acidic (pH 5.6) conditions were calculated _{K D} values. At neutral and acidic pH, mAbs 32D4, 28G7 and 13D1 all showed a strong and similar bivalent affinity (K _D ) for recombinant mouse TLR3, better than 500 picomolar. The affinity of mAb28G7 (average of 2 or 3 experiments) is 7.05 ^* 10 ⁻¹³ at neutral pH (average K _D (M) at pH 7.2) and acidic pH (at pH 5.6). mean _K D (M)) was in 1.26 ^* 10 ^-13.

Example 5 Human Reporter Assay Antibodies were tested for inhibition of TLR3 signaling in reporter gene activity (293T-TLR3-ISRE) using luciferase. Binding of the TLR3 receptor with a TLR3-agonist such as poly (I: C) has been reported to activate the type IFN pathway including the promoter ISRE (Wietek et al. J. Biol. Chem.,). 278 (51), P50923, 2003). Briefly, TLR3 signaling was evaluated after inducing TLR3 signaling in a reporter assay in the presence of anti-TLR3 antibody by using a dsRNA TLR3 agonist. Antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 were all more potent than antibody 31C3 in this assay. The results are shown in FIGS. 2A, 2B, 2C, 2D and 2E for antibodies 11E1, 7G11, 32C4, 31F6 and 37B7, respectively, which are dose dependent of TLR3 signaling using a 293T human TLR3 luciferase assay with human anti-TLR3 antibody Inhibition. Each antibody is compared to standard antibody 31C3.

  Similarly, rat anti-mouse TLR3 antibodies were equally evaluated in separate studies for their ability to inhibit TLR3 signaling in reporter gene activity using mouse TLR3 luciferase (293T-mTLR3-ISRE). Antibody 28G7 showed a dose-dependent inhibition of TLR3 signaling with an IC50 of 2.6 μg / ml.

Example 6-Epitope mapping Epitope mapping at neutral pH. Competition assays were performed by FACS assay on HEK293T-WT TLR3 ECD / CD32 cells. Antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 competed with previously obtained antibody 31C3 for binding to TLR3 because binding by one antibody impaired binding of another antibody to TLR3. Antibody 31C3 binds at least in part to a region of TLR3 corresponding to residues 102-204 (particularly residues 174-191 and residue 182) of the mature TLR3 polypeptide and competes with each other for binding to human TLR3. Antibodies 11E1, 7G11, 31F6, 32C4, and 37B7 each competed with 31C3, but the degree of competition varied, and the epitopes of 11E1, 7G11, 31F6, 32C4, and 37B7 are in the same region but differ from each other Is suggested. Antibody 11E1 competed with each of antibodies 7G11, 31F6, 32C4 and 37B7. Based on the competitive profile of antibody 11E1, 7G11, 31F6, 32C4 and 37B7 and antibody 31C3, at least 11E1, 37B7 was different from each other and was also likely to be different from 7G11, 31F6, 32C4, so at least 3 different epitopes Bins were determined.

Example 7-Epitope mapping by binding to TLR3 mutant Antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 compete with 31C3 for binding to TLR3. 31C3 has been found to bind within the N-terminus of human TLR3, which has the major epitope of an antibody that includes residue 182 but does not include residues K145, D116, K182, E171, or N196. . Therefore, antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 were tested for binding to TLR3 mutants. A TLR3 mutant polypeptide (based on SEQ ID NO: 1) having mutations K145E, D116R, K182E, N196A and E171A was prepared as described in the Materials and Methods section, and the TLR3 mutant polypeptide was prepared. Anti-TLR3 antibody staining for expressing cells was evaluated by FACS. Antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 showed no loss of binding to non-mutated wild type (WT) TLR3 or to any of K145E, D116R, E171A, K182E or N196A. Therefore, the major epitopes of antibodies 11E1, 7G11, 31F6, 32C4 and 37B7 do not include residues K145, D116, K182, E171 or N196 when located in the N-terminal region.

