JP2015204752A - Glycosylation enzyme, and production method of c glycoside disubstituted by sugar using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel glycosylation enzyme having an enzymatic activity which artificially and simply produces disubstituted C glycoside by sugar which is obtained by a carbon-carbon bond of the sugar to a substrate, and to provide a method for producing disubstituted C glycoside by the sugar which is glycosylated using the same.SOLUTION: A glycosylation enzyme is derived from citrus fruits or pulse, and has an enzymatic activity producing disubstituted C glycoside by sugar which is obtained by a carbon-carbon bond of each of the sugar to two carbon atoms in a structure of a substrate selected from phenylpropanoid and phenylacetophenone. The glycosylation method produces disubstituted C glycoside using a glycosylation enzyme gene having DNA encoding the glycosylation enzyme.

Description

  The present invention relates to a novel glycosylase that produces a C-glycoside disubstituted by sugar by sugar-carbon bonding to a substrate. Furthermore, a glycosidase gene that expresses the glycosylase, a cDNA encoding the glycosidase, a plasmid incorporating the glycosidase gene, a transformant incorporating the same, and a novel glycosylation using the transformant Regarding the method.

  A glycoside is a group of components in which a substrate (aglycone) other than sugar and a monosaccharide or oligosaccharide are bound, and is mainly produced and accumulated as a secondary metabolite in plants and microorganisms. At this time, glycosyltransferase (glycosylation) is carried out in plants and microorganisms by glycosidases. A method for producing glycosides using these glycosylases has been reported (Patent Documents 1 and 2).

  Many glycosides are O-glycosides in which the sugar is bound to the hydroxy group of the substrate, but carboxyglycosides bound to carboxy groups, N-glycosides bound to amino groups, S bound to thiol groups. Various things, such as a glycoside and the cyanide glycoside couple | bonded with the hydroxyl group adjacent to a nitrile, are reported (nonpatent literature 1).

  All of the glycosides listed above are glycosylated via heteroatoms in the bond between the substrate and the sugar. On the other hand, glycosides called C-glycosides, in which a sugar carbon atom is directly covalently bonded to a carbon atom of a substrate, are widely available as other glycosides.

  C glycosides are very stable compared to O glycosides because they are not subject to hydrolysis by glucosidase or acid due to their characteristic carbon-carbon bond mode.

  C-glycoside is a secondary metabolite formed in organisms such as microorganisms, plants, and insects, and is distributed in nature. They are known to exhibit various functions in vivo such as iron transport carriers, antibiotics, antioxidants, inducers, and antifeedants (Non-Patent Documents 2 and 3).

  As for the glycosyltransferase that biosynthesizes C-glycoside, the C-glycosylase OsCGT in rice was partially purified in 2009, and its gene was identified (Non-patent Document 4). Have been reported (Non-Patent Documents 5 and 6). Recently, a novel C-glycosylation enzyme in corn has been reported (Non-patent Document 7).

JP 2008-174507 A JP 2009-34028 A JP 2006-238828 A JP 2006-238829 A

Wang X., Structure, mechanism and engineering of plant natural product glycosyltransferases, FEBS. Letters. 583 (2009) 3303-3309. Hultin P.G., Bioactive C-glycosides from bacterial secondary metabolism, Curr. Top. Med. Chem., 5 (2005) 1299-1331. Franz G., Grun M., Chemistry, Occurrence and biosynthesis of C-glycosyl compounds in plants, Planta Med., 47 (1983) 131-140. Brazier-Hicks M., Evans K.M., Gershater M.C., Puschmann H., Steel P G, Edwards R, The C-glycosylation of flavonoids in cereals, J. Biol. Chem., 284 (2009) 17926-17934. Bungaruang L., Gutmann A., Nidetzky B., Lelioir Glycosyltransferases and Natural Product Glyxosylation: Biocatalytic Synthesis of the C-Glucoside Nothofagin, a Major Antioxidant of Redbush Herbal Tea, Adv. Synth. Catal., 355 (2013) 1-8 . Brazier-Hicks M., Edwards R., Metabolic engineering of the flavone-C-glycoside pathway using polyprotein technology, Metabolic Engineering., 16 (2013) 11-20. Falcone Ferreyra M. L., Rodriguez E., Casas M. I., Labadie G., Grotewold E., Casati P., Identification of a bifunctional maize C- and O-glucosyltransferase, J. Biol. Chem., 288 (2013) 31678-31688. Kim B.G., Kim H.J., Ahn J.H., Production of bioactive flavonol rhamnosides by expression of plant genes in Escherichia coli., J. Agric Food Chem., 60 (2012) 11143-11148

  All of the C-glycosides listed above are reports on mono-substituted glycosides in which one sugar is bound to a substrate. Glycosides with multiple sugars, especially di-C glycosides with two sugars attached to a substrate (hereinafter also referred to as di-C glycosides), 2) etc. have been reported and their usefulness has been studied. Identification of glycosyltransferase genes that induce these disubstituted C-glycosides, and technology for the production of disubstituted C-glycosides using them There is no report about.

  The present invention has been made in view of the above circumstances, and is a novel glycoside having an enzyme activity for easily and artificially producing a C-glycoside disubstituted by sugar-carbon bonding to a substrate. It is an object of the present invention to provide a saccharification enzyme, a method for producing a disubstituted C-glycoside by glycosylation using the same, and a di-substituted C-glycoside produced by the method.

  As a result of diligent research, the present inventors have found that in specific plants such as citrus fruits and beans, two sugars are specifically added to two carbon atoms of a specific substrate such as phenylpropanoids such as flavonoids and dihydrochalcones. Successful identification of glycosyltransferase genes for carbon-carbon bonds, respectively, and introduction of this glycosyltransferase gene into a specific host cell enables efficient disubstitution of the two sugars linked to each other. It was found that C-glycoside can be produced, and the present invention has been completed.

  That is, the present invention according to claim 1 is a saccharifying enzyme derived from citrus fruits or beans, wherein each sugar is carbon-carbon bonded to 2 carbon atoms in the skeleton of the substrate selected from phenylpropanoids and acetophenones. And a glycosylase characterized by having an enzyme activity for producing a C-glycoside disubstituted by the sugar.

  The present invention according to claim 2 is the phenylpropanoids selected from flavonoids and dihydrochalcones, wherein the substrate may have its phenyl group hydrogen substituted with a hydroxyl group, or The glucosidase according to claim 1, which is the acetophenone selected from acetophenone and α-phenylacetophenone.

