JP2015116141A - Isobutyric acid ester-producing microorganisms and methods for producing isobutyric acid ester - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a microorganism capable of producing isobutyric acid ester and a method for producing isobutyric acid ester using it.SOLUTION: The invention provides a microorganism transformed to have an ability to produce isobutyric acid ester by transducing a gene of alcohol acyltransferase gene capable of producing isobutyric acid ester from isobutyryl CoA and an alcohol or phenolic compound. Also provided is a method for producing isobutyric acid ester that comprises a step of producing isobutyric acid ester by the action of the microorganism.

Description

  The present invention relates to a method for producing an isobutyric acid ester using a microorganism.

Isobutyric acid ester is an ester compound that is important as a raw material for producing mainly fragrance esters, pharmaceuticals, peroxides and the like. There are several industrial production methods, for example, a method of producing isobutyric acid from isobutyraldehyde as a raw material and esterifying it is known. These chemical production methods depend on fossil raw materials and require a lot of energy. In recent years, from the viewpoint of preventing global warming and protecting the environment, a technique for producing various chemical products from biomass has attracted attention as a carbon source that can replace conventional fossil raw materials. Isobutyric acid esters are also expected to be produced from biomass raw materials, but no specific production examples from biomass raw materials have been reported.
Methods for producing isobutyric acid by microorganisms have been proposed (see Patent Document 1), but even if these methods are used, the esterification process for producing isobutyric acid ester still depends on chemical methods. is there.
Alcohol acyltransferase is known as a fruity flavor synthase. Patent Document 2 proposes a method for synthesizing various esters that are fruit flavors by identifying the same enzyme gene contained in a specific fruit.
On the other hand, for some alcohol acyltransferases, the ability to produce isobutyric acid esters has been known (Non-patent Document 1), but it has been reported whether they can effectively produce isobutyric acid esters in microorganisms. It was completely unknown.

International Publication No. 2012/109534 International Publication No. 00/32789 Pamphlet Japanese Patent Laid-Open No. 10-337185 Japanese Patent Laid-Open No. 10-24867 JP 2011-200133 A JP-A-5-64589

Nippon Shokuhin Kogyo Gakakishi Vol. 39, no. 2, 183 to 187 (1992) Botanical Journal of the Lincoln Society, 2009, 161, 105121 Methods in Enzymology (2000) 324: 129-138 Journal of Bacteriology, 1981, 148 (2), 647-652.

As described above, actually, fermentation production of isobutyric acid ester with microorganisms has not been achieved.
Although some proposals or studies have been made, there is no example of actually producing isobutyric acid ester by microorganisms, and establishment of an effective production method has been desired.
An object of the present invention is to provide a microorganism having an ability to produce an isobutyric acid ester and a method for producing an isobutyric acid ester using the same.

By introducing an alcohol acyltransferase gene and transforming a microorganism, it was found that the microorganism can produce an isobutyric acid ester, and the present invention has been completed. That is, the present invention is as follows.
(1) A microorganism having an ability to produce isobutyric acid ester.
(2) The microorganism according to (1), wherein the isobutyric acid ester is any of isobutyric acid methyl ester, isobutyric acid ethyl ester, or isobutyric acid butyl ester.
(3) The microorganism according to (1) or (2), into which an alcohol acyltransferase gene having an activity of synthesizing isobutyric acid ester from isobutyryl CoA and alcohol or phenol is introduced.
(4) The microorganism according to (3), further comprising a gene encoding 2-oxoisovalerate dehydrogenase having an activity of synthesizing isobutyryl CoA from 2-oxoisovalerate.
(5) The microorganism according to any one of (1) to (4), wherein the microorganism belongs to the genus Rhodococcus or the genus Escherichia.
(6) The microorganism according to any one of (1) to (5), which has an ability to accumulate 1 ppm or more of isobutyric acid ester.
(7) A method for producing an isobutyric acid ester comprising a step of producing an isobutyric acid ester in the presence of an alcohol or a phenol by the action of the microorganism according to any one of (1) to (6).
(8) A method for producing an isobutyric acid ester comprising a step of producing an isobutyric acid ester from 2-oxoisovaleric acid in the presence of an alcohol or a phenol by the action of the microorganism according to any one of (1) to (6).
(9) The method for producing isobutyric acid ester according to (7) or (8), wherein 1 ppm or more of isobutyric acid ester is accumulated.

  The present invention provides a microorganism having the ability to produce isobutyric acid esters. By using the microorganism of the present invention, fermentation production of isobutyric acid ester can be achieved. As a result, compared to the conventional chemical manufacturing process, the load on energy, resources, and the environment can be significantly reduced, and isobutyric acid ester can be efficiently produced.

It is a figure which shows the manufacturing process from 2-oxoisovaleric acid to isobutyric acid ester. It is a figure which shows the structure of the plasmid for LigD homologous gene deletion. It is a figure explaining the preparation method of the plasmid for gene deletion using In Fusion method. It is a figure which shows the structure of the plasmid for both BCKAD-AAT expression.

  DESCRIPTION OF EXEMPLARY EMBODIMENTS Hereinafter, preferred embodiments for carrying out the invention will be described with reference to the drawings. In addition, embodiment described below shows an example of typical embodiment of this invention, and, thereby, the range of this invention is not interpreted narrowly.

(1) Microorganism having ability to produce isobutyric acid ester In the present invention, isobutyric acid ester is a compound represented by Formula 1. In Formula 1, R represents a linear or branched hydrocarbon group having 1 to 20 carbon atoms. The hydrocarbon group may be saturated or unsaturated acyclic and may be saturated or unsaturated cyclic. Preferably, it is a linear or branched C1-C10 unsubstituted alkyl group, aralkyl group or aryl group. Particularly preferably, methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, sec-butyl group, tert-butyl group, n-pentyl group, isopentyl group, tert-pentyl group, n- A hexyl group, an isohexyl group, a 2-hexyl group, a dimethylbutyl group, an ethylbutyl group, a heptyl group, an octyl group, a 2-ethylhexyl group having 1 to 8 carbon atoms, a benzyl group, or a phenyl group.

In the present invention, the microorganism having the ability to produce isobutyric acid esters is a microorganism having the ability to produce isobutyric acid esters from renewable raw materials and / or biomass resulting from the use of the renewable raw materials and alcohols or phenols. There is no particular limitation.
A “renewable raw material” is a natural resource, such as a resource derived from an animal, plant or microorganism, which can be reconstructed by natural processes. “Biomass resulting from the use of renewable raw materials” means gasification, liquefaction, saccharification, enzyme treatment, fermentation, fermentation product distillation, hydrolysis, dehydration, concentration, drying, etc. to obtain various organic substances from renewable raw materials This means all resources generated by processing, including at least one of the following steps. Biomass includes plant material, animal material, biodegradable waste, and the like.

  In the present invention, the alcohol or phenol is a compound represented by the following formula 2. Since the structure of alcohol or phenol corresponds to isobutyric acid ester, the structure has the same definition as R in the formula 1, and represents a linear or branched hydrocarbon group having 1 to 20 carbon atoms. The hydrocarbon group may be saturated or unsaturated acyclic and may be saturated or unsaturated cyclic. Preferred are linear or branched unsubstituted alcohols having 1 to 10 carbon atoms, aralkyl alcohols or phenols, particularly preferably methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentyl alcohol, isopentyl alcohol, tert-pentyl alcohol, n-hexyl alcohol, isohexyl alcohol, 2-hexyl alcohol, dimethylbutyl alcohol, ethylbutyl alcohol, heptyl alcohol, octyl alcohol, 2-ethylhexyl alcohol Or an alkyl alcohol having 1 to 8 carbon atoms, benzyl alcohol or phenol. Among these, unsubstituted alcohol having 1 to 4 carbon atoms such as methanol, ethanol, n-propanol, isopropanol, n-butanol and isobutanol is particularly preferable.

  In the present invention, a microorganism having the ability to produce isobutyrate ester is specifically transformed by introducing an alcohol acyltransferase gene having an activity of synthesizing isobutyrate ester from isobutyryl CoA and alcohol or phenols. It is preferable that the microorganism be a microorganism.

  In the present invention, isobutyryl CoA is a compound represented by the following structural formula. Isobutyryl CoA is known in vivo as a metabolic intermediate for valine.

In the present invention, alcohol acyltransferase (hereinafter referred to as AAT) is an enzyme having a catalytic action of synthesizing an ester by transferring an acyl group of acyl CoA to alcohol or phenol.
AAT is said to be involved in the formation of esters in various fruits.
AAT is ginger (banana), rose (strawberry, apple, pear, peach), cucumber (melon), azalea (kiwi), perilla (olive), eggplant (tomato), mugwort (lemon, mango) ) And the like are known to exist in plants.

The AAT used in the present invention is not particularly limited as long as it is a bio-derived catalyst having an ability to produce isobutyric acid ester using isobutyryl CoA and alcohol or phenol as raw materials. As the enzyme source, those derived from plants are preferable, and among them, those classified as angiosperms are preferable.
AAT suitable for the present invention can be selected from plants by the following method. Acquired by cutting the appropriate part of the tissue as necessary. A solution containing isobutyryl CoA and the alcohol or phenol represented by Formula 2 is added to the cutting site, shaken, and allowed to react for a certain time. The synthetic activity can be confirmed by confirming the presence or absence of isobutyric acid ester in the reaction solution by GC (gas chromatography).
Specifically, for example, pulp or peel is cut, and a solution containing 1 to 10 mM isobutyryl CoA, 0.35 M KCl and 5 to 50-fold molar amount of n-butanol is added thereto, and 1 to 10 at 30 ° C. Shake time. After completion of the reaction, AAT applicable to the present invention can be selected by confirming the presence or absence of isobutyric acid ester by GC.

Suitable AAT enzyme sources for the present invention include Zingiberales, Rosales, Azaleas, Cucurbites, Brassicales, Laurales, and Rice. (Poales), Palms (Areales), Asparagales, Saxifragales, Caryophylles, Vitales, Malphialae, Malpihiales ), Mucarididae (Sapindales), Aoiidae (Malvales), Myrtaceae (Myrtales), Buttercups Ranunculales), Solanales (Solanales), lamiales (Lamiales), those belonging to one of the eye selected from the group consisting of gentianales (Gentianales) and calycerales (Asterales).
Among these, preferably selected from the group consisting of Zingiberales, Rosales, Azaleas, Ericales, Cucurbitales, Brassicales and Laurales It belongs to one of the eyes. Particularly preferred are plants belonging to the order of Rosales.

As plants belonging to the order Ginger, plants of Musaceae and Zingiberaceae are preferable. As plants belonging to the order of Rosaceae, plants of Rosaceae and Moraceae are preferable. The plants belonging to the order Azalea are Ericaceae, Actinidiaceae, Ebenaceae, and Theaceae. The plant belonging to the order of Cucurbitaceae is preferably a plant belonging to the family Cucurbitaceae. The plants belonging to the order of Brassicaceae are preferably the plants of the family Papaceae (Caricaceae) and Brassicaceae (Brassicaceae). A plant belonging to the family Camphoraceae is preferably a plant belonging to the family Lauraceae. As those belonging to the order of rice, plants of the family Pineappleceae (Bromeliaceae) and Poaceae (Poaceae) are preferable. As a member belonging to the order of palms, plants of the family Alaceaceae are preferable. Orchidaceae and Iridaceae plants are preferred as belonging to the order of the genus Coleoptera. Examples of the family belonging to the order of the genus Lepidoptera are Grossaceae. A plant belonging to the order of the genus Caryophyllaceae is preferably a plant of the family Caryophyllaceae. Vitaceae plants are preferred as belonging to the order of Grapes. The plants belonging to the order of the quintranoaceae are preferably the plants of the family Malphiaceae, Passifloraceae, Euphorbiaceae and Salicaceae. The plant belonging to the order of Oxalisaceae is preferably a plant of the family Oxalidiaceae. The plant belonging to the order of legumes is preferably a plant of the family Legaceae. The plants belonging to the order in the order of the order of the genus Mucurodia are Rutaceae, Sapindaceae and Anacardiaceae. A plant belonging to the family Malvaceae is preferable as belonging to the order of Mallow. Plants belonging to the order of Myrtaceae are Lythracaeae, Onagraceae and Myrtaceae. As plants belonging to the order Ranunculaceae, plants of the family Ranunculaceae and Papaveraceae are preferable. As plants belonging to the order of Solanum, solanaceae plants are preferred. Plants belonging to the family Lamiaceae are preferably Oleaceae, Verbenaceae, and Lamiaceae. A plant belonging to the family Gentianaceae is preferably an Apocynaceae. As plants belonging to the order of Asterales, plants of the family Asteraceae are preferable. Related species of the above plants can also be used. More preferably among these, Musaceae, Rosaceae, Ericaceae, Actinidiaceae, Cucurbitaceae, Caricaceae or L.aceae L It belongs to the plant. Particularly preferred are plants belonging to the Rosaceae family.
Specifically, the genus Musa belongs to the genus Musacea, the genus Zingiberaceae belongs to the genus Zingiber, the genus Rosaceae belongs to the genus Fragaria, the apple (Malus) ), Prunus, Pyrus, Eriobotrya, Chaenomeles, Rubus and Rose, Moraceae (Ficus), belonging to the genus Azalea, belonging to the genus Vaccinium, belonging to the family Matabidae, belonging to the genus Actinidia, belonging to the oyster family, Diospyros As for belonging to the camellia family, camellia (Camellia) genus, as for belonging to the Cucurbitaceae family, the genus Cucumis and the watermelon (Citullulus) genus, as belonging to the family of papaya family, the genus Papaya (Carica) and Vasconcellea (Vasconcellea) ), Belonging to the Brassicaceae family, Arabidopsis genus, belonging to the camphor family, Persea genus, belonging to the pineapple family, Ananas, belonging to the Gramineae family (Oryza), wheat (Triticum), barley (Hordeum), maize (Zea), sorghum and Brachypodium The genus Cocos belongs to the palm family, the genus Vanda belongs to the orchid family, the iris genus belongs to the iris family, and the currant belongs to the currant family. ) Genus, belonging to the genus Phyllidae, belonging to the genus Gypsophila, belonging to the vine family, belonging to the genus Gratis (Vitis), belonging to the family Quintranoaceae, belonging to the genus Malpighia, As for those belonging to the genus Passiflora, belonging to Euphorbiaceae, belonging to the genus Ricinus, as belonging to the willow family, as belonging to the genus Populus, as belonging to the family Oxalis, to the genus Averrhoa, legume As belonging to the genus Medagogo, the genus Lupinus, the genus soybean (Glycine) and the genus Clitoria, the genus Citrus is the genus Citrus and the Aegle, As belonging to the genus Litchi, belonging to the urushi family, genus Mangofera, belonging to the mallow family, genus Durian and cocoa (Theobroma), pomegranate as belonging to the family Misohagi As for the genus (Punica), those belonging to the family Acabanaceae, as for those belonging to the genus Clarkia, as belonging to the Myrtaceae family, as belonging to the genus Psidium, as belonging to the buttercup family As for the genus Acteaa, belonging to the poppy family, the genus Papaver, as belonging to the solanaceae family, the genus Solanum, the capsicum genus, the Nicotiana genus and the Petunia genus The genus Oleaceae belongs to the genus Oleaceae, the family belonging to the genus Oleaceae belongs to the genus Glandularia, the family belonging to the family Lamiaceae, the genus Salvia and the oleophiaceae belong to the family Oleander. The plant belonging to the genus (Rauvolfia), the genus Catharanthus, and the family Asteraceae is preferably a plant of the genus Chamaemelum. Among them, a plant belonging to the genus Bacho, Dutch strawberry, Apple, Sakura, Pear, Sunoki, Matabi, Cucumber, Papaya or Alligator is more preferable.
Among them, plants belonging to the genus Strawberry or Apple are particularly preferred.
More specifically, banana (Musa x paradisiaca), Musa basjoo, Musa coccinea, and Mala sama (Musa acuminata) are particularly preferred as belonging to the genus Basho. Ginger (Zingiber officinale) belongs to the genus Ginger, and Strawberries (Fragaria x ananassa), Virginia strawberry (Fragaria virginiana), Chile strawberry (Fragaria chiloensis) and strawberry fever c. preferable. Among those belonging to the genus Apple, apples (Malus pumila, Malus domestica, Malus baccata), Hanakaidou (Malus halliana), Kaidozumi (Malus floribunda) and dog apple (Malus prunifolia) are particularly preferred. The genus Prunus mume, Prunus avium, Prunus persica, Apricot (Prunus armeniaca), Almond (Prunus dulcis), Prunus salicus (Prunus salicus) Is particularly preferred. As those belonging to the genus Pear, pear communis, pear (Pyrus pyrifolia), pear (Pyrus calleriana) and pear pyraster (Pyrus pyraster) are particularly preferred. As the member belonging to the genus Loquat, loquat (Eriobotrya japonica) is particularly preferable. As that belonging to the genus Boke, quinoline (Chaenomeles sinensis) is particularly preferable. Raspberries (Rubus idaeus) and black raspberries (Rubus fruticosus) are particularly preferred as belonging to the genus Rubus. As the member belonging to the genus Rose, Rana rugosa is particularly preferable. As those belonging to the genus Fig, Ficus carica is particularly preferred. Among the species belonging to the genus Vaccinium are Vaccinium corimbosum, Vaccinium angustifolium, Bilberry (Vaccinium myrtillus), Berryberry (Vaccinium vitis-idaea) and Vulcinium bilberry (especially Vaccinco vacum). Among those belonging to the genus Matabi, Kiwi (Actinidia chinensis, Actinidia deliciosa), Sarnas (Actinidia arguta), Shimasuna pear (Actinidia rufa), and Matabi (especially Actinidia poly) are preferred. Oysters (Diospyros kaki) are particularly preferred as belonging to the genus Oyster. Among the genus Camellia are Camellia sinensis, and those belonging to the genus Cucumber are cucumber (Cucumis sativus), melon (Cucumis melo), western Indian cucumber (Cucumis anguria) and particularly cucumber cucumber et al. A watermelon is particularly preferred as belonging to the genus Watermelon. As a member belonging to the genus Papaya, papaya (Carica papaya) is particularly preferable. As a member belonging to the genus Vasconcerea, mountain papaya (Vasconcellea undinamarcensis) is particularly preferable. As those belonging to the genus Arabidopsis, Arabidopsis thaliana and Arabidopsis lyrata are particularly preferable. Avocado (Persea americana) is particularly preferred as belonging to the genus Vanilla, and pineapple (Ananas comosus) is particularly preferred as belonging to the Ananas genus. Rice (Oryza sativa) is particularly preferable as a member belonging to the genus Rice. As belonging to the genus Wheat, wheat (Triticum aestivum) is particularly preferred. Barley (Hordeum vulgare) is particularly preferred as belonging to the genus Barley. Maize (Zea mays) is particularly preferable as belonging to the genus Maize. Sorghum (Sorghum bicolor) is particularly preferable as belonging to the genus Sorghum. As a member belonging to the genus Dendrobium, Brachypodium distachyon is particularly preferable. As a member belonging to the genus Coconut, coconut (Cocos nucifera) is particularly preferable. As the member belonging to the genus Vanda, a banda (Vanda hybrid cultivar) is particularly preferable. As the member belonging to the genus Iris, Dutch iris (Iris x hollandica) is particularly preferable. As those belonging to the genus Currant, ribs nigrum is particularly preferable. As belonging to the genus Gypsophila, gypsophila (Gypsophila paniculata, Gypsophila elegans) is particularly preferable. Grapes (Vitis vinifera, Vitis labrusca) are particularly preferred as belonging to the genus Grape. As belonging to the genus Hollytrano, acerola (Malpighia grabra) is particularly preferred. Passion fruit (Passiflora edulis) is particularly preferred as belonging to the genus Passiflora. As the member belonging to the genus Castorium, castor bean (Ricinus communis) is particularly preferable. Cottonwood (Populus trichocarpa) is particularly preferred as belonging to the genus Porcupine. Star fruit (Averhoa carambola) is particularly preferred as belonging to the genus Carambola. As a member belonging to the genus Umanago, Medicago truncatula is particularly preferable. Lupine (Lupinus albus) is particularly preferable as belonging to the genus Haupibean. Soybean (Glycine max) is particularly preferable as belonging to the genus Soybean. As a member belonging to the genus Butterfly, a butterfly (Criteria ternatea) is particularly preferable. Lemon (Citrus limon) is particularly preferred as belonging to the mandarin genus. Sudachi (Citrus sudachi), Kavos (Citrus sphaerocarpa), Grapefruit (Citrus x paradisi), Yuzu (Citrus aurantifolia), Citrus aurantifolia (especially Citrus unsic) (Citrus unsushi). Aegle marmelos is particularly preferred as belonging to the genus Aegle. Litchi chinensis is particularly preferred as belonging to the genus Ganoderma. Mango (Mangifera indica) is particularly preferred as belonging to the genus Mango. As a member belonging to the genus Durian, durian (Durio zibetinus) is particularly preferable. The cocoa genus is particularly preferably cocoa (Theobroma cacao). Pomegranate (Punica granatum) is particularly preferable as belonging to the genus Pomegranate. As belonging to the genus Sanjisou, fairy fans (Clarkia breweri) and Red ribbons (Clarkia concinna) are particularly preferred. As belonging to the genus Vanjiro, guava (Psidium guajava) is particularly preferred. As the member belonging to the genus Ruijosho, American tuna (Actea racemosa) is particularly preferable. As those belonging to the genus Poppy, poppy (Papaver somniferum), Oni-geshi (Papa orientale), and Papaver Oni-geshi (Papa bractatum) are particularly preferable. Tomato (Solanum lycopersicum) is particularly preferable as belonging to the genus Solanum. As those belonging to the genus Capsicum, capsicum annuum and capecum chinense are particularly preferable. As a member belonging to the genus Tobacco, tobacco (Nicotiana tabacum, Nicotiana attenuata) is particularly preferable. Petunia (Petunia x hybrida) is particularly preferred as belonging to the genus Tsukubanasagao. As the thing belonging to the genus Olive, olive (Olea europaea) is particularly preferable, and as the thing belonging to the genus Grandeuraria, bijozakura (Glandularia x hybrida) is particularly preferable. Salvia splendens is particularly preferable as belonging to the genus Akigiri. As that belonging to the genus Lauolphia, Indian jaboku (Rauvolfia serpentina) is particularly preferable. As belonging to the genus Periwinkle, Catharanthus roseus is particularly preferable. As those belonging to the genus Chamomile, Roman chamomile (Chamaemelum nobile) is particularly preferred.

  Among these, banana, strawberry, apple, plum, pear, brieberry, kiwi, melon, papaya or avocado is more preferable. Furthermore, an apple or a strawberry is particularly preferable.

  In the present invention, the classification of plants shall be in accordance with the APG plant classification system 3rd edition (Botanical Journal of the Lincoln Society, 2009, 161, 105121).

  Some AAT genes have been published (see, for example, Patent Document 2). Based on the information, a DNA probe can be prepared, for example, a primer used for PCR can be prepared, and the gene can be isolated by performing PCR. It is also possible to completely synthesize the base sequence of the AAT gene by a usual method. Whether or not AAT whose gene information is known has isobutyric acid ester synthesis activity can be confirmed in the same manner as described above. On the other hand, for AAT for which genetic information is unknown, AAT can be purified, and genetic information can be obtained by genetic engineering techniques based on the protein.

In the present invention, a preferable AAT gene is not particularly limited as long as the translation product has an ability to produce isobutyric acid ester, and is appropriately selected from the AAT enzyme sources. Particularly preferred are AAT apple-derived AAT gene (SEQ ID NO: 2), strawberry-derived AAT gene (SEQ ID NO: 4), and strawberry-derived AAT gene (SEQ ID NO: 6).
In the present invention, the AAT gene includes an amino acid sequence in which one or more amino acids are substituted, deleted or added in the wild-type amino acid sequence, and has an activity of generating isobutyric acid ester from isobutyryl CoA and alcohol. Also included are genes encoding proteins.
Here, “several” means 40 or less, preferably 20 or less, more preferably 10 or less. In order to introduce a mutation into a gene, a mutation introduction kit using site-directed mutagenesis, for example, QuikChangeTM Site-Directed Mutagenesis Kit (Stratagene), GeneTailorTM Site-Directed
Mutagenesis System (Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: Takara Bio Inc.) and the like can be used. Alternatively, the entire gene having a sequence containing a mutation may be artificially synthesized.

  In the present invention, the DNA base sequence can be confirmed by sequencing by a conventional method. For example, based on the Sanger method, it is also possible to confirm the sequence using an appropriate DNA sequencer.

  In the present invention, the AAT gene has 90% or more, preferably 95% or more, more preferably 99.5% or more, and still more preferably 99.9% or more identity with a protein comprising a wild-type amino acid sequence. Also included are genes that encode proteins that have the activity of generating isobutyric acid esters from isobutyryl CoA and alcohol.