  The antibodies were then tested for binding to another set of mutants in the N-terminal part of TLR3 to find new epitopes. Therefore, the antibody was tested for binding to the TLR3 mutant. Positions Q44H and V45I, R64Q and R65Q, T86S and K89Q, K97I and M100L, K117Q and A120V, Q136H, N140S, V144K and K145N, K147A, K163A, Q167G, Q184L and K187R, Q184L and K187Q, 1984 H218Q, A219T, G234N and S236H, L243W and A246S, S112A, Q113S, and S115A, and TLR3 mutant polypeptides with mutations in K137S and K139A (based on SEQ ID NO: 1) Prepared as described in section and evaluated by anti-TLR3 antibody staining for cells expressing TLR3 mutant polypeptide by FACS It was. Antibody 11E1 showed binding to mutants with substitutions R64Q and R65Q, and to a lesser extent, possibly loss of binding to adjacent mutants T86S and K89Q. Antibodies 7G11, 31F6, 32C4 and 37B7 showed loss of binding to mutants with substitutions K117Q and A120V, but not for the other mutants. Antibodies 11E1 and 37B7 showed complete loss of binding to mutants with substitutions K137S and K139A, whereas antibodies 7G11, 31F6 and 32C4 showed partial binding to mutants with substitutions K137S and K139A. Showed loss. Furthermore, all 7G11, 31F6, 32C4 and 37B7 antibodies showed a complete loss of binding to mutants with substitutions S112, Q113 and S115. Antibodies 11E1 and 31C3 showed no loss of binding to mutants with substitutions S112, Q113 and S115. Thus, the major epitope of antibody 11E1 includes residues R64 and R65, and possibly (to a lesser extent) adjacent residues T86 and K89, and residues K137 and K139. Thus, the major epitopes of antibodies 7G11, 31F6, 32C4 and 37B7 include residues K117 and / or A120 and S112, Q113 and / or S115. In addition, in the case of antibody 37B7, the major epitope further comprises residues K137 and / or K139, and in the case of antibodies 7G11, 31F6 and 32C4, residues K137 and K139 may also be present within the epitope. In particular, residues R64Q and R65Q are in the N-terminal dsRNA binding region on the glycan-free outer surface of TLR3, and residues K117 and A120 are partial on the backbone of the TLR3 molecule, but are N-terminal dsRNA. Adjacent to the bond area. Surface exposed residues adjacent to these mutated residues are also thought to contribute to the epitope of the antibody, such as residues located on the surface of TLR3 in the region of the N-terminal dsRNA binding region, for example. 41, 43, 60, 61, 62, 64, 65, 67, 68, 88, 91, 92, 93, 96, 97, 108, 110, 112, 113, 114, 115, 121, 132, 134, 137 and / Or 139 (based on SEQ ID NO: 1). The antibody can thus compete with dsRNA binding to TLR3. The antibody may bind within and / or adjacent to the N-terminal dsRNA binding site, which optionally further comprises residues extending over the backbone of the TLR3 protein.

  Figures 2F, 2G, and 2H show N-terminal views of TLR3 polypeptides, which are mutated amino acid residues (Q44, V45, R64, R65, T86, K89, K97, M100, shown in black). K117, A120, Q136, N140, V144, K145, K147, K163, Q167, Q184, K187, Q184, K187, D192, A195, Q208, I209, H218, A219, G234 and S236, L243, and A246) . Also, in gray, residues adjacent to residues 86, 89, 117 and 120 (residues 41, 43, 60, 61, 62, 67, 68, 88, 91, 92, 93, 96, 108, 110, 110, 112, 113, 114, 115, 121, 132, 134, 137 and 139) are also shown; such adjacent residues may also be bound to the indicated antibodies. FIG. 2F shows a view of the glycan-free lateral surface of TLR3; FIG. 2G shows a view of the TLR3 polypeptide and backbone glycan-free lateral surface, with the N-terminus of the TLR3 polypeptide in the foreground (left side of the figure). FIG. 2H shows a view of the TLR3 polypeptide and backbone glycan-free outer surface with the N-terminus of the TLR3 polypeptide in the foreground (right side of the figure).

Example 8-In Vivo Efficacy Model for Treatment of RA Prevention Setting Briefly, 20 mice were emulsified in CFA supplemented with Mycobacter tuberculosis (2 mg / ml) on day 0. Immunization was performed by intradermal (ID) injection of 100 μg of collagen into the base of the tail. On day 17, mice were scored (clinical signs often appear before boost) and randomized into two groups of 8 or 9 mice depending on the sum of the 4 limb clinical scores And then treated. On day 21, collagen immunity was added by ID administration of collagen alone (100 μg in 50 μl).

The following groups were organized:
-Group 1 (PBS, n = 9): treated with two 200 [mu] l / week IP-Group 2 (28G7, n = 8): treated with two 500 [mu] g / week IP

  Mouse limb scoring was evaluated 3 times a week for 3-4 weeks. Scoring was evaluated according to Table 7.

The results are shown in FIG. 3A. This experiment shows that anti-TLR3 antibody is statistically effective in the healing treatment of rheumatoid arthritis (RA) compared to PBS ( ^* p> 0.05, ^* p in Dunnett's test) > 0.005) clearly.

Example 9-In vivo efficacy model experiment # 1: 28G7, PBS, MTX for treatment of RA healing setting
Briefly, 30 mice were injected intradermally (ID) into the base of the tail with 100 μg collagen emulsified in CFA supplemented with Mycobacterium tuberculosis (2 mg / ml) on day 0. I was immunized. Twenty-one days later, collagen immunity was added by ID administration of collagen alone (50 μl / 100 μg in mouse). On day 24, treatment was initiated after the mice were randomized into 3 groups of 10 mice according to the total of the 4 limb clinical scores.

-Group 1 (PBS, n = 10): treated with two 200 [mu] l / week IP-Group 2 (methotrexate-MTX, n = 10): treated with two 2.5 mg / week IP-Group 3 (28G7, n = 10): 500 μg / mouse treated twice / week IP

  Mouse limb scoring was evaluated 3 times a week for 3-4 weeks. Scoring was evaluated according to Table 7.

The results are shown in FIG. 3B. This experiment shows that anti-TLR3 antibodies are statistically effective in treating established rheumatoid arthritis (RA) compared to PBS and methotrexate ( ^* p> 0.05 with Dunnett's test). ) Clearly shows that. Since MTS has a different mechanism of action from anti-TLR3 antibodies, the combination of two drugs can be beneficial.

Experiment # 2: 28G7, PBS, anti-TNFα Humira ™
Briefly, 35 mice were injected intradermally (ID) into the base of the tail with 100 μg collagen emulsified in CFA supplemented with Mycobacterium tuberculosis (2 mg / ml) on day 0. I was immunized. Twenty-one days later, collagen immunity was added by ID administration of collagen alone (50 μl / 100 μg in mouse). On day 24, treatment was initiated after mice were randomized into 4 groups according to the total clinical score of the 4 limbs.