  Further, the present invention according to claim 3 is the amino acid sequence represented by any one of SEQ ID NOs: 1 to 4 in the sequence listing and the enzyme among the amino acid sequences represented by any one of the sequence listings SEQ ID NO: 1 to 4. The amino acid according to any one of claims 1 to 2, which has any one of a modified amino acid sequence in which one or two or more amino acids are deleted, substituted, and / or added within a range that retains activity. It is a glucosidase.

  Moreover, this invention of Claim 4 has DNA which codes the glycosidase of any one of Claims 1-3, The glycosidase gene characterized by the above-mentioned.

  Further, the present invention according to claim 5 is characterized in that the DNA has a nucleotide sequence represented by any one of SEQ ID NOs: 5 to 8 in the sequence listing and a nucleotide sequence represented by any one of the sequence numbers 5 to 8 in the sequence listing. Among them, it has any one of a modified base sequence in which one or two or more bases are deleted, substituted and / or added within a range in which the enzyme activity of the encoding glycosylase is retained. Item 5. The glycosyltransferase gene according to Item 4.

  Moreover, this invention of Claim 6 is cDNA which codes the glycosylase described in any one of Claims 1-3.

  Moreover, this invention of Claim 7 is a plasmid characterized by incorporating the glycosidase gene of any one of Claims 5-6.

  The present invention described in claim 8 is a transformant obtained by introducing the plasmid described in claim 7 into a host cell.

  The present invention according to claim 9 is the transformant according to claim 8, wherein the host cell is Escherichia coli.

  Moreover, this invention of Claim 10 co-incubates the transformant of any one of Claims 8-9, the substrate selected from phenylpropanoids and acetophenones, and sugar. Including the step of carbon-carbon bonding each of the sugars to two carbon atoms in the skeleton of the substrate to form a C-glycoside disubstituted with the sugar, thereby glycosylating the substrate. Is a method for producing a C-glycoside disubstituted with a sugar.

  The present invention according to claim 11 is the phenylpropanoid selected from flavonoids and dihydrochalcones, wherein the substrate may have its phenyl group hydrogen substituted with a hydroxyl group, or It is the said acetophenone selected from acetophenone and alpha-phenyl acetophenone, The glycosylation method of Claim 10 characterized by the above-mentioned.

  Moreover, this invention of Claim 12 was manufactured by the glycosylation method of any one of Claims 9-10, and in the frame | skeleton of the substrate chosen from phenylpropanoids and acetophenones It is a C-glycoside disubstituted with a sugar, characterized in that each sugar has a carbon-carbon bond to two carbon atoms and is a glycoside disubstituted with the sugar.

  Moreover, the present invention described in claim 13 contains the C-glycoside disubstituted by the sugar described in claim 12 as an active ingredient, and is selected from foods and drinks, pharmaceuticals, supplements, and feeds. It is a C-glycoside-containing product characterized by being either.

  According to the novel glycosylation enzyme of the present invention and a method for producing a C-glycoside disubstituted by using the sugar, phenylpropanoids such as flavonoids and dihydrochalcones, or acetophenone and α-phenylacetophenone C-glycosides in which two sugars are each carbon-carbon-bonded to two carbon atoms of a specific substrate such as acetophenones can be produced.

  According to this production method, a sugar-disubstituted C-glycoside can be easily obtained by a glycosylation enzyme having a specific amino acid sequence or a glycosylation enzyme gene that expresses it. In this production method, by using a saccharifying enzyme gene having a DNA encoding saccharifying enzyme, a plasmid or recombinant vector containing the saccharifying enzyme gene, or a transformant having these introduced into a host cell, substrate-specific and Specifically, it is possible to obtain a C-glycoside that is high-purity and efficient and is disubstituted with a sugar.

  The C-glycoside disubstituted with the sugar of the present invention exhibits various functions and medicinal effects in vivo as an antioxidant, an inducer, an antifeedant, a sweetener, a flavoring agent or an antitumor substance. Therefore, a C-glycoside-containing product can be prepared by using a composition that is contained in a food, drink, pharmaceutical, supplement, or feed as an active ingredient.

It is a plasmid diagram of pCR4Blunt-TOPO_CuCGT. It is a plasmid figure of pET-28a_CuCGT. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxy pinocembrin using CuCGT by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-hydroxy pinocembrin using CuCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of phloretin using CuCGT by HPLC. It is a mass spectrum as a result of analyzing the reaction product of phloretin using CuCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-phenyl-2 ', 4', 6'-trihydroxyacetophenone using CuCGT by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-phenyl-2 ', 4', 6'-trihydroxyacetophenone using CuCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using CuCGT by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using CuCGT by LC-MS. It is a mass spectrum as a result of having analyzed the 2nd reaction material of 2-hydroxynaringenin using CuCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using FcCGT by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using FcCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of phloretin using FcCGT by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of phloretin using FcCGT by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxy pinocembrin using MtrCGT1 by HPLC. It is a mass spectrum as a result of having analyzed the reaction product of 2-hydroxy pinocembrin using MtrCGT1 by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using MtrCGT1 by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using MtrCGT1 by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using GmCGT2 by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of 2-hydroxynaringenin using GmCGT2 by LC-MS. It is the spectrum of the result of having analyzed the reaction product of phloretin using GmCGT2 by HPLC. It is a mass spectrum of the result of having analyzed the reaction product of phloretin using GmCGT2 by LC-MS. It is the spectrum of the result of having analyzed the reaction product of 2-hydroxy pinocembrin using FeCGTa by HPLC. It is a mass spectrum as a result of having analyzed the reaction product of 2-hydroxy pinocembrin using FeCGTa by LC-MS. It is the spectrum of the result of having analyzed the reaction product of phloretin using FeCGTa by HPLC. It is a mass spectrum as a result of analyzing the reaction product of phloretin using FeCGTa by LC-MS.

  Hereinafter, a glycosylation enzyme according to the present invention, its gene / cDNA / plasmid / recombinant vector / transformant, and a form for carrying out the method for producing a C-glycoside disubstituted with sugars by them explain.

  A C-glycoside produced by a glycosylation enzyme in which two sugars are bonded to the carbon atom of the substrate is a monosaccharide or oligosaccharide at two carbon atoms of the substrate, that is, the non-sugar component, aglycone. Such a sugar is a compound that is disubstituted with a sugar having a carbon-carbon bond structure. Such a C-glycoside disubstituted with a sugar is, for example, bisenin-2 as a known compound. Bisenin-2 has been reported to be used as a sweetener and a flavoring agent (Patent Documents 3 and 4).