  Furthermore, in the present invention, the AAT gene hybridizes under stringent conditions to a polynucleotide having a base sequence complementary to the wild-type base sequence, and generates an isobutyric acid ester from isobutyryl CoA and alcohol. Also included is a gene encoding a protein having Examples of the stringent conditions include, for example, a nylon membrane on which DNA is immobilized, 6 × SSC (1 × SSC is 8.76 g of sodium chloride, 4.41 g of sodium citrate dissolved in 1 liter of water), Hybridization by incubation with a probe at 65 ° C. for 20 hours in a solution containing 1% SDS, 100 μg / mL salmon sperm DNA, 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 0.1% ficoll. Although the conditions to perform can be mentioned, it is not necessarily limited to this. Those skilled in the art should set hybridization conditions by taking into account various conditions such as probe concentration, probe length, reaction time, etc. in addition to such conditions as buffer salt concentration and temperature. Can do.

As washing conditions after hybridization, for example, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.”, and more stringent conditions, for example, Conditions such as “1 × SSC, 0.1% SDS, 65 ° C.” and “0.5 × SSC, 0.1% SDS, 50 ° C.” can be mentioned.
For details of the hybridization procedure, see Molecular Cloning, A Laboratory Manual 2nd ed. (Cold Spring Harbor Laboratory Press (1989))), Current Protocols in Molecular Biology (John Wiley & Sons (1987-1997)) and the like.

Further, in the present invention, the AAT gene contains 80% or more, more preferably 90% or more, most preferably, when calculated using a wild-type base sequence and BLAST or the like (for example, default or default parameters). A gene encoding a protein consisting of a base sequence having an identity of 95% or more and having an activity of generating isobutyric acid ester from isobutyryl CoA and alcohol is also included. Moreover, the codon of the AAT gene may be converted according to the codon usage frequency of the microorganism host used for transformation.
Here, in the case of a base sequence, the “identity” of the sequences means that both base sequences are aligned so that the bases of the two base sequences to be compared match as much as possible. What is divided by the number of bases is expressed as a percentage. In the above alignment, a gap is appropriately inserted in one or both of the two sequences to be compared as necessary. Such alignment of sequences can be performed using a known program such as BLAST, FASTA, CLUSTALW, and the like. When gaps are inserted, the total number of bases is the number of bases obtained by counting one gap as one base. When the total number of bases counted in this way differs between the two sequences to be compared, the identity (%) is calculated by dividing the total number of bases of the longer sequence and dividing the number of matched bases. The The same applies to amino acid sequence identity.

By introducing DNA encoding these AAT genes and translating them into proteins in the microorganism, isobutyric acid esters can be produced.
In the present invention, the host microorganism into which the AAT gene is introduced is preferably a microorganism having the ability to synthesize isobutyryl CoA. Microorganisms capable of synthesizing isobutyryl CoA specifically include acyl CoA synthase (eg, EC number 6.2.1.-), n-butyryl CoA having the ability to convert isobutyric acid to isobutyryl CoA. Isobutyryl CoA mutase (eg, EC number 5.4.99.13) having the ability to convert acetylene to isobutyryl CoA, isobutyryl CoA dehydrogenase (eg, EC number 1.3) having the ability to convert methacrylyl CoA to isobutyryl CoA 8.1, 1.3.8.7 and 1.3.99.12) or 2-oxoisovalerate dehydrogenase (complex) enzyme having the ability to convert 2-oxoisovalerate to isobutyryl CoA A microorganism having a gene is shown.
Particularly in the present invention, it is particularly preferable to use a microorganism having a 2-oxoisovalerate dehydrogenase (hereinafter referred to as BCKAD) gene having an activity of synthesizing isobutyryl CoA from 2-oxoisovalerate.

2-Oxoisovaleric acid (3-methyl-2-oxobutyric acid) is an intermediate substance in the valine biosynthesis pathway, and is a compound that can be biosynthesized by many microorganisms. The enzyme that synthesizes 2-oxoisovaleric acid can directly use the metabolic system originally possessed by the host microorganism.
The same gene can be introduced into a microorganism not having a BCKAD gene as in the case of the AAT. Even in the case of a microorganism already having a BCKAD gene, it is also effective to enhance the activity by introducing a gene in the same manner. That is, by introducing the BCKAD gene into a microorganism having the ability to synthesize 2-oxoisovaleric acid (= valine synthesis ability), isobutyryl CoA can be synthesized and isobutyric acid ester can be produced in the step shown in FIG. .

  BCKAD is known as a branched-chain amino acid degrading enzyme. The BCKAD gene is not particularly limited as long as it is an enzyme gene capable of synthesizing isobutyryl CoA from 2-oxoisovalerate, and is an enzyme gene classified as pyruvate dehydrogenase or oxoglutarate dehydrogenase. Also good.

In the present invention, although there is no particular limitation, the following microorganisms may be mentioned as the host or the source of the BCKAD gene.
Prokaryotic microorganisms include Rhodospirillales, Rhodobacterales, Sphingomonadales, Caulobacterales, Rhizobiales, Parvularculales, and Burkhordelia , Hydrogenophilales, Neisseriales, Nitrosomonadales, Rhodocyclales, Chromatiales, Acidithiobacillales, Xanthomonahales, Xanthomonahales ), Oceanospirillales, Pseudomonadales, Alteromonadales, Vibrionales, Aeromonadales, Enterobacter Enterobacteriales, Salinisphaerales, Legionellales, Desulfobacterales, Desulfarculales, Desulfuromonadales, Syntrophobellovi, les B ), Myxococcales, Acidobacteriales, Actinomycetales, Bifidobacteriales, Rubrobacterales, Solirubrobacterales, Basilis (Bacillales), Lactobacillales, Clostridiales, Thermoanaerobacterales, Natranaerobiales, Sphingobacteria Sphingobacteriales, Bacteroidales, Cytophagales, Flavobacteriales, Deinococcales, Thermales, Gemmatimonadales, Fusobacteria les, Fusobacteria les Eyes (Chloroflexales), Herpetosiphonales, Thermomicrobes (Thermomicrobiales), Thermotogaes (Deferribacterales), Sulfolobales, Desulfurococcales Examples include microorganisms belonging to Thermoproteales, Acidilobales, Halobacteriales, Thermoplasmatales, and Archaeoglobales.

  Preferred microorganisms include Rhodospirillales, Rhodobacterales, Sphingomonadales, Caulobacterales, Rhizobiales, Parvularculales, and Burkholderia. , Hydrogenophilales, Neisseriales, Nitrosomonadales, Rhodocyclales, Chromatiales, Xanthomonadales, Thiotrichales, Thiotrichales (Oceanospirillales), Pseudomonadales, Alteromonadales, Vibrionales, Aeromonadales, Enterobacteriales, Salinisphaela (Salinisphaerales), Legionellales, Desulfobacterales, Desulfarculales, Desulfuromonadales, Syntrophobacterales, Bdellovibrixoles (Myxococcales), Acidobacteriales, Actinomycetales, Rubrobacterales, Solirubrobacterales, Bacillales, Lactobacillales, rids ), Thermoanaerobacterales, Natranaerobiales, Sphingobacteriales, Bacteroidales, Cytophagales Flavobacteriales, Deinococcales, Thermales, Gemmatimonadales, Fusobacteriales, Chloroflexales, Herpetosiphonales, Herpetosiphonales The order of Thermomicrobiales, Thermotogales, Deferribacterales, Sulfolobales, Desulfurococcales, Thermoproteales, Acidilobales, Acidilobales It is a microorganism belonging to the order of Halobacteriales, Thermoplasmatales, or Archaeoglobales.

More preferred microorganisms are Rhodobacterales, Sphingomonadales, Caulobacterales, Rhizobiales, Burkholderiales, Pseudomonadas, Alteromonas, Alteromonas It is a microorganism belonging to the order Enterobacteriales, Vibrionales, Actinomycetales, Bacillales, or Sphingobacteriales.
Examples belonging to the order Rhodospirillales include Rhodospirillaceae and Acetobacteraceae. Examples belonging to the order Rhodobacterales include Rhodobacteraceae and Hyphomonadaceae. Examples belonging to the order of Sphingomonadales include Sphingomonadaceae and Erythrobacteraceae. Caulobacteres (Caulobacteresae) include the Caulobacteraceae family. The Rhizobiales belong to the Rhizobiaceae family, the Xanthobacteraceae family, the Brucellaceae family, the Phyllobacteriaceae family, the Aurantimonadaceae family, and the Bradyrizobium family. Family (Bradyrhizobiaceae), Methylobacteriaceae, Hyphomicrobiaceae, Rhodobiaceae, and Methylocystaceae. As belonging to the order of Parvularculales, there is Parvularculaceae. Examples of the family belonging to the order Burkholderiales include Burkholderiaceae, Alcaligenaceae, Comamonadaceae, and Oxalobacteraceae. Examples of the family belonging to the order of Hydrogenophilales include the family Hydrogenophilaceae. Neisseriaceae (Neisseriaceae) can be listed as belonging to Neisseriales. Examples of the family belonging to the order of Nitrosomonadales include Nitrosomonadaceae. The Rhodocyclales family includes the Rhodocyclaceae family. Examples of the family belonging to the order Chromatiales include Chromatiaceae and Ectothiorhodospiraceae. Examples of those belonging to the order of Acidithiobacillales include Acidithiobacillaceae. Examples of the family belonging to the order of Xanthomonadales include the family Xanthomonadaceae. Examples belonging to the order Thiotrichales include Francisellaceae and Piscirickettsiaceae. Those belonging to the order of Oceanospirillales include Oceanospirillaceae, Hahellaceae, Halomonadaceae, and Alcanivoracaceae. Examples belonging to the order of Pseudomonadales include Pseudomonadaceae and Moraxellaceae. The Alteromonadidae (Alteromonadales) includes the Alteromonadaceae (Alteromonadaceae), the Shewanellaceae (Shewanellaceae), the Ferrimonasae (Ferrimonadaceae), the Idiomarinaceae, the Colwelliaceae, and the Pseudoalteromonae (Pse) Can be mentioned. Examples belonging to the order Vibronales include Vibrionaceae, and those belonging to the order Aeromonadales include Aeromonadaceae. The Enterobacteriales belong to the family Enterobacteriaceae. Examples belonging to the order Salinisphaerales include Salinisphaeraceae. Examples belonging to the order of Legionellales are Legionellaceae and Coxiellaceae. Examples belonging to the order of Desulfobacterales include Desulfobulbaceae. A member of the order of Desulfarculales is Desulfarculaceae. Examples belonging to the order of Desulfuromonadales include Geobacteraceae. Examples belonging to the order of Syntrophobacterales include Syntrophobacteraceae and Syntrophaceae. Examples belonging to the order of Bdellovibrionales include Bdellovibrionaceae and Bacteriovoracaceae. Examples belonging to the order Myxococcales include Cystobacteraceae, Myxococcaceae, Polyangiaceae and Kofleriaceae. Examples belonging to the order Acidobacteriales include the family Acidobacteriaceae. Examples of the family belonging to the order of Acidimicrobiales include Acidimicrobiaceae. The species belonging to the order Actinomycetales includes Streptosporangiaceae, Streptosporangiaceae, Nocardiopsaceae, Thermomonosporaceae, Pseudonocardiaceae, mat Actinidae, Micromonosporaceae, Actinopolysporaceae, Propionibacteriaceae, Nocardioidaceae, Corynebacteriaceae, Nocardiaceae, Ordoniaceae ), Deetziaceae, Mycobacteriaceae, Tsukamurellaceae, Segniliparaceae, Microbacteriaceae, Microcotactaceae Micrococcaceae, Dermabacteraceae, Dermatophilaceae, Brevibacteriaceae, Cellulomonadaceae, Intrasporangiaceae, Yonesiaceae, Jonesiaceae (Rarobacteraceae), Frankiaceae, Acidothermaceae, Nakamurellaceae, Cryptosporangiaceae, Geodermatophilaceae, Glycomycetaceae, Glycomycetaceae Actinomycetaceae), Streptomycetaceae, Catenulisporaceae, and Kineosporiaceae. Examples of the family belonging to the order Bifidobacteriales include Bifidobacteriaceae. Examples belonging to the order of Rubrobacterales include Rubrobacteraceae. A member of the order of Solirubrobacterales is the Conexibacteraceae family. As for belonging to the order of Bacillales, Bacillaceae, Alicyclobacillaceae, Paenibacillaceae, Planococcaceae, Sporolactobacillaceae and Thermoactinoceae Thermoactinomycetaceae). Examples belonging to the order of Lactobacillales include Lactobacillaceae, Leuconostocaceae, Aerococcaceae, Carnobacteriaceae, and Streptococcaceae. The Clostridiaceae (Clostridiales) include the Clostridiaceae (Clostridiaceae), Syntrophomonadaceae, Eubacteriaceae, Peptococcaceae, Peptostreptococcaceae (Peptostreptococcaceae) Lachnospiraceae) and Oscillospiraceae. Thermoanaerobacteraceae (Thermoanaerobacteraceae) includes those belonging to the order of Thermoanaerobacterales. Examples of the family belonging to the order of Natroaerobiales include Natranaerobiaceae. Examples belonging to the order of Sphingobacteriales include Sphingobacteriaceae and Saprospiraceae. Examples belonging to the order of Bacteroidales include Bacteroidaceae, Marinilabiliaceae, Prevotellaceae, and Porphyromonadaceae. Examples belonging to the order of Cytophagales include Cytophagaceae and Flameovirgaceae. Examples of the family belonging to the order of Flavobacteriales are Flavobacteriaceae. Examples of the family belonging to the order of Deinococcales include Deinococcaceae. A member of the order of Thermales is Thermaceae. Examples of the family belonging to the order of Gemmatimonadales include Gemmatimonadaceae. Examples of the family belonging to the order of Fusobacteriales include the family Fusobacteriaceae. Examples of the family belonging to the order of Chloroflexales include Chloroflexaceae. Examples of the family belonging to the order of Herpetosiphonales include Herpetosiphonaceae. Examples of the family belonging to Thermomicrobials include Thermomicrobiaceae. A member belonging to the order Thermotogaes is Thermotogaceae. Examples of the family belonging to the order of Deferribacterales include Deferribacteraceae. Examples of the family belonging to the order of Sulfolobales include the Sulfolobaceae family. Examples belonging to the order of Desulfurococcales include Desulfurococcaceae. Examples of the family belonging to the order Thermoproteales include the family Thermoproteaceae. As belonging to the order of Acidilobales, there is Acidilobaceae. Examples belonging to the order of Halobacteriales include the family Halobacteriaceae. Examples of those belonging to Thermoplasmatales include Thermoplasmataceae, Picrophilaceae, and Ferroplasmaceae. A member of the order of Archaeoglobes (Archaeoglobaceae).

  Particularly preferred microorganisms are Rhodospirillaceae (Rhodospirillaceae), Acetobacteraceae, Rhodobacteraceae, Hyphomonadaceae, Sphingomonadaceae, Erythrobacteraceae, Erythrobacteraceae, Rhizobiaceae, Xanthobacteraceae, Brucellaceae, Phyllobacteriaceae, Aurantimonadaceae, Bradyrhizobiaceae, Methylobacterium (Methylobacteriaceae), Hyphomicrobiaceae, Rhodobiaceae, Methylocystaceae, Parvularculaceae, Burkholderiaceae, Alkali Nessaceae (Alcaligenaceae), Comamonadaceae (Comamonadaceae), Oxalobacteraceae, Neisseriaceae (Neisseriaceae), Nitrosomonadaceae, Rhodocyclaceae, Chromatiaceae Ectothiorhodospiraceae), Xanthomonadaceae, Francisellaceae, Piscirickettsiaceae, Oceanospirillaceae, Hahellaceae, Alamoracaceae (Halomonaceae) ), Pseudomonadaceae, Moraxellaceae, Alteromonadaceae, Shewanellaceae, Ferrimonadaceae, Idiomarinaceae, Colwellia (Colwelliaceae), Pseudoalteromonadaceae, Vibrionaceae, Aeromonadaceae, Enterobacteriaceae, Salinisphaeraceae, Legionellaceae, Coxiellalaceae, Coxiellalaceae Desulfobulbaceae, Desulfarculaceae, Geobacteraceae, Syntrophobacteraceae, Syntrophaceae, Bdellovibrionaceae, Bacteria B ), Cystobacteraceae, Myxococcaceae, Polyangiaceae, Kofleriaceae, Acidobacteriaceae, Acidimicrobium (Acidimicrobiaceae), Streptosporangiaceae (Streptosporangiaceae), Nocardiopsaceae (Nocardiopsaceae), Thermomonosporaceae (Thermomonosporaceae), Pseudonocardiaceae, Actinosynmicromonoaceae (Actinosynmicromonopoeaceae) ), Nocardioidaceae, Corynebacteriaceae, Nocardiaceae, Gordoniaceae, Dietziaceae, Mycobacteriaceae, Tsukamurellaceae (Tsukamurellaceae) (Segniliparaceae), Microbacteriaceae, Micrococcaceae, Dermabacteraceae, Cellulomonadaceae, Intraspora ngiaceae), Frankiaceae, Acidothermaceae, Nakamurellaceae, Geodermatophilaceae, Glycomycetaceae, Streptomycetaceor, Catenulispora , Rubrobacteraceae, Conexibacteraceae, Bacillaceae, Alicyclobacillaceae, Paenibacillaceae, Lactobacillaceae, Carnobacteriaceae, Carnobacteriaceae (Clostridiaceae), Syntrophomonadaceae, Eubacteriaceae, Peptococcaceae, Lachnospiraceae, Oscillospiraceae Thermoanaerobacteraceae, Thermoanaerobacteraceae, Natranaerobiaceae, Sphingobacteriaceae, Saprospiraceae, Porphyromonadaceae, Cytophobacteriaceae ), Deinococcaceae, Thermaceae, Gemmatimonadaceae, Fusobacteriaceae, Chloroflexaceae, Herpetosiphonaceae, Thermomicrobiaceae, Thermomicrobiaceae, Thermomicrobiaceae Thermotogaaceae (Thermotogaceae), Deferribacteraceae (Deferribacteraceae), Sulfolobaceae (Sulfolobaceae), Desulfurococcaceae, Thermoproteaceae (Thermoproteaceae), Akidilob It is a microorganism belonging to the family Acridobaceae, Halobacteriaceae, Thermoplasmataceae, Picrophilaceae, Ferroplasmaceae or Archaeoglobaceae.

  More particularly preferred microorganisms include Rhodobacteraceae, Sphingomonadaceae, Caulobacteraceae, Rhizobiaceae, Xanthobacteraceae, Brucellaceae, Philobacterium (Phyllobacteriaceae), Alcaligenaceae, Comamonadaceae, Pseudomonadaceae, Moraxellaceae, Shewanellaceae, Vibrionaceae, Enterobacterceae Enterobacterceae (Nocardiaceae), Streptomycetaceae, Bacillaceae, Paenibacillaceae or Sphingobacteriaceae.

Examples belonging to the Rhodospirillaceae family include the genus Magnetospirillum, the genus Rhodospirillum, the genus Azospirillum and the genus Tistrella. Examples of those belonging to the family Acetobacteraceae include the genus Acetobacter, the genus Acidiphilium and the genus Gluconacetobacter. Examples of the Rhodobacteraceae include Rhodobacter genus, Paracoccus genus, Ruegeria genus, Jannaschia genus, Roseobacter genus, Dinoroseobacter genus, Pseudovibrio genus, Phaeobacter genus, Octadecabacter genus and Ahrensia genus. Examples of the family belonging to the family Hyphomonadaceae include the genus Hyphomonas, the genus Maricaulis, and the genus Hirschia. Examples of the family belonging to the family Sphingomonadaceae include the genus Sphingomonas, Novosphingobium, Sphingopyxis, Sphingobium, Lutibacterium and Zymomonas. The genus Erythrobacter is mentioned as belonging to the family Erytrobacteraceae. Examples of the family belonging to the family Caulobacteraceae include the genus Brevundimonas, the genus Caulobacter, the genus Phenylobacterium, and the genus Asticcacaulis. Examples belonging to the family Rhizobiaceae include the genus Agrobacterium, the genus Rhizobium and the genus Sinorhizobium. Examples belonging to the family Xanthobacteraceae include the genus Xanthobacter and the genus Azorhizobium. Examples of the genus Brucellaceae include the genus Brucella and the genus Ochrobactrum. Examples of the family belonging to the family Phyllobacteriaceae include the genus Mesorhizobium and the genus Chelativorans. The Aurantimonas family belongs to the Aurantimonadaceae family. Examples belonging to the Bradyrhizobiaceae family include the Bradyrhizobium genus, the Agromonas genus, the Rhodopseudomonas genus and the Nitrobacter genus. Examples of those belonging to the Methylobacteriaceae family include the genus Methylobacterium. Examples of the family belonging to the family Hyphomicrobiaceae include the genus Hyphomicrobium, the genus Rhodomicrobium, and the genus Pelagibacterium. Examples of the family belonging to the Rhodobiaceae include the genus Parvibaculum. The genus Methylocystis is mentioned as belonging to the Methylocystaceae family. Parvularcula genus is mentioned as belonging to the Parvularculaceae family. Examples of the family belonging to the family Burkholderiaceae include the genus Burkholderia, Ralstonia, Cupriavidus and Polynucleobacter. Examples of the genus Alcaligenaceae include the genus Achromobacter, Alcaligenes, Bordetella, Taylorella, Pusillimonas and Oligella. Examples of the Comamonadaceae family include the genus Comamonas, Alicycliphilus, Delftia, Ramlibacter, Rhodoferax, Variovorax, Polaromonas, Acidovorax, and Verminephrobacter. Examples of the family belonging to the family Oxalobacteraceae include the genus Herminiimonas, the genus Herbaspirillum, and the genus Collimonas. Examples of the family belonging to the family Hydrophilophilaceae include the genus Hydrophilophilus and the genus Thiobacillus. Examples belonging to the family Neisseriaceae include the genus Chromobacterium, the genus Laribacter and the genus Pseudogulbenkiania. Examples of the family belonging to the family Nitrosomonadaceae include the genus Nitrosomonas and the genus Nitrosospira. Examples belonging to the Rhodocyclaceae family include the genus Aromatoleum, the genus Azoarcus, the genus Dechloromonas, the genus Thauera and the genus Azospira (Dechlorosoma). Examples of the family Chromatiaceae include the genus Rheinheimera, the genus Thiosphaera and the genus Nitrosococcus. Examples of those belonging to the ectothiorhodospiraceae family include the genus Halorhodospira. Examples of the family belonging to the family Acidithiobacillaceae include the genus Acidithiobacillus. Examples belonging to the family Xanthomonas include the genus Xanthomonas, the genus Stenotrophomonas, the genus Pseudoxanthomonas and the genus Rhodanobacter. Examples of the family belonging to the family Francisellaceae include the genus Francisella. Examples of the family belonging to Piscirickettsiaceae include the genus Cycloclasticus. Examples of those belonging to the Oceanospirillaceae family include the genus Oceanospirillum and the genus Marinospirillum. Examples of those belonging to the Hahellaceae family include the genus Hahella. The genus Halomonas can be mentioned as belonging to the family Halomomonadaceae. Examples belonging to the family Alcanivoracaceae include the genus Alcanivorax and the genus Kangiella. Examples belonging to the family Pseudomonadaceae include the genus Pseudomonas and the genus Azotobacter. Examples belonging to the Moraxellaceae family include the genus Acinetobacter and the genus Psychrobacter. Examples of the family belonging to the family Alteromonadaceae include the genus Alishewanella, the genus Alteromonas, the genus Glaciecola, the genus Marinobacter, the genus Marinobacterium and the genus Saccharophagus. Examples of the family belonging to the family Shewanellaceae include the genus Shewanella. Examples of the family belonging to the family Ferrimonaadaceae include the genus Ferrimonas. Examples of the family belonging to the family Idiomarinaceae include the genus Idiomarina. The genus Colwellia is mentioned as belonging to the Colwelliaceae family. Examples of the Pseudoalteromonadaceae family include the genus Pseudoalteromonas. Examples belonging to the Vibrionaceae family include Listonella, Vibrio and Photobacterium. Examples belonging to the family Aeromonadaceae include the genus Aeromonas and the genus Oceanimonas. Examples of the family Enterobacteriaceae include the genus Enterobacter, Citrobacter, Erwinia, Klebsiella, Rahnella, Proteus and Serratia. Examples belonging to the Salinisphaeraceae family include the genus Salinisphaera, and those belonging to the Legionellaceae family include the genus Legionella. Examples of the family belonging to the family Coxiellaceae include the genus Coxiella. Examples of the family belonging to the family Desulfobulbaceae include the genus Desulfococcus, the genus Desulfobacterium, and the genus Desulfatibacillum. Examples belonging to the Desulfarculaceae family include the genus Desulfobulbus and the genus Desulfarculus. The genus Geobacter is mentioned as belonging to the Geobacteraceae family. Syntrophobacteraceae can be mentioned as belonging to the Syntrophobacteraceae family. Examples belonging to the Syntrophaceae family include the genus Syntrophus and the genus Desulfomonile. Examples of the family belonging to the family Bdellovibrionaceae include the genus Bdellovibrio. Examples of the family belonging to the family Bacteriovoracaceae include the genus Bacteriovorax. Examples belonging to the family Cystobacteraceae include the genus Stigmatella. Examples belonging to the Myxococcaceae family include the genera Myxococcus and Anaeromyxobacter. As belonging to the Polyangiaceae family, there is the genus Sorangium. As belonging to the family Kofleriaceae, there is the genus Haliangium. Examples belonging to the family Acidobacteriaceae include the genera Acidobacterium and Granulicella. Examples of the family belonging to the family Acidimicrobiaceae include the genus Ilumatobacter. Examples of the Streptosporangiaceae family include Streptosporangium genus, Acrocarpospora genus, Herbidospora genus, Microbispora genus, Nonomuraea genus, Planobispora genus and Planomonospora genus. Examples of the family Nocardiopsaceae include the genus Nocardiopsis and the genus Thermobifida. Examples of the family belonging to Thermomonosporaceae include the genus Actinocorallia, the genus Actinomadura and the genus Thermomonospora. The Pseudonocardiaceae family includes the Pseudonocardia, Actinoalloteichus, Amycolatopsis, Kibdelosporangium, Saccharomonospora, Saccharopolyspora, Saccharothrix, Streptoalloteichus, and Thermobispora genera. Examples of the family belonging to the family Actinosynnemataceae include the genus Actinokineospora and Actinosynnema. Examples of the family belonging to Micromonosporaceae include the genus Micromonospora, Actinoplanes, Catellatospora, Couchioplanes, Dactylosporangium, Pilimelia, Salinispora and Verrucosispora. Actinopolyspora genus is mentioned as what belongs to Actinopolysporaceae (Actinopolysporaceae). Examples belonging to the family Propionibacteriaceae include the genus Propionibacterium and the genus Luteococcus. Examples of the Nocardioidaceae family include the genus Nocardioides, the genus Aeromicrobium, the genus Kribbella, and the genus Pimelobacter. Examples of those belonging to the family Corynebacteriaceae include the genus Corynebacterium. Examples of the Nocardiaceae family include the genus Nocardia and the genus Rhodococcus. Gordonia genus is mentioned as belonging to the Gordoniaceae family. As a member of the Dietziaceae family, there is the genus Dietzia. Examples belonging to the Mycobacteriaceae family include the Mycobacterium genus and the Amycolicicoccus genus. Examples of the family belonging to the family Tsukamurellaceae include the genus Tsukamurella. Segniliparus genus is mentioned as belonging to Segniliparaceae. Examples belonging to the family Microbacteriaceae include the genus Microbacterium, the genus Agromyces, the genus Clavibacter, the genus Curtobacterium and the genus Rathayibacter. Examples of the family belonging to the family Micrococcaceae include the genus Micrococcus, Arthrobacter, Citricoccus, Renibacterium, Kocuria and Rothia. Examples belonging to the family Dermabacteraceae include the genera Brachybacterium, Dermacoccus, Demetria and Kytococcus. Examples of the family belonging to the family Dermatophilaceae include the genus Dermatophilus. Brevibacterium genus is mentioned as belonging to Brevibacteriaceae. Examples of those belonging to the family Cellulomonadaceae include the genus Cellulomonas and the genus Oerskovia. Those belonging to the family Intrasporangiaceae include the genera Intrasporangium, the genus Janibacter, the genus Terrabacter, and the genus Serinicoccus. The genus Jonesia is mentioned as belonging to the Jonesiaceae family (Jonesiaceae). Examples belonging to the family Rarobacteraceae include the genus Rarobacter. As belonging to the family Franciaceae (Frankiaceae), there is the genus Frankia. Examples of the family belonging to Acidothermaceae include the genus Acidothermus. Examples of the family belonging to the family Nakamurellaceae include the genus Nakamurella. Examples of the family belonging to the family Cryptosporangiaceae include the genus Cryptosporangium. Geodermatophilaceae (Geodermatophilaceae) belongs to the Geodermato




