JP2015193558A - Anti-inflammatory agent containing stilbene analogue compound as active ingredient - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a compound useful as an anti-inflammatory agent and to provide an anti-inflammatory agent using the same.SOLUTION: The invention provides an anti-inflammatory agent containing as an active ingredient a stilbene compound which can be obtained from propolis from Senegal.

Description

  The present invention relates to an anti-inflammatory agent comprising a stilbene analog as an active ingredient.

  Stilbene is an aromatic compound in which two benzene rings are bonded with an ethylene-ethylene structure in between. Azo dyes are prominent as pigments and dyes. Further, as a naturally occurring stilbene compound, a stilbene tetramer and resveratrol contained in the genus Vateria indica are known (Patent Document 1).

  In the course of studying physiological functions of compounds derived from natural products, the present inventors have found a stilbene compound that has not been known in nature in the propolis of Senegal and is considering its use.

JP 2002-173490 A

  An object of the present invention is to provide a compound useful as an anti-inflammatory agent and an anti-inflammatory agent using the same.

  The present inventors have isolated a stilbene-related compound having a strong anti-inflammatory action from propolis produced in Senegal, found that it can be used as an anti-inflammatory agent, and have completed the present invention.

That is, the present invention has the following configuration.
(1) An anti-inflammatory agent comprising a stilbene compound obtainable from Senegalian propolis as an active ingredient.
(2) The anti-inflammatory agent according to (1), wherein the stilbene compound is any substance represented by formulas 1 to 3.
Formula 1
Formula 2
Formula 3

  The present invention provides a compound effective as an anti-inflammatory agent.

The HPLC pattern of the ethanol extract of poplar, baccaris, Senegal propolis is shown. The HPLC pattern of the solvent extract of propolis from Senegal is shown. The HPLC patterns of fractions 6, 10, and 11 separated by preparative chromatography are shown. It is a schematic diagram of the process of acquiring the fraction obtained in an Example. It is the graph which measured the antioxidant effect by the DPPH test of the fraction obtained in the Example. It is a graph which shows the anti-inflammatory effect of the fraction obtained in the Example. It is a graph which shows the result of having confirmed the cell death in the test of an anti-inflammatory action. It is a graph which shows the result of having tested the iNOS expression inhibitory effect by RT-PCR method. It is a graph which shows the result of having measured NO radical scavenging ability using nitroprusside. It is the graph which tested the concentration dependence of the compound whose NO radical scavenging ability was positive.

This invention is invention which uses the compound represented by Formula 1-3 as an active ingredient.
The compound of the present invention is a known substance and can be isolated from various plants, and the present inventor can isolate it by solvent extraction and chromatography from propolis produced in Senegal as disclosed herein. Can do.
The anti-inflammatory agent of the present invention can be administered to primates such as humans and monkeys, rodents such as mice, rats and rabbits, small pet animals such as dogs and cats, and domestic animals such as cattle, horses and pigs. .

  The anti-inflammatory agent of the present invention comprises a compound represented by formulas 1 to 3, or a salt, solvate or physiologically functional derivative thereof, and one or more pharmaceutically acceptable carriers. A pharmaceutically acceptable carrier generally refers to an inert, non-toxic, solid or liquid, bulking agent, diluent or encapsulating material that does not react with the active ingredients of the present invention, for example, Water, ethanol, polyol (eg, glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, solvents or dispersion media such as vegetable oils, and the like.

The anti-inflammatory agent of the present invention is orally or parenterally, for example, into the skin, subcutaneously, mucous membranes, intravenously, intraarterially, intramuscularly, intraperitoneally, intravaginally, pulmonary, intracerebral. Administered to the eye and intranasally.
Examples of the preparation for oral administration include tablets, granules, fine granules, powders, capsules, chewables, pellets, syrups, solutions, suspensions and inhalants.
For parenteral administration, suppositories, retention enemas, drops, eye drops, nasal drops, injections, mouth washes, and skins such as ointments, creams, gels, controlled-release patches and patches Examples include external preparations.