  The glucosidase according to the present invention is a saccharogenic enzyme extracted and purified from plants such as citrus fruits and beans. As a typical example, 450 to 500 glucosidases shown in any one of SEQ ID NOs: 1 to 4 in the sequence listing are used. Mention may be made of proteins having a certain amino acid sequence.

  As long as the glycosylation enzyme according to the present invention is a protein having glycosylation activity that binds sugar to two carbon atoms of the substrate, among the amino acid sequences shown in any one of SEQ ID NOs: 1 to 4 in the sequence listing It may be a protein having a modified amino acid sequence in which one or more amino acids are deleted, substituted and / or added.

  “One or more amino acids have been deleted, substituted and / or added” means a number which can be deleted, substituted and / or added by an appropriate method such as the Kunkel method well known to those skilled in the art. Of amino acids are deleted, substituted and / or added.

  As an example of a glucosidase according to the present invention, it has a homology of 80% or more, preferably 90% or more, more preferably 95% or more with the amino acid sequence shown by any of SEQ ID NOs: 1 to 4 in the sequence listing. Examples include proteins having modified amino acid sequences.

  The term “citrus fruits” means a plant belonging to the citrus family, Citrus subfamily mandarin, and is understood to include plants other than the mandarin genus, for example, plants of the genus Kumquat. Examples of citrus fruits include, for example, Satsuma mandarin, orange, Hanayu, Kumquat, Iyokan, Kavos, Satsuma mandarin, quinotto, grapefruit, Koji, Sangoukan, Jabara, Sudachi, Daidai, Tachibana, Tangor, Natsumikan, Hassaku, Hyuganatsu, Hirami Lemon, Examples include Bungtan, Ponkan, Lime, Lemon and Yuzu. Among the above citrus fruits, particularly preferred examples of the citrus fruits are Satsuma mandarin, orange, hanayu and kumquat.

  “Beans” means leguminous plants. Examples of legumes include, for example, soybeans, peanuts, ginkgo acacia, kusanemu, nemunoki, weasel hagi, yabume, genge, hamanamame, hanessena, raccoon bean, licoridae, American deigo, pea pea, yamagogi, tamago coconut, Yahazu Pea, broad bean, azuki bean, and Fuji. Among the above beans, particularly preferred examples in the present invention are tarumago palm and soybean.

  Substrates for generating a C-glycoside disubstituted by a glycosidase are phenylpropanoids optionally having a substituent such as a hydroxyl group, a lower alkoxy group having 1 to 6 carbon atoms, or a halogen atom And acetophenones.

  “Phenylpropanoids” is a general term for organic compounds derived from a 1-phenylpropane skeleton, and the phenyl group derived from the phenyl skeleton may have a phenolic hydroxyl group, and is derived from the propane skeleton. A tri-carbon group such as a propyl group, a propenyl group, a propionyl group, a trimethylene group, or a propenylene group, which are part of a chain or a heterocyclic group, may have a hydroxyl group, and some or all of these hydroxyl groups are etherified It may have an alkoxy group such as a methoxy group.

  “Flavonoid” is a kind of polyphenol and means an organic compound having a skeleton in which two benzene rings are linked by three carbon chains. Examples of flavonoids include flavones, flavonols, flavanones, isoflavones, catechins, anthocyanins, tannins and derivatives thereof. Among the above flavonoids, particularly preferable examples in the present invention are organic compounds having a flavan as a basic skeleton, and 2-hydroxyflavanones that can be hydroxylated at the 2-position to form a ring-opening structure are as follows. More preferred examples include 2-hydroxypinocembrin, 2-hydroxynaringenin, and 2-hydroxyeriodictyol.

  “Dihydrochalcone” is a related compound of chalcone and means an organic compound having 1,3-diphenyl-1-propanone as a skeleton. Examples of dihydrochalcones include, for example, 2-phenyl-2 ′, 4 ′, 6′-trihydroacetophenone, phloretin, phlorizin, 3 ′, 5′-dihydroxy-2 ′, 4 ′, 6′-trimethoxydihydro Examples include chalcone, methyllindelone, 5-hydroxy-6,7,8-trimethoxyflavone, and 2′-hydroxy-3 ′, 4 ′, 5 ′, 6′-tetramethoxydihydrochalcone. Among the above-mentioned dihydrochalcones, particularly preferred examples in the present invention include phloretin and phlorizin.

  “Acetophenones” are those having an acetophenone skeleton and a partial skeleton of chalcone or flavanone (for example, 2-hydroxyflavanone), the phenyl group of which may have a phenolic hydroxyl group, and the acetyl group of which is a phenol. It is an organic compound that may have an α-phenyl group that can be substituted with a functional hydroxyl group. Examples of acetophenones include acetophenone optionally substituted with a hydroxyl group, for example acetophenone such as 2 ′, 4 ′, 6′-trihydroxyacetophenone; α-phenylacetophenone, for example 2-phenyl-2 ′, 4 ′ , 6'-trihydroxyacetophenone.

  Among these substrates, 2-hydroxypinocembrin, 2-hydroxynaringenin, 2-hydroxyeriodictyol, 2-phenyl-2 ′, 4 ′, 6′-trihydroacetophenone, phloretin, and phlorizin are preferable. Among these substrates, flavonoids and dihydrochalcones having a hydroxyl group that can be easily dehydrated, such as 2-hydroxynaringenin, can produce C-glycosides that are disubstituted with the corresponding sugars.

  The glucosidase gene according to the present invention is a gene having a DNA encoding a saccharification enzyme having a saccharification activity that binds a saccharide to two carbon atoms of a substrate. Any of the base sequences indicated by the numbers 5 to 8 can be mentioned.

  The DNA of the glucosidase gene according to the present invention is one DNA in any of the basic acid sequences shown in SEQ ID NOs: 5 to 8 in the sequence listing, as long as the activity of the encoded saccharifying enzyme is maintained. Alternatively, it may be a modified base sequence composed of DNA having a base sequence in which two or more bases are deleted, substituted and / or added.

  “Encode” encodes the saccharifying enzyme according to the present invention as a continuous structural sequence (exon), or encodes the saccharifying enzyme according to the present invention via an appropriate intervening sequence (intron). Including both.

  The plasmid according to the present invention is, for example, a recombinant vector into which the saccharifying enzyme gene according to the present invention is inserted. As a typical example, the plasmid is represented by any one of the nucleotide sequences shown in SEQ ID NOs: 5 to 8 in the sequence listing. And a recombinant vector into which the gene to be inserted is inserted.