genus philus. Examples of the family belonging to Glycomycetaceae include the genus Glycomyces and the genus Stackebrandtia. Examples of those belonging to Actinomycetaceae (Actinomycetaceae) include the genus Arcanobacterium. Examples of those belonging to the Streptomycetaceae family include the genus Streptomyces and the genus Kitasatospora. Catenulispora is a genus of Catenulisporaceae. Examples of the family belonging to the family Kineosporiaceae include the genus Kineosporia and the genus Kineococcus. Examples of the family belonging to the family Bifidobacteriaceae include the genus Bifidobacterium. The genus Rubrobacter can be mentioned as belonging to the Rubrobacteraceae family. Examples of the family belonging to the family Conexibacteraceae include the genus Conexibacter. Examples belonging to the family Bacillaceae include the genera Bacillus, Geobacillus, Oceanobacillus, Lysinibacillus and Halobacillus. Examples of the genus Alicyclobacillaceae include the genus Alicyclobacillus and the genus Kyrpidia. Examples belonging to the family Paenibacillaceae include the genera Paenibacillus and Brevibacillus. Those belonging to the Planococcaceae family include the genus Planococcus and the genus Kurthia. Examples of the family belonging to the family Sporolactobacillaceae include the genus Sporolactobacillus. The genus Thermoactinomyces is included in the family Thermoactinomycetaceae. Examples belonging to the family Lactobacillaceae include the genus Lactobacillus and the genus Pediococcus. Examples belonging to the Leuconostocaceae family include the genus Leuconostoc and the genus Weissella. Examples belonging to the family Aerococcaceae include the genus Aerococcus and the genus Globicatella. Examples belonging to the family Carnobacteriaceae include the genus Alloiococcus and the genus Carnobacterium. Examples of those belonging to the family Streptococcaceae include the genus Streptococcus. Examples of the genus Clostridiaceae include the genus Clostridium and the genus Alkaliphilus. Syntrophomonas and Syntrophothermus genera are included as belonging to the Syntrophomonadaceae family. Eubacterium genus is mentioned as what belongs to Eubacteriaceae. Examples of the family belonging to the family Peptococcaceae include the genera Peptococcus, Desulfitobacterium, Desulfotomaculum and Pelotomaculum. Examples of the family belonging to the family Peptostreptococcaceae include the genus Peptostreptococcus. Examples belonging to the Lachnospiraceae family include the genera Butyrivibrio and Roseburia. Oscillibacter genus is mentioned as belonging to Oscillospiraceae. Examples of the family belonging to Thermoanaerobacteraceae include the genus Thermoanaerobacter and the genus Carboxydothermus. Natranaerobius genus is mentioned as belonging to the family Natroaerobiaceae. Examples belonging to the family Sphingobacteriaceae include the genus Sphingobacterium, the genus Pedobacter, and the genus Mucilaginibacter. As belonging to the Saprospiraceae family, there is the genus Haliscomenobacter. Examples of the family belonging to the family Bacteroidaceae include the genus Bacteroides. Examples of the family belonging to the family Marinilabiliaceae include the genus Marinilabilia. Prevotella genus is mentioned as belonging to the Prevotlaceae family (Prevotellaceae). Examples of the family belonging to Porphyromonadaceae include the genus Porphyromonas and the genus Odoribacter. Examples belonging to the Cytophagaceae family include the genus Flexibacter, the genus Spirosoma, and the genus Runella. The genus Flamemeovirga can be mentioned as belonging to the family Flammovavirgaceae. Examples of those belonging to the Flavobacteriaceae include Flavobacterium, Chryseobacterium and Maribacter. Examples of the family belonging to the family Deinococcaceae include the genus Deinococcus. Examples belonging to the Thermaceae include Thermus genus, Meiothermus genus, Oceanithermus genus and Marinithermus genus. Examples belonging to the family Gemmatimonadaceae include the genus Gemmatimonas. Examples belonging to the family Fusobacteriaceae include the genera Fusobacterium and the genus Ilyobacter. The genus Roseiflexus can be mentioned as belonging to the Chloroflexaceae family. The Herpetosiphonaceae genus can be mentioned as belonging to the family Herpetosiphonaceae. Examples of the family belonging to Thermomicrobiaceae include the genus Thermoomicrobium. Examples belonging to the family Thermotogaceae include the genus Thermotoga, the genus Thermosipho, and the genus Fervidobacterium. Examples belonging to the family Deferribacteraceae include the genus Deferribacter, the genus Calditerrivibrio and the genus Flexistipes. Examples belonging to the family Sulfolobaceae include the genus Metallosphaera and the genus Acidianus. Examples of those belonging to the family Desulfurococcaceae include the genus Aeropyrum. Examples belonging to the family Thermoproteaceae include the genus Pyrobaculum, the genus Caldivirga, and the genus Vulcanisaeta. Examples of the family belonging to the family Acidilobaceae include the genera Acidilobus. Examples of the genus Halobacteriaceae include the genera Halobacterium, Halococcus, Haloarcula, Haloquadratum, Natronomonas, Halorubrum, Haloterrigena, Natrialba, Halalkalicoccus and Halogeometricum. Thermoplasma genus is mentioned as what belongs to Thermoplasmataceae. Examples belonging to the family Picrophilaceae include the genus Picrophilus. Examples of the family belonging to the family Ferroplasmaceae include the genus Ferroplasma. The genus Archaeoglobaceae includes the genus Archaeoglobus and Ferroglobus.

  Furthermore, examples of microorganisms whose classification is unclear are Polymorphum genus, Micavibrio genus, Simidia genus, Leptothrix genus, Thiomonas genus, Rubrivavax genus and Methylibium genus. Examples of microorganisms belonging to the order of Bacillales and whose classification is not determined include the genus Exiguobacterium. The genus Anaerococcus is mentioned as a microorganism belonging to the order of Clostridiales and whose classification is not determined.

Among these, preferable microorganisms include the following genera that are suggested to have the resolution of branched chain amino acids.
Magnetospirillum genus, Rhodospirillum genus, Azospirillum genus, Tistrella genus, Acidiphilium genus, Rhodobacter genus, Paracoccus genus, Ruegeria genus, Jannaschia genus, Roseobacter genus, Dinoroseobacter genus, Pseudovibrio genus, Phaeobacter genus, Octadecabacter, , Sphingomonas genus, Novosphingobium genus, Sphingopyxis genus, Sphingobium genus, Erythrobacter genus, Brevundimonas genus, Caulobacter genus, Phenylobacterium genus, Asticcacaulis genus, Agrobacterium genus, Rhizobium genus, Sinorhizobium genus, Xanthoborb Genus, Chelativorans, Aurantimonas, Bradyrhizobium, Agromonas, Rhodopseudomonas, Nitrobacter, Methylobacterium, Rhodomicrobium, Pelagibacterium, Parvibaculum, Methylocystis, Parvularobacter, C Genus, Bordetella, Taylorella, Pusillimonas, Comamonas, Alicycliphil Genus us, Delftia, Ramlibacter, Rhodoferax, Variovorax, Polaromonas, Acidovorax, Verminephrobacter, Herminiimonas, Herbaspirillum, Collimonas, Chromobacterium, Laribacter, Pseudogulbenkium, Nitrosomonas, Genus , Azoarcus, Dechloromonas, Thauera, Azospira (Dechlorosoma), Rheinheimera, Nitrosococcus, Halorhodospira, Xanthomonas, Stenotrophomonas, Pseudoxanthomonas, Rhodanobacter, Francisella, illus, Cycloclasticella, illus Genus, Alcanivorax, Kangiella, Pseudomonas, Azotobacter, Acinetobacter, Psychrobacter, Alishewanella, Alteromonas, Glaciecola, Marinobacter, Marinobacterium, Saccharophagus, Shewanella, Wellio, Pseudoalteromonas, Listonella, Vibrio, Photobacterium, Aeromonas, Oceanimanas, Salinisphaera, Legi Onella, Coxiella, Desulfococcus, Desulfobacterium, Desulfatibacillum, Desulfobulbus, Desulfarculus, Geobacter, Syntrophobacter, Syntrophus, Desulfomonile, Bdellovibrio, Bacteriovorax, Stigmatella, Genus , Haliangium, Acidobacterium, Granulicella, Ilumatobacter, Streptosporangium, Nocardiopsis, Thermobifida, Thermomonospora, Pseudonocardia, Amycolatopsis, Saccharomonospora, Saccharopolyspora, Actinobis, Genus Genus, Nocardioides, Kribbella, Corynebacterium, Nocardia, Rhodococcus, Gordonia, Dietzia, Mycobacterium, Amycolicicoccus, Tsukamurella, Segniliparus, Microbacterium, Micrococcus, Arthrobacter, Nitricocus, Regenus Kocuria, Kytococcus, Cellulomonas, Intrasporangium, Serinicoccus , Frankia, Acidothermus genus, Nakamurella genus, Geodermatophilus genus, Stackebrandtia genus, Streptomyces genus Catenulispora genus, Rubrobacter genus, Conexibacter genus, Bacillus genus, Geobacillus genus, Oceanobacilis genus, Halysobacillus genus, Halobacillus genus, Halibacillus genus, Alibibacillus genus, Alibibacillus genus Lactobacillus, Carnobacterium, Clostridium, Alkaliphilus, Syntrophomonas, Syntrophothermus, Eubacterium, Desulfitobacterium, Desulfotomaculum, Pelotomaculum, Butyrivibrio, Roseburia, Oscillibacter, Nad, Box , Pedobacter genus, Haliscomenobacter genus, Porphyromonas genus, Odoribacter genus, Spirosoma genus, Runella genus, Maribacter genus, Deinococcus spp. Genus, Thermomicrobium, Thermotoga, Thermosipho, Fervidobac terium genus, Deferribacter genus, Calditerrivibrio genus, Flexistipes genus, Metallosphaera genus, Aeropyrum genus, Pyrobaculum genus, Caldivirga genus, Vulcanisaeta genus, Acidilobus genus, Haloarcula genus, Haloquadratum genus, Halorubalic genus, Haloteral genus , Halogeometricum genus, Thermoplasma genus, Picrophilus genus, Ferroplasma genus, Archaeoglobus genus, Ferroglobus genus, Polymorphum genus, Micavibrio genus, Simidia genus, Leptothrix genus, Thiomonas genus, Rubrivivax genus, Methylibium genus, Exigucobacterium genus or Exigucobacterium genus .

  Further, particularly preferred microorganisms include the genus Paracoccus, Sphingomonas, Brevundimonas, Agrobacterium, Rhizobium, Xanthobacter, Ochrobactrum, Mesorhizobium, Achromobacter, Comamonas, Pseudomonas, Acinetobacter, Listella, It is a microorganism belonging to the genus Rhodococcus, Streptomyces genus Bacillus, Geobacillus genus, Paenibacillus genus, Sphingobacterium genus or Pedobacter genus.

Examples of microorganisms classified into the genus Pseudomonas include, for example, Pseudomonas aeruginosa, Pseudomonas agarici, Pseudomonas alcaligenes, Pseudomonas adale, Pseudomonas agudare, Iriseptica (Pseudomonas anguiliseptica), Pseudomonas antimicrobica, Pseudomonas aspleni, Pseudomonas aurantiaca, Pseudomonas amonofure avellanae), Pseudomonas azotoformans, Pseudomonas balearica, Pseudomonas bagelinski Pseudomonas beijerinsckii, Pseudomonas beteli, Pseudomonas boreopolis, Pseudomonas carboxyhydrogenas, Pseudomonas caricapes, Pseudomonas caricapes Pseudomonas cissicola, Pseudomonas citronellolis, Pseudomonas coronafaciens, Pseudomonas corrugate, Pseoffmonas doudomos, Pseudomonas corrugate Eselongate (Pseudomonas elongate), Pseudomonas ficuserectae (Pseudomonas ficuserectae), Pseudomonas flavesens (Pseud) omonas flavescens), Pseudomonas flectens, Pseudomonas fluorescens, Pseudomonas fragi, Pseudomonas fulva, Pseudomonas fluva, Pseudomonas fse gelidicola), Pseudomonas geniculata, Pseudomonas glathei, Pseudomonas halophila, Pseudomonas hibiscicola, Pseudomonas udosse mons ), Pseudomonas lancelota, Pseudomonas lemoignei, Pseudomonas lundens is), Pseudomonas luteola, Pseudomonas marginalis, Pseudomonas meliae, Pseudomonas mendocina, Pseudomonas moncido Pseudomonas nautica, Pseudomonas nitroreducens, Pseudomonas oleovorans, Pseudomonas oryzihabitans, Pseudomonas oryzi Pseudomonas phenazinium), Pseudomonas pictorum, Pseudomonas pseudoalcaligenes, Pseudomonas Pseudomonas putida, Pseudomonas pyrrocinia, Pseudomonas resinovorans, Pseudomonas rhodesiae, Pseudomonas saccharidea, Pseudomonas smon Pseudomonas spinosa, Pseudomonas stanieri, Pseudomonas straminae, Pseudomonas stutzeri, Pseudomonas synxantsy, Pseudomonas synxantsy (Pseudomonas syzygii), Pseudomonas taetrolens, Pseudomonas tolaasii, Pseudomona · Beronii (Pseudomonas veronii), Pseudomonas Biridifuraba (Pseudomonas viridiflava), Pseudomonas vulgaris (Pseudomonas vulgaris), Pseudomonas Wiesbaden con Hsien cis (Pseudomonas wisconsinensis), and the like.
Examples of microorganisms classified into the genus Bacillus include, for example, Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis, Bacillus acidiceler, and Bacillus.・ Bacillus acidicola 、 Bacillus aeolius 、 Bacillus aerius 、 Bacillus aerophilus 、 Bacillus agaradhaerens 、 Bacillus aki 、 Bacillus aki Bacillus alcalophilus, Bacillus algicola, Bacillus alkalidiazotrophicus, Bacillus alkalitelluris, Bacillus alkalitelluris Bacillus altitudinis, Bacillus alveayuensis, Bacillus amyloliquefaciens, Bacillus anthracis, Bacillus nosicil (Bacillus asimaris), Bacillus asimaris (Bacillus asimaris) , Bacillus arseniciselenatis, Bacillus arsenicus, Bacillus arvi, Bacillus asahii, Bacillus atrophaeus, Bacillus atrophaeus, Bacillus atrophaeus Bacillus aurantiacus), Bacillus axarquiensis, Bacillus azotoformans, Bacillus badius, Bacillus barbaricas (Bacillus barbaricus), Bacillus bataviensis, Bacillus benzoevorans, Bacillus bogoriensis, Bacillus boroniphilus, Bacillus butanoribolance (Bacillus carboniphilus), Bacillus cecembensis, Bacillus cellulosilyticus, Bacillus chagannorensis, Bacillus cibi, Bacillus circulans, Bacillus circulans・ Clarky (Bacillus clarkii), Bacillus clausii, Bacillus coagulans, Bacillus coahuilensis, Bacillus coahuilensis Bacillus cohnii, Bacillus decisifrondis, Bacillus decolorationis, Bacillus drentensis, Bacillus edaphicus, Bacillus edaphicus, Bacillus edaphicus endophyticus), Bacillus farraginis, Bacillus fastidiosus, Bacillus firmus, Bacillus flexus, Bacillus foraminis, Bacillus foraminis, Bacillus foraminis Bacillus fordii), Bacillus fortis, Bacillus fumarioli, Bacillus funiculus, Bacillus galactosidilyticus Bacillus gelatini, Bacillus gibsonii, Bacillus halmapalus, Bacillus halodurans, Bacillus halophilus, Bacillus hemophilus hemicellulosilyticus), Bacillus herbersteinensis, Bacillus horikoshii, Bacillus horti, Bacillus humi, Bacillus hwajinpoensis, Bacillus hwajinpoensis Bacillus idriensis, Bacillus indicus, Bacillus infantis, Bacillus infernus, Bacillus insolitus, Bacillus isabeliae, Bacillus jeotgali, Bacillus koreensis, Bacillus krulwichiae, Bacillus lehensis, Bacillus lentus, Bacillus lentus, Bacillus lentus Bacillus licheniformis, Bacillus litoralis, Bacillus luciferensis, Bacillus macauensis, Bacillus macyae, bacillus macilae, tens Bacillus mannanilyticus, Bacillus marinus, Bacillus marisflavi, Bacillus massiliensis, Bacillus meiliensis Bacillus megaterium, Bacillus methanolicus, Bacillus mojavensis, Bacillus mucilaginosus, Bacillus muralis, Bacillus murimartis (ini), Bacillus murimartis (Bacillus murimartis) (Bacillus mycoides), Bacillus nealsonii, Bacillus niabensis, Bacillus niacini, Bacillus novalis, Bacillus odysseyi, Bacillus odysseyi (Bacillus okhensis), Bacillus okuhidensis, Bacillus oleronius, Bacillus oshimensis, Bacillus pallidus, Bacillus Panacitellae (Bacillus panaciterrae), Bacillus patagoniensis, Bacillus plakortidis, Bacillus pocheonensis, Bacillus polygoi (Bacillus polygoni), basilis philus phil Bacillus pseudofirmus, Bacillus pseudomycoides, Bacillus psychrodurans, Bacillus psychrosaccharolyticus, Bacillus psychrotolerans , Bacillus pumilus, Bacillus pycnus, Bacillus qingdaonensis, Bacillus ruris , Bacillus safensis, Bacillus salarius, Bacillus saliphilus, Bacillus schlegelii, Bacillus selenatarsenatis, Bacillus selenatarsenatiscelis (Bacillus selenitireducens), Bacillus seohaeanensis, Bacillus shackletonii, Bacillus silvestris, Bacillus simplex, Bacillus siralis, Bacillus siralis Bacillus smithii, Bacillus soli, Bacillus sonorensis, Bacillus sphaericus, Bacillus sporotus (Bacillus sporotus) hermodurans), Bacillus stratosphericus, Bacillus subterraneus, Bacillus taeanensis, Bacillus tequilensis, Bacillus thermantic ant Bacillus thermoamylovorans, Bacillus thermocloacae, Bacillus thioparans, Bacillus tusciae, Bacillus vallismortis, cil, ved Bacillus velezensis, Bacillus vietnamensis, Bacillus vireti, Bacillus wakoensis, Bashira Examples include Bacillus weihenstephanensis.

  Examples of microorganisms classified into the genus Sphingobacterium include, for example, Sphingobacterium multivorum, Sphingobacterium spiritivorum, and Sphingobacterium alimentarium. alimentarium, Sphingobacterium anhuiense, Sphingobacterium antarcticum, Sphingobacterium bambusae, Sphingobacterium canadense, Sphingobacterium canadense (Sphingobacterium composti), Sphingobacterium daejeonense, Sphingobacterium fasium (Sphingoba cterium faecium), Sphingobacterium heparinum, Sphingobacterium kitahiroshimense, Sphingobacterium lactis, Sphingobacterium mizutaii, Sphingobacterium mizutaii, Sphingobacterium nematocida, Sphingobacterium piscium, Sphingobacterium shayense, Sphingobacterium siyangense, Sphingobacterium talpophilum, Sphingobacterium thalpophil Examples thereof include Sphingobacterium wenxiniae.

  Examples of microorganisms classified into the genus Comamonas include, for example, Comamonas acidovorans, Comamonas aquatica, Comamonas badia, Comamonas composti, and Comamonas composti. Demonificans (Comamonas denitrificans), Comamonas granuli (Comamonas granuli), Comamonas kerstersii, Comamonas koreensis, Comamonas nitrativorans, Comamonas nitrativorans (Comamonas odontotermites), Comamonas terrae, Comamonas terrigena, Comamonas testosteroni, Camamonas thiooxyda ns), Comamonas zonglianii and the like.

  Examples of microorganisms classified into the genus Brevundimonas include, for example, Brevundimonas alba, Brevundimonas aurantiaca, Brevundimonas bacteroides, Brevundimonas basaltis, Brevundimonas bullata, Brevundimonas diminuta, Brevundimonas intermedia, Brevundimonas Quantunensis (Brevundimonas kwangchunensis), Brevundimonas lenta, Brevundimonas mediterranea, Brevundimonas nasdae, Brevundimonas・ Orey (Brevundimonas olei), Brevundimonas subvibrioides, Brevundimonas terrae, Brevundimonas vancanneytii, Brevundimonas varibilis (Brevundimonas vari) , Brevundimonas vesicularis, Brevundimonas viscosa and the like.

  Examples of microorganisms classified into the genus Sphingomonas include, for example, Sphingomonas abaci, Sphingomonas adhaesiva, Sphingomonas aerolata, and Sphingomonas aerolata. Sphingomonas aquatilis), Sphingomonas asaccharolytica, Sphingomonas astaxanthinifaciens, Sphingomonas aurantiaca, Sphingomonas azo phingogen ), Sphingomonas azotofornans, Sphingomonas capsulata, Sphingomonas changbaiensis (Sphing) omonas changbaiensis), Sphingomonas chlorophenolica, Sphingomonas cynarae, Sphingomonas desinocabinos, Sphingomonas dophdonomonas dophdonomonas , Sphingomonas endophytica, Sphingomonas faeni, Sphingomonas fennica, Sphingomonas ginsenosidimutans, Sphingomonas (Sphingomonas haloaromaticamans), Sphingomonas herbicidovorans, Sphingomonas humi, Sphingomonas herbicidovorans Sphingomonas insulae, Sphingomonas japonica, Sphingomonas jaspsi, Sphingomonas jejuensis, Sphingomonas jenasien, korsis, Tabidas (Sphingomonas macrogoltabidus), Sphingomonas mali, Sphingomonas melonis, Sphingomonas molluscorum, Sphingomonas munas ), Sphingomonas oligophenolica, Sphingomonas panni, Sphingomonas Sphingomonas parapaucimobilis, Sphingomonas paucimobilis, Sphingomonas phyllosphaerae, Sphingomonas pituitosa, polysarotimos Sphingomonas pruni, Sphingomonas rosa, Sphingomonas roseiflava, Sphingomonas rubra, Sphingomonas sanguinis, Sphingomonas sanguinis, Sphingomonas sanguinis soli), Sphingomonas suberifaciens, Sphingomonas subterranea, sphingo Sphingomonas terrae, Sphingomonas trueperi, Sphingomonas ursincola, Sphingomonas wuchichii, Sphingomonas yabuae, Sphingomonas yabuae Sphingomonas yanoikuyae), Sphingomonas yunnanensis and the like.