  The anti-inflammatory agent of the present invention may contain additives commonly used in the pharmaceutical field. Such additives include, for example, excipients, binders, disintegrants, lubricants, antioxidants, colorants, flavoring agents, and the like, and can be used as necessary. In order to achieve sustained release so that it can act for a long time, it can also be coated with a known retarder or the like. Examples of excipients include sodium carboxymethylcellulose, agar, light anhydrous silicic acid, gelatin, crystalline cellulose, sorbitol, talc, dextrin, starch, lactose, sucrose, glucose, mannitol, magnesium aluminate metasilicate, calcium hydrogen phosphate Etc. can be used. Examples of the binder include gum arabic, sodium alginate, ethanol, ethyl cellulose, sodium caseinate, sodium carboxymethyl cellulose, agar, purified water, gelatin, starch, tragacanth, lactose, hydroxycellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, etc. Is mentioned. Examples of the disintegrant include carboxymethyl cellulose, carboxymethyl cellulose sodium, carboxymethyl cellulose calcium, crystalline cellulose, starch, hydroxypropyl starch and the like. Examples of the lubricant include stearic acid, calcium stearate, magnesium stearate, talc, hydrogenated oil, sucrose fatty acid ester, waxes and the like. Examples of the antioxidant include tocopherol, gallic acid ester, dibutylhydroxytoluene (BHT), butylhydroxyanisole (BHA), ascorbic acid and the like. Other additives and drugs as required, such as antacids (sodium bicarbonate, magnesium carbonate, precipitated calcium carbonate, synthetic hydrotalcite, etc.), gastric mucosa protective agents (synthetic aluminum silicate, sucralfate, copper chlorophyllin sodium, etc.) ) May be added.

Example 1
Isolation and identification of each compound from propolis produced in Senegal (1) HPLC pattern An HPLC extract of the propolis bulk mass collected in May 2012 in Hunjung, Fatik, Republic of Senegal under the following conditions The results were compared with the chromatograms of propolis derived from poplar and baccaris, which are well known. FIG. 1C shows the result of HPLC analysis of propolis produced in Senegal. (A) is a known poplar-derived propolis, and (B) is a baccharis-derived propolis.

<HPLC> conditions
Column ： SHISEIDO CAPCELL PAK C18 UG120 (4.6mm id × 250mm)
Gradient: (A) H ₂ O (0.1% TFA), (B) MeCN (0.1% TFA)
(B) 20-100% (0-45min)
Detection: 270 nm
Flow rate: 1.0 mL / min

  From the results of HPLC analysis, it was confirmed that propolis produced in Senegal showed a completely different peak pattern from poplar and baccharis-derived propolis well known so far.

(2) Ethanol extraction and liquid-liquid partition extraction of Senegal propolis 41.2 g of Senegal propolis bulk was finely crushed, immersed in 500 mL of EtOH, and extracted by stirring at room temperature for 1 day. Thereafter, the insoluble solid material was removed using suction filtration, and the obtained extract was concentrated under reduced pressure. The extract yield was 29.0 g.
This EtOH extract was turbid in 300 mL pure water and 300 mL hexane was added. After mixing with a separatory funnel, the upper layer was recovered, and 300 mL of hexane was added again to perform the same operation. The collected upper layer was used as a hexane extract. Next, ethyl acetate was distributed in the same manner as hexane, and the upper layer was the ethyl acetate extract and the lower layer was the water extract. The respective yields were hexane extract (7.0 g), water extract (0.8 g), and ethyl acetate extract (8.8 g).
The results of HPLC analysis of each extract under the following conditions are shown in FIG. (A) shows the pattern of the hexane layer, (B) shows the pattern of the aqueous layer, and (C) the ethyl acetate layer.

<HPLC> conditions
Column ： SHISEIDO CAPCELL PAK C18 UG120 (4.6mm id × 250mm)
Gradient: (A) H ₂ O (0.1% TFA), (B) MeCN (0.1% TFA)
(B) 20-100% (0-45min)
Detection: 270nm
Flow rate: 1.0mL / min

(3) Rough fractionation of ethyl acetate extract by silica gel column chromatography 8.8 g of ethyl acetate extract was coated on an appropriate amount of Silica gel 60 and crude fractionation by silica gel column chromatography (Silica gel CC) under the following conditions. And fractionated into 11 fractions (Fr. 1-11).