Group 1 (PBS, n = 9): treated with 200 μl twice / week IP Group 2 (control Ig antibody, n = 9): treated with 500 μl twice / week IP Group 3 (28G7, n = 9): 500 μg / mouse treated twice / week IP—Group 4 (Humira ™, n = 6): 100 μl treated twice / week IP

  Mouse limb scoring was evaluated 3 times a week for 3-4 weeks. Scoring was evaluated according to Table 7.

  The results are shown in FIG. 3C. This experiment clearly shows that anti-TLR3 antibodies are effective in treating established rheumatoid arthritis (RA) compared to PBS and anti-TNFα antibody Humira ™. Since anti-TNFα has a different mechanism of action from anti-TLR3 antibodies, the combination of two drugs can be beneficial.

Example 10-In vivo efficacy model for the treatment of colitis Four groups of 10 male mice (Balb / c) were used for the model of TNBS-induced colitis and another group of 8 controls (dose) None, intracolonic infusion of saline).

Treatment groups were divided as follows:
Group 1: 10 animals received antibody 28G7 (ip, 500 μg / mouse).
-Group 2: 10 received non-TLR3-related antibody (ip, 500 μg / mouse).
-Group 3: 10 animals received rat anti-mouse TNF antibody (ip, 15 mg / kg, Humira ™).
Group 4: 10 animals received PBS (ip, 200 μg / mouse).

  One hour after injection, male Balb / c mice (5-6 weeks of age) were given an intracolonic instillation of 2,4,6-trinitrobenzene-sulfonic acid (TNBS) (2 mg / mouse in 40% ethanol in TNBS). Induced colitis. In Groups 1, 2 and 3, another injection of either 28G7 or non-TLR3-related antibody or anti-TNF antibody was performed 72 hours after the first antibody injection.

  For all groups, several parameters of disease progression were evaluated daily: body weight, presence of blood in feces, presence and severity of diarrhea. Seven days after induction of colitis, all mice were killed for tissue recovery. Macroscopic damage scores, wall thickness and myeloperoxidase activity (index of granulocyte infiltration) were measured in colon tissue. Visual damage score is assessed by obtaining bloody stool, diarrhea, bleeding, adhesions, mucus, erythema, edema, ulcers and stenosis.

  FIG. 4 shows the results of the experiment. FIG. 4A shows mice treated with saline (black circles), TNBS only (black squares), anti-TNFα antibody and TNBS (black triangles), 28G7 and TNBS (white circles), and control Ab and TNBS (white squares). The measured thickness is shown. FIG. 4B shows mice treated with saline (black circles), TNBS alone (black squares), anti-TNFα antibody and TNBS (black triangles), 28G7 and TNBS (white circles), and control Ab and TNBS (white squares). The damage score with the naked eye is shown.

Example 11-In vivo efficacy model for the treatment of COPD (chronic obstructive pulmonary disease) Single Agent Test Three groups of 10 male mice are as follows:
-One group of 10 animals in the vehicle;
-On day 0, 3, 7, 10, 14, 17, 21 and 24, one group of 10 animals was given anti-mouse TLR3 28G7 antibody (ip, 500 μg / mouse);
-A group of 10 animals was treated with the positive control roflumilast (approved as Daxas ™; antagonist of PDE-4) (oral, 15 mg / kg, 5 times a week).

  On days 0, 7, 14, and 21, all mice were treated with elastin and LPS (in) to induce COPD. On day 28, mice were killed for analysis.

On day 28, cellular infiltrate into the airways was measured by analysis of bronchoalveolar lavage (BAL) fluid with differential cell counts. On day 28, venous blood oxidation was measured by gas quantification. The level of inflammatory mediators in BALF by analysis of protein levels of TNF-α, IL-6, IL-17A and IP-10 was performed by multiplex assay. The results are shown in FIG. These figures show that anti-TLR3 antibodies are very effective in the treatment of COPD such as neutrophil airway infiltration, venous oxygen saturation and reduction of inflammatory cytokines. Statistical analysis is performed on all data using Student's test: ^(*) p <0.05, ^(**) p <0.005, ^(***) p <0.0005) did.

  FIG. 5A shows BAL cell fractions for macrophages, eosinophils, neutrophils and lymphocytes. Anti-TLR3 antibody strongly reduced neutrophil infiltration into the respiratory tract, but did not substantially affect macrophages, eosinophils or lymphocytes. COPD is primarily mediated by neutrophils, not macrophages or eosinophils (and not the lymphocytes used here as controls).

FIG. 5B shows venous blood saturation oxygen (%) for LPS / elastase alone and LPS / elastase, respectively, in combination with anti-TLR3 antibody or roflumilast. Arterial oxygen saturation (%) decreases in COPD patients compared to healthy individuals, whereas oxygen venous saturation increases in COPD patients compared to healthy individuals. Therefore, reduction in venous blood _{O 2} (%) is an important indicator of favorable response in disease treatment (O'Connor et al.Respiration 2011; 81: see 18-25). It can be seen that the anti-TLR3 antibody reduced venous blood O ₂ to about the same extent as roflumilast. Accordingly, anti-TLR3 antibodies are effective in treating COPD. In actual medicine, arterial blood gas (ABG) analysis is used both in the acute phase and for the purpose of assessing the patient's gas exchange status during clinical stability. Thus, blood gas analysis, such as ABG analysis, assesses whether a patient is suitable for treatment with anti-TLR3 antibodies and assesses whether treatment with anti-TLR3 antibodies is effective during the acute or clinically stable period. Can be a particularly useful means.