  Examples of microorganisms classified into the genus Ochrobactrum include, for example, Ochrobactrum anthropi, Ochrobactrum cytisi, Ochrobactrum daejeonense, and Ocrobacterium. · Ochrobactrum gallinifaecis, Ochrobactrum grignonense, Ochrobactrum haemophilum, Ochrobactrum intermedium, Ochrobactrum intermedium, Ochrobactrum lupini Uchrobactrum oryzae, Ochrobactrum pseudintermedium, Ochrobactrum psudintermedium (Ochrobactrum ps) eudogrignonense), Ochrobactrum thiophenivorans, Ochrobactrum tritici, and the like.

  Examples of microorganisms classified into the genus Pedobacter include, for example, Pedobacter africanus, Pedobacter agri, Pedobacter alluvius, Pedobacter aquatilis Pedobacter borealis, Pedobacter caeni, Pedobacter composti, Pedobacter cryoconitis, Pedobacter daechungened, Pedobacter daechungened, er dura・ Pedobacter ginsengisoli, Pedobacter hartonius, Pedobacter heparinus, Pedobacter heparinus (Pedobacter himalayensis), Pedobacter jeongneungensis, Pedobacter koreensis, Pedobacter lentus, Pedobacter metabolipen, Pedobacter metabolipen Pedobacter panaciterrae, Pedobacter piscium, Pedobacter roseus, Pedobacter saltans, Pedobacter steynii, Pedobacter steyned Examples thereof include terricola (Pedobacter terricola).

  Examples of microorganisms classified into the genus Paenibacillus include, for example, Paenibacillus aestuarii, Paenibacillus alginolyticus, Paenibacillus algorifontic, Paenibacillus algorifontic, ), Paenibacillus amylolyticus, Paenibacillus apiarius, Paenibacillus assamensis, Paenibacillus azoreducens, Paenibacillus azoreducens, Paenibacillus azotoducus (Paenibacillus barcinonensis), Paenibacillus barengoltzii, Paenibacillus barengoltzii Paenibacillus campinasensis, Paenibacillus cellulosilyticus, Paenibacillus chibensis, Paenibacillus chitinolyticus, Paenibacillus chitinolyticus, Paenibacillus chitinolyticus, Paenibacillus chitinolyticus Kaen (Paenibacillus curdlanolyticus), Paenibacillus daejeonensis, Paenibacillus durus, Paenibacillus ehimensis, Paenibacillus elci (Paenibacillus ecilensis) (Paenibacillus frigoriresistens), Paenibacillus gansuensi (Paenibacillus gansuensi) s), Paenibacillus ginsengihumi, Paenibacillus glucanolyticus, Paenibacillus glycanilyticus, Paenibacillus gayanis (Paenibacillus hordei), Paenibacillus humicus, Paenibacillus illinoisensis (Paenibacillus illinoisensis), Paenibacillus jamilae (Paenibacillus jamilae), Paenibacillus cobensis Paenibacillus konsidensis), Paenibacillus kribben sis), Paenibacillus larvae subsp. larvae (Paenibacillus larvae subsp. pulvifaciens), Paenibacillus larvae subs. Paenibacillus macerans), Paenibacillus macquariensis subsp. Defensor, Paenibacillus mendelii, Paenibacillus motobuensis, lus, nov Paenibacillus nematophilus, Paenibacillus oceanisediminis, Paenibacillus oedis Paenibacillus odorifer, Paenibacillus pabuli, Paenibacillus pasadenensis, Paenibacillus peoriae, Paenibacillus phiori Paenibacillus pinellihumi, Paenibacillus polymyxa, Paenibacillus pueri, Paenibacillus rigui, Paenibacillus stellifer, tai sis ), Paenibacillus terrigena, Paenibacillus thermophilus Paenibacillus thiaminolyticus, Paenibacillus tundrae, Paenibacillus validus, Paenibacillus ponsis, Paenibacillus ponsis xylaniclasticus).

  Examples of microorganisms classified into the genus Achromobacter include, for example, Achromobacter arsenitoxydans, Achromobacter cholinophagum, Achromobacter cholinophagum (Achromobacter cholinophagum) Achromobacter cycloclastes), Achromobacter denitrificans, Achromobacter fischeri, Achromobacter hartlebii, Achromobacter immobilis, Achromobacter immobilis, Achromobacter immobilis -Insolitas (Achromobacter insolitus), Achromobacter lactolyticus, Achromobacter lyticus, Achromobacter methanolophila (Achromobacter methanolophila) , Achromobacter pestifer, Achromobacter piechaudii, Achromobacter ruhlandii, Achromobacter spanios, Achromobacter spanos, Achromobacter viscos ), Achromobacter xerosis, Achromobacter xylosoxidans, Achromobacter xylosoxidans subsp. Denitrificans, Achromobacter -Xylosoxy dance, sub-species, xylosoxidans (Achromobacter xylosoxidans subsp. Xylosoxidans), etc. are mentioned.

  Examples of microorganisms classified into the genus Acinetobacter include, for example, Acinetobacter baumannii, Acinetobacter aylyi, Acinetobacter beijacter azitob・ Acinetobacter boubetii, Acinetobacter calcoaceticus (Acinetobacter calcoaceticus), Acinetobacter gerneri, Acinetobacter grimontii (Acinetobacter grimontii), Acinetobacter grito , Acinetobacter haemolyticus (Acinetobacter haemolyticus), Acinetobacter johnsonii (A cinetobacter johnsonii), Acinetobacter junii, Acinetobacter kyonggiensis, Acinetobacter lwoffii, Acinetobacter lwoffii, Acinetobacter l Acinetobacter psychrotolerans, Acinetobacter radioresistens, Acinetobacter schindleri, Acinetobacter soli, Acinetobacter sociacter, tandoter Gie (Acinetobacter tjernbergiae), Acinetobacter toneri (Aci netobacter towneri), Acinetobacterursingii, Acinetobacter venetianus and the like.

  Examples of microorganisms classified into the genus Shewanella include, for example, Shewanella piezotolerans, Shewanella abyssi, Shewanella affinis, Shewanella algae, and Shuwanella algae. Shewanella algidipiscicola, Shewanella amazonensis, Shewanella aquimarina, Shewanella arctica, Shewanella atlantiche, Shewanella atlantiche b ), Shewanella basaltis, Shewanella benthica, Shewanella candadensis, Shewanella chilikensis , Shewanella colwelliana, Shewanella corallii, Shewanella decolorationis, Shewanella denitrificans, Shewanella denitrificans, Shewanella degaificis Shewanella fidelis, Shewanella fodinae, Shewanella frigidimarina, Shewanella gaetbuli, Shewanella gelidicia, Swanella glaetia Shewanella gopherii, Shewanella hafniensis, Shewanella halifaxensis, Shewanella ha Owan (Shewanella haliotis), Shewanella hanedai, Shewanella japonica, Shewanella kaireitica, Shewanella ivingstonensis, lowanh i Shewanella marina, Shewanella marinintestina, Shewanella marisflavi, Shewanella morhuae, Shewanella olleyana, Shewanella olleyana, Shewanella olleyana, Shewanella olleyana, Shewanella olleyana, Shewanella olleyana Shewanella pacifica, Shewanella pealeana, Shewanella pneumatophori, Shewanella pfunada rofunda, Shewanella putrefaciens, Shewanella sairae, Shewanella schlegeliana, Shewanella sediminis, Shewanella sulgenesis Shewanella vesiculosa), Shewanella violacea, Shewanella waksmanii, Shewanella woodyi, Shewanella xiamenensis and the like.

Examples of microorganisms classified into the genus Listonella include Listonella anguillara, Listonella anguillarum, Listonella pelagia, and the like.
Examples of microorganisms classified into the genus Agrobacterium include Agrobacterium agile, Agrobacterium aureum, Agrobacterium azotophilum, and Agrobacterium.・ Agrobacterium gypsophilae, Agrobacterium luteum, Agrobacterium pseudotsugae, Agrobacterium rhizogenes, Agrobacterium ferrugineum, Agrobacterium・ Sangineum (Agrobacterium sanguineum), Agrobacterium tumefaciens (Agrobacterium tumefaciens), Agrobacterium viscosum (Agrobacterium viscosum), Agrobacterium Examples include Agrobacterium vitis.

  Examples of microorganisms classified into the genus Mesorhizobium include Mesorhizobium albiziae, Mesorhizobium amorphae, Mesorhizobium auszoumium, Mesozozoumium, Mesozozoumium, Mesozozoumium Chascoens (Mesorhizobium chacoense), Mesorhizobium ciceri, Mesorhizobium gobiense, Mesorhizobium loti, Mesorhizobium loti, Mesorhizobium medizoumium Mesorhizobium opportunistum, Mesorhizobium plurifarium, Mesorhizobium plurifarium, Mesorhizobium opportunistum Mesorhizobium huakuii, Mesorhizobium septentrionale, Mesorhizobium shangrilense, Mesorhizobium tarimense, Mesorhizobium tempura Mesorhizobium thiogangeticum) and Mesorhizobium tianshanense.

  Examples of microorganisms classified into the genus Rhizobium include, for example, Rhizobium alamii, Rhizobium alkalisoli, Rhizobium cellulosilyticum, Rhizobium cellulosilyticum, and Rejzobium daejeonium. , Rhizobium endophyticum, Rhizobium etli, Rhizobium fabae, Rhizobium gallicum, Rhizobium giardin (Rhizobium giardin) ), Rhizobium hainanense, Rhizobium huautlense, Rhizobium galegae, Rhizobium indica, Rhizobium indica Rhizobium indicus, Rhizobium indigoferae, Rhizobium larrymoorei, Rhizobium leguminosarum, Rhizobium loeshi, ca Rhizobium lupini, Rhizobium lusitanum, Rhizobium mesosinicum, Rhizobium miluonense, Rolzobium montosium (Rhizobium mics) , Rhizobium nagarjuna nagarensis, Rhizobium oryzae, Rhizobium phaseoli, Rhizobium phasei zobium pisi, Rhizobium pusense, Rhizobium radiobacter, Rhizobium rhizogenes, Rhizobium rubi, Rhizobium rubi, selhizobium sel Sori (Rhizobium soli), Rhizobium sullae, Rhizobium tibeticum, Rhizobium trifolii, Rhizobium tropici, Rhizobium tropici, Rhizobium tropici (Rhizobium undicola), Rhizobium validum, Rhizobium vitis, and the like.

  Examples of microorganisms classified into the genus Paracoccus include Paracoccus aestuarii, Paracoccus alcaliphilus, Paracoccus alkenifer, Paracoccus aminophilus, Paracoccus aminophilus and Paracoccus aminophilus Paracoccus aminovorans, Paracoccus beibuensis, Paracoccus bengalensis, Paracoccus chinensis, Paracoccus denitrificac, Paracoccus denitrificus, Paracoccus denitrificus Paracoccus homiensis, Paracoccus kocurii, Paracoccus caeni, Paracoccus kondratievae, Paracoccus koreensis, Paracoccus marinus, Paracoccus methylutens, Paracoccus oceanense, Paracoccus oceanense, Paracoccus oceanense pantotrophus), Paracoccus seriniphilus, Paracoccus solventivorans, Paracoccus sulfuroxidans, Paracoccus thiocyanatus, Paracoccus bercus (Paracoccus yeei), Paracoccus zeaxanthinifaciens and the like.

  As microorganisms classified into the genus Xanthobacter, for example, Xanthobacter agilis, Xanthobacter aminoxidans, Xanthobacter autotrophicus, Xanthobacter flavus, Xanthobacter tagetidis, Xanthobacter viscosus and the like.

Examples of microorganisms classified into the genus Streptomyces include, for example, Streptomyces abikoensis, Streptomyces aburaviensis, Streptomyces abraaviensis subspecies. Tuftformis, Streptomyces achromogenes, Streptomyces achromogenes subsp. Achromogenes, Streptomyces achromogenes, Streptomyces achromogenes Dilith (Streptomyces achromogenes subsp. Rubradiris), Streptomyces achromogenes subsp. Streptozoticus, Streptomyces achromogenes subsp. Streptomyces achromogenes subsp. Tomaymyceticus, Streptomyces acidiscabies, Streptomyces acidoresistans, Streptomyces cristias Streptomyces acrimycini), Streptomyces actuosus, Streptomyces aculeolatus, Streptomyces adephospholyticus, Streptomyces afganiensis (Streptomyces afganiensis) Myses africanus (Streptomyces africanus), Streptomyces agglomeratus (Streptomyces agglomeratus), Streptomyces ahigloscopy Streptomyces ahygroscopicus, Streptomyces akiyoshiensis, Streptomyces alanosinicus, Streptomyces albaduncus, Streptomyces albicans biaxial stalis , Streptomyces albidochromogenes, Streptomyces albidoflavus, Streptomyces albidus, Streptomyces albireticuli, Streptomyces albireticuli, Streptomyces albireticuli, Streptomyces albireticuli, Streptomyces albireticuli Streptomyces albochromogenes, Streptomyces albocinerescens (Streptomyces albocinerescens), Streptomyces albofaciens (Streptomyces albofaciens), Streptomyces alboflavus, Streptomyces albogriseolus, Streptomyces albohelvatus, Streptomyces albolongus, Streptomyces albolongus, Streptomyces albolongus Streptomyces alboniger, Streptomyces albospinus, Streptomyces albosporeus, Streptomyces albosporeus subspices Labylomysetticus ), Streptomyces albovinaceus, Streptomyces alboviridis, Streptomyces alboviridis (Streptomyces albulus), Streptomyces albus, Streptomyces albus subspices Albus, Streptomyces albus subsp. Albus, Streptomyces albus subsp. Albus subsp coleimyceticus), Streptomyces albus subsp. pathocidicus, Streptomyces alcalophilus, Streptomyces almquistii, Streptomyces almquistii (Streptomyces alni), Streptomyces althioticus, Streptomyces amagasakensis, Streptomyces amaxaensis (Streptomyces amaxasaensis) amakusaensis), Streptomyces ambofaciens, Streptomyces aminophilus, Streptomyces anandii, Streptomyces angustmyceticus, Streptomyces anthocyanicus (Streptomyces ansochromogenes), Streptomyces anthocyanicus, Streptomyces antibiotics (Streptomyces antibioticus), Streptomyces antibiotics Fibrinolyticus (Streptomyces antifibrinolyticus), Streptomyces antimycoticus (Streptomyces antimycoticus), Streptomyces anuratus (Streptomyces anulatos) tus), Streptomyces aomiensis, Streptomyces arabicus, Streptomyces ardus, Streptomyces arenae, Streptomyces algentiosis argenteolus), Streptomyces argenteolus subsp. toyonakensis, Streptomyces argillaceus, Streptomyces armeniaent (Streptomyces armeniacus), Streptomyces armeniaent ), Streptomyces arsitiensis, Streptomyces ascomycinicus, Streptomyces Streptomyces asiaticus, Streptomyces asterosporus, Streptomyces atratus, Streptomyces atroaurantiacus, Streptomyces atrussia Neuus (Streptomyces atrocyaneus), Streptomyces atrofaciens, Streptomyces atrolaccus, Streptomyces atroolivaceus, Streptomyces atroolivacus ), Streptomyces atrovirens, Streptomyces aurantiacogriseus, Streptomyces aut Streptomyces aurantiacus, Streptomyces aurantiogriseus, Streptomyces auratus, Streptomyces aureocirculatus, Streptomyces aureocirculatus, Streptomyces aureocirculatus (Streptomyces aureofaciens), Streptomyces aureomonopodiales (Streptomyces aureomonopodiales), Streptomyces aureolectus (Streptomyces aureorticus), Streptomyces aureoverticillatus (Streptomyces aureoverticillatus), Streptomyces aureus aureus aureus aureus ureus ), Streptomyces aurigineus, Streptomyces avellaneus, Streptomyces aurilaneus Streptomyces avermectinius, Streptomyces avermitilis, Streptomyces avicenniae, Streptomyces avidinii, Streptomyces avidinii, Streptomyces in rep Streptomyces azureus, Streptomyces baarnensis, Streptomyces bacillaris, Streptomyces badius, Streptomyces baliensis, Streptomyces baliensis Streptomyces bambergiensis, Streptomyces bangladeshensis, Streptomyces Bangladesh Streptomyces bangladeshiensis, Streptomyces beijiangensis, Streptomyces bellus, Streptomyces bellus subsp. Cirolerosus, Streptomyces Bernensis, Streptomyces bicolor, Streptomyces bifurcus, Streptomyces bikiniensis, Streptomyces bikiniensis, Zobonensis (Streptomyces bikiniensis subsp. Zorbonensis), Streptomyces blastmyceticus, Streptomyces bluensis, Streptomyces bobili, Streptomyces bottropensis, Streptomyces brasiliensis, Streptomyces brevisprorus, Streptomyces breviprorus (Streptomyces brevisprorus) Streptomyces brunneogriseus), Streptomyces bungoensis, Streptomyces cacaoi, Streptomyces cacaoi subsp. Asoensis, Streptomyces cacaoi subsp. Asoensis・ Kakaoi (Streptomyces cacaoi subsp. Cacaoi), Streptomyces caelestis, Streptomyces caelicus, Streptomyces Streptomyces caeruleus, Streptomyces caesius, Streptomyces californicus, Streptomyces calvus, Streptomyces canadiensis (Streptomyces canadiensis Streptomyces canarius, Streptomyces candidus, Streptomyces canescens, Streptomyces cangkringensis, Streptomyces canifers (Streptomyces canaricens) ), Streptomyces canus, Streptomyces capillispiralis, Streptomyces capospiralis (Streptomyces capoamus), Streptomyces capuensis, Streptomyces carnosus, Streptomyces carpaticus, Streptomyces carpinensis, Streptomyces carpinensis Streptomyces castaneoglobisporus, Streptomyces castaneus




(Streptomyces castaneus), Streptomyces castelarensis, Streptomyces catenulae, Streptomyces cattleya, Streptomyces cavourensis, Streptomyces cavourensis・ Caborensis subspices ・ Caborensis (Streptomyces cavourensis subsp. Cavourensis), Streptomyces cebimarensis, Streptomyces cellostaticus (Streptomyces cellostaticus), Streptomyces cellulofabres (ulosto) Streptomyces cellulosae, Streptomyces champavatii, Streptomyces chatreausis (Streptomyces chartreusis), Streptomyces chattanoogensis, Streptomyces cheonanensis, Streptomyces chiangmaiensis, Streptomyces chibamaisis, Streptomyces chibaensis Streptomyces chlorochromogenes (Streptomyces chrestomyceticus subsp. Rubescens), Streptomyces crestmyceticus subsp. Rubescens (Streptomyces chromofuscus), Streptomyces chromogenus, Streptomyces chryseus, Streptomyces Streptomyces chrysomallus, Streptomyces chrysomallus subsp.fumigatus, Streptomyces chungwhensis, Streptomyces cinereolecus (Streptomyces cinereortus) Streptomyces cinereolub subsp. Cinereoruber, Streptomyces cinereolub subsp. Streptomyces cinereospinus, Streptomyces cinereus, Streptomyces cinereus Chromogenes (Streptomyces cinnamonensis), Streptomyces cinnabarinus, Streptomyces cinnamocastaneus, Streptomyces cinnamonensis (Streptomyces cinnamonensis), Streptomyces cinnamonensis Streptomyces cinnamoneus subsp. Forma azacoluta, Streptomyces cinnamoneus subsp. Forma azacoluta, Streptomyces cinnamoneus subsp. Forma azacoluta Streptomyces cinnamoneus subsp. Lanosus), Streptomyces cinnamoneus subspices spurs (Streptomyces cinnamoneus subsp. sparsus), Streptomyces circulatus, Streptomyces cirratus, Streptomyces ciscaucasicus, Streptomyces citreofluorescens , Streptomyces citreus, Streptomyces citricolor, Streptomyces clavifer, Streptomyces clavuligerus, Streptomyces clavuligerus (Streptomyces clavuligerus) Streptomyces coacervatus), Streptomyces cocklensis, Streptomyces coelescens, Streptomyces coeliascens (Streptomyc es coeliatus), Streptomyces coelicoflavus (Streptomyces coelicoflavus), Streptomyces coelicolor (Streptomyces coelicolor), Streptomyces coeruleoaurantiacus, Streptomyces coerleofuscus (ule) Streptomyces coeruleoprunus, Streptomyces coeruleorubidus, Streptomyces coerulescens, Streptomyces collinus, Streptomyces collinus, Streptomyces collinus・ Streptomyces collinus subsp. Albescens, Streptomyces colombiensis, Streptomyces colle Streptomyces coralus, Streptomyces corchorusii, Streptomyces coriofaciens, Streptomyces costaricanus, Streptomyces creterifer (Streptomyces craterifer) , Streptomyces cremeus, Streptomyces croceus, Streptomyces crystallinus, Streptomyces curacoi, Streptomyces cuspidus pid Streptomyces cyaneofuscatus, Streptomyces cyaneogriseus, Streptomyces cyaneusus (S treptomyces cyaneus), Streptomyces cyanoalbus, Streptomyces cyanocolor, Streptomyces cyanogenus, Streptomyces cyanogriseus, Streptomyces cyanogriseus, Streptomyces cyanogriseus Streptomyces cylindosporus, Streptomyces daghestanicus, Streptomyces davawensis, Streptomyces decoyicus, Streptomyces decoyicus, Strepmyces rep Streptomyces diastaticus (Streptomyces diastaticus), Streptomyces diastaticus subspecies Ardesiacas (Streptomyces diastaticus subsp. ardesiacus), Streptomyces diastaticus subsp. diastaticus, Streptomyces diastatochromogenes, Streptomyces diastatochromogenes, Streptomyces diastatochromogenes subspecies Luteus (Streptomyces diastatochromogenes subsp. Luteus), Streptomyces distallicus, Streptomyces djakartensis, Streptomyces drozdowiczii, Streptomyces drazdowiczii Streptomyces durhamensis), Streptomyces durmitorensis, Streptomyces eburosporeus, Streptomyces Streptomyces echinatus, Streptomyces echinoruber, Streptomyces ederensis, Streptomyces elgreteus, Streptomyces elgreteus elizabeth iza・ Streptomyces emeiensis, Streptomyces endus, Streptomyces enissocaesilis, Streptomyces eridani, Streptomyces erumpens (Streptomyces erumpens)・ Erythrochromogenes (Streptomyces erythrochromogenes), Streptomyces erythrogriseus, Streptomyces espi Nosus (Streptomyces espinosus), Streptomyces eurocidicus (Streptomyces europaeiscabiei), Streptomyces eurythermus (Streptomyces eurythermus), Streptomyces exfoliatus (Streptomyces exforiatus) exfoliatus, Streptomyces fasiculatus, Streptomyces ferreus, Streptomyces ferralitis, Streptomyces ferralitis, Streptomyces fervens subsp melrosporus), Streptomyces ficellus, Streptomyces filamentosus, Streptomyces filipine Streptomyces filipinensis, Streptomyces fimbriatus, Streptomyces fimicarius, Streptomyces finlayi, Streptomyces flaveolus, Streptomyces flaveolus Streptomyces flaveus, Streptomyces flavidofuscus, Streptomyces flavidovirens, Streptomyces flavidovirens subsp. Fuscus, Streptomyces flavidovircus subsp. Flavis cleoticus (Streptomyces flaviscleroticus), Streptomyces flavochromogenes (Streptomyces flavochromogenes), Streptomyces flavo Streptomyces flavofungini, Streptomyces flavofuscus, Streptomyces flavogriseus, Streptomyces flavomacrosporus, Streptomyces fra Streptomyces rep Streptomyces flavotricini, Streptomyces flavotricini subsp. Pseudochromogenes, Streptomyces flavovariinis, Streptomyces flavovariabilis, Streptomyces flaviense flavovirens), Streptomyces flavoviridis (Streptomyces flavoviridis), Streptomyces flavaz (Streptomyces flavus), Streptomyces flocculus, Streptomyces floridae, Streptomyces fluorescens, Streptomyces fradiae, Streptomyces fradiae (Streptomyces fradiae) fradiae subsp. acinicolor