<Slica gel column chromatography conditions>
Column tube Glass column (20mm id × 320mm)
Stationary phase Silica gel 60N
Mobile phase (1) CHCl ₃ : MeOH = 10: 0 (140mL)
(2) CHCl ₃ : MeOH = 9.9: 0.1 (100 mL)
(3) CHCl ₃ : MeOH = 9.8: 0.2 (100 mL)
(4) CHCl ₃ : MeOH = 9.5: 0.5 (100 mL)
(5) CHCl ₃ : MeOH = 9: 1 (50 mL)
(6) CHCl ₃ : MeOH = 5: 5 (50 mL)
(7) CHCl ₃ : MeOH = 0: 10 (140mL)

(4) Fractionation by preparative HPLC
The results of analyzing Fr. 6, 10, 11 using analytical HPLC under the following solvent conditions are shown in FIG.
Subsequently, Fr. 6 was further fractionated into Fr. 6-1 to 6 under the following conditions using preparative reverse-phase HPLC.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 65: 35 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 10 was further fractionated into Fr. 10-1 to 9 using the preparative reverse phase HPLC under the following conditions.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 55: 45 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 11 was further fractionated into Fr. 11-1 to 6 under the following conditions using preparative reverse phase HPLC.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 70: 30 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

(5) Isolation and purification of main components by preparative HPLC
Fr. 11-2, 3, 4, 5, and 10-2 were purified under the following conditions to obtain 0.9, 11.3, 5.4, 3.9, and 22.9 mg of Compound 1, 2, 3, 4, and 5, respectively.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 70: 30 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 6-1 and 2 were purified under the following conditions to obtain 74.4 and 19.6 mg of Compound 6 and 7.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 65: 35 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 6-3 was purified under the following conditions to obtain 58.0 mg of Compound 8.

<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 62: 38 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 6-4 was purified under the following conditions to obtain 24.1 mg of Compound 9.
<Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 60: 40 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

Fr. 6-5 was purified under the following conditions to obtain 9.2 mg of Compound 10 <Preparative HPLC conditions>
Column: SHISEIDO CAPCELL PAK C18 UG120 (20mm id × 250mm)
Solvent H ₂ O: MeCN = 50: 50 (0.1% TFA)
Flow rate: 10mL / min
Detection: 270nm

  The above fractionation is schematically shown in FIG.

(6) Structural analysis of isolated compound Various instrumental analyzes were performed to determine the structure of isolated Compound 1-10. Using Acetone-d ₆ as a solvent, NMR measurements such as ¹ H-NMR, ¹³ C-NMR, HSQC, and HMBC were performed. For Compound 2, 3, 6, 7, and 9, NMR measurement of INADEQUATE or 1,1-ADEQUATE was performed. Moreover, since the HRESIMS analysis of each compound was conducted, the conditions are shown below.

Compounds 2-4 and 7-10 were subjected to MS analysis under the following conditions.
<HRESIMS>
Scan mode full MS scan
Ion source ESI (Positive, Negative)
Spray voltage 3.5kV (Positive), 2.0kV (Negative)
Capillary temperature 350 ℃

Compound 1 was subjected to MS analysis under the following conditions.
<HRESIMS>
Scan mode full MS scan
Ion source ESI (Positive, Negative)
Spray voltage 2.7kV (Positive), 2.0kV (Negative)
Capillary temperature 250 ℃

Compound 5 was subjected to MS analysis under the following conditions.
<HRESIMS>
Scan mode full MS scan
Ion source ESI (Positive, Negative)
Spray voltage 2.0kV (Positive), 2.0kV (Negative)
Capillary temperature 250 ℃

Compound 6 was subjected to MS analysis under the following conditions.
<HRESIMS>
Scan mode full MS scan
Ion source ESI (Positive, Negative)
Spray voltage 4.0kV (Positive), 3.0kV (Negative)
Capillary temperature 400 ℃