  In such a recombinant vector, as long as the cDNA according to the present invention can be introduced in a form in which the target protein can be expressed, the type thereof is not limited. Examples include E. coli plasmids.

  The transformant according to the present invention refers to a cell into which the plasmid according to the present invention has been introduced as a recombinant vector in a form capable of expressing a desired protein. The host cell to be a transformant in the present invention is not particularly limited as long as it is a prokaryotic cell or a eukaryotic cell capable of producing the saccharifying enzyme according to the present invention, but typical examples thereof include Escherichia coli and yeast. Can be mentioned.

  “Transformation” means that by introducing foreign DNA into a cell, the cell (host cell) undergoes a permanent genetic change. “Transformant” refers to a cell into which a host cell, an ancestral cell of the host cell, or a subcultured cell thereof is introduced with a recombinant vector containing DNA encoding the desired protein by recombinant DNA technology. It means that.

  Next, the glycoside enzyme gene and the glycosylation method according to the present invention will be described more specifically. The glycosidase gene according to the present invention can be obtained, for example, through the following steps.

(Manufacture of cDNA)
First, total RNA (total RNA) is extracted from a plant containing the glucosidase gene according to the present invention. Total RNA can be extracted by crushing the plant with a mortar or the like, turbid with an extraction buffer, or centrifuged. A person skilled in the art can appropriately select a known method for extracting total RNA from a plant.

  From the extracted total RNA, a portion related to the glucosidase gene according to the present invention is selected to produce a saccharidase cDNA. The production of cDNA can be performed by polymerase chain reaction (PCR) on cDNA obtained by adding reverse transcriptase and performing reverse transcription. A person skilled in the art can appropriately select known primers, reverse transcriptase, PCR enzyme, reaction conditions, and the like used in conducting the reverse transcription reaction and the PCR reaction.

(Manufacture of recombinant vectors)
The recombinant vector according to the present invention is produced by introducing the cDNA produced in the previous step into a predetermined vector. In the present invention, the type of vector to be used is not particularly limited, but a vector that allows E. coli to express a protein is preferable, and a pET-28a (+) vector is particularly preferable. A person skilled in the art can appropriately select a known method for the introduction into a vector.

(Manufacture of transformants)
By introducing the recombinant vector produced in the previous step into a predetermined host cell, a transformant that expresses the glycosylase according to the present invention is produced. The host cell is not particularly limited, but a prokaryotic cell is preferable, and Escherichia coli is particularly preferable. A person skilled in the art can appropriately select a known method for introducing the recombinant vector into the host cell.

(Manufacture of glycosides)
The glycoside according to the present invention is produced by culturing a transformant introduced with a glucosylase gene together with a substrate such as phenylpropanoids or acetophenones, particularly flavonoids, dihydrochalcone or α-phenylacetophenone. Done in At this time, it is also possible to react with a substrate after producing a glycosidase in the transformant in advance. A person skilled in the art can express a method for expressing a target protein using transformed cells, and a method for performing a target reaction using a transformant expressing the target protein. A known method can be appropriately selected.

The glycoside according to the present invention can be produced by batch treatment in which the transformant into which the glycoside enzyme gene according to the present invention has been introduced and the substrate are co-cultured and recovered each time. As a method, it can also be produced by continuous treatment in which the substrate is appropriately added to the culture medium of the transformant into which the glucosylase gene according to the present invention has been introduced, and then sequentially recovered. At this time, the amount of the substrate that can be added depends on the solubility of the substrate.

  The C-glycoside-containing product according to the present invention contains a predetermined amount of the above-described sugar-disubstituted C-glycoside as an active ingredient. For example, a liquid, powder, capsule, or tablet , Foods and beverages, pharmaceuticals, supplements, or feeds of any shape such as a lump or gel.

  Hereinafter, embodiments of the present invention will be described in more detail.

Example 1
<Devices used>
In this example, a bioshaker BR-23FP (manufactured by Taitec Co., Ltd.) was used as a shaker. Moreover, himac CF-15R (made by Hitachi, Ltd.) was used as a centrifuge. A T-100 thermal cycler (manufactured by Bio-Rad) was used for the intended RT-PCR reaction. LC / MS ACQUITY (registered trademark) UPLC SQD SYSTEM (manufactured by Waters) was used for analysis of the obtained C-glycoside disubstituted with sugar. A DNA sequencer ABI3100 (manufactured by Life Technology) was used to determine the DNA sequence.

<Acquisition of Glucose Enzyme Genes in Citrus Plants>
Freeze Satsuma mandarin leaves (2 g) under liquid nitrogen, crush them with a mortar and pestle, extract buffer ((100 mM Tris-HCl (trishydroxymethylaminomethane hydrochloride) (pH 9.0), 100 mM NaCl) 10 mL of 10 mM EDTA (ethylenediaminetetraacetic acid) (pH 8.0), 1 mL of 10% SDS (sodium dodecyl sulfate), 50 μL of 14M mercaptoethanol, and 10 mL of phenol (pH 9.0) were well turbid.

  Thereafter, the turbid solution was shaken for 10 minutes at 15 ° C., then added with 10 mL of a chloroform / isoamyl alcohol mixture, shaken for 10 minutes, and centrifuged at 9,000 rpm for 10 minutes, 15 minutes. The supernatant was collected by centrifugation at 0 ° C.

  7.5 ml of phenol (pH 9.0) is added to the collected supernatant, shaken at 15 ° C for 10 minutes with a shaker, added with 7.5 ml of chloroform / isoamyl alcohol mixture, and shaken at 15 ° C for 10 minutes. That ’s it. Thereafter, the mixture was centrifuged at 9,000 rpm for 10 minutes at 15 ° C., and the supernatant was collected. Thereafter, 1/10 volume of 3M sodium acetate was added to the collected supernatant and allowed to stand on ice for 30 minutes.

  After centrifugation at 12,000 rpm for 15 minutes at 4 ° C. using a centrifuge, the supernatant was recovered, 20 ml of isopropanol was added, and the mixture was allowed to stand at −20 ° C. for 20 minutes. The mixture was centrifuged at 12,000 rpm for 20 minutes at 4 ° C, the supernatant was removed, 70% ethanol was added, and the mixture was centrifuged at 12,000 rpm for 3 minutes at 4 ° C. After removing the supernatant, add TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0)) (400 μL) and shake for 10 minutes at 4 ° C. to completely dissolve the precipitate. 1/4 amount of 10M LiCl was added, and the mixture was allowed to stand at -20 ° C for 2 hours.