), Streptomyces fradiae subsp. Italicus, Streptomyces fragilis, Streptomyces fragmentans, Streptomyces fragmentments subspecies・ Aquatica, Streptomyces fulvissimus, Streptomyces fulvobeus, Streptomyces fulvoviolaceus, Streptomyces fulvoviolaceus, Streptomyces (Streptomyces fulvoviridis), Streptomyces fumanus, Streptomyces fumigatiscleroticus, Streptomyces Streptomyces fungicidicus, Streptomyces furlongus, Streptomyces furlongus subsp. Furlongus, Streptomyces fuscoatrus ), Streptomyces gabonae, Streptomyces galbus, Streptomyces galilaeus, Streptomyces gallinarius, Streptomyces dicus ), Streptomyces gangtokensis, Streptomyces gannmycicus, Streptomyces garden (Streptomy ces garden), Streptomyces gardneri, Streptomyces gedanensis, Streptomyces gelaticus, Streptomyces geldanamycininus, Streptomyces geldanamycininus・ Streptomyces geysiriensis 、 Streptomyces ghanaensis 、 Streptomyces gibsonii 、 Streptomyces ginsengisoli 、 Streptomyces gloces Streptomyces glauciniger, Streptomyces glaucosporus, Streptomyces glaucus , Streptomyces globifer, Streptomyces globisporus, Streptomyces globisporus subsp. Caucasicus, Streptomyces globisporus・ Streptomyces globisporus (Streptomyces globisporus subsp. Globisporus), Streptomyces globosus, Streptomyces glomeratus, Streptomyces glomeroaurantiacus (Streptomyces glomeroaurant Streptomyces glomeroau) Streptomyces glomerochromogenes, Streptomyces gobitricini, Streptomyces goshricensis (Streptomyces goshricensis) ikiensis), Streptomyces gougerotii, Streptomyces graminearus, Streptomyces gramineus, Streptomyces graminofaciens, Streptomyces graminofaciens, Streptomyces graminofaciens, Streptomyces graminofaciens, Streptomyces graminofaciens, Streptomyces graminofaciens Streptomyces griseiniger, Streptomyces griseinus, Streptomyces griseoaurantiacus, Streptomyces griseobrunneuus, Streptomyces griseobrunneus (Streptomyces griseocarneus), Streptomyces griseochromogenes (Streptomyces griseochromogenes), Streptomyces griseochromogenes subspecies Streptomyces griseochromogenes subsp. Suitaensis, Streptomyces griseofaciens, Streptomyces griseoflavus, Streptomyces griseoflavus subspice g Streptomyces griseofuscus, Streptomyces griseoincarnatus, Streptomyces griseoloalbus, Streptomyces griseolousbus (Streptomyces griseofuscus) ), Streptomyces griseolus, Streptomyces griseoluteus, Streptomyces Streptomyces griseomycini, Streptomyces griseoplanus, Streptomyces griseorubens, Streptomyces griseoruber, Streptomyces griseoruber, Streptomyces griseorub Streptomyces griseospiralis, Streptomyces griseosporeus, Streptomyces griseostramineus, Streptomyces griseostramineus, Streptomyces griseostramineus griseoverticillatus), Streptomyces griseoviridis, Streptomyces griseus, Streptomyces Streptomyces griseus subsp. Bruneus, Streptomyces griseus subsp. Desideus, Streptomyces griseus subsp. Streptomyces griseus subsp. Formicus, Streptomyces griseus subsp. Griseus, Streptomyces griseus subsp. Perpareus (Streptomyces griseus subsp. Formicus) subsp. purpureus), Streptomyces griseus subsp. rhodochrous, Streptomyces griseus subsp. -Streptomyces griseus subsp. Solvifaciens, Streptomyces guanduensis, Streptomyces gulbargensis, Streptomyces gypseus, Streptomyces gypseus Streptomyces hainanensis, Streptomyces halotolerans, Streptomyces halstedii, Streptomyces halstedii, Streptomyces hawaiens Streptomyces hazeliensis, Streptomyces hebeiensis, Streptomyces heimi, Streptomyces heimi Streptomyces heliomycini, Streptomyces helvaticus, Streptomyces henetus, Streptomyces herbaricolor, Streptomyces heteromorphus (Streptomyces heteromorphus ), Streptomyces himgriensis, Streptomyces hiroshimensis, Streptomyces hirsutus, Streptomyces horton, Streptomyces horton, Streptomyces humida Streptomyces humidus), Streptomyces humidus subsp. Antitumoris, Streptomyces humifer (Strept) omyces humifer), Streptomyces humiferus, Streptomyces hundungensis, Streptomyces hyalinus, Streptomyces hyderabadensis, Streptomyces hyderabadensis, Streptomyces hyderabadensis Streptomyces hydrogenans, Streptomyces hygroscopicus, Streptomyces hygroscopicus subsp. Abomyceticus, Streptomyces hygroscopicus Streptomyces hygroscopicus subsp. Angustmyceticus, Streptomyces hygroscopicus subspecies azalomizeti (Streptomyces hygroscopicus subsp. Azalomyceticus), Streptomyces hygroscopicus subsp. Crystallogenes (Streptomyces hygroscopicus subsp. Crystallogenes), Streptomyces hygroscopicus subsp. Streptomyces hygroscopicus subsp. Geldanus, Streptomyces hygroscopicus subsp. Geldanus, Streptomyces hygroscopicus subsp. Geldanus, Streptomyces hygroscopicus subsp. Geldanus・ Streptomyces hygroscopicus subsp. Glebosus, Streptomyces hygroscopicus ・ Subspecies hyaromyceticus (Streptomyces hygro scopicus subsp. hialomyceticus), Streptomyces hygroscopicus subsp. hygroscopicus, Streptomyces hygroscopicus subsp. hygroscopius, Streptomyces hygroscopicus subsp. hygroscopius Streptomyces hygroscopicus subsp. Ossamyceticus, Streptomyces hygroscopicus subsp. Ossamyceticus, Streptomyces hygroscopicus subsp. Ossamyceticus, Streptomyces hygroscopicus subsp. Ossamyceticus (Streptomyces hygrospinosus), Streptomyces iakyrus, Streptomyces inaequalis, Streptomyces indiaquale Streptomyces indiaensis, Streptomyces indicus, Streptomyces indigocolor, Streptomyces indigoferus, Streptomyces indieniensis, Streptomyces indieniensis Streptomyces insignis, Streptomyces
・ Streptomyces intermedius, Streptomyces inusitatus, Streptomyces ipomoeae, Streptomyces iranensis, Streptomyces ishigakire Streptomyces ishigaki Streptomyces jamaicensis, Streptomyces janthinus, Streptomyces javensis, Streptomyces jietaisiensis, Streptomyces juy , Streptomyces jumonjinensis, Streptomyces kagawaensis, Streptomyces・ Streptomyces kagoshimanus 、 Streptomyces kanamyceticus 、 Streptomyces kaniharaensis 、 Streptomyces karnatakensis 、 Streptomyces karnatakensis 、 Streptomyces rep kasugaensis), Streptomyces kasugaspinus, Streptomyces katrae, Streptomyces kentuckensis, Streptomyces khandalensis, Streptomyces khandalensis, Streptomyces khandalensis (Streptomyces kitasatoensis), Streptomyces kobenensis, Streptomyces koyangensis, Streptomyces koyangensis Streptomyces krainskii, Streptomyces kunmingensis, Streptomyces kurssanovii, Streptomyces kuwaitiensis, Streptomyces lavaeda Streptomyces labedae), Streptomyces laceyi, Streptomyces laculatusporus, Streptomyces laeteviolaceus, Streptomyces lanatus (Streptomyces lanatus) Streptomyces lannensis, Streptomyces lasaliensis, Streptomyces lateritius, Streptomyces・ Streptomyces laurentii, Streptomyces lavendofoliae, Streptomyces lavendulae, Streptomyces lavendulae subspices, Stuptomysp. Streptomyces lavendulae subsp. Lavendulae (Streptomyces lavendulae subsp. Lavendulae), Streptomyces lavendulae subsp. Lavendula Lecto (Streptomyces lavendulae subsp. Streptomyces lavenduligriseus, Streptomyces lavendulocolor, Streptomyces Streptomyces lazureus, Streptomyces levis, Streptomyces levoris, Streptomyces libani, Streptomyces libani subspice libani subsp libani, Streptomyces libani subsp. rufus, Streptomyces lienomycini, Streptomyces lieskei, Streptomyces lilaceus ), Streptomyces lilacinofulvus, Streptomyces lilacinus, Streptomyces limosus, Streptomyces limosus, Streptomyces limosus, Streptomyces limosus, Streptomyces limosus Streptomyces lincolnensis, Streptomyces lipmanii, Streptomyces lisandri, Streptomyces litmocidini, Streptomyces lividis (Streptomyces lividis (Streptomyces lividans) Streptomyces lividoclavatus, Streptomyces lividus, Streptomyces loidensis, Streptomyces lomondensis, Streptomyces lomondensis, Streptomyces lomondensis (Streptomyces longisporoflavus), Streptomyces longispororuber, Streptomyces longispororuber, Streptomyces longisporoflavus Streptomyces longissimus, Streptomyces longwoodensis, Streptomyces lucensis, Streptomyces lunalinharensis, Streptomyces lunalinharensis, Streptomyces lunalinharensis Streptomyces lunalinharesii, Streptomyces luridiscabiei, Streptomyces luridus, Streptomyces lusitanus, Streptomyces lucitanus subpyrus Cyclini (Streptomyces lusitanus var. Tetracyclini), Streptomyces luteireticuli, Streptomyces luteocolor, Streptomyces Streptomyces luteogriseus, Streptomyces luteolutescens, Streptomyces luteosporeus, Streptomyces luteoverticillatus (Streptomyces luteoverticillatus), Streptomyces luteoverticillatus (Streptomyces luteoverticillatus) lydicus), Streptomyces macromomyceticus, Streptomyces macrosporus, Streptomyces macrosporus, Streptomyces maizeus, Streptomyces maizeus Streptomyces malachiticus, Streptomyces malachiticus subspices, Griseospinosas p. Streptomyces malaysiensis, Streptomyces manipurensis, Streptomyces marinus, Streptomyces maritimus, Streptomyces marokenen (Streptomyces marokenen) ), Streptomyces mashuensis, Streptomyces massasporeus, Streptomyces mashuensis Streptomyces matensis, Streptomyces mauvecolor, Streptomyces mayteni, Streptomyces mediocidicus, Streptomyces mediolani, Streptomyces mediolani, Streptomyces mediolani Streptomyces megasporus, Streptomyces melanogenes, Streptomyces melanosporofaciens, Streptomyces mentougouensis, Streptomyces mentougouensis, Streptomyces mentougouensis Streptomyces mexicanus, Streptomyces michiganensis, Streptomyces michiganensis, Subspecies amylolyticus (Str eptomyces michiganensis subsp. amylolyticus), Streptomyces microflavus, Streptomyces microsporus, Streptomyces miharaensis, Streptomyces minoensis (Streptomyces minoensis) Streptomyces minutiscleroticus, Streptomyces mirabilis, Streptomyces misakiensis, Streptomyces misawanensis, Streptomyces misawanensis, Streptomyces misawanensis (Streptomyces misionensis), Streptomyces mobaraensis, Streptomyces moderatus, Streptomyces Streptomyces monomycini, Streptomyces mordarskii, Streptomyces morookaense, Streptomyces morookaensis, Streptomyces murookaensis, flavus Streptomyces multispiralis, Streptomyces murinus, Streptomyces mutabilis, Streptomyces mutomycini, Streptomyces mycarfaciens of Stactomyces , Streptomyces myxogenes, Streptomyces naganishii, Streptomyces naninge Streptomyces nanningensis, Streptomyces nanshensis, Streptomyces naraensis, Streptomyces narbonensis, Streptomyces nashbilensis (Streptomyces nashensis) Streptomyces natalensis, Streptomyces neburosus, Streptomyces neocaliberis, Streptomyces netropsis, Streptomyces neroposa, Streptomyces neyen Niguelus (Streptomyces nigellus), Streptomyces niger (Streptomyces niger), Streptomyces nigrescens (Streptomyces nigrescens) , Streptomyces nigrifaciens, Streptomyces nigrogriseolus, Streptomyces nigroviolens, Streptomyces nitrosporeus, Streptomyces niveoruber, Stre
Streptomyces niveus, Streptomyces nobilis, Streptomyces noboritoensis, Streptomyces nodosus, Streptomyces nodosus subspices Assis (Streptomyces nodosus subsp. Asukaensis), Streptomyces nogalater, Streptomyces nojiriensis, Streptomyces noursei, Streptomyces noursei (Streptomyces nogalsei) novaecaesareae), Streptomyces novoverticillus, Streptomyces ochraceiscleroticus, Streptomyces oo Streptomyces ochrosporus, Streptomyces odorifer, Streptomyces ogaensis, Streptomyces oidiosporus, Streptomyces olichostic scleroticus ), Streptomyces olivaceoviridis, Streptomyces olivaceus, Streptomyces olivochromogenes, Streptomyces olivochromogenes subspecies Cytobilinas (Streptomyces olivochromogenes subsp. Cytovirinus), Streptomyces olivogriseus (Streptomyces olivogriseus), Streptomyces olivoverticillatus Streptomyces olivoverticillatus), Streptomyces olivoviridis, Streptomyces omiyaensis, Streptomyces orinoci, Streptomyces ornatus, Streptomyces ornatus, Streptomyces ortotus Streptomyces osmaniensis, Streptomyces ostreogriseus, Streptomyces owasiensis, Streptomyces pactum, Streptomyces padanus (us) Streptomyces pallidus, Streptomyces panacagri, Streptomyces panaciterrae, Streptomyces panacacie Streptomyces panayensis, Streptomyces paradoxus, Streptomyces paraguayensis, Streptomyces parvulus, Streptomyces parvulus, Streptomyces parves (us) Streptomyces paucidiastaticus, Streptomyces paucisporeus, Streptomyces paucisporogenes, Streptomyces paulus, Streptomyces paulus, Streptomyces perulus (Streptomyces peruviensis), Streptomyces peucetius, Streptomyces peucetius subspecies ca Streptomyces peucetius subsp. Caesius, Streptomyces peucetius subsp. Carneus, Streptomyces phaeochromogenes, Streptomyces faeochromes phaeofaciens), Streptomyces phaeoluteichromatogenes, Streptomyces phaeoluteigriseus, Streptomyces phaeopurpureus, Streptomyces Streptomyces phaeoviridis (Streptomyces phaeoverticillatus subsp. Takatsukiensis), Streptomyces phaeoviridis, Strep Streptomyces pharetrae, Streptomyces phemorphus, Streptomyces phytohabitans, Streptomyces pilosus, Streptomyces pilosus Streptomyces piloviolofuscus), Streptomyces piomogenus, Streptomyces platensis, Streptomyces platensis subsp. Clarensis, Streptomyces platensis・ Malvinus (Streptomyces platensis subsp. Robigocidicus), Streptomyces platensis subspices Robigocidicus, Streptomyces plicatus, Streptomyces plumbeus, Streptomyces plumbiresistens, Streptomyces pluricolorescens, Streptomyces polyantibiosis Streptomyces polyantibioticus, Streptomyces polychromogenes, Streptomyces polychromogenes subsp. Arenicolus, Streptomyces poonensis, Streptomyces poonensis, Streptomyces poonensis Streptomyces praecox, Streptomyces prasinopilosus, Streptomyces prasinospo (Streptomyces prasinosporus), Streptomyces prasinus, Streptomyces pristinaespiralis, Streptomyces propurpuratus, Streptomyces prunicolor, Streptomyces prunicolor Streptomyces psammoticus), Streptomyces pseudoechinosporeus, Streptomyces pseudogriseolus, Streptomyces pseudogriseolus subspices flucofermentans ), Streptomyces pseudovenezuelae, Streptomyces pulcher, Streptomyces Streptomyces pulveraceus, Streptomyces puniceus, Streptomyces puniceus subsp. Doliceus, Streptomyces puniciscabi, Streptomyces punicis Chromogenes (Streptomyces purpeochromogenes), Streptomyces purpeofuscus, Streptomyces purpurascens, Streptomyces purpureofuscus, Streptomyces purpureofuscus Scus subspecies acoagulance (Streptomyces purpureofuscus subsp. Acoagulans), Streptomyces purpureus, Streptomyces -Streptomyces purpurogeneiscleroticus, Streptomyces pyridomyceticus, Streptomyces racemochromogenes, Streptomyces racemosus, Streptomyces racemosus, Streptomyces racemosus, Streptomyces racemosus Streptomyces radiopugnans, Streptomyces raffinosus, Streptomyces rameus, Streptomyces ramosissimus, Streptomyces ramosissus Streptomyces rangoonen, Streptomyces rangoonensis, Streptomyces rapamycins (Streptomyces rapamycincus), Streptomyces recifensis, Streptomyces rectiviolaceus, Streptomyces refuineus subsp. thermotolerans, Streptomyces subsp. thermotolerans, Streptomyces Streptomyces regalis), Streptomyces regensis, Streptomyces resistomycificus, Streptomyces reticuli subspecies protomycicus, Streptomyces reticuli subsp. Protomycicus Streptomyces reticuliscabiei, Streptomyces rhizosphaericus, Streptomyces ribosidifficus Streptomyces ribosidificus), Streptomyces rimofaciens, Streptomyces limosus (Streptomyces rimosus), Streptomyces limosus subspices Palomomyces subsp. Rimosus (Streptomyces rimosus subsp. Rimosus), Streptomyces rishiriensis, Streptomyces robefuscus, Streptomyces rochei, Streptomyces rosa (Streptomyces rosa) , Streptomyces rosa subsp. Notoensis, Streptomyces roseis scleroticus (Streptomyces roseiscleroti cus), Streptomyces roseoalbus, Streptomyces roseoaurantius, Streptomyces roseochromogenes, Streptomyces roseochromogenes (Streptomyces roseoogenus) Streptomyces roseochromogenus subsp. Albocyclini, Streptomyces roseocinereus, Streptomyces roseocinereus, Streptomyces roseodiastaticus, Streptomyces roseodiastaticus・ Roseoflavus (Streptomyces roseoflavus), Streptomyces roseofulvus (Streptomyces roseofulvus), Streptomyces roseogriseus (Streptomyces roseogriseus), Streptomyces roseoliplatinus (Streptomyces roseolilacinus), Streptomyces roseoluteus (Streptomyces roseoluteus), Streptomyces roseoplatus (Streptomyces roseoplatus), Streptomyces rose ns rep Myses Roseo
Streptomyces roseosporus, Streptomyces roseoverticillatus (Streptomyces roseoverticillatus), Streptomyces roseoviolaceus, Streptomyces roseoviolascens, Streptomyces roseosviolascens, Streptomyces roseoviridis), Streptomyces roseus, Streptomyces ruber, Streptomyces rubicolor, Streptomyces rubidus, Streptomyces rubidus, Streptomyces rubiduso Herbolus (Streptomyces rubiginosohelvolus), Streptomyces rubiginosus, Streptomyces rubrireticuli, Streptomyces Streptomyces rubrocyanodiastaticussubsp. Piger, Streptomyces rubrogriseus, Streptomyces rubrolavendulae, Streptomyces・ Streptomyces rubroverrucosus, Streptomyces rubrus, Streptomyces rufochromogenes, Streptomyces rutgersensis, Streptomyces rensis ryensis), Streptomyces sahachiroi, Streptomyces sakaiensis, Streptomyces salinarum, Stre Streptomyces sampsonii, Streptomyces sanglieri, Streptomyces sannanensis, Streptomyces sannurensis, Streptomyces sannurensis (Streptomyces sannurensis) Streptomyces saprophyticus, Streptomyces saraceticus, Streptomyces sayamaensis, Streptomyces scabiei, Streptomyces screpeices (Streptomyces screpeices) scabrisporus), Streptomyces sclerogranulatus (Streptomyces sclerogranulatus), Streptomyces sclerotialus (Streptomyces sclerot ialus), Streptomyces scopiformis, Streptomyces sedi, Streptomyces senoensis, Streptomyces seoulensis, Streptomyces septas (Streptomyces septatus), Streptomyces serianimatus, Streptomyces setae, Streptomyces setonensis, Streptomyces setonii, Streptomyces setonii Streptomyces shaanxiensis, Streptomyces shiodaensis, Streptomyces showdoensis, Streptomyces cinder Streptomyces sindenensis, Streptomyces sioyaensis, Streptomyces sodiiphilus, Streptomyces somaliensis, Streptomyces spadicis, Streptomyces spadicis Streptomyces sparsogenes, Streptomyces sparsus, Streptomyces specialis, Streptomyces spectabilis, Streptomyces sponbones (Streptomyces sponei) Streptomyces spheroides, Streptomyces spinichromogenes, Streptomyces spinico Streptomyces spinicoumarensis, Streptomyces spinoverrucosus, Streptomyces spiralis, Streptomyces spiroverticillatus, Streptomyces spongiae (Streptomyces spteia streptiae) Streptomyces sporocinereus, Streptomyces sporoclivatus, Streptomyces spororaveus, Streptomyces sporoverrucosus, Streptomyces (Streptomyces steffisburgensis), Streptomyces steffisburgensis (Streptomyces steffisburgensis) teffisburgensis subsp. steffisburgensis), Streptomyces stelliscabiei, Streptomyces stramineus, Streptomyces subrutilus, Streptomyces subdantis Streptomyces sulfonofaciens, Streptomyces sulphureus, Streptomyces sviceus, Streptomyces synnematoformans, Streptomyces synnematoformans (Streptomyces synnematoformans) Streptomyces tanashiensis), Streptomyces tanashiensis subsp. Cephalomyceticus, Stretomyces tanashiensis subsp. Cephalomyceticus Streptomyces tateyamensis, Streptomyces tauricus, Streptomyces tendae, Streptomyces tenebrarius, Streptomyces tenebramarisis (Streptomyces tenrimarisis) , Streptomyces termitum, Streptomyces testaceus, Streptomyces tetanusemus, Streptomyces thermoalcalitolerans, Streptomyces thermoalcalitolerans Streptomyces thermoatroviridis, Streptomyces thermocarboxydovorans, Streptomyces thermocal Streptomyces thermocarboxydus, Streptomyces thermocastaneus, Streptomyces thermocoerulescens, Streptomyces thermocoprophilus, Streptomyces thermosia Streptomyces thermocyaneomaculatus, Streptomyces thermocyaneoviolaceus, Streptomyces thermodiastaticus, Streptomyces thermoflavus, Streptomyces thermoflavus, Streptomyces thermoflavus Thermogriseviolaceus (Streptomyces thermogriseoviolaceus), Streptomyces thermogriseus, Streptomyces sir Streptomyces thermohylacscopicus subsp. Rubiginosus, Streptomyces thermolilacinus, Streptomyces thermolineatus, Streptomyces thermolineats eu, Streptomyces thermomolatus eu Streptomyces thermoluteus subsp. Fuscus, Streptomyces thermonitrificans, Streptomyces thermoolivaceus subsp. Fuscus Streptomyces thermoolivaceus subsp. Thermoolivaceus, Streptomyces Thermophilus, Streptomyces thermospinosisporus, Streptomyces thermotolerans, Streptomyces thermoviolaceus, Streptomyces thermoviolaceus, Streptomyces thermoviolaceus Streptomyces thermoviolaceus subsp. Apingens, Streptomyces thermoviolaceus subsp. Thermoviolaceus, Streptomyces thermovulgaris, Streptomyces thermovulgaris, Streptomyces thermovulgaris Singhirensis (Streptomyces thinghirensis), Streptomyces thioluteus (Streptomyces thioluteus), Streptomyces threomytheticus (St reptomyces threomyceticus), Streptomyces torulosus, Streptomyces tosaensis, Streptomyces toxifertilis, Streptomyces toxytricini, Streptomyces toxytricini Streptomyces toyocaensis, Streptomyces triangulatus, Streptomyces tricolor, Streptomyces triculaminicus, Streptomyces triostinicus (Streptomyces triangulatus) triostinicus), Streptomyces tritolerans, Streptomyces tsukiyonensis, Streptomyces tsushi Ensis (Streptomyces tsusimaensis), Streptomyces tubercidicus, Streptomyces tuirus, Streptomyces tumemacerans, Streptomyces tutum, Streptomyces tumuli Streptomyces turgidiscabies, Streptomyces umbrinus, Streptomyces umbrosus, Streptomyces variabilis, Streptomyces variabilis, Strepmyces variegis variegatus), Streptomyces varius, Streptomyces varsoviensis, Streptomyces vastus, Streptomyces vellosus, Streptomyces vendargensis, Streptomyces venezuelae, Streptomyces verne, Streptomyces verneperis (Streptomyces versipellis), Streptomyces vertisilay
Streptomyces verticillatus, Streptomyces verticillus, Streptomyces vietnamensis, Streptomyces vinaceus, Streptomyces vinaceus, Strepd Streptomyces violaceochromogenes (Streptomyces violaceochromogenes), Streptomyces violaceolatus (Streptomyces violaceorectus), Streptomyces violaceorectus (Streptomyces violaceorectus) Theorbidus (Streptomyces violaceorubidus), Streptomyces violaceus (Streptomyces violaceus), Streptomyces violaceus niger (Strepto myces violaceusniger), Streptomyces violarus, Streptomyces violascens, Streptomyces violens, Streptomyces violorubens, Streptomyces violorubens -Streptomyces virens, Streptomyces virginiae, Streptomyces virginiae subsp. Lipoxae, Streptomyces viridans, Streptomyces viridans, Streptomyces viridans Streptomyces viridifaciens, Streptomyces viridiflavus, Streptomyces viridis, Streptomyces viridis Streptomyces viridiviolaceus, Streptomyces viridobrunneus, Streptomyces viridochromogenes, Streptomyces viridchromogenes subsp. ), Streptomyces viridochromogenes subsp. Sulfomycini, Streptomyces viridodiastaticus, Streptomyces viridogenes, Streptomyces viridogenes, Streptomyces viridogenes・ Streptomyces viridosporus, Streptomyces viridoverrucosus, Streptomyces vitaminophila (Streptomyces vitaminophilus), Streptomyces vulgaris, Streptomyces wedmorensis, Streptomyces wellingtoniae, Streptomyces werraensis, Streptomyces werraensis Streptomyces willmorei, Streptomyces wistariopsis, Streptomyces woolensis, Streptomyces xanthochromogenes, Streptomyces xanthochromogenes Dicas (Streptomyces xanthocidicus), Streptomyces xantholiticus (Streptomyces xantholiticus), Streptomyces xanthophaeus (Streptomyces xanthophaeus), Streptomyces xiamenensis, Streptomyces xinghaiensis, Streptomyces xylophagus, Streptomyces yanglinensis, Streptomyces yanglinensis Streptomyces yanii), Streptomyces yatensis, Streptomyces yeochonensis, Streptomyces yerevanensis, Streptomyces yogyakartensis, Streptomyces yogyakartensis・ Yokokanensis (Streptomyces yokosukanensis), Streptomyces youssoufiensis (Streptomyces youssoufiensis), Streptomyces unannensis (S treptomyces yunnanensis), Streptomyces zaomyceticus, Streptomyces zelensis, Streptomyces zinciresistens and the like.