Hereinafter, determination of the structural formulas of the compounds of Compound 4 (Formula 1), Compound 8 (Formula 2), and Compound 10 (Formula 3) determined as stilbene-related compounds by the above analysis and the like will be described.
Structural analysis of Compound 4
The physicochemical properties of Compound 4 were Molecular formula C ₁₆ H ₁₈ O ₅ , HR-ESI-MS (m / z) found: 289.10740 (MH) ⁻ , calcd .: 289.10760 (MH) ⁻ .
From the result of HRESIMS analysis, a molecular ion peak of (MH) ⁻ was observed at m / z 289.10740 in the negative mode, and the molecular formula was estimated as C ₁₆ H ₁₈ O ₅ .
In ¹ H-NMR spectrum in Acetone-d ₆ , δ 6.38, δ 6.54, and δ 6.71 were estimated to be aromatic protons, and δ 3.72 and δ 3.79 were estimated to be methoxy group protons.
^{In the 13} C-NMR spectrum, 16 signals were observed.
HSQC spectrum revealed the correlation between proton and carbon. Furthermore, from HMBC spectrum and NOESY spectrum, HMBC correlation between proton and carbon and NOE between protons were observed. Structural analysis was conducted in the same manner, and it was assumed that this compound was a compound having two benzene rings, and they were bound by two methylenes.
From the above, it was possible to derive that this compound is a compound having a skeleton in dihydrostilbene.
From the above, the structure of this compound was determined as shown in Formula 1.

Formula 1

  The compound was identified as 4- [2- (3-hydroxy-4,5-dimethoxyphenyl) ethyl] -1,2-benzenediol.

Structural analysis of Compound 8
The physicochemical properties of Compound 8 were Molecular formula C ₁₇ H ₂₀ O _5, HR-ESI-MS (m / z) found: 305.13770 (M + H) ⁺ , calcd .: 305.13890 (M + H) ⁺ .
From the result of HRESIMS analysis, a molecular ion peak of (M + H) ⁺ was observed at m / z 305.13770 in the positive mode, and thus the molecular formula was estimated as C ₁₇ H ₂₀ O ₅ .
In the ¹ H-NMR spectrum in Acetone-d ₆ , δ 6.41, δ 6.43, δ 6.66, δ 6.76, and δ 6.83 were estimated to be aromatic protons, and δ 3.75 and δ 3.80 were estimated to be methoxy group protons.
^{In the 13} C-NMR spectrum, 17 signals were observed.
HSQC spectrum revealed the correlation between proton and carbon. Furthermore, from HMBC spectrum and NOESY spectrum, HMBC correlation between proton and carbon and NOE between protons were observed. From these signals, this compound was considered to be a compound having a structure similar to Compound 4.
Structural analysis was conducted in the same manner, and it was estimated that the compound was a dihydrostilbene skeleton compound. From the above, the structure of this compound could be derived as shown in Formula 2.

Formula 2

  This compound was identified as 5- [2- (3-hydroxy-4-methoxyphenyl) ethyl] -2,3-dimethoxy-phenol (common name: Combretastatin B-2).

Structural analysis of Compound 10
The physicochemical properties of Compound 10 are Molecular formula C ₁₈ H ₂₀ O _5, HR-ESI-MS (m / z) found: 317.13756 (M + H) ^+- , calcd .: 317.13890 (M + H) ⁺ It was. From the result of HRESIMS analysis, a molecular ion peak of (M + H) ⁺ was observed at m / z 317.13756 in the positive mode, and the molecular formula was estimated as C ₁₈ H ₂₀ O ₅ .
In ¹ H-NMR spectrum in Acetone-d ₆ , δ 6.62, δ 6.78, δ 6.87, δ 6.88 are aromatic protons, δ 6.43 and δ 6.49 are double bonds based on the coupling constant (J = 12.2Hz). The protons at the cis position of δ 3.67, δ 3.71, and δ 3.83 were presumed to be protons of the methoxy group.
^{In the 13} C-NMR spectrum, 18 signals were observed.
HSQC spectrum revealed the correlation between proton and carbon. Furthermore, from HMBC spectrum and NOESY spectrum, HMBC correlation between proton and carbon and NOE between protons were observed. From these signals, the present compound was considered to be a compound having a structure similar to that of the conventional compound.
Structural analysis was conducted in the same manner, and it was presumed to have two benzene rings, which were connected by a double bond at the cis position. Therefore, this compound was presumed to be a cis-stilbene skeleton compound. From the above, the structure of this compound could be derived as shown in Formula 3.