  The standing supernatant was centrifuged at 15,000 rpm for 10 minutes at 4 ° C., the supernatant was removed, 70% ethanol was added, and the mixture was centrifuged at 12,000 rpm for 3 minutes at 4 ° C. Thereafter, the supernatant was further removed, and the precipitate was dissolved in 100 μL of pure water, and this was used as total RNA.

<Manufacture of cDNA>
1 μL of dT-T3 primer was added to the obtained total RNA (500 ng) to make a total of 6 μL, and allowed to stand at 65 ° C. for 10 minutes. After that, 5 × RT buffer (TOYOBO) 4 μL, 2.5 mM dNTP 8 μL, sterile water 0.8 μL, RNase inhibitor (RNase inhibitor, Invitrogen) 0.2 μL, Ribatraace (reverse transcriptase, manufactured by TOYOBO) as an enzyme ( 1 μL of registered trademark) was added, and RT reaction was performed at 42 ° C. for 1 hour. 180 μL of extraction buffer was added to the product to make a total of 200 μL, which was used as a cDNA solution. Moreover, the used primer is shown to sequence number 10 of a sequence table.

(SEQ ID NO: 10)
5'- attaaccctcactaaagggttttttttttttttttvv-3 '

  Using cDNA solution as a template, PCR reaction (Initial denaturation 98 ℃, 30 seconds, denaturation 98 ℃, 10 seconds, Annealing 60 ℃, Extension 72 ℃ with a combination of primers CuCGT_Fw_Nde and CuCGT_Rv_Xho using Phusion DNA polymerase (Finnzyme) , 40 cycles of 45 seconds). Thereafter, the obtained PCR product was TOPO cloned into a pCR4Blunt-TOPO vector (manufactured by Invitrogen) and transformed into DH5α by a heat shock method. Plasmid extraction was performed from the obtained bacteria to obtain pCR4Blunt-TOPO_CuCGT (Unshu mandarin), and the nucleotide sequence was determined. The base sequence of the obtained glycosidase gene CuCGT derived from the leaves of Citrus unshiu is shown in SEQ ID NO: 5 of the sequence listing. The obtained pCR4Blunt-TOPO_CuCGT is shown in FIG. Moreover, the used primer is shown to sequence number 11 and 12 of a sequence table.

(SEQ ID NO: 11)
5'-gtcatatgtc agattccggc ggctttg-3 '
(SEQ ID NO: 12)
5'-gactcgagtt aatgggtgttgttgttgcac-3 '

<Manufacture of recombinant vectors>
The obtained pCR4Blunt-TOPO_CuCGT was treated with a restriction enzyme (NdeIXhoI) and ligated with the pET-28a (+) vector. After transformation into DH5α and confirmation of the introduced fragment by colony PCR, plasmid extraction was carried out to obtain pET-28a_CuCGT (Satsuma mandarin). The obtained pET-28a_CuCGT is shown in FIG.

<Manufacture of transformant>
Next, Rosetta2 (DE3) (Novagen) was transformed with this plasmid to obtain Escherichia coli for protein expression.

<Production of di-C glycoside of 2-hydroxypinocembrin>
A glycoside was produced using the obtained transformant. Manufacture was performed with reference to the method described in Non-Patent Document 8. The transformant (pET-28a_CuCGT / Rosetta2 (DE3)) produced in the previous step was inoculated into 200 mL of LB medium and cultured with shaking at 22 ° C. At this time, IPTG (isopropyl-β-thiogalactopyranoside) was added to a final concentration of 0.4 mM and cultured overnight with shaking to induce protein expression to obtain a sugarcane-derived glycosidase. The amino acid sequence of the obtained glycosidase is shown in SEQ ID NO: 1 in the sequence listing.

  Thereafter, the transformant in which protein expression induction was performed was collected and suspended in 20 mL of M9 medium (containing 2% glucose) at an OD600 = 3.5. A substrate (2-hydroxypinocembrin with a final concentration of 200 μM) was added to the obtained suspension, and the mixture was cultured at 30 ° C. The structural formula of 2-hydroxypinocembrin is shown below.

  The supernatant of the culture solution with the substrate was analyzed by HPLC. The analysis conditions were as follows: the stationary phase was an octadecylsilyl (ODS) column (2.1 × 50 mm: ACQUITY (registered trademark) BEH C18, manufactured by Waters), and the mobile phase was solvent A (0.1% formic acid / ultra pure water) and solvent B ( 0.1% formic acid / methanol) gradient. The analytical methods used were solvent B: 20% 0.5 min, B: 20% -60% 2 min, B: 60% 2 min, B: 20% 2 min. The analysis was performed at a measurement flow rate of 0.25 mL / min, a temperature of 40 ° C., and a detection wavelength of 290 nm.

  The analysis results are shown in FIG. In FIG. 3, the upper figure shows the spectrum before the reaction (after 0 minutes), and the lower figure shows the spectrum after 2 hours from the reaction. From FIG. 3, it can be seen that the substrate reacted to produce a di-C glycoside. The peak in the above figure is that of 2-hydroxypinocembrin. In the figure below, the peak on the left is that of the di-C glycoside produced in this example, 6,8-di-C-glucosyl-2-hydroxypinocembrin (molecular weight 596), negative scan mode LC / MS analysis of (ES-) shows m / z = 595. In the figure below, the peak on the right is that of the mono-C glycoside 6-C-glucosyl-2-hydroxypinocembrin (molecular weight 434), and LC-MS analysis in negative scan mode (ES-) M / z = 433. The structural formula of 6,8-di-C-glucosyl-2-hydroxypinocembrin, which is a di-C glycoside, is shown below.

  FIG. 4 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. This LC-MS analytical data supports the structural formula of 6,8-di-C-glucosyl-2-hydroxypinocembrin.

  When hydrochloric acid is added to the reaction solution to 1M and allowed to act at 60 ° C for 2 hours, 6,8-di-C-glucosyl-2-hydroxypinocembrin is converted to 6,8-di-C-glucosyl lysine. It was done. The structural formula of 6,8-di-C-glucosyl lysine is shown below.

(Example 2)
Using the same transformant as in Example 1, a phloretin di-C glycoside was produced. The equipment used, the recombinant vector used, the transformant used, and the method for analyzing the produced glycoside are the same as in Example 1.