  Examples of microorganisms classified into the genus Geobacillus include, for example, Geobacillus caldoproteolyticus, Geobacillus caldoxylosilyticus, Geobacillus debilis, Geobacillus debilis, Geobacillus debilis, Geobacillus galactosidasius, Geobacillus gargensis, Geobacillus jurassicus, Geobacillus kaustophilus, Geobacillus pallius, Geobacillus pallius Thermophilus (Geobacillus stearothermophilus), Geobacillus stromboliensis (Geobacillus stromboliensis), Geobacillus subterra Geobacillus subterraneus, Geobacillus tepidamans, Geobacillus thermocatenulatus, Geobacillus thermodenitrificans, Geobacillus thermodenitrificans Calidus), Geobacillus thermoglucosidasius, Geobacillus thermoleovorans, Geobacillus toebii, Geobacillus tocili, genus basilis genus vulcani), Geobacillus zalihae, and the like.

  Examples of microorganisms classified into the genus Rhodococcus include, for example, Rhodococcus rhodochrous, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus rhodoch, Rhodococcus rhodoch Rhodococcus corallinus, Rhodococcus rubropertinctus, Rhodococcus coprophilus, Rhodococcus globercus, Rhodococcus globercus, Rhodococcus globercus, Rhodococcus globercus, Rhodococcus globercus ), Rhodococcus aichiensis, Rhodococcus chubuensis, Rhodococcus maris, Dokokkasu-Fashiensu (Rhodococcus fascines), and the like.

Furthermore, the following microorganisms are mentioned as a preferable species.
Examples of microorganisms classified into the genus Magnetospirillum include Magnetospirillum magneticum. Examples of microorganisms classified into the genus Rhodospirillum include Rhodospirillum rubrum, Rhodospirillum centenum, and Rhodospirillum photometricum. Examples of microorganisms classified into the genus Azospirillum include Azospirillum lipoferum and Azospirillum brasilense. Examples of microorganisms classified into the genus Tistrella include Tistrella mobilis. Examples of microorganisms classified into the genus Acidiphilium include Acidiphilium cryptum and Acidiphilium multivorum. Examples of microorganisms classified into the genus Rhodobacter include Rhodobacter sphaeroides and Rhodobacter capsulatus. Examples of microorganisms classified into the genus Ruegeria include Ruegeria pomeroyi. Examples of microorganisms classified into the genus Roseobacter include Roseobacter denitrificans and Roseobacter litoralis. Examples of microorganisms classified into the genus Dinoroseobacter include Dinoroseobacter shibae. Examples of microorganisms classified into the Phaeobacter genus include Phaeobacter gallaeciensis. Examples of microorganisms classified into the genus Octadecabacter include Octadecabacter antarcticus and Octadecabacter arcticus. Examples of microorganisms classified into the genus Hyphomonas include Hyphomonas neptunium. Examples of microorganisms classified into the genus Maricaulis include Maricaulis maris. Examples of microorganisms classified into the genus Hirschia include Hirschia baltica. Examples of microorganisms classified into the genus Novosphingobium include Novosphingobium aromaticivorans. Examples of microorganisms classified into the genus Sphingopyxis include Sphingopyxis alaskensis. Examples of microorganisms classified into the genus Sphingobium include Sphingobium japonicum and Sphingobium chlorophenolicum. Examples of microorganisms classified into the genus Erythrobacter include Erythrobacter litoralis. Examples of microorganisms classified into the genus Caulobacter include Caulobacter crescentus and Caulobacter segnis. Examples of microorganisms classified into the genus Phenylobacterium include Phenylobacterium zucineum. Asticcacaulis excentricus is mentioned as a microorganism classified into the genus Asticcacaulis. Examples of microorganisms classified into the genus Sinorhizobium include Sinorhizobium meliloti, Sinorhizobium medicae, and Sinorhizobium fredii. Azorhizobium caulinodans is mentioned as microorganisms classified into the genus Azorhizobium. Examples of microorganisms classified into the genus Brucella include Brucella melitensis, Brucella abortus, Brucella suis, Brucella ovis, Brucella canis, Brucella microti, Brucella pinnipedialis, and Brucella ceti. Aurantimonas manganoxydans is mentioned as a microorganism classified into Aurantimonas genus. Examples of microorganisms classified into the genus Bradyrhizobium include Bradyrhizobium japonicum. Examples of microorganisms classified into the genus Agromonas include Agromonas oligotrophica. Examples of microorganisms classified into the genus Rhodopseudomonas include Rhodopseudomonas palustris. Examples of microorganisms classified into the genus Nitrobacter include Nitrobacter winogradskyi and Nitrobacter hamburgensis. Examples of microorganisms classified into the genus Methylobacterium include Methylobacterium extorquens, Methylobacterium radiotolerans and Methylobacterium nodulans. Examples of microorganisms classified into the genus Rhodomicrobium include Rhodomicrobium vannielii. Examples of microorganisms classified into the genus Pelagibacterium include Pelagibacterium halotolerans. Examples of microorganisms classified into the genus Parvibaculum include Parvibaculum lavamentivorans. Examples of microorganisms classified into the genus Parvularcula include Parvularcula bermudensis. Burkholderia The microorganisms are classified into Burkholderia genus mallei, Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia vietnamiensis, Burkholderia cenocepacia, Burkholderia ambifaria, Burkholderia multivorans, Burkholderia cepacia, Burkholderia xenovorans, Burkholderia phymatum, Burkholderia phytofirmans, Burkholderia glumae, Burkholderia rhizoxinica, Burkholderia gladioli , Burkholderia phenoliruptrix and Burkholderia oklahomensis. Examples of microorganisms classified into the genus Ralstonia include Ralstonia solanacearum, Ralstonia pickettii, and Ralstonia eutropha. Examples of microorganisms classified into the genus Cupriavidus include Cupriavidus metallidurans, Cupriavidus taiwanensis, and Cupriavidus necator. Examples of the microorganism classified into the genus Polynucleobacter include Polynucleobacter necessarius. Examples of microorganisms classified into the genus Bordetella include Bordetella pertussis, Bordetella parapertussis, Bordetella petrii, and Bordetella avium. Examples of microorganisms classified into the genus Taylorella include Taylorella equigenitalis. Examples of microorganisms classified into the genus Alicycliphilus include Alicycliphilus denitrificans. Examples of the microorganism classified into the genus Delftia include Delftia acidovorans, and examples of the microorganism classified into the genus Ramlibacter include Ramlibacter tataouinensis. Examples of microorganisms classified into the genus Rhodoferax include Rhodoferax ferrireducens. Examples of microorganisms classified into the genus Variovorax include Variovorax paradoxus. Examples of microorganisms classified into the genus Polaromonas include Polaromonas naphthalenivorans. Examples of microorganisms classified into the genus Acidovorax include Acidovorax citrulli, Acidovorax ebreus, and Acidovorax avenae. Examples of microorganisms classified into the genus Verminephrobacter include Verminephrobacter eiseniae. As a microorganism classified into the genus Herminiimonas, Herminiimonas arsenicoxydans can be mentioned. Examples of microorganisms classified as Herbaspirillum include Herbaspirillum seropedicae. Collimonas fungivorans can be mentioned as a microorganism classified into the genus Collimonas. Examples of microorganisms classified into the genus Chromobacterium include Chromobacterium violaceum. Examples of microorganisms classified into the genus Laribacter include Laribacter hongkongensis. Examples of microorganisms classified into the genus Pseudogulbenkiania include Pseudogulbenkiania ferrooxidans. As a microorganism classified into the genus Nitrosomonas, Nitrosomonas europaea can be mentioned. Examples of microorganisms classified into the genus Nitrosospira include Nitrosospira multiformis. Examples of microorganisms classified into the genus Aromatoleum include Aromatoleum aromaticum. Examples of microorganisms classified into the genus Dechloromonas include Dechloromonas aromatica. Examples of microorganisms classified into the genus Azospira (Dechlorosoma) include Azospira oryzae (Dechlorosoma suillum). Examples of microorganisms classified into the genus Rheinheimera include Rheinheimera nanhaiensis. Nitrosococcus oceani is mentioned as a microorganism classified into the genus Nitrosococcus. Examples of microorganisms classified into the genus Halorhodospira include Halorhodospira halophila. Examples of microorganisms classified into the genus Xanthomonas include Xanthomonas campestris, Xanthomonas axonopodis, Xanthomonas oryzae, Xanthomonas albilineans, and Xanthomonas citri. Stenotrophomonas maltophilia is mentioned as a microorganism classified into the genus Stenotrophomonas. Examples of microorganisms classified into the genus Pseudoxanthomonas include Pseudoxanthomonas suwonensis and Pseudoxanthomonas spadix. Examples of microorganisms classified into the genus Francisella include Francisella tularensis and Francisella novicida. Examples of microorganisms classified into the genus Cycloclasticus include Cycloclasticus zancles. Examples of microorganisms classified as Hahella include Hahella chejuensis. Examples of microorganisms classified into the genus Halomonas include Halomonas elongata. Examples of microorganisms classified into the genus Alcanivorax include Alcanivorax borkumensis and Alcanivorax dieselolei. Examples of microorganisms classified into the genus Kangiella include Kangiella koreensis. Azotobacter vinelandii is mentioned as a microorganism classified into the genus Azotobacter. Examples of microorganisms classified into the genus Psychrobacter include Psychrobacter arcticus and Psychrobacter cryohalolentis. Alishewanella jeotgali is mentioned as a microorganism classified into the genus Alishewanella. Examples of microorganisms classified into the genus Alteromonas include Alteromonas macleodii. Examples of microorganisms classified into the genus Glaciecola include Glaciecola nitratireducens, Glaciecola psychrophila, and Glaciecola punicea. Examples of microorganisms classified into the genus Marinobacter include Marinobacter aquaeolei, Marinobacter hydrocarbonoclasticus, Marinobacter adhaerens, Marinobacter algicola, and Marinobacter manganoxydans. Examples of microorganisms classified into the genus Marinobacterium include Marinobacterium stanieri. Examples of microorganisms classified into the genus Saccharophagus include Saccharophagus degradans. Examples of microorganisms classified into the genus Ferrimonas include Ferrimonas balearica. Examples of microorganisms classified into the genus Idiomarina include Idiomarina loihiensis and Idiomarina baltica. Examples of microorganisms classified as Colwellia include Colwellia psychrerythraea. Examples of microorganisms classified into the genus Pseudoalteromonas include Pseudoalteromonas haloplanktis, Pseudoalteromonas atlantica, and Pseudoalteromonas tunicata. Microorganisms classified into the genus Vibrio include Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio harveyi, Vibrio furnissii, Vibrio tubiashii, Vibrio sinaloensis, Vibrio rotiferianus, Vibrio orientalis, Vibrio harveyi, Vibrio coricii, Vibrio coric . Examples of microorganisms classified into the genus Photobacterium include Photobacterium profundum. Examples of microorganisms classified as Aeromonas include Aeromonas hydrophila, Aeromonas salmonicida and Aeromonas veronii. Examples of microorganisms classified into the genus Salinisphaera include Salinisphaera shabanensis. Examples of microorganisms classified into the genus Legionella include Legionella pneumophila and Legionella longbeachae. Examples of microorganisms classified into the genus Coxiella include Coxiella burnetii. Examples of microorganisms classified into the genus Desulfococcus include Desulfococcus oleovorans. Examples of microorganisms classified into the genus Desulfobacterium include Desulfobacterium autotrophicum. Examples of microorganisms classified into the genus Desulfatibacillum include Desulfatibacillum alkenivorans. Examples of microorganisms classified into the genus Desulfobulbus include Desulfobulbus propionicus. Examples of microorganisms classified into the genus Desulfarculus include Desulfarculus baarsii. Examples of microorganisms classified into the genus Geobacter include Geobacter metallireducens, Geobacter uraniireducens and Geobacter bemidjiensis. Examples of microorganisms classified into the genus Syntrophobacter include Syntrophobacter fumaroxidans. Examples of microorganisms classified into the genus Syntrophus include Syntrophus aciditrophicus. Examples of microorganisms classified into the genus Desulfomonile include Desulfomonile tiedjei. Examples of microorganisms classified into the genus Bdellovibrio include Bdellovibrio bacteriovorus and Bdellovibrio exovorus. Bacteriovorax marinus is mentioned as a microorganism classified into the genus Bacteriovorax. Examples of microorganisms classified into the genus Stigmatella include Stigmatella aurantiaca. Examples of microorganisms classified into the genus Myxococcus include Myxococcus xanthus and Myxococcus fulvus. Examples of the microorganism classified into the genus Anaeromyxobacter include Anaeromyxobacter dehalogenans. Examples of microorganisms classified into the genus Sorangium include Sorangium cellulosum. Examples of microorganisms classified into the genus Haliangium include Haliangium ochraceum. Examples of microorganisms classified into the genus Acidobacterium include Acidobacterium capsulatum. Examples of microorganisms classified into the genus Granulicella include Granulicella tundricola. Examples of microorganisms classified into the genus Ilumatobacter include Ilumatobacter coccineum. Examples of microorganisms classified into the genus Streptosporangium include Streptosporangium roseum. Examples of microorganisms classified into the genus Nocardiopsis include Nocardiopsis dassonvillei. Thermobifida fusca is mentioned as a microorganism classified into the genus Thermobifida. Thermomonospora curvata is mentioned as a microorganism classified into the genus Thermomonospora. Examples of microorganisms classified into the genus Pseudonocardia include Pseudonocardia dioxanivorans. Examples of microorganisms classified into the genus Amycolatopsis include Amycolatopsis mediterranei. Examples of microorganisms classified into the genus Saccharomonospora include Saccharomonospora viridis and Saccharomonospora xinjiangensis. Examples of microorganisms classified into the genus Saccharopolyspora include Saccharopolyspora erythraea and Saccharopolyspora spinosa. Examples of microorganisms classified as Thermobispora include Thermobispora bispora. Actinosynnema mirum is mentioned as a microorganism classified into the genus Actinosynnema. Micromonospora aurantiaca is mentioned as a microorganism classified into the genus Micromonospora. Examples of microorganisms classified into the genus Salinispora include Salinispora tropica and Salinispora arenicola. Examples of microorganisms classified into the genus Verrucosispora include Verrucosispora maris. Examples of microorganisms classified into the genus Kribbella include Kribbella flavida. Examples of microorganisms classified into the genus Corynebacterium include Corynebacterium jeikeium, Corynebacterium urealyticum, Corynebacterium glutamicum, Corynebacterium ammoniagenes, and Corynebacterium kroppenstedtii. Examples of microorganisms classified as Nocardia include Nocardia farcinica, Nocardia brasiliensis, and Nocardia cyriacigeorgica. Examples of microorganisms classified into the genus Gordonia include Gordonia bronchialis, Gordonia neofelifaecis and Gordonia terrae. Examples of microorganisms classified into the genus Dietzia include Dietzia cinnamea. Microorganisms classified as Mycobacterium are Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium leprae, Mycobacterium avium, Mycobacterium smegmatis, Mycobacterium ulcerans, Mycobacterium vanbaalenii, Mycobacterium gilvum, Mycobacterium abscessus, Mycobacterium marires, Mycobacterium pylei, Mycobacterium pylei, Mycobacterium phlei, Mycobacterium xenopi and Mycobacterium rhodesiae. Examples of microorganisms classified into the genus Amycolicicoccus include Amycolicicoccus subflavus. Examples of microorganisms classified into the genus Tsukamurella include Tsukamurella paurometabola. Examples of microorganisms classified into the genus Segniliparus include Segniliparus rotundus. Microbacterium testaceum is mentioned as a microorganism classified into Microbacterium genus. Micrococcus luteus is mentioned as microorganisms classified into the genus Micrococcus. Examples of microorganisms classified into the genus Arthrobacter include Arthrobacter arilaitensis, Arthrobacter chlorophenolicus, Arthrobacter globiformis, and Arthrobacter phenanthrenivorans. Examples of microorganisms classified into the genus Renibacterium include Renibacterium salmoninarum. Examples of microorganisms classified into the genus Kocuria include Kocuria rhizophila. Examples of microorganisms classified into the genus Kytococcus include Kytococcus sedentarius. Examples of microorganisms classified into the genus Cellulomonas include Cellulomonas fimi. Examples of the microorganism classified into the genus Intrasporangium include Intrasporangium calvum. Examples of microorganisms classified into the genus Serinicoccus include Serinicoccus profundi. Examples of microorganisms classified into the genus Frankia include Frankia alni. Examples of microorganisms classified into the genus Acidothermus include Acidothermus cellulolyticus. Examples of microorganisms classified into the genus Nakamurella include Nakamurella multipartita. Examples of microorganisms classified into the genus Geodermatophilus include Geodermatophilus obscurus. Examples of microorganisms classified into the genus Stackebrandtia include Stackebrandtia nassauensis. Catenulispora acidiphila is mentioned as a microorganism classified into the genus Catenulispora. Examples of microorganisms classified in the genus Rubrobacter include Rubrobacter xylanophilus. Examples of microorganisms classified into the genus Conexibacter include Conexibacter woesei. Examples of microorganisms classified into the genus Oceanobacillus include Oceanobacillus iheyensis. Examples of microorganisms classified into the genus Lysinibacillus include Lysinibacillus sphaericus. Examples of microorganisms classified into the genus Halobacillus include Halobacillus halophilus. Examples of the microorganism classified into the genus Alicyclobacillus include Alicyclobacillus acidocaldarius. Examples of microorganisms classified into the genus Kyrpidia include Kyrpidia tusci. Brevibacillus choshinensis is mentioned as a microorganism classified into the genus Brevibacillus. Examples of microorganisms classified into the genus Lactobacillus include Lactobacillus buchneri. Examples of microorganisms classified as Clostridium include Clostridium acetobutylicum, Clostridium perfringens, Clostridium kluyveri, Clostridium cellulovorans, Clostridium difficile, and Clostridium sticklandii. Examples of microorganisms classified into the genus Alkaliphilus include Alkaliphilus metalliredigens and Alkaliphilus oremlandii. Examples of microorganisms classified into the genus Syntrophomonas include Syntrophomonas wolfei. Examples of microorganisms classified into the genus Syntrophothermus include Syntrophothermus lipocalidus. Examples of microorganisms classified into the genus Eubacterium include Eubacterium rectale and Eubacterium limosum. Examples of microorganisms classified into the genus Desulfitobacterium include Desulfitobacterium hafniense. Examples of microorganisms classified into the genus Desulfotomaculum include Desulfotomaculum reducens. Examples of microorganisms classified into the genus Pelotomaculum include Pelotomaculum thermopropionicum. Examples of microorganisms classified into the genus Butyrivibrio include Butyrivibrio proteoclasticus. Examples of microorganisms classified into the genus Roseburia include Roseburia hominis. Examples of microorganisms classified into the genus Oscillibacter include Oscillibacter valericigenes. Thermoanaerobacter microorganisms classified into the genus Thermoanaerobacter include Thermoanaerobacter tengcongensis. Examples of microorganisms classified into the genus Carboxydothermus include Carboxydothermus hydrogenoformans. Examples of microorganisms classified into the genus Natranaerobius include Natranaerobius thermophilus. Examples of microorganisms classified into the genus Haliscomenobacter include Haliscomenobacter hydrossis. Examples of microorganisms classified into the genus Porphyromonas include Porphyromonas gingivalis and Porphyromonas asaccharolytica. Examples of microorganisms classified into the genus Odoribacter include Odoribacter splanchnicus. Examples of microorganisms classified into the genus Spirosoma include Spirosoma linguale. Examples of microorganisms classified into the genus Runella include Runella slithyformis. Examples of microorganisms classified into the genus Deinococcus include Deinococcus radiodurans, Deinococcus geothermalis, Deinococcus deserti, Deinococcus maricopensis, Deinococcus proteolyticus and Deinococcus gobiensis. Examples of microorganisms classified into the genus Thermus include Thermus thermophilus, Thermus agnaticus, Thermus flavus, Thermus caldophilus, Thermus ruder and Thermus scotoductus. Examples of microorganisms classified into the genus Meiothermus include Meiothermus ruber and Meiothermus silvanus. Examples of microorganisms classified into the genus Oceanithermus include Oceanitermus profundus. Examples of microorganisms classified into the genus Marinithermus include Marinithermus hydrothermalis. Examples of microorganisms classified into the genus Gemmatimonas include Gemmatimonas aurantiaca. Examples of microorganisms classified into the genus Fusobacterium include Fusobacterium nucleatum. Examples of the microorganism classified into the genus Ilyobacter include Ilyobacter polytropus. Examples of microorganisms classified into the genus Roseiflexus include Roseiflexus castenholzii. Examples of microorganisms classified into the genus Herpetosiphon include Herpetosiphon aurantiacus. Examples of microorganisms classified into the genus Thermomicrobium include Thermobrobium roseum. Thermotoga lettingae is mentioned as microorganisms classified into the genus Thermotoga. Examples of microorganisms classified into the Thermosipho genus include Thermosipho melanesiensis and Thermosipho africanus. Examples of microorganisms classified into the genus Fervidobacterium include Fervidobacterium nodosum. Examples of microorganisms classified into the genus Deferribacter include Deferribacter desulfuricans. Examples of microorganisms classified into the genus Calditerrivibrio include Calditerrivibrio nitroreducens. Examples of microorganisms classified into the genus Flexistipes include Flexistipes sinusarabici. Examples of microorganisms classified into the genus Metallosphaera include Metallosphaera sedula. Examples of microorganisms classified into the Aeropyrum genus include Aeropyrum pernix. Examples of microorganisms classified into the genus Pyrobaculum include Pyrobaculum aerophilum, Pyrobaculum islandicum, Pyrobaculum calidifontis, and Pyrobaculum neutrophilum. Examples of microorganisms classified into the genus Caldivirga include Caldivirga maquilingensis. Examples of microorganisms classified into the genus Vulcanisaeta include Vulcanisaeta distributa. Examples of microorganisms classified into the genus Acidilobus include Acidilobus saccharovorans. Examples of microorganisms classified into the genus Haloarcula include Haloarcula marismortui. Examples of microorganisms classified into the genus Haloquadratum include Haloquadratum walsbyi. Examples of microorganisms classified into the genus Natronomonas include Natronomonas pharaonis. Examples of microorganisms classified into the genus Halorubrum include Halorubrum lacusprofundi. Examples of microorganisms classified as Haloterrigena include Halotherrigena turkmenica. Examples of microorganisms classified as Natrialba include Natrialba magadii. Examples of microorganisms classified into the genus Halalkalicoccus include Halalkalicoccus jeotgali. Examples of microorganisms classified into the genus Halogeometricum include Halogeometricum borinquense. Examples of microorganisms classified into the genus Thermoplasma include Thermoplasma acidophilum and Thermoplasma volcanium. Examples of microorganisms classified into the genus Picrophilus include Picrophilus torridus. Examples of microorganisms classified as Ferroplasma include Ferroplasma acidarmanus. Examples of microorganisms classified into the genus Archaeoglobus include Archaeoglobus fulgidus and Archaeoglobus veneficus. Examples of microorganisms classified as Ferroglobus include Ferroglobus placidus. Examples of microorganisms classified into the genus Polymorphum include Polymorphum gilvum. Examples of microorganisms classified into the genus Micavibrio include Micavibrio aeruginosavorus. Examples of microorganisms classified into the genus Simiduia include Simiduia agarivorans. Examples of microorganisms classified into the genus Leptothrix include Leptothrix cholodnii. Examples of microorganisms classified as Thiomonas include Thiomonas intermedia. Examples of microorganisms classified in the genus Rubrivivax include Rubrivivax gelatinosus. Examples of microorganisms classified into the genus Methylibium include Methylibium petroleiphilum. Examples of microorganisms classified into the genus Anaerococcus include Anaerococcus prevotii.
Examples of microorganisms belonging to eukaryotes suitable for the present invention include the order Eurotiales, Saccharomycetales, Capnodiales, Pleosporales, Ustilaginales, Tremellales, Cystofilobasidia (Cystofilobasidiales), Blotchidae (Helotiales), Chawantake (Pezizales), Sarnoshokushi (Polyporales), Agaricales, Pucciniales, Magnaporthales (Magnaporthales) ), Microascales, Hypocreales, Sporidiobolales, Exobasidiales, Malasseziales, Onygenales, Labulbeniales or Laboulbeniales Eye (Mucorales) And microorganisms belonging to