Formula 3

  The compound was identified as 5,6-dimethoxy-2,3,7-phenanthrenetriol

Example 2 Antioxidant activity test of each compound Compound 1-10 isolated from Senegalian propolis was tested for antioxidant activity using DPPH.
(1) DPPH radical scavenging activity test A sample was dissolved in EtOH, and 150 μL of 0.1 mM DPPH / EtOH solution was added to 20 μL of this solution and stirred. Absorbance at 517 nm was measured after 1 hour in the dark. Samples were prepared with final concentrations ranging from 50-1000 μM. Then, from the measurement results, the radical scavenging activity rate was determined according to the following formula, and EC50 was calculated. In addition, Trolox was used as a positive control.

Method of calculation
DPPH radical scavenging activity rate (%) = {(Ac-As) / Ac} × 100
Ac: Control absorbance
As: Sample absorbance
For EC50, three points with linearity (R2 = 0.99 or more) were plotted, and the concentration at which 50% radical scavenging activity was shown was determined.

(2) Results
FIG. 5 shows the DPPH radical scavenging rate at 250 μM, and Table 1 shows EC50 values for radical scavenging. The EC50 of Trolox as a positive control was 147.0 μM (36.8 μg / mL).
All of the compounds of Compound 1, Compound 2, Compound 3, Compound 5, Compound 6, Compound 7, and Compound 9 of the present invention had an antioxidant action.

Example 3 Anti-inflammatory activity test (1) Test method
J774.1 cells were cultured in RPMI-1640 medium supplemented with 10% FBS (fetal bovine serum) and 1% penicillin / streptomycin. The cells were prepared in RPMI medium (+ FBS) so that the number of cells was 1.0 × 10 ⁶ cells / mL, and seeded at 100 μL / well in a 96-well plate. After culturing the cells in a 5% CO ₂ , 37 ° C. incubator for 24 hours, 100 μL of a medium supplemented with 10 μg / mL of lipopolysaccharide (LPS) was added to each sample having different concentrations, and the cells were cultured. The sample dissolved in DMSO was added at 0.1% or less with respect to the medium.
NO production was assessed by grease assay after culturing the cells for 24 hours. Transfer 100 μL of the culture supernatant from each well to another 96-well plate, add 100 μL of grease reagent (1% sulfanilamide, 0.1% NL-naphthylethylenediamine, 2.5% H3PO4), and absorb the absorbance at 550 nm. Measured with a microplate reader. The NO production rate (%) was calculated as a value relative to the control (when 0.1% DMSO was added). Quercetin was used as a positive control.
(2) Measurement of cell viability using J774.1 cells At the same time, cell viability was measured using WST-8. The tetrazolium salt WST-8 is a chromogenic substrate that produces highly sensitive water-soluble formazan, and is colored by being reduced by intracellular dehydrogenase. The number of living cells is measured by measuring the absorbance at this time. In this test, 5 μL / well of WST-8 was added to the residue (cells) after collecting the supernatant for the grease assay and incubated at 37 ° C. for 30 minutes. Thereafter, the absorbance at 450 nm was measured with an absorbance plate reader. The cell viability (%) was calculated as a value relative to the control (when 0.1% DMSO was added).

(3) Results Table 2 shows IC50 values, and FIG. 6 shows NO production rates at concentrations of 0.5, 5, and 50 μg / mL. FIG. 7 shows cell viability. Quercetin was used as a positive control, and this IC50 was 18.9 μM. Compound 1, Compound 2, Compound 3, Compound 5, Compound 6, Compound 7, Compound 7, and Compound 9 of the present invention all had a strong anti-inflammatory action. It was also revealed that the cell viability was high even at high concentrations.