  FIG. 5 shows the result of HPLC analysis of the product according to this example. In the figure, among the two peaks of the product having a shorter retention time than phloretin, the faster peak is the 3 ′, 5′-di-C-glucosyl of the di-C glycoside produced in this example. It is of phloretin (molecular weight 598), and shows m / z = 597 in LC-MS analysis in negative scan mode (ES-). The slower of the two peaks of the product is that of the mono-C glycoside 3'-C-glucosylphloretin (nosofazine, molecular weight 436), and negative scan mode (ES-) LC / MS analysis shows m / z = 435. The structural formula of 3 ′, 5′-di-C-glucosylphloretin, which is a di-C glycoside, is shown below.

  FIG. 6 shows a mass spectrum in which the product was detected by the negative scan mode (ES−) of the mass spectrometry (MS) detector in the HPLC analysis. This LC-MS analysis data supports the structural formula of 3 ′, 5′-di-C-glucosylphloretin.

(Example 3)
Using the same transformant as in Example 1, a di-C glycoside of 2-phenyl-2 ′, 4 ′, 6′-trihydroxyacetophenone was produced. The equipment used, the recombinant vector used, the transformant used, and the method for analyzing the produced glycoside are the same as in Example 1.

  FIG. 7 shows the HPLC analysis result of the product produced in this example. The upper figure shows the results of detecting metabolites by HPLC (OD 290 nm) immediately after administration of the transformant and the substrate according to this example to the medium, and the lower figure shows 2 hours after administration. The method for analyzing the produced di-C glycoside is the same as in Example 1. Of the two peaks in the spectrum shown below, the peak with the faster retention time is the 3 ′, 5′-di-C-glucosyl-2-phenyl-2 ′ of the di-C glycoside produced in this example. , 4 ′, 6′-trihydroxyacetophenone (molecular weight 568), and shows m / z = 567 by LC-MS analysis in negative scan mode (ES−). Of the two peaks of the product, the peak with the later retention time is the mono-C glycoside 3′-C-glucosyl-2-phenyl-2 ′, 4 ′, 6′-trihydroxyacetophenone ( It has a molecular weight of 406), and shows m / z = 405 by LC-MS analysis in negative scan mode (ES-). The structural formula of 3 ′, 5′-di-C-glucosyl-2-phenyl-2 ′, 4 ′, 6′-trihydroxyacetophenone, which is a di-C glycoside, is shown below.

  FIG. 8 shows a mass spectrum in which the product was detected by the negative scan mode (ES−) of the mass spectrometry (MS) detector in the HPLC analysis. This LC-MS analytical data supports the structural formula of 3 ′, 5′-di-C-glucosyl-2-phenyl-2 ′, 4 ′, 6′-trihydroxyacetophenone.

Example 4
A glycoside of 2-hydroxynaringenin was produced using a glucosidase gene isolated from Satsuma mandarin. The equipment used, reagents used, experimental methods, etc. are the same as in Example 1.

  FIG. 9 shows the spectrum of the HPLC analysis result of the glycoside produced in this example. The upper figure shows the results of detecting metabolites by HPLC (OD 290 nm) immediately after administration of the transformant and the substrate according to this example to the medium, and the lower figure shows 2 hours after administration. The method for analyzing the produced di-C glycoside is the same as in Example 1. In the above figure, the main peak is that of apigenin. In the figure below, each main peak is in order of increasing retention time, 6,8-di-C-glucosyl-2-hydroxynaringenin (molecular weight 612), vinylene-2 (molecular weight 594), vitexin (molecular weight 432), isovitexin (molecular weight) 432).

  FIG. 10 shows a mass spectrum in which the product eluted first in HPLC analysis was detected by the negative scan mode (ES−) of the mass spectrometry (MS) detector. From FIG. 10, it can be seen that a di-C glycoside (m / z = 611) of 2-hydroxynaringenin is produced.

  FIG. 11 shows a mass spectrum of the product in this example, in which the second eluted product was detected by the negative scan mode (ES−) of the mass spectrometry (MS) detector. From FIG. 11, it can be seen that vicenin-2 (m / z = 593) is produced.

The structural formula of 6,8-di-C-glucosyl-2-hydroxynaringenin is shown below.

The structural formula of Vicenin-2 is shown below.

(Example 5)
Using a glycosyltransferase gene isolated from kumquat, glycosides of 2-hydroxynaringenin were produced. The apparatus used, the reagent used including the primer, the experimental method, etc. are the same as in Example 1. The amino acid sequence of the kumquat-derived glucosidase is shown in SEQ ID NO: 2 in the sequence listing. In addition, the base sequence of kumquat-derived glucosidase gene is shown in SEQ ID NO: 6 in the sequence listing.

  FIG. 12 shows the spectrum of the HPLC analysis result of the glycoside produced in this example. The upper diagram shows the results of detecting metabolites by HPLC (OD290nm) 4 hours after administration of the transformant and substrate according to this example immediately after administration to the medium. The method for analyzing the produced di-C glycoside is the same as in Example 1. In the above figure, the main peak is that of 2-hydroxynaringenin. In the figure below, each main peak is 6,8-di-C-glucosyl-2-hydroxynaringenin (molecular weight 612) and 6-C-glucosyl-2-hydroxynaringenin (molecular weight 450) in order of increasing retention time. These can be converted to vicenin-2, vitexin and isovitexin, respectively, by dehydration by acid treatment.

  FIG. 13 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. From FIG. 13, it can be seen that a di-C glycoside (m / z = 611) of 2-hydroxynaringenin is produced.

(Example 6)
A glycoside of phloretin was produced using a glucosidase gene isolated from kumquat. Equipment used, reagents used including primers, experimental methods, etc. are the same as in Example 1.

  FIG. 14 shows the result of HPLC analysis of the product of this example. In FIG. 14, the faster peak among the two peaks of the product having a shorter retention time than phloretin is the 3 ′, 5′-di-C— of the di-C glycoside produced in this example. It is of glucosylphloretin (molecular weight 598) and shows m / z = 597 in LC-MS analysis in negative scan mode (ES-). The slower of the two peaks of the product is that of the mono-C glycoside 3′-C-glucosylphloretin (nosofazine, molecular weight 436).

  FIG. 15 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. This LC-MS analysis data supports the structural formula of 3 ′, 5′-di-C-glucosylphloretin.

(Example 7)
A glycoside of 2-hydroxypinocembrin was produced using a glucosidase gene MtrCGT1 isolated from Taruma palm.

  0.4 g of the leaves of Taruma palm were collected, frozen with liquid nitrogen, ground in a mortar, and total RNA was extracted using Sepasol-RNA I SuperG (manufactured by Nacalai Tesque).