Particularly preferred microorganisms are those belonging to the order of the Eurotiales or Saccharomycetales.
Examples of microorganisms classified as Capnodiales include Mycosphaerella, Zygophiala, Zymoseptoria, Cladosporium, and Capnodium. Examples of microorganisms classified as Pleosporales include the genera Preussia, Brachycladium, Cochliobolus, Pleospora, Pleospora, Leptosphaeria, Leptosphaerulina, Phaeosphaeria, and Pyrenophora. Examples of microorganisms classified in the order of Ustilaginales include the genus Pseudozyma, the genus Tolyposporium, and the genus Ustilago. Examples of microorganisms classified into the order of Tremellales include the genus Bulleromyces, the genus Filobasidi (Cryptococcus), the genus Bullera, the genus Fellomyces, the genus Kockovaella and the genus Trichosporon. Examples include microorganisms of the genus Mrakia, Xanthophyllomyces and Udeniomyces, which are classified into the order Cystofilobasidiales. Examples of microorganisms classified as Hellotiales include Botryotinia, Monilia, Monilinia, and Sclerotinia. Examples of microorganisms classified into the order of Pezizales include the genus Peziza, the genus Morchella, the genus Helvella, the genus Ascodesmis, the genus Ascobolus and the genus Tuber. Examples of microorganisms classified as Polyporales include Mycoleptodonoides, Mycoaciella, Parmastomyces and Postia. Examples of microorganisms classified as Agaricales include Arthromyces, Mycenoporella, Laccaria, Moniliophthora, Coprinopsis and Schizophyllum. Examples of microorganisms classified as Pucciniales include the genera Puccinia, Melampsora, Cronartium, Cyttaria, Coleosporium, Blastospora and Ravenelia. Examples of microorganisms classified into the order of Magnaporthales include the genus Magnaporthe. Examples of microorganisms classified as Sordariales include Podospora genus, Neurospora genus, Sordaria genus, Chaetomium genus, Thielavia genus, Myceliophthora genus and Monotosporella genus. Examples of microorganisms classified into the order Microascales include the genus Microascus, the genus Nodulosphaeria, the genus Okanomyces, and the genus Ceratocystis. Examples of microorganisms classified in the order of Hypocreales include Fusarium, Nectria, Hypocrea, Hypomyces, Trichoderma, Cordyceps, Claviceps, and Acremonium. Examples of microorganisms classified into the order Sporidiobolales include the genus Rhodosporidium, the genus Rhodotorula, the genus Sporidiobolus, and the genus Sporobolomyces. Examples of microorganisms classified into the order of Exobasidiales include the genus Graphiola, the genus Exobasidium, and the genus Dicellomyces. Examples of microorganisms classified as Malasseziales include the genus Malassezia. Examples of microorganisms classified as Onygenales include the genus Gymnoascus, Eremascus, Arthroderma, Coccidioides, Paracoccidioides, Uncinocarpus, Trichophyton and Ajellomyces. Examples of microorganisms classified as Laborbeniales include Rhachomyces, Rickia, Stigmatomyces, and Ceratomyces. Examples of microorganisms classified into the order Mucorales include microorganisms belonging to the genera Absidia, Mucor, Rhizomucor, and Rhizopus. Examples of microorganisms classified as Eurotiales include the genera Neopetromyces, Aspergillus, Neosartorya, Byssochlamys, Emericella, Eupenicillium, Eurotium, Hemicarpenteles, Penicillium, Talaromyces and Monascus. The microorganisms classified into the order Saccharomycetales include Arthroascus, Guilliermondella, Clavispora, Metschnikowia, Lipomyces, Endomyces, Ascoidea, Cephaloascus, Wickerhamiella, Zygoascus, Genus Genus Blastobotrys, Botryozyma, Brettanomyces, Myxozyma, Ogataea, Komagataella, Trigonopsis, Schizoblastosporion and Sympodiomyces. Furthermore, microorganisms belonging to the order Saccharomycetales, and preferable microorganisms include microorganisms classified into Saccharomycodaceae, Pichiaceae, Dipododascaceae, and mitosporic Saccharomycetales. The microorganisms belonging to the genus include Hanseniaspora, Kloeckera, Saccharomycodes, Nadsonia, Ashbya, Citeromyces, Dekkera, Issatchenkia, Kluyveromyces, Pachysolen, Saccharomyces, Saturnispora, Tetrapisispora, Tetrapisispora, Genus, Zygotorulaspora, Eremothecium, Lachancea, Vanderwaltozyma, Naumovozyma, Kazachstania, Eremothecium, Willopsis, Pichia, Yarrowia, Dipodascus, Arxula, Galactomyces, Geotrichum, Babyovia, Examples include the genus Schwanniomyces, the genus Priceomyces, the genus Yamadazyma, the genus Scheffersomyces, the genus Meyerozyma, the genus Lodderomyces, the genus Sporopachydermia and the genus Candida.

  Among those belonging to eukaryotes, the other genera include Botryosphaeria, Helicomyces, Aureobasidium, Selenophoma, Melanotaenium, Otospora, Glomus, Allomyces, Rhizidiomyces, Hyphochytrium, Schizosaccharomyces, Filobasidium, , Lophodermium genus, Dothidea genus, Oidium genus, Amorphotheca genus, Scytalidium genus, Taphrina genus, Strangospora genus, Chytridium genus, Pneumocystis genus, Sclerotium spp. Genus, Sporothrix, Moleospora, Verticillium, Microascales, Leucosporidium, Microstroma and Thraustochytrium.

  Among them, preferred microorganisms are Zymoseptoria, Phaeosphaeria, Pyrenophora, Ustilago, Ashbya, Kluyveromyces, Saccharomyces, Yarrowia, Debaryomyces, Schefersomyces Genus, Meyerozyma, Lodderomyces, Candida, Filobidiella (Cryptococcus), Botryotinia, Sclerotinia, Tuber, Postia, Laccaria, Moniliophthora, Coprinopsis, Schizophyllum, Puccinia, Podospora, Neurospora genus, Sordaria genus, Thielavia genus, Myceliophthora genus, Fusarium genus, Nectria genus, Malassezia genus, Aspergillus genus, Neosartorya genus, Arthroderma genus, Paracoccidioides genus, Uncinocarpus genus, Trichophyton genus or Ajellomyces genus is there.

  Particularly preferred microorganisms are microorganisms classified into the genus Saccharomyces, Candida or Aspergillus.

Examples of microorganisms classified into the genus Saccharomyces (Saccharomyces) include, for example, Saccharomyces barnettii, Saccharomyces bayanus, Saccharomyces bayanus var. U. Saccharomyces boulardii), Saccharomyces bulderi, Saccharomyces cariocanus, Saccharomyces cerevisiae, Saccharomyces cerevisiae, Castelen Saccharomyces diastaticus), Saccharomyces douglasii, Saccharomyces Exicuus (Saccharomyces exiguus), Saccharomyces humaticus, Saccharomyces kluyveri, Saccharomyces kluyveri (Saccharomyces kumatics), Saccharomyces kumatic Saccharomyces mikatae, Saccharomyces naganishii, Saccharomyces novalvarietatis, Saccharomyces paradoxas, Saccharomyces or sac・ Saccharomyces rouxii, Saccharo Saccharomyces stellatus, Saccharomyces servazzii, Saccharomyces spencerorum, Saccharomyces transvaalensis, Saccharomyces transvaalensis, Saccharomyces transvaalensis Ensis (Saccharomyces yakushimaensis var. Yakushimaensis), Saccharomyces unisporus, Saccharomyces uvarum, etc. are mentioned.
As microorganisms classified into the genus Candida, for example, Candida aaseri, Candida africana, Candida aglyptinia, Candida agrestis, Candida akabanensis, Candida alai, Candida albicans, Candida alishanica, Candida allociferrii, ae, Candida adi Candida ambrosiae, Candida amphixiae, Candida anatomiae, Candida ancudensis, Candida andamanensis Candida andamanensis), Candida anglica, Candida anneliseae, Candida antillancae, Candida anutae, Candida apicola, Candida apicola, Candida apicola Candida apis, Candida apis var. Apis, Candida aquaetextoris, Candida arabinofermentans, Candida arcana, Candida ascalaphidarum, Candida asiatica, Candida atbi, Candida atakaporum, Candida athensensis, Candida Candida atlantica, Candida atmosphaerica, Candida auringiensis, Candida auris, Candida aurita, Candida austromarina (Candida austromarina), Candida azyma, Candida barrocoloradensis, Candida batistae, Candida beechii, Candida bertae, Candida bertae・ Candida berthetii, Candida bituminiphila, Candida blackwellae, Candida blankii, Candida blattae, Candida Candida blattariae, Candida bohiensis, Candida boidinii, Candida bokatorum, Candida boleticola, other lit, C Candida bombi, Candida bombicola, Candida bondarzewiae, Candida bovina, Candida bribrorum, Candida brumptii, Candida brumptii -Candida buenavistaensis, Candida buinensis, Candida bullrunensis, Candida butyri, Candida Candida cacaoi, Candida canberraensis, Candida cantarellii, Candida cariosilignicola, Candida carpophila, Candida carpophila car , Candida caseinolytica, Candida castellii, Candida castrensis, Candida catenulata, Candida cellulolytica, Candida cerambai Durham (Candida cerambycidarum), Candida chauliodes, Candida chickasaworum, Candida chilensis, Candida chiropte Loram (Candida chiropterorum), Candida choctaworum (Candida choctaworum), Candida chrysomelidarum, Candida cidri, Candida ciferrii, Candida cleridarum (Candida, Candida cleridarum, Candida cleridarum (Candida, Candida, Candida, Candida, Candida) Candida coipomensis, Candida colliculosa, Candida conglobata, Candida corydali, Candida cylindracea, Candida dajieen and Candida dajiaen ), Candida davenportii, Candida davisiana, Candida deformans, Candida・ Candida dendrica, Candida dendronema, Candida derodonti, Candida deserticola, Candida diddensiae, Candida degbioendiva dig C (Candida diversa), Candida dosseyi, Candida drimydis, Candida drosophilae, Candida dubliniensis, Candida iasanandidae (Candida edax), Candida elateridarum, Candida elegans, Candida emberorum, Kande Candida endomychidarum, Candida entomophila, Candida eppingiae, Candida eremophlia, Candida ergatenida, obii ), Candida etchellsii, Candida ethanolica, Candida famata, Candida famata var. Famata, Candida fennica, Candida fennica・ Candida fermentati, Candida fermenticarens, Candida floricola, Candida fluviatilis, Candida Candida fragi, Candida fragicola, Candida freyschussii, Candida friedrichii, Candida frijolensensis, Candida fructus (Candida fructus) Candida fukazawae, Candida fukuyamanensis, Candida fungicola, Candida fusiformata, Candida galacta, Candida galis, and Candida galis・ Candida gatunensis, Candida geochares, Candida germanica, Candida ghanaensis, Candida giga Candida gigantensis, Candida glabrata, Candida glaebosa, Candida globosa, Candida glucosophila, Candida gobii, Candida gobi Candida gorgasii), Candida gosingica, Candida gotoi, Candida gropengiesseri, Candida guaymorum, Candida guillionmul and Candida guilliermondi ), Candida halonitratophila, Candida halophila, Candida hasegawae, Candida Helenika ( Candida hellenica, Candida holmii, Candida homilentoma, Candida hordei, Candida hsintzibuensis, Candida humilis (Candida humilis) (Candida hungarica), Candida hungchunana, Candida incommunis, Candida inconspicua, Candida ingens, Candida insectalens, Candida insectalens Candida insectamans, Candida insectorum, Candida insectosa, Candida intermedia, Candida intermedia Intermedia, Candida intermedia var. Intermedia, Candida ipomoeae, Candida ishiwadae, Candida japonica, Candida jaroonii, Candida jaroonii (Candida jeffriesii), Candida jianshihensis, Candida jiufengensis, Candida kanchanaburiensis, Candida kaohsiungensis, Candida kaohsiungensis, Candida kaohsiungensis ), Candida kashinagacola, Candida kazuoi, Candida kefyr, Candida Khaoyaiensis ( Candida khaoyaiensis), Candida khmerensis, Candida kofuensis, Candida krabiensis, Candida krissii, Candida krui and ii Candida krui krusei), Candida krusoides, Candida kunorum, Candida kunwiensis, Candida labiduridarum, Candida lactis-den・ Candida laemsonensis, Candida lambica, Candida lassenensis, Candida laureliae, Candida land Candida leandrae, Candida lessepsii, Candida levantina, Candida lidongshanica, Candida lignicola, Candida lignoha ganto Candida lignophila), Candida lignosa, Candida lipolytica, Candida litsaeae, Candida llanquihuensis, Candida lodder and landiana lodderae ), Candida lusitaniae, Candida lycoperdinae, Candida lyxosophila, Candida Maeda (Candida maesa), Candida magnoliae, Candida maltosa, Candida mannitofaciens, Candida maris, Candida maritima, Candida maritima・ Candida maxii, Candida melibiosica, Candida melinii, Candida membranifaciens, Candida mesenterica, metasis sil and C Candida methanolovescens, Candida methanosorbosa, Candida methylica, Candida michaelii, Candida mirei (C andida milleri), Candida mogii, Candida mokoenaii, Candida molischiana, Candida montana, Candida morakotiae, ciferida morakotiae, ciferida morakotiae ), Candida multigemmis, Candida musae, Candida mycetangii, Candida naeodendra, Candida nakhonratchdimen and Candida nakhonratchdimensis nanaspora), Candida natalensis, Candida neerlandica, Candida nemodendra, Candida newtonensis (Can dida neustonensis, Candida nitrativorans, Candida nitratophila, Candida nodaensis, Candida nonsorbophila, Candida novegenda, Candida norvegensis Candida norvegica), Candida novakii, Candida obtusa var. Obtusa, Candida odintsovae, Candida oleophila, Candida oleophila, Candida oleophila, Candida oleophila , Candida ontarioensis, Candida ooitensis, Candida orba, Candida oregonensis Candida orthopsilosis, Candida ortonii, Candida ovalis, Candida oxycentoniae, Candida pallodes, palmida pallodes, and Candida pallodes Candida palmyrensis, Candida paludigena, Candida panamensis, Candida panamericana, Candida parapolymorpha, Candida parapolymorph and Candida parapolymorph ), Candida parapsilosis var. Parapsilosis, Candida pararugosa, Candida patanien (Candida pattaniensis), Candida peltata, Candida peoriaensis, Candida petrohuensis, Candida phangngensis, Candida phangngensis picachoensis), Candida piceae, Candida pignaliae, Candida pimensis, Candida pini, Candida pintolopesii, Candida pintolopesii (Candida pintolopesii var. Pintolopesii), Candida pintolopesii var. Sloofiae, Candida pinus (Candida pinus), Candida plutei (Candida plutei) Candida polymorpha, Candida pomiphila, Candida ponderosae, Candida populi, Candida powellii, Candida pratia racis , Candida prunicola, Candida pseudoflosculorum, Candida pseudoglaebosa, Candida pseudohaemulonii, Candida pseudointermedia (Candida pseudointermedia) ), Candida pseudojiufengensis, Candida pseudolambica, Candida pseudov (Candida pseudov) anderkliftii), Candida psychrophila, Candida pulcherrima, Candida pyralidae, Candida quercitrusa, Candida quercitundum, cadre railenensis, Candida ralunensis, Candida ranongensis, Candida ratchasimensis, Candida restingae, Candida reversaida, Candida reversaida rhi , Candida robnettiae, Candida rugopelliculosa, Candida rugosa, Candida Lugo The Bar Lugoza (Candida rugosa var. Rugosa), Candida sagamina (Candida sagamina), Candida saitoana (Candida salmon), Candida salmanticensis, Candida salmanticensis Candida sanitii, Candida santamariae, Candida santamariae var. Membranifaciens, Candida santamariae (Candida santamariae) santamariae, Candida santjacobensis, Candida sanyiensis, Candida saraburiensis, Candida savonica, scandi C ), Candida sekii, Candida sequanensis, Candida sergipensis, Candida shehatae, Candida shehaosa, Candida shehatae・ Candida shehatae var. Lignosa, Candida shehatae var. Shehatae, Candida siamensis, Candida silvae, Candida silvae silvanorum, Candida silvatica, Candida silvicultrix, Candida sinolaborantium, Candida sithepensis, Candida Candida slooffiae, Candida smagusa, Candida smithsonii, Candida sojae, Candida solani, Candida soricola (Candida solicola) Candida sonckii, Candida songkhlaensis, Candida sonorensis, Candida sophiaereginae, Candida sorbophila, sorb, Candida sosorbena Candida sorbosivorans, Candida sorboxylosa, Candida spandovensis, Candida sphaerica, Candida・ Candida stauntonica, Candida stellata, Candida stellimalicola, Candida stri, Candida succiphila, Candida suecica, Candida suedica (Candida suthepensis), Candida suwanaritii, Candida suzukii, Candida takamatsuzukensis, Candida takata, Candida taliae, Candida taliae Candida tammaniensis, Candida tannotolerans, Candida tanticharoeniae, Candida tanzawaensis, mosquito Candida taoyuanica, Candida tartarivorans, Candida temnochilae, Candida tenuis, Candida tepae, Candida tepae, Candida tepae Candida terraborum, Candida tetrigidarum, Candida thailandica, Candida thaimueangensis, Candida theae, Candida thermophila thermophila, Candida tilneyi, Candida tolerans, Candida torresii, Candida tritomae, Candida Tropica Squirrel (Candida tropicalis), Candida tropicalis var. Tropicalis, Candida trypodendroni, Candida tsuchiyae, Candida tsukubaensis, Candida tumulicola, Candida ulmi, Candida utilis, Candida vaccinii, Candida valdiviana, Candida valida, Candida valida Candida vanderwaltii, Candida variabilis, Candida vartiovaarae, Candida veronae, Candida versatilis, Candida Candida vinaria, Candida vini, Candida viswanathii, Candida wancherniae, Candida wickerhamii, Candida wanorum (Candida wrumunun) Candida wyomingensis Candida xestobii, Candida xyloterini, Candida yuanshanicus, Candida yuchoand z, Candida yuchoand z -Candida zeylanoides, Candida zeylanoides var. Zeylanoides, etc. are mentioned.

As microorganisms classified into the genus Aspergillus (Aspergillus), for example, Aspergillus acanthosporus (Aspergillus acanthosporus), Aspergillus acolumnaris (Aspergillus acolumnaris) (Aspergillus aculeatus (Aspergillus aculeatus)),・ Aspergillus affinis, Aspergillus allahabadii, Aspergillus alliaceus, Aspergillus alusaceus, Aspergillus ambigulus (Aspergillus amylovorus), Aspergillus anomalus, Aspergillus anso Aspergillus anthodesmis, Aspergillus apica, Aspergillus appendiculatus, Aspergillus arenarius, Aspergillus asperescens, sperm Aurantio Bruneus (Aspergillus aurantiobrunneus), Aspergillus auratus, Aspergillus aureus var. Acidus, Aspergillus aureus var. Acidus, Aspergillus aureus var. Minor -Aspergillus aureofulgens, Aspergillus aureolatus, Aspergillus aureolatus (Aspergillus aureolatus) aureolus), Aspergillus auricomus, Aspergillus avenaceus, Aspergillus awamori, Aspergillus awamori var. fumeus, Aspergillus awamori var. fumeus, Aspergillus awamori var. Aspergillus awamori var. Fuscus), Aspergillus awamori var. Minimus, Aspergillus awamori var. Piceus, Aspergillus batatas, Aspergillus batatas, Aspergillus batatas bicolor), Aspergillus biplanus, Aspergillus bisporus, Aspergillus bombycis, Aspergillus brasilien Aspergillus brasiliensis, Aspergillus brevipes, Aspergillus bridgeri, Aspergillus brneeo-uniseriatus, Aspergillus bruneeo-uniseriatus uni eria unn uni eria uni var. (Aspergillus carbonarius), Aspergillus carneus, Aspergillus carnoyi, Aspergillus Aspergillus cellulosae, Aspergillus cervinus, Aspergillus chevalieri, Aspergillus chevalieri var. Intermedius, Aspergillus chilli cerus Aspergillus cinnamomeus, Aspergillus citrisporus, Aspergillus clavatoflavus, Aspergillus clavatonus sperm, Aspergillus clavatonus sperm Tas (Aspergillus cleistominutus), Aspergillus conicus (Aspergillus conicus) ), Aspergillus conjunctus, Aspergillus coremiiformis, Aspergillus corrugatus, Aspergillus crassihyphae, Aspergillus crassihyphae, C. sperm (Aspergillus cristatus), Aspergillus crustosus, Aspergillus crystallinus, Aspergillus deflectus (Aspergillus deflectus), Aspergillus dimorphicus (Aspergillus dimorphicus), Aspergillus diversicus・ Dorsicas (Aspergillus dorothicus), Aspergillus duricaulis, Aspergillus Aspergillus eburneocremeus, Aspergillus echinulatus, Aspergillus egyptiacus, Aspergillus elegans, Aspergillus sper elliptical elongatus), Aspergillus fennelliae, Aspergillus ficuum, Aspergillus fischeri, Aspergillus fischeri var. brasiliensis, Aspergillus fischeri var. brasiliensis Glaber, Aspergillus fischeri var. Spinosus, Aspergillus fischeri var. Spinosus Aspergillus flaschentraegeri, Aspergillus flavipes, Aspergillus flavofurcatus, Aspergillus flavus, flavus var. ), Aspergillus flavus var. Flavus, Aspergillus flavus var. Sojae, Aspergillus flocculosus, Aspergillus flocculosus, Aspergillus floris Aspergillus foetidus, Aspergillus foetidus var. Acidus, Aspergillus foetidus bar Lidas (Aspergillus foetidus var. Pallidus), Aspergillus foveolatus, Aspergillus fresenii, Aspergillus fruticulosus, Aspergillus fulticulosus ), Aspergillus fumigatus var. Acolumnaris, Aspergillus fumigatus var. Ellipticus, Aspergillus fumigatus var. Ellipticus, Aspergillus fumigatus bur. Aspergillus fumigatus var. Helvolus, Aspergillus funiculosus, Aspergillus giganteus Aspergillus giganteus, Aspergillus glaber, Aspergillus glaucus, Aspergillus gorakhpurensis, Aspergillus gracilis, Aspergillus ula Aspergillus granulosus, Aspergillus gymnosardae, Aspergillus halophilicus, Aspergillus helicothrix, Aspergillus henicothic, Aspergillus genus Aspergillus heteromorphus, Aspergillus heteromorphus s heterothallicus), Aspergillus iizukae, Aspergillus implicatus, Aspergillus insuetus, Aspergillus insperic, Aspergillus inspericus ), Aspergillus ivoriensis, Aspergillus janus, Aspergillus janus var. Brevis, Aspergillus janus var. Janus, Spell Aspergillus japonicus, Aspergillus japonicus var. Atrofuscus, Aspergillus japonicus Aspergillus japonicus var. Viridiflavus, Aspergillus kambarensis, Aspergillus kanagawaensis, Aspergillus kawachii, Aspergillus sus Aspergillus lentulus, Aspergillus leporis, Aspergillus leucocarpus, Aspergillus longivesica, Aspergillus luciferous, Aspergillus lucidus (Aspergillus luteo-niger), Aspergillus malignus, Aspergillus maldo Aspergillus malodoratus, Aspergillus manginii, Aspergillus medius, Aspergillus melleus, Aspergillus microcephalus, Aspergillus microcephalus, Aspergillus microcephalus, Aspergillus microcephalus ), Aspergillus microcysticus, Aspergillus minimus, Aspergillus miyokoensis, Aspergillus montevidensis, Aspergillus multicolor (Aspergillus multicolor, Aspergillus multicolor)・ Aspergillus mutabilis, Aspergillus nidulans, Aspergillus nudrans -Aspergillus nidulans var. Acristatus, Aspergillus ndulans var. Dentatus, Aspergillus nidulans var. Echinulatus, Aspergillus nidulans var. Echinulatus Asperg
illus nidulans var. latus), Aspergillus nidulans var. roseus, Aspergillus niger, Aspergillus niger mut. cinnamomeus, Aspergillus niger mut. cinnamomeus Intermedius, Aspergillus niger var. Macrosporus, Aspergillus niger var. Nanus, Aspergillus niger bar niger (Aspergillus niger var. Aspergillus niger var. Niger), Aspergillus niger var. Niger f. Hennebergii, Aspergillus niger var. Phoenicis, Aspergillus niger Cie Aspergillus niger mut. Schiemanni, Aspergillus niveoglaucus, Aspergillus niveus, Aspergillus niveus ver. Indica, Aspergillus nom Aspergillus nutans, Aspergillus ochraceoroseus, Aspergillus ochraceus, Aspergillus ortus, Aspergillus oryz, Aspergillus oryz, Aspergillus oryz oryzae var. brunneus), Aspergillus oryzae var. effusus, Aspergillus oryzae var. agnasporus), Aspergillus oryzae var. oryzae, Aspergillus oryzae var. sporoflavus, Aspergillus oryzae var. varibilis, Aspergillus oryzae var. Aspergillus oryzae var. Viridis, Aspergillus ostianus, Aspergillus pallidus, Aspergillus panamensis (Aspergillus panamensis), Aspergillus paragillus A. Aspergillus parasiticus), Aspergillus parasiticus var. Globosus, Aspergillus parvathecius, Aspergillus Aspergillus parvulus, Aspergillus penicillioformis, Aspergillus penicillioides, Aspergillus persii, Aspergillus speri pellet , Aspergillus phialiseptus, Aspergillus phoenicis, Aspergillus proliferans, Aspergillus protuberus, Aspergillus defus pellus Aspergillus pseudoglaucus, Aspergillus pseudotamarii, Aspergillus Aspergillus pulverulentus, Aspergillus pulvinus, Aspergillus puniceus, Aspergillus quadricinctus, Aspergillus quadricinctus (Aspergillus quadricinctus), Aspergillus quadricinctus (Aspergillus quadricinctus) ), Aspergillus quercinus var. Petrakii, Aspergillus raperi, Aspergillus recurvatus, Aspergillus repens, Aspergillus repens, Aspergillus repens, Aspergillus repens, Aspergillus repens, Aspergillus repens, Aspergillus repens・ Rhizopodas (Aspergillus rhizopodus), Aspergillus robustus (Aspergillus robustus), Aspergillus luber (A spergillus ruber, Aspergillus rugulosus, Aspergillus saitoi var. kagoshimaensis, Aspergillus salviicola (Aspergillus salviicola), Aspergillus sacrerolus sperum Aspergillus sepultus, Aspergillus silvaticus, Aspergillus sojae, Aspergillus sparsus, Aspergillus spathulatus, Aspergillus spathulatus, Aspergillus spathulatus, Aspergillus spathulatus ), Aspergillus speluneus, Aspergillus spinusus (Aspergillus spinusus) ulosus, Aspergillus stellatus, Aspergillus stellatus var. astellatus, Aspergillus stramenius, Aspergillus striatus, Aspergillus striatus ), Aspergillus subolivaceus, Aspergillus subsessilis, Aspergillus sulphureus, Aspergillus sulphure sulphus, sperm・ Aspergillus sydowii, Aspergillus tamarii, Aspergillus Aspergillus tardus, Aspergillus terreus, Aspergillus terreus bar africanus, Aspergillus terreus var. Aureus, Aspergillus terreus var. Aureus, Aspergillus terreus var. Aureus Aspergillus terreus var.baedijnii, Aspergillus terreus var. Globosus, Aspergillus terreus var. Terreus, Aspergillus ter.・ Tericola bar Americana (Aspergillus terricola var. Americana), Aspergillus terricola var. Indicus, Aspergillus testaceocoloran (Aspergillus testaceocoloran) s), Aspergillus thermomutatus, Aspergillus thomii, Aspergillus togoensis, Aspergillus tonophilus, Aspergillus togillus A, sperm tubingensis), Aspergillus umbrosus, Aspergillus unguis, Aspergillus unilateralis, Aspergillus usamii mut. shirousi mut. shirousami mut. Aspergillus usamii var. Shiro-usamii), Aspergillus ustus, Aspergillus uvarum Aspergillus vadensis, Aspergillus varians, Aspergillus versicolor, Aspergillus violaceofuscus (Aspergillus violaceofuscus), Aspergillus violusius sperm viridinutans), Aspergillus vitis, Aspergillus vitis var. montevidensis, Aspergillus wentii, Aspergillus went bari var. ), Aspergillus zonatus, Aspergillus zonatus and the like.