  FIG. 5C shows IL17A in BAL fluid (BALF). Anti-TLR3 antibody substantially reduced IL17A (pg / ml) and was comparable to roflumilast. FIG. 5D shows IP-10 in BALF. Anti-TLR3 antibody substantially reduced IP-10 (pg / ml).

B. Drug combination study Four groups of mice are as follows:
-1 group of mice with vehicle (PBS, ip, twice weekly);
-1 group of mice treated with anti-mouse TLR3 28G7 antibody (ip, 500 μg / mouse, twice a week);
-1 group of mice with a positive control roflumilast (approved as Daxas ™; antagonist of PDE-4) (3 mg / kg po, 5 times per week);
-1 group of mice with both roflumilast and 28G7 antibody (each drug follows the schedule used as a single agent)
Treated.

  As in Test A, all mice were treated with elastin and LPS (in) to induce COPD.

  As in Test A, cell infiltrate into the airways was measured by analysis of bronchoalveolar lavage (BAL) fluid by differential cell counts.

  FIG. 5E shows BAL cell fractions for macrophages, neutrophils and lymphocytes. Anti-TLR3 antibody strongly reduced neutrophil infiltration into the respiratory tract, and a reduction in macrophages and lymphocytes was also observed. COPD is primarily mediated by neutrophils, not macrophages or eosinophils (and not the lymphocytes used here as controls). Roflumilast also resulted in a reduction in neutrophil infiltration into the respiratory tract along with a reduction in macrophages. Interestingly, the combination of anti-TLR3 antibody and roflumilast substantially reduced the infiltration of neutrophils into the airways to the level seen in wild-type mice, much more than what was observed with each of them alone. Resulting in over-reduction.

Example 12-Sepsis-Cecal Ligation and Puncture (CLP)-In Vivo Efficacy Model for Treatment of Healing Settings Briefly, 30 mice were operated on: the operation consisted of cecal ligation and puncture. In this way, the contents of the cecal lumen are drained from the abdominal cavity, leading to peritonitis, resulting in septic shock. CLP is moderate, eg, ligation is performed in the middle of the cecum.

  Mice were treated with 28G7 (100 μg / mouse, ip), control antibody without TLR3 specificity (“control”, 100 μg / mouse, ip) or PBS (300 μl / mouse, ip) at 6 and 24 hours after surgery. . 24, 28, 32, 48, 52, 56, 72, 76, 80, 96, 100, 104, 120, 124, 128, 144, 148, 152, 168, 172, 176, 192, 196, 200, 216, Survival was assessed after 220, 224, 240, 244, 248, 264, 270, 274, 288, 292, 296, 312, 316, 320 and 336 hours. After 336 hours, surviving mice cleared acute phase infection. The experiment was stopped and the mice were killed.

  FIG. 6 shows the results of the experiment. The group treated with 28G7 has 80% survival, while the untreated group exhibits 40% survival. These results demonstrate that TLR3 antibody is effective in treating mice in the CLP mouse model. In this acute model, mice exhibit an acute infection that mimics septic shock. In surviving mice, acute infection was effectively eliminated. Accordingly, anti-TLR3 antibodies are suitable agents for treating patients suffering from severe acute infections such as SIRS, sepsis, severe sepsis or septic shock.

Example 13-IP-10 production of IN VITRO by donor PBMCS in response to DSRNA and drug combination IP-10 production was evaluated in human donors in response to pIC. Fresh PBMCs were isolated from donor whole blood to produce 0, 10 or 50 μg / ml anti-human TLR3 mAb and a specific dose range of dexamethasone (0.2, 2 and 20 μg / ml) or Humira® (1 , 0.1, 0.01 μg / ml). After incubating the cells at 37 ° C. for 30 minutes, 30 μg / ml poly (I: C) was added. Cells were incubated for an additional 24 hours at 37 ° C. The supernatant was then collected and IP10 production was quantified by ELISA.

  The results of drug combination with anti-human TLR3 mAb combined with dexamethasone or Humira® are shown in FIGS. 7A and 7B, respectively. Each antibody substantially reduces IP-10 production in response to polyIC and further reduces IP-10 when used in combination with dexamethasone or Humira®. Thus, anti-TLR3 antibodies can provide additional effects when used in combination with dexamethasone or Humira. In particular, in response to polyIC, the antibody enhances the effect of dexamethasone, the standard therapeutic agent in rheumatoid arthritis. Furthermore, anti-TLR3 antibodies were also found to enhance the effects of 0.1 and 1 μg / ml Humira. Anti-TLR3 antibodies can be advantageously used in combination with such agents because they can act by modulating signal pathways complementary to those regulated by dexamethasone or Humira® without antagonism. be able to.