  To the obtained totalRNA (500 ng), 1 μL of dT-T3 primer was added to make a total of 6 μL, and allowed to stand at 65 ° C. for 10 minutes. Then, 5 × RT buffer 4 μL, 2.5 mM dNTP 8 μL, sterilized water 0.8 μL, RNase out (Invitrogen) 0.2 μL, and Ribatra Ace (TOYOBO) (registered trademark) 1 μL were added as enzymes, 42 ° C., 1 hour RT reaction was performed. 180 μL of extraction buffer was added to the product to make a total of 200 μL, which was used as cDNA.

  PCR was performed using the prepared cDNA as a template and the primers shown in SEQ ID NOs: 13 and 14 in the Sequence Listing.

(SEQ ID NO: 13)
5'-cggatccatgtctgatgaagttgttcatgt-3 '
(SEQ ID NO: 14)
5'-cctcgagttaattgttgacattgtttttcc-3 '

  The PCR product was TOPO cloned into pCR4Blunt-TOPO vector (Invitrogen) and transformed into DH5α by the heat shock method. Plasmid extraction was performed from each of the obtained colonies to obtain pCR4Blunt-TOPO_MtrCGT1 (Taluma palm).

  After confirmation with a DNA sequence (DNA sequencer ABI3100, Life Technology), it was treated with restriction enzymes (NdeI, XhoI) and ligated with the pET-28a (+) vector. The base sequence of the isolated glucosidase gene is shown in SEQ ID NO: 7 (MtrCGT1). The amino acid sequence of the obtained glycosidase derived from Taruma palm is shown in SEQ ID NO: 3 in the sequence listing.

  Transformation into DH5α and plasmid extraction were carried out to obtain pET-28a_MtrCGT1 (Taluma palm).

  Rosetta2 (DE3) (Novagen) was transformed with the prepared plasmid pET-28a_MtrCGT1, and the introduction of the plasmid was confirmed by colony PCR to produce the transformant in this example.

  A di-C glycoside of 2-hydroxypinocembrin was produced using the produced transformant. The experimental method is the same as in Example 1, and the method for analyzing the produced di-C glycoside is the same as in Example 1.

  FIG. 16 shows the spectrum of the HPLC analysis result of the glycoside produced in this example. In FIG. 11, the upper diagram shows the result of detecting the metabolite by HPLC (OD 290 nm) immediately after administration of the transformant and substrate according to this example to the medium, and the lower diagram shows the metabolite 4 hours after administration. The method for analyzing the produced di-C glycoside is the same as in Example 1. In addition, the product was identified by LC-MS. In the figure above, the main peak is that of 2-hydroxypinocembrin. As in Example 1, the left peak in the figure below is the 6,8-di-C-glucosyl-2-hydroxypinocembrin (molecular weight 596) of the di-C glycoside produced in this example. The peaks on the right are those of the mono-C glycoside 6-C-glucosyl-2-hydroxypinocembrin (molecular weight 434), and were each identified. From the figure, it can be seen that a di-C glycoside of 2-hydroxypinocembrin has been produced.

  FIG. 17 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. This LC-MS analytical data (m / z = 595) supports the structural formula of 6,8-di-C-glucosyl-2-hydroxypinocembrin.

(Example 8)
A glycoside of 2-hydroxynaringenin was produced using a glucosylase gene isolated from Taruma palm. Equipment used, reagents used including primers, experimental methods, etc. are the same as in Example 7.

  FIG. 18 shows the spectrum of the HPLC analysis result of the glycoside produced in this example. In FIG. 18, the upper diagram shows the results of detecting the metabolite by HPLC (OD 290 nm) immediately after administration of the transformant and the substrate according to this example to the medium, and the lower diagram shows the metabolites 4 hours after the administration. The method for analyzing the produced di-C glycoside is the same as in Example 1. In the above figure, the main peak is that of 2-hydroxynaringenin. Unlike Example 5, this example shows an example in which no acid treatment was performed. In the figure below, the left peak is that of the di-C glycoside produced in this example, 6,8-di-C-glucosyl-2-hydroxynaringenin (molecular weight 612), and the right peak is The mono-C glycosides of 6-C-glucosyl-2-hydroxynaringenin (molecular weight 450) were identified. From FIG. 18, it can be seen that a di-C glycoside of 2-hydroxynaringenin is produced.

In conjunction with the above HPLC, the product was identified by LC-MS. FIG. 19 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. From FIG. 19, it can be seen that a di-C glycoside of 2-hydroxynaringenin is produced.

Example 9
A glycoside of 2-hydroxynaringenin was produced using a glucosidase gene isolated from soybean. Experimental equipment and experimental procedures are the same as in Example 7. The used primers are shown in SEQ ID NOs: 15 and 16. The base sequence of the extracted glycosidase gene is shown in SEQ ID NO: 8 in the sequence listing. In addition, the amino acid sequence of soybean-derived glycoside (GmCGT2) is shown in SEQ ID NO: 4 in the sequence listing.

(SEQ ID NO: 15)
5'-ggtcatatgtctgtttctgaacgtgttg-3 '
(SEQ ID NO: 16)
5'-ggctccgagtcaagtagcttgagaattcctc-3 '

  FIG. 20 shows the spectrum of the HPLC analysis result of the glycoside produced in this example. The upper diagram shows the results of detecting metabolites by HPLC (OD290nm) 4 hours after administration of the transformant and substrate according to this example immediately after administration to the medium. The method for analyzing the produced di-C glycoside is the same as in Example 7. In the above figure, the main peak is that of 2-hydroxynaringenin. In the figure below, each main peak is 6,8-di-C-glucosyl-2-hydroxynaringenin (molecular weight 612) and 6-C-glucosyl-2-hydroxynaringenin (molecular weight 450) in order of increasing retention time. Respectively, m / z = 611 and m / z = 449 are shown by LC-MS analysis in negative scan mode (ES-).

  FIG. 21 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. From FIG. 21, it can be seen that a di-C glycoside of 2-hydroxynaringenin is produced.

(Example 10)
A glycoside of phloretin was produced using a glucosidase gene isolated from soybean. Equipment used, reagents used including primers, experimental methods, etc. are the same as in Example 9.