Example 4 Measurement of iNOS gene expression level using real-time RT-PCR (1) Test method Mouse-derived J774.1 cells (obtained from RIKEN Biosource Center) were treated with 10% FBS (fetal bovine serum) and 1% The cells were cultured in RPMI-1640 medium supplemented with penicillin / streptomycin. The cells were diluted with RPMI medium (+ FBS) so that the number of cells became 1.0 × 10 ⁶ cells / mL, and seeded at 1 mL / well in a 24-well plate. The cells were cultured in a 5% CO ₂ , 37 ° C. incubator for 24 hours, and 1 mL of medium supplemented with LPS 1 μg / ml was added to each sample having different concentrations, followed by culture. A sample dissolved in DMSO was used at 0.1% or less.
Total RNA was extracted using an RNA extraction kit (NucleoSpin: trade name RNA II) after culturing the cells for 24 hours. Then, cDNA was synthesize | combined using the reverse transcription reaction kit (PrimeScript brand name RT reagent Kit). The reverse transcription reaction was performed at 37 ° C. for 15 minutes (reverse transcription reaction) and at 85 ° C. for 5 seconds (reverse transcriptase inactivation).
Next, the expression level of iNOS was measured using a real-time PCR kit (SYBR: trade name Premix Ex Tag II). As a reference gene, the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was measured and corrected. The base sequence of the probe used is shown below. The PCR reaction was performed according to the following protocol.

Hold (initial modification)
1 Cycle
95 ° C, 30 seconds
2Step PCR
40 cycles
95 ° C, 5 seconds, 60 ° C, 30 seconds
Dissociation
iNOS (F) CCGATTTAGAGTCTTGGTGAAAGTG (sequence 1)
(R) CTGACCCGTGAAGCCATGA (sequence 2)
GAPDH (F) CGTGTTCCTACCCCCAATGT (sequence 3)
(R) ATGTCATCATACTTGGCAGGTTTCT (sequence 4)

(2) Results FIG. 8 shows the result of the expression rate of iNOS by real-time RT-PCR. When iNOS expression of 8 compounds (Compound 1, 2, 5, 6, 7, 8, 9, 10) that strongly suppressed NO production was confirmed using real-time RT-PCR, all 8 compounds were confirmed. However, iNOS expression was suppressed.

Example 5 FIG. Measurement of NO radical scavenging ability using nitroprusside (SNP) (1) Test method
NO radicals generated by dissolving SNP in the solution were detected with a grease reagent. SNP was dissolved in phosphate buffer (PBS) pH 7.4 to prepare 10 mM SNP-PBS. Samples of different concentrations dissolved in DMSO were added and incubated in a water bath at 25 ° C. for 180 minutes with agitation. Thereafter, after an interval of 30 minutes, 0.1 mL of the sample was colored with 0.1 mL of the grease reagent, and the absorbance was measured at 550 nm. In addition, quercetin was used as a positive control.

(2) Results Table 3 and FIGS. 9 and 10 show the results of NO radical scavenging rate using 10 mM SNP-PBS. Table 3 shows the IC50 value, FIG. 9 shows the activity at a concentration of 200 μM, and FIG. 10 shows the concentration-dependent change in activity for the compound in which the activity was observed.
In addition, quercetin was used as a positive control. The NO production scavenging activity rate was 48.6 ± 1.7% at a concentration of 200 μM. Compound 2-6 showed activity equivalent to quercetin at a concentration of 200 μM. Comparing Compound 3 and 7 and Compound 4 and 8 with the same skeleton, Compound 3 or 4 with a catechol structure captured more NO radicals. From this, it was suggested that the activity was increased by the presence of the catechol structure, contrary to the result of iNOS expression. Regarding Compound 2, 5, 6, and 9 which are dihydrophenanthrene skeleton compounds, Compound 5 and 6 showed high activity despite having no catechol structure, and Compound 9 showed no activity. Among compounds 2-10, NO radical scavenging activity was observed in highly polar compounds such as compound 2-6.

  From the above test results, it was revealed that the compounds of Compound 1, Compound 2, Compound 3, Compound 5, Compound 5, Compound 6, Compound 7, and Compound 9 of the present invention are all useful as anti-inflammatory agents.

Claims (2)

  An anti-inflammatory agent comprising, as an active ingredient, a stilbene-related compound that can be obtained from Senegal propolis. The anti-inflammatory agent according to (1), wherein the stilbene analog is any substance represented by formulas 1 to 3.
Formula 1
Formula 2
Formula 3