  All headings and subheadings are used herein for convenience only and should not be construed as limiting the invention in any way. Any combination of all possible variations of the above-described elements is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by the content of the text. Detailed description of a numerical range is intended only to serve as a simple way to individually indicate each individual value within that range, unless stated otherwise herein. Each value is incorporated herein as if it were individually described herein. Unless otherwise stated, all exact values given herein are representative of the corresponding approximation (eg any exact value stated for a particular factor or measurement is Can also be considered to provide corresponding approximate measurements that are modified by “about”).

  All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by the content of the text.

  Any examples or exemplary terminology (e.g., "such as") described herein are merely intended to explain the present invention more clearly and, unless stated otherwise, are within the scope of the present invention. It does not impose a limitation. Unless expressly so stated, no language in the specification should be construed as indicating any element as essential to the practice of the invention.

  The citation and incorporation of patent documents herein is done for convenience only and does not represent any view of the validity, patentability and / or enforceability of such patent documents. Descriptions of all aspects or embodiments of the invention using terms such as those associated with an element or elements are specific for the specific element unless otherwise stated herein or otherwise clearly contradicted by the content of the text. Or a plurality of elements “consisting of”, “consisting essentially of”, “substantially comprising” is intended to provide support for similar aspects or embodiments of the invention (eg, certain elements A composition described herein as comprising is also understood to represent a composition composed of its elements, unless otherwise specified herein or otherwise clearly contradicted by the content of the text. Should).

  This invention includes all modifications and equivalents of the subject matter recited in the aspects or claims described herein to the maximum extent permitted by applicable law.

  All publications and patent applications cited herein are hereby incorporated by reference in their entirety as if each individual publication and patent application were specifically and individually described to be incorporated by reference. As incorporated herein.

  Although the invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those skilled in the art will depart from the spirit or scope of the appended claims in light of the teachings of the invention. It will be readily apparent that certain changes and modifications may be made to the present invention without doing so.

Claims (64)