  FIG. 22 shows the result of HPLC analysis of the product of this example. In FIG. 22, among the two peaks of the product having a shorter retention time than phloretin, the faster peak is the 3 ′, 5′-di-C— of the di-C glycoside produced in this example. It is of glucosylphloretin (molecular weight 598) and shows m / z = 597 in LC-MS analysis in negative scan mode (ES-). The slower of the two peaks of the product is that of the mono-C glycoside 3′-C-glucosylphloretin (nosofazine, molecular weight 436).

  FIG. 23 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. This LC-MS analysis data supports the structural formula of 3 ′, 5′-di-C-glucosylphloretin.

(Example 11)
The obtained di-C glycoside was contained in the above blending amount to obtain a C glycoside-containing product.

(Example 12)
C-glycoside was produced using a glycoside enzyme gene (FeCGTa) isolated from buckwheat (Fagopyrum esculentum) cotyledons. The glycoside produced in this example is not a di-C glycoside according to the present invention but a mono-substituted mono-C glycoside in which one sugar is bonded to a substrate. Compared to saccharification technology, it is a simple method by using E. coli transformants, and it is new in that it enables highly efficient conversion exceeding 90% by using FeCGTa as a saccharifying enzyme gene It is. This method for producing a mono-C glycoside or di-C glycoside using a buckwheat-derived glycoside enzyme gene can also constitute a novel invention. In this example, the equipment used, the reagent used, and the like are the same as in Example 7. The used primers are shown in SEQ ID NOs: 17 and 18. The base sequence of the extracted glycosidase gene (FeCGTa) is shown in SEQ ID NO: 9 in the sequence listing. As a specific method, E. coli Rosetta2 (DE3) was transformed with a plasmid in which FeCGTa was introduced into pET28a (+). Thereafter, the obtained transformant was cultured in LB medium, and IPTG was added to induce protein expression at 22 ° C.

(SEQ ID NO: 17)
5'- ccggcatatgatgggagatttaacaacttc -3 '
(SEQ ID NO: 18)
5'- cctcgagaattcaacgtttaagacttccga -3 '

  FIG. 24 shows the result of HPLC analysis of the reaction product of the transformant using FeCGTa and 2-OH pinocembrin according to this example. In FIG. 24, the peak with a shorter retention time than 2-hydroxypinocembrin is the mono-C glycoside 6-C-glucosyl-2-hydroxypinocembrin (molecular weight 434) produced in this example. It shows m / z = 433 in LC-MS analysis in negative scan mode (ES-). In FIG. 24, it can be seen that 90% or more of the administered substrate is converted to glycoside.

  FIG. 25 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis. This LC-MS analytical data supports the structural formula of 6-C-glucosyl-2-hydroxypinocembrin.

  In this example, 2-hydroxypinocembrin was used as a substrate. However, in the method for producing a glycoside using FeCGTa, phloretin, 2-hydroxynaringenin, 2-phenyl-2 ′, 4 ′, 6 The mono-C glycoside of '-trihydroxyacetophenone can also be produced with high efficiency. FIG. 26 shows the results of HPLC analysis when a phloretin glycoside was produced using FeCGTa. FIG. 27 shows a mass spectrum in which the product was detected by negative scan mode (ES−) of a mass spectrometry (MS) detector in HPLC analysis.

  The glycosylation enzyme of the present invention is used for efficiently producing a di-C glycoside disubstituted with a sugar using phenylpropanoids and acetophenones as an aglycone.

  The glycoside enzyme gene or cDNA of the present invention is used in a method for producing a C-glycoside disubstituted with a sugar by incorporating it into a plasmid or transforming it into a transformant.

  The sugar-disubstituted C-glycoside of the present invention is incorporated into foods and drinks, pharmaceuticals, supplements, and feeds as active ingredients, for C-glycoside-containing products that exhibit various medicinal effects such as antitumor effects. Used.

Claims (13)

A saccharogenic enzyme derived from citrus or beans,
It has an enzyme activity for producing a C-glycoside disubstituted with a sugar by carbon-carbon bonding to the two carbon atoms in the skeleton of the substrate selected from phenylpropanoids and acetophenones. Glycosylating enzyme.   The substrate may be substituted with hydrogen of a phenyl group by a hydroxyl group, and is the phenylpropanoid selected from flavonoids and dihydrochalcones, or the acetophenone selected from acetophenone and α-phenylacetophenone. The saccharifying enzyme according to claim 1.   1 or 2 or more of amino acid sequences represented by any one of SEQ ID NOs: 1 to 4 in the sequence list and amino acid sequences represented by any one of SEQ ID NOs: 1 to 4 in the sequence list within the range that retains the enzyme activity. The glycosidase according to any one of claims 1 to 2, wherein the amino acid has any one of a modified amino acid sequence deleted, substituted and / or added.   A glycoside enzyme gene comprising the DNA encoding the glycoside enzyme according to any one of claims 1 to 3.   The enzyme activity of the saccharifying enzyme encoded by the DNA among the base sequence represented by any of SEQ ID NOs: 5 to 8 in the sequence listing and the base sequence represented by any of SEQ ID NOs: 5 to 8 of the sequence listing 5. The glucosidase gene according to claim 4, which has any one of a modified base sequence in which one or two or more bases are deleted, substituted, and / or added within a range in which is maintained.   A cDNA encoding the saccharifying enzyme according to any one of claims 1 to 3.   A plasmid comprising the glycosyltransferase gene according to any one of claims 5 to 6.   A transformant comprising the plasmid according to claim 7 introduced into a host cell.   The transformant according to claim 8, wherein the host cell is Escherichia coli.   A step of incubating the transformant according to any one of claims 8 to 9, a substrate selected from phenylpropanoids and acetophenones, and a saccharide together with the skeleton of the substrate. C-glycoside disubstituted with a sugar, wherein the sugar is carbon-carbon bonded to two carbon atoms to form a disubstituted C-glycoside with the sugar, and the substrate is glycosylated. Body manufacturing method.   The substrate may have its phenyl group hydrogen substituted with a hydroxyl group, and is the phenylpropanoid selected from flavonoids and dihydrochalcones, or the acetophenones selected from acetophenone and α-phenylacetophenone The glycosylation method according to claim 10, wherein   It is manufactured by the glycosylation method according to any one of claims 9 to 10, wherein each sugar is carbon-carbon bonded to 2 carbon atoms in the skeleton of the substrate selected from phenylpropanoids and acetophenones. A sugar-disubstituted C-glycoside, which is a glycoside disubstituted by the sugar. A C-glycoside comprising a sugar-disubstituted C-glycoside according to claim 12 as an active ingredient and selected from foods, drinks, pharmaceuticals, supplements, and feeds Contained products.