  A monoclonal antibody that inhibits TLR3-mediated signaling in a TLR3-expressing cell, wherein the antibody binds to the glycan-free outer surface of the N-terminal portion of the TLR3 polypeptide.   A TLR3 polypeptide having a mutation at its N-terminal portion in a segment corresponding to residues 41 to 139 of SEQ ID NO: 1 compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1 2. The antibody of claim 1 having reduced binding to.   The antibody of any one of claims 1-2, wherein the antibody binds to the TLR3 polypeptide on the backbone of the TLR3 polypeptide.   The antibody of any one of claims 1-2, wherein the antibody competes with dsRNA for binding to the N-terminal portion of a human TLR3 polypeptide.   A monoclonal antibody that competes with dsRNA for binding to the N-terminal portion of human TLR3 polypeptide.   6. The antibody of any one of claims 1-2 or 4-5, wherein the antibody binds to the N-terminal dsRNA binding site of the TLR3 polypeptide.   7. The antibody of any one of claims 1-6, wherein the antibody does not substantially bind to the glycan-free outer surface of the N-terminal portion of the TLR3 polypeptide. The antibody has an EC ₅₀ of 0.3 μg / ml or less, optionally 0.2 μg / ml or less, optionally 0.1 μg / ml or less, for binding to cells that express human TLR3 only on the cell surface; The antibody according to any one of claims 1 to 7. Wherein the antibody, for binding to TLR3 polypeptides at neutral pH, ^{10 -9} M or less, optionally less than ^{10 -10} M, with a _{K D} of less than arbitrarily ^{10 -11} M, of claims 1 to 8 The antibody according to any one of the above.   Human TLR3 expressed on the surface of cells with neutral affinity, higher affinity under acidic conditions, optionally 0.5 log higher affinity, 1-log higher affinity, 2-log higher affinity 10. The antibody of any one of claims 1-9 that binds to a polypeptide. The antibody is:
A light chain CDR1 (LCDR1) amino acid sequence of SEQ ID NO: 58;
The light chain CDR2 (LCDR2) amino acid sequence of SEQ ID NO: 59;
A light chain CDR3 (LCDR3) amino acid sequence of SEQ ID NO: 60;
The heavy chain CDR1 (HCDR1) amino acid sequence of SEQ ID NO: 61 or 62;
The heavy chain CDR2 (HCDR2) amino acid sequence of SEQ ID NO: 63;
-Comprising the heavy chain CDR3 (HCDR3) amino acid sequence of SEQ ID NO: 64,
The antibody according to any one of claims 1 to 10. A monoclonal antibody that inhibits TLR3-mediated signal transduction in TLR3-expressing cells, wherein the antibody binds to a cell that expresses human TLR3 only on the cell surface and is 0.3 μg / ml or less, optionally 0.2 μg / Monoclonal antibody having an EC ₅₀ of ml or less, optionally 0.1 μg / ml or less.   Compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1, the antibody has residues 64, 65, 86, 89, 112, 113, 115, 117 of the TLR3 polypeptide of SEQ ID NO: 1. 13. The antibody of any one of claims 1-12, having reduced binding to a mutant TLR3 polypeptide having a mutation at 120, 137, and / or 139.   The antibody is a TLR3 polypeptide having a mutation in residue D116 and / or K145 of the TLR3 polypeptide of SEQ ID NO: 1 compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1. 14. An antibody according to any one of claims 1 to 13, which substantially maintains binding (no significant reduction in binding to the polypeptide).   The antibody substantially binds to a TLR3 polypeptide having a mutation at residue K182 of the TLR3 polypeptide of SEQ ID NO: 1 compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1. 15. The antibody of any one of claims 1-14, wherein the antibody is maintained at (no significant reduction in binding to the polypeptide).   The antibody has a TLR3 polymorphism having a mutation in residues K467, R488, and / or R489 of the TLR3 polypeptide of SEQ ID NO: 1 compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1. 16. An antibody according to any one of claims 1 to 15, which maintains binding to the peptide (no significant reduction in binding to the polypeptide). A monoclonal antibody that inhibits signal transduction by a human TLR3 polypeptide, wherein the antibody is in each case compared to the binding between the antibody and the wild-type TLR3 polypeptide of SEQ ID NO: 1,
(A) a TLR3 polypeptide having a mutation at residues 64 and / or 65 of said TLR3 polypeptide of SEQ ID NO: 1;
(B) a TLR3 polypeptide having a mutation at residues 86 and / or 89 of said TLR3 polypeptide of SEQ ID NO: 1;
(C) a TLR3 polypeptide having a mutation at residues 117 and / or 120 of said TLR3 polypeptide of SEQ ID NO: 1;
(D) a TLR3 polypeptide having a mutation at residues 137 and / or 139 of the TLR3 polypeptide of SEQ ID NO: 1;
(E) a monoclonal antibody having reduced binding to a TLR3 polypeptide having a mutation at residues 112, 113 and / or 115 of said TLR3 polypeptide of SEQ ID NO: 1.   A monoclonal antibody that inhibits signaling by a human TLR3 polypeptide, wherein the antibody is (i) a TLR3 polypeptide having a mutation in residues 112, 113 and / or 115 of the TLR3 polypeptide of SEQ ID NO: 1. In contrast, and further having reduced binding to a TLR3 polypeptide having a mutation at residues 137 and / or 139 of the TLR3 polypeptide of SEQ ID NO: 1, and / or (ii) the TLR3 of SEQ ID NO: 1 A monoclonal antibody that binds to an epitope comprising 1, 2, 3, 4 or 5 residues 112, 113, 115, 137 and 139 of a polypeptide.   The antibody is directed against a TLR3 polypeptide having a mutation at residues 112 and / or 113 of the TLR3 polypeptide of SEQ ID NO: 1 and suddenly having a mutation at residue 137 of the TLR3 polypeptide of SEQ ID NO: 1. 19.A mutant TLR3 polypeptide has reduced binding or binds to an epitope comprising one, two or three of residues 112, 113 and 137 of said TLR3 polypeptide of SEQ ID NO: 1. The monoclonal antibody described.   The antibody further has reduced binding to a TLR3 polypeptide having a mutation at residues 117 and / or 120 of the TLR3 polypeptide of SEQ ID NO: 1, or the antibody is the TLR3 of SEQ ID NO: 1 20. Monoclonal antibody according to claim 18 or 19, which binds to an epitope further comprising one or two residues 117 and 120 of the polypeptide.   A monoclonal antibody that inhibits signal transduction by a human TLR3 polypeptide, wherein the antibody comprises (i) a TLR3 polypeptide having a mutation in residues 64 and / or 65 of the TLR3 polypeptide of SEQ ID NO: 1, and a sequence Having reduced binding to a TLR3 polypeptide having a mutation at residues 137 and / or 139 of said TLR3 polypeptide of number 1 and / or (ii) residues of said TLR3 polypeptide of SEQ ID NO: 1 A monoclonal antibody that binds to an epitope comprising 1, 2, 3, 4 or 5 of 64, 65, 137 and 139.   TLR3 wherein the antibody is mutated to a TLR3 polypeptide having a mutation at residues 64 and / or 65 of the TLR3 polypeptide of SEQ ID NO: 1 and to a residue 137 of the TLR3 polypeptide of SEQ ID NO: 1 The polypeptide has reduced binding to a polypeptide or the antibody binds to an epitope further comprising one, two or three of residues 64, 65 and 137 of the TLR3 polypeptide of SEQ ID NO: 1. 21. The monoclonal antibody according to 21. A monoclonal antibody that inhibits signal transduction by a human TLR3 polypeptide, said antibody comprising:
(I) a heavy chain comprising the heavy chain variable region CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequence of SEQ ID NO: 3; and / or (b) a heavy chain variable region CDR1, 2, and SEQ ID NO: 4 3 (LCDR1, LCDR2, LCDR3) a light chain comprising an amino acid sequence, wherein 1, 2, 3, 4 or 5 of said amino acids in any one or more of said CDRs are optionally replaced by different amino acids Good heavy and light chains;
(Ii) a heavy chain comprising the heavy chain variable region CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acid sequence of SEQ ID NO: 14; and / or (b) a heavy chain variable region CDR1, 2 and SEQ ID NO: 15 3 (LCDR1, LCDR2, LCDR3) a light chain comprising an amino acid sequence, wherein 1, 2, 3, 4 or 5 of said amino acids in any one or more of said CDRs are optionally replaced by different amino acids Good heavy and light chains;
(Iii) a heavy chain comprising the heavy chain variable region CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acid sequence of SEQ ID NO: 25; and / or (b) a heavy chain variable region CDR1,2 and SEQ ID NO: 26 3 (LCDR1, LCDR2, LCDR3) a light chain comprising an amino acid sequence, wherein 1, 2, 3, 4 or 5 of said amino acids in any one or more of said CDRs are optionally replaced by different amino acids Good heavy and light chains;
(Iv) the heavy chain comprising the heavy chain variable region CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequence of SEQ ID NO: 36; and / or (b) the CDR1, 2, and 3 of the heavy chain variable region of SEQ ID NO: 37 3 (LCDR1, LCDR2, LCDR3) a light chain comprising an amino acid sequence, wherein 1, 2, 3, 4 or 5 of said amino acids in any one or more of said CDRs are optionally replaced by different amino acids Or (v) a heavy chain comprising the CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequence of the heavy chain variable region of SEQ ID NO: 47; and / or (b) of SEQ ID NO: 48 A light chain comprising the CDR1, 2 and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences of the heavy chain variable region, wherein one or more of said CDRs Monoclonal antibody comprising also be heavy and light chains substituted by 1, 2, 3, 4 or 5 different to any amino of the amino acid that. A monoclonal antibody that specifically binds to a human TLR3 polypeptide and inhibits signal transduction by the human TLR3 polypeptide, said antibody comprising:
(I) the heavy chain CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequences shown in SEQ ID NOs: 5, 6 or 7 (HCDR1), 8 or 9 (HCDR2) and 10 (HCDR3), respectively; and / or ( b) light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 11, 12, and 13, respectively, wherein the amino acids 1, 2, and 2 in any one or more of the sequences An amino acid sequence in which 3, 4 or 5 may be optionally substituted by different amino acids;
(Ii) the heavy chain CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequences shown in SEQ ID NOs: 16, 17 or 18 (HCDR1), 19 or 20 (HCDR2) and 21 (HCDR3), respectively; and / or ( b) the light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 22, 23, and 24, respectively, wherein the amino acids 1, 2, and 2 in any one or more of the sequences An amino acid sequence in which 3, 4 or 5 may be optionally substituted by different amino acids;
(Iii) the heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino acid sequences shown in SEQ ID NOs: 27, 28 or 29 (HCDR1), 30 or 31 (HCDR2) and 32 (HCDR3), respectively; and / or ( b) light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 33, 34, and 35, respectively, wherein the amino acids 1, 2, and 2 in any one or more of the sequences An amino acid sequence in which 3, 4 or 5 may be optionally substituted by different amino acids;
(Iv) the heavy chain CDR1, 2, and 3 (HCDR1, HCDR2, HCDR3) amino acid sequences shown in SEQ ID NOs: 38, 39 or 40 (HCDR1), 41 or 42 (HCDR2) and 43 (HCDR3), respectively; and / or ( b) light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequences shown in SEQ ID NOs: 44, 45, or 46, respectively, wherein one, two, or two of the amino acids in any one or more of the sequences 3, 4 or 5 amino acid sequences optionally substituted with different amino acids; or (v) shown in SEQ ID NOs: 49, 50 or 51 (HCDR1), 52 or 53 (HCDR2) and 54 (HCDR3), respectively Heavy chain CDR1, 2 and 3 (HCDR1, HCDR2, HCDR3) amino And / or (b) the light chain CDR1, 2, and 3 (LCDR1, LCDR2, LCDR3) amino acid sequence shown in SEQ ID NOs: 55, 56, or 57, respectively, wherein the sequence in any one or more of the above sequences A monoclonal antibody comprising an amino acid sequence which may optionally substitute 1, 2, 3, 4 or 5 amino acids with different amino acids.   25. The antibody of any one of claims 1 to 24, wherein the antibody competes for binding of antibody 11E1, 31F6, 32C4, 37B7 or 7G11 to a human TLR3 polypeptide.   A monoclonal antibody that specifically binds to a human TLR3 polypeptide and inhibits signal transduction by the human TLR3 polypeptide, wherein the antibody can bind to a TLR3 polypeptide comprising the sequence of SEQ ID NO: 1, A monoclonal antibody wherein the antibody competes for binding of antibody 11E1, 31F6, 32C4, 37B7 or 7G11 to human TLR3 polypeptide. 27. The antibody of any of claims 1-26, wherein the antibody inhibits signaling by the TLR3 polypeptide and has a Kd of less than ^10-9 M for binding to the TLR3 polypeptide at both neutral and acidic pH. 2. The antibody according to item 1.   28. The signal of any one of claims 1-27, wherein the antibody inhibits signaling by the TLR3 polypeptide without blocking binding of a dsRNA TLR3 ligand to the C-terminal dsRNA binding site of the TLR3 polypeptide. antibody.   29. The antibody of any one of claims 1-28, wherein the antibody comprises a heavy chain constant region that does not substantially bind to a human FcγRIIIa polypeptide.   30. The antibody of any one of claims 1-29, wherein the antibody comprises an IgG4 heavy chain comprising a serine to proline mutation at residue 228 according to the EU index.   31. The antibody of any one of claims 1 to 30, wherein the antibody is a chimeric, human or humanized antibody.   The antibody is an antibody fragment selected from multiple antibodies comprising Fab, Fab ′, Fab′-SH, F (ab ′) 2, Fv, diabody, single chain antibody fragments, or multiple different antibody fragments. The antibody according to any one of claims 1 to 31.   35. The antibody of any one of claims 1-32, wherein the antibody can be internalized by TLR3-expressing cells.   34. The antibody of any one of claims 1-33, wherein the antibody is bound or covalently bound to a toxic moiety.   35. The antibody of any one of claims 1-34, wherein the antibody is bound or covalently bound to a detectable moiety.   The antibody obtained by chimerizing or humanizing the antibody of any one of Claims 1-30.   37. The antibody of any one of claims 1-36 for use in the treatment of inflammatory or autoimmune disorders.   38. An antibody according to any one of claims 1 to 37 for use in the treatment of seizures, onset, relapse or exacerbations in individuals with established or chronic autoimmune or inflammatory diseases.   39. The antibody according to any one of claims 1 to 38, for use in therapy in combination with DMARD selected from the group consisting of an anti-TNFα agent, methotrexate and dexamethasone.   A pharmaceutical composition comprising the antibody according to any one of claims 1 to 39 and a pharmaceutically acceptable carrier.   41. The composition of claim 40, wherein the antibody is present in an amount of about 25 mg to 500 mg.   42. The composition of claim 40 or 41, wherein the composition is formulated for administration to nasal cavity or lung tissue.   42. The composition of claim 40 or 41, wherein the carrier is a pharmaceutically acceptable nasal carrier.   44. A kit comprising the antibody of any one of claims 1-43, optionally further comprising a labeled secondary antibody that specifically recognizes the antibody of any one of claims 1-43. (A) a container comprising the anti-TLR3 antibody according to any one of claims 1-44; and (b) instructions for treating cancer in a patient comprising about 0.05-20 mg / kg. A product comprising a package insert with instructions indicating that a dose of an anti-TLR3 antibody is to be administered to a patient about once a week to about once every two months.   A hybridoma or recombinant host cell that produces the antibody of any one of claims 1-36.   38. A method of treating an individual having autoimmune or inflammatory disease comprising administering to said individual an effective amount of the antibody of any one of claims 1-36.   48. The method of claim 47, wherein the effective amount is about 0.05 to 20 mg / kg and is administered to the individual about once a week to about once every two months.   49. The method of claim 47 or 48, wherein the antibody is formulated for administration to nasal cavity or lung tissue.   49. The method of claim 47 or 48, wherein the antibody is delivered intranasally or by inhalation administration.   44. A method of treating an individual who has established or has chronic autoimmune or inflammatory disease, comprising administering to said individual the antibody or composition of any one of claims 1-43.   44. A method of treating seizures, onset, relapse or exacerbation in an individual who has established or has chronic autoimmunity or inflammatory disease, wherein the antibody or composition of any one of claims 1 to 43 is applied to the individual. Administration. A method of treating an autoimmune or inflammatory disease in an individual comprising:
(A) assessing the presence, stage and / or progression of the disease in the individual; and (b) administering to the individual an effective amount of the antibody or composition of any one of claims 1-43. A method comprising steps.   The assessment of the presence, stage and / or progression of a disease in an individual comprises analyzing the level of autoantibodies, CRP, or any proteolytic enzyme, inflammatory mediator or marker of ongoing inflammation. 53. The method according to 53.   An assessment of the presence, stage and / or progression of the disease in the individual is performed by blood gas analysis and if the individual is found to have COPD, an effective amount of an antibody that binds to the TLR3 polypeptide is given to the individual. 54. The method of claim 53, comprising administering. A method of treating an autoimmune or inflammatory disease in an individual comprising:
44. (a) determining whether the individual has established disease; and (b) when the individual has established disease, an effective amount of any one of claims 1-43. Administering the antibody or composition to said individual. A method of treating an autoimmune or inflammatory disease in an individual comprising:
(A) determining whether the individual is experiencing a seizure, onset, relapse or exacerbation; and (b) if the individual experiences a seizure, onset, exacerbation or relapse. 44. A method comprising administering to said individual an effective amount of the antibody or composition of any one of -43. A method of treating an autoimmune or inflammatory disease in an individual comprising:
44. (a) determining whether the individual has a disease characterized by the presence of dsRNA; and (b) if the individual has a disease characterized by the presence of dsRNA. A method comprising administering to said individual an effective amount of an antibody or composition according to any one of the preceding claims.   57. The method of any one of claims 47 to 56, further comprising administering DMARD or corticosteroid to the individual.   A method of treating an individual having an autoimmune or inflammatory disease comprising: (a) an effective amount of an antibody or composition according to any one of claims 1 to 43; and (b) DMARD. Or a method comprising administering a corticosteroid.   59. The method of claim 58, wherein the DMARD is an anti-TNFα antibody and / or methotrexate.   A method for determining the suitability of treatment with an antibody or composition according to any one of claims 1 to 43 for a patient, wherein said patient has established autoimmune or inflammatory disease, Determining whether the patient is experiencing seizures, onset, worsening or relapse and / or whether the patient has a disease characterized by the presence of dsRNA.   A method for identifying, screening and / or generating an antibody that specifically binds to and inhibits a TLR3 polypeptide in a mammalian subject, comprising: a) optionally a non-human mammal with an immunogen comprising a TLR3 polypeptide Providing a plurality of antibodies that bind to a human TLR3 polypeptide by a method comprising immunizing an animal; and (b) binding affinity of said antibody to a TLR3 polypeptide in cells that express human TLR3 only on the cell surface. Evaluating the sex. The method further comprises 0.3 μg / ml or less, optionally 0.2 μg / ml or less, optionally 0.1 μg / ml for binding to the cells expressing human TLR3 only on the cell surface from the plurality of antibodies. further comprising the step of selecting antibodies having the following EC _50, the method of claim 61.

Images