  Furthermore, examples of microorganisms classified into the genus Zymoseptoria include Zymoseptoria tritici. Examples of microorganisms classified as Phaeosphaeria include Phaeosphaeria nodorum. Examples of microorganisms classified into the genus Pyrenophora include Pyrenophora teres. Ustilago maydis is mentioned as a microorganism classified into the genus Ustilago. Examples of microorganisms classified into the genus Ashbya include Ashbya gossypii (Eremothecium gossypii). Examples of microorganisms classified into the genus Kluyveromyces include Kluyveromyces lactis. Examples of microorganisms classified into the genus Yarrowia include Yarrowia lipolytica. Examples of microorganisms classified into the genus Debaryomyces include Debaryomyces hansenii. Examples of microorganisms classified into the genus Scheffersomyces include Scheffersomyces stipitis. Examples of microorganisms classified into the genus Meyerozyma include Meyerozyma guilliermondii. Examples of microorganisms classified into the genus Lodderomyces include Lodderomyces elongisporus. Examples of microorganisms classified into the genus Filobasidiella (Cryptococcus) include Cryptococcus neoformans, Cryptococcus gattii and Cryptococcus amylolentus. Examples of microorganisms classified into the genus Botryotinia include Botryotinia fuckeliana. Examples of microorganisms classified into the genus Sclerotinia include Sclerotinia sclerotiorum. Examples of microorganisms classified into the genus Tuber include Tuber melanosporum. Examples of microorganisms classified into the genus Postia include Postia placenta. Examples of microorganisms classified into the genus Laccaria include Laccaria bicolor. Examples of microorganisms classified into the genus Moniliophthora include Moniliophthora perniciosa. Examples of microorganisms classified into the genus Coprinopsis include Coprinopsis cinerea. Examples of microorganisms classified into the genus Schizophyllum include Schizophyllum commune. Examples of microorganisms classified as Puccinia include Puccinia graminis. Examples of microorganisms classified into the genus Magnaporthe include Magnaporthe oryzae. Podospora anserina is mentioned as a microorganism classified into Podospora genus. Examples of microorganisms classified into the genus Neurospora include Neurospora crassa. Sordaria macrospora is mentioned as a microorganism classified into the genus Sordaria. Examples of microorganisms classified into the genus Thielavia include Thielavia terrestris. Examples of microorganisms classified into the genus Myceliophthora include Myceliophthora thermophila. Examples of microorganisms classified into the genus Fusarium include Fusarium graminearum. Examples of microorganisms classified as Nectria include Nectria haematococca. Examples of microorganisms classified into the genus Malassezia include Malassezia globosa. Examples of microorganisms classified as Neosartorya include Neosartorya fischeri. Arthroderma benhamiae is mentioned as a microorganism classified into Arthroderma genus. Examples of microorganisms classified into the genus Coccidioides include Coccidioides immitis and Coccidioides posadasii. Examples of microorganisms classified into the genus Paracoccidioides include Paracoccidioides brasiliensis. Examples of microorganisms classified into the genus Uncinocarpus include Uncinocarpus reesii. Examples of microorganisms classified into the genus Trichophyton include Trichophyton verrucosum. Examples of microorganisms classified into the genus Ajellomyces include Ajellomyces capsulatus. Hypocrea rufa is mentioned as a microorganism classified into the genus Hypocrea. Acremonium chrysogenum is mentioned as a microorganism classified into the genus Acremonium. Examples of microorganisms classified into the genus Penicillium include Penicillium camembertii. Ogataea minuta is mentioned as a microorganism classified into the genus Ogataea. Examples of microorganisms classified into the genus Komagataella include Komagataella pastoris. Examples of microorganisms classified into the genus Trigonopsis include Trigonopsis variabilis. Examples of microorganisms classified into the genus Schizosaccharomyces include Schizosaccharomyces pombe. Examples of microorganisms classified into the genus Scytalidium include Scytalidium thermophirum.

  The present inventors have found each microorganism presumed to have a valine degradation pathway (PCT / JP2013 / 5359). From the findings, particularly preferred genera are as shown below. Pseudomonas, Bacillus, Sphingobacterium, Comamonas, Brevundimonas, Sphingomonas, Ochrobactrum, Pedobacter (Pedobacter), Paenibacillus, Achromobacter, Acinetobacter, Shewanella, Listonella, Agrobacterium, Mesohizobium (Meshizobium) , Rhizobium genus, Paracoccus genus, Xanthobacter genus, Streptomyces genus, Geobacillus genus, Rhodococcus genus, Saccharomyces genus Candida) is a microorganism belonging to the genus or Aspergillus (Aspergillus) genus.

  Particularly preferred are microorganisms belonging to the genus Pseudomonas or Rhodococcus.

  The microorganisms exemplified here are the American Type Culture Collection (ATCC), the National Institute of Product Evaluation Technology Biotechnology Headquarters Biogenetic Resources Division (NBRC), the National Institute of Advanced Industrial Science and Technology (AIST) ) And the like.

A microorganism having the ability to produce isobutyric acid ester can be produced by introducing the DNA encoding the AAT gene into the microorganism as a host and transcriptionally translating it into a protein in the microorganism. Furthermore, an enzyme gene that enhances isobutyryl CoA production activity may be introduced simultaneously.

  There are no particular restrictions on the gene transfer method, but the DNA to be transferred is preferably in the form of being incorporated into a vector. That is, the AAT gene is incorporated into a vector in a form that can be expressed in the host cell, and introduced into a host microorganism. These vectors include those that can replicate autonomously in the host microorganism and those that are integrated into the genome of the microorganism, but are not particularly limited as long as they retain the AAT gene, and a vector suitable for each microorganism is used. be able to. In some bacteria, it is possible to insert a DNA fragment containing an expressible AAT gene into the genome by utilizing the property that DNA introduced by electroporation or the like is easily integrated into the genome. is there. When it is desired to introduce a plurality of genes including the AAT gene into a cell, they can be incorporated into one or a plurality of expression vectors in such a form that each can be expressed.

  Vectors that can be used in the present invention include plasmid vectors, phage (virus) vectors, cosmid vectors, artificial chromosome vectors, and the like, and further include one or more selectable marker genes and appropriate expression control sequences. be able to. Many host / vector systems are known, but if necessary, they can be developed in the same manner.

  For example, vectors for introduction into microorganisms belonging to the genus Rhodococcus include pK1, pK2, pK3 and pK4, and pSJ034 (see JP-A-10-337185), pSJ023 and pSJ002 (JP-A-10-24867). Well-known vectors such as (see, but not limited to) can be used. Moreover, what modified the well-known vector into the desired structure can also be used. pSJ023 is deposited as a transformant Rhodococcus rhodochrous ATCC12674 / pSJ023 (FERM BP-6232) at the National Institute of Advanced Industrial Science and Technology Patent Organism Depositary.

The above AAT gene and insertion into a vector can be performed using gene recombination techniques known to those skilled in the art. For example, a method using a restriction enzyme cleavage and ligation kit, a method using topoisomerase, an In Fusion kit (Takara Bio) and the like can be used. The gene inserted into the vector is inserted in a linked manner downstream of a promoter capable of controlling the transcription and translation of the protein encoded by each gene in the host organism. Further, if necessary at the time of insertion, an appropriate linker may be added.
In addition, a terminator sequence, an enhancer sequence, a splicing signal sequence, a poly A addition signal sequence, a ribosome binding sequence such as an SD sequence or a Kozak sequence, a selectable marker gene, etc. that can be used in the host microorganism into which the gene is to be introduced, if necessary. Can be connected. Examples of selectable marker genes include drug resistance genes such as ampicillin resistance gene, tetracycline resistance gene, neomycin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, and intracellular biosynthesis of nutrients such as amino acids and nucleic acids. Examples include genes involved or genes encoding fluorescent proteins such as luciferase. A part of the amino acid sequence encoded by the DNA may be replaced with the insertion.

From the above points, in one example of the present invention, it is particularly preferable to use pLK005 obtained by performing mutation treatment on pK4 as a vector for the genus Rhodococcus. An expression plasmid vector expressing the AAT gene by the promoter can be constructed by ligating and inserting the AAT gene so as to be located 3 ′ downstream of the promoter of pLK005.
Any one gene selected from an AAT gene group alone or another enzyme gene group that enhances isobutyryl CoA synthesis activity may be inserted into the vector, or a plurality of genes may be inserted. When used for genes to be inserted into a vector, the term “plurality” means that 2 to 5, 2 to 4, preferably 2 to 3 genes can be inserted. When a plurality of genes are inserted into one vector, these genes preferably form an operon. Here, the “operon” is a nucleic acid sequence unit composed of one or more genes transcribed under the control of the same promoter.
The above genes, preferably in the form of vectors, are introduced into the host microorganism by methods known to those skilled in the art. The method for introducing the recombinant vector into the host microorganism is not particularly limited as long as it is a method suitable for the host microorganism. For example, electroporation method, spheroplast method, lithium acetate method, calcium phosphate method, lipofection Method, bonding transmission method and the like.
When a microorganism that does not have a BCKAD gene is used as a host, the BCKAD gene can be introduced into any microorganism, and a microorganism having the ability to produce isobutyric acid ester can be produced. It is also possible to introduce the BCKAD gene and the AAT gene simultaneously.

In the present invention, a preferable BCKAD gene is not particularly limited as long as the translation product has the ability to produce isobutyryl CoA, and can be appropriately selected from any one of the above microorganism groups.
For example, Pseudomonas putida and BCKAD derived from Pseudomonas aeruginosa are complexes composed of four polypeptides, and their genes are known to form operons (Methods in Enzymology (2000) 324: 129-). 138). For example, Primer for amplifying the entire BCKAD operon is designed from the genome sequence of Pseudomonas aeruginosa PAO1, and the entire operon is amplified by PCR reaction using genomic DNA as a template and incorporated into an expression vector for E. coli. Thus, a vector for expressing BCKAD can be constructed. Using this, a recombinant can be produced and the BCKAD gene can be obtained (SEQ ID NOs: 7 and 8).
The base sequence of the BCKAD gene whose gene information is known can be totally synthesized by a usual method. Whether BCKAD whose gene information is known has isobutyryl CoA synthesis activity is evaluated by confirming isobutyryl CoA synthesis activity (Journal of Bacteriology, 1981, 148 (2), 647-652). Can do.

On the other hand, for BCKAD for which genetic information is unknown, BCKAD can be purified, and genetic information can be obtained by genetic engineering techniques based on the protein. For example, it is possible to purify using an ordinary method with BCKAD synthesis activity as an index.
Alternatively, it is also possible to determine the entire genome sequence for any microorganism in the above group of microorganisms and obtain gene sequence information encoding BCKAD from the genome sequence. For example, a homology search is performed using known BCKAD gene information, a gene sequence having high homology is searched, the gene is isolated or totally synthesized, and introduced into a general host vector system. Selection can be made by expressing the candidate protein with the converted microorganism and evaluating the activity by the method described above. With the widespread use of next-generation sequencers, a person skilled in the art can easily analyze the entire genome sequence of microorganisms.
In the present invention, the BCKAD gene includes an amino acid sequence in which one or a plurality of amino acids are substituted, deleted or added in the wild-type amino acid sequence, and has activity to generate isobutyryl CoA from isobutyryl CoA and alcohol The gene encoding is also included.
Here, “several” means 40 or less, preferably 20 or less, more preferably 10 or less. In order to introduce a mutation into a gene, a mutation introduction kit using site-directed mutagenesis, for example, QuikChangeTM Site-Directed Mutagenesis Kit (Stratagene), GeneTailorTM Site-Directed
Mutagenesis System (Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: Takara Bio Inc.) and the like can be used. Alternatively, the entire gene having a sequence containing a mutation may be artificially synthesized.
In the present invention, the BCKAD gene has 90% or more, preferably 95% or more, more preferably 99.5% or more, and further preferably 99.9% or more identity with a protein comprising a wild-type amino acid sequence. Also included are genes encoding proteins that have the activity to produce isobutyryl CoA.
Furthermore, in the present invention, the BCKAD gene encodes a protein having an activity of hybridizing to a polynucleotide having a base sequence complementary to a wild-type base sequence under the above-mentioned stringent conditions to generate isobutyryl CoA. Gene to be included.

Furthermore, in the present invention, the BCKAD gene contains 80% or more, more preferably 90% or more, most preferably, when calculated using a wild-type base sequence and BLAST or the like (for example, default or default parameters). A gene encoding a protein consisting of a base sequence having an identity of 95% or more and having an activity of producing isobutyryl CoA is also included. Moreover, the codon of the said BCKAD gene may be converted according to the codon usage frequency of the microorganism host used for transformation.
The introduction of the BCKAD gene can be carried out by any method as in the introduction of the AAT gene.

As described above, a microorganism having an ability to produce an isobutyric acid ester can be produced by transforming AAT having an activity of synthesizing an isobutyric acid ester and, if necessary, introducing a BCKAD gene.
The microorganism having the ability to produce a preferred isobutyric acid ester in the present invention is a microorganism having the ability to accumulate 1 ppm or more, more preferably 2 ppm of the isobutyric acid ester by these transformations. The isobutyric acid ester accumulation capacity is as follows. The concentration of 2-oxoisovaleric acid is 0.4% under the condition of pH 7.0 to 7.5, and any alcohol selected from methanol, ethanol, n-butanol and isobutanol is used. It can be measured by reacting a reaction solution in which the concentration is 40 mM and the microbial cell body is adjusted to a concentration of 10 with OD630 at a temperature of 30 ° C. for 20 hours, and analyzing the corresponding isobutyric acid ester produced. More detailed conditions are as described in Examples 6 and 9. If necessary, the reaction can be carried out in the presence of a hydrolase inhibitor. Depending on the alcohol used and / or transformed AAT, there may be a difference in the production capacity of isobutyrate, but it is particularly a microorganism having the ability to accumulate 10 ppm of the corresponding isobutyrate with any alcohol. preferable.

Furthermore, the present invention includes mutant strains obtained by inducing gene mutations in microorganisms capable of producing isobutyryl CoA, and mutant strains whose activity is enhanced or whose activity is deficient or reduced. Mutant strains can be obtained by inducing gene mutations by changing culture conditions (for example, medium composition, temperature, etc.), or by chemical or physical treatment (for example, γ-irradiation).
Enhancing activity means that the expression level of an enzyme gene (regardless of origin) in the microorganism is increased, and in addition to introducing a gene encoding the enzyme from outside the microorganism cell. Enhances the promoter activity of an enzyme gene possessed by the microorganism on the genome or replaces it with other promoters, or reduces or inactivates the repressor activity of the enzyme gene As a result of enhancing the enzyme activity.

  `` Deficiency '' or `` decrease '' in activity means that the expression of the enzyme gene in the microorganism is completely eliminated or decreased, and in addition to occurrence of substitution, deletion or insertion in the enzyme gene, Reducing the promoter activity of enzyme genes held in the genome by microorganisms, or suppressing the expression of enzyme genes by replacing them with other promoters, or enhancing or activating the repressor activity of the enzyme genes As a result of reducing the enzyme activity. These modifications may be performed according to a conventional method.

  Preferred mutants in the case of the microorganism having the ability to produce the isobutyric acid ester of the present invention include mutants having at least one of the following characteristics (a) to (d).

(A) Isobutyryl CoA metabolic decomposition activity is suppressed by deletion or inactivation of isobutyryl CoA dehydrogenase in the valine degradation pathway and subsequent enzyme groups.
(B) Aminotransferase and / or 2-isopropylmalate synthase activity acting on 2-oxoisovalerate is suppressed.
(C) Enzymes of BCKAD and / or valine biosynthetic pathway are strengthened, and isobutyryl CoA production activity is improved.
(D) The decomposing enzyme activity of isobutyric acid ester is suppressed.
By using these mutant strains, microorganisms having an excellent ability to produce isobutyryl CoA can be produced, and by using these strains, microorganisms having a high ability to produce isobutyric acid esters can be obtained.

(2) Method for producing isobutyric acid ester A microorganism having an ability to produce isobutyric acid ester introduced with necessary genes such as AAT gene and BCKAD gene as required arises from the use of renewable raw materials and / or the use of the renewable raw materials Contact with biomass and alcohol or phenols to produce isobutyric acid esters.

  Here, “contact” means that the microorganism and the raw material are exposed to a certain time. Specifically, culturing microorganisms in an aqueous medium containing raw materials or the like, or adding a culture of microorganisms to an aqueous medium containing raw materials, suspending and mixing them, and isolating them in the aqueous medium and / or in the gas phase. Butyrate ester is obtained. At that time, there may be growth of microorganisms. In this step, a mixture containing the recombinant microorganism and isobutyric acid ester is obtained.

  “Aqueous medium” refers to water or an aqueous solution containing water as a main component, and includes those in which an undissolved liquid / solid is dispersed. “Gas phase” refers to a portion occupied by gas, water vapor or the like excluding a portion occupied by a liquid (medium or the like) in a culture tank (a container for culturing microorganisms) or a reaction tank (a container for reaction). “Culture” means a product obtained by culturing bacterial cells, culture solution, cell-free extract, cell membrane and the like.

  Renewable raw materials and biomass are not particularly limited as long as they can produce isobutyric acid esters. Renewable raw materials and biomass may be plant materials, animal materials, biodegradable wastes, and the like. Suitable renewable raw materials and biomass are extracts such as polypeptone, meat extract, yeast extract, corn steep liquor or soy. These extracts are used as they are or after being partially purified. Renewable raw materials may be polysaccharides, oligosaccharides and monosaccharides glucose, galactose, mannose, fructose, xylose and arabinose and their derivatives. Furthermore, lipids, amino acids, organic acids and alcohols derived from these saccharides or derived from metabolism can also be used as renewable raw materials and biomass. Suitable renewable raw materials include sugars such as glucose, fructose and xylose; amino acids such as valine, alanine, leucine, lysine and glutamic acid; acetic acid, pyruvic acid, lactic acid, acetoacetic acid, acetolactic acid, 2-oxoisovaleric acid, Examples include acids such as butyric acid, isobutyric acid, propionic acid, malic acid, fumaric acid, citric acid, and succinic acid; and alcohols such as ethanol, n-propanol, isopropanol, n-butanol, and isobutanol. These renewable raw materials can be used individually by 1 type or in combination of 2 or more types.

[Production of isobutyric acid ester by culture]
In the present invention, isobutyric acid ester is produced by culturing a microorganism capable of producing isobutyric acid ester in an aqueous medium containing a renewable raw material and / or biomass resulting from the use of the renewable raw material and alcohol or phenols. Thus, isobutyric acid ester is produced and accumulated in the cultured cell or culture, and the isobutyric acid ester is recovered from the cultured cell or culture or the gas phase part of the culture vessel.
The aqueous medium (medium) containing a renewable raw material and / or biomass used for culturing microorganisms is preferably a solid medium or a liquid medium containing sufficient nutrients containing at least one carbon source capable of growing microorganisms. The medium is adjusted to the optimum pH and salt concentration for the growth and growth of microorganisms as necessary.

  The concentration of renewable raw materials and / or biomass in the medium is not particularly limited as long as isobutyric acid ester can be produced. The concentration is, for example, 0.05 to 20 (w / v)%, preferably 0.1 to 15 (w / v)%, more preferably 0.2 to 10 (w / v)%. Within this range, the ability of microorganisms to produce isobutyric acid ester increases, and a dramatic increase in effect is observed.

Alcohol or phenols are added to the medium depending on the target isobutyric acid ester. As the alcohol or phenol, those described above are preferably used. These alcohols or phenols can be used singly or in combination of two or more.
The concentration of alcohol or phenol in the medium is not particularly limited as long as isobutyric acid ester can be produced. The concentration is, for example, from 0.01 to 20 (w / v)%, preferably from 0.05 to 10 (w / v), more preferably from 0.1 to 5 (w / v), from the viewpoint of economy and production efficiency. )% Is good. Within this range, growth and reaction are hardly inhibited and suitable for the production of isobutyric acid esters.
In addition, alcohol or phenols can be added to the medium in advance, or can be added continuously or intermittently in two or more steps while culturing.
An inorganic nitrogen source or inorganic metal salts may be added to the medium. As the inorganic nitrogen source, for example, an inorganic acid such as ammonium chloride, ammonium sulfate, ammonium acetate, or ammonium phosphate, or an ammonium salt of an organic acid, or the like is used.

The concentration of the nitrogen source in the medium is not particularly limited as long as isobutyric acid ester can be produced. The concentration is, for example, 0.01 to 10 (w / v)%, preferably 0.05 to 8 (w / v)%, more preferably 0.1 to 4 (w / v)%.
Examples of the inorganic metal salt include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.
The concentration of inorganic salts in the medium is not particularly limited as long as isobutyric acid ester can be produced. The concentration is, for example, 0.001 to 1.6 (w / v)%, preferably 0.005 to 1.3 (w / v)%, more preferably 0.01 to 1 (w / v)%. good. Within this range, the ability of microorganisms to produce isobutyric acid esters increases, and a dramatic increase in effect is observed.

In addition, trace metals, vitamins, and the like are added to the medium as necessary. In addition, various organic substances, inorganic substances, surfactants or commonly used antifoaming agents necessary for the growth of microorganisms can be additionally added to the medium as necessary.
The seeding of microorganisms in the medium may be performed by a conventionally known method. The culture method is also not particularly limited, and known techniques such as shaking culture, aeration stirring culture, and stationary culture can be used.
The culture conditions for microorganisms are not particularly limited as long as the microorganisms grow and produce isobutyric acid esters. The culture may be performed under aerobic conditions or anaerobic conditions. It is also possible to carry out this reaction under reduced pressure or aeration conditions. This is because the produced isobutyric acid ester can be continuously separated under the above conditions, and as a result, the reaction may proceed efficiently.

The pH, temperature, and culture time are not particularly limited as long as the microorganism can grow and can produce isobutyric acid ester. The pH is preferably 3 to 10, more preferably 4 to 9, and still more preferably 5 to 8. The temperature is preferably 10 to 45 ° C, more preferably 15 to 40 ° C, and still more preferably 20 to 37 ° C.
When the pH and temperature are within these ranges, the produced isobutyric acid ester is hardly decomposed and the production amount is not reduced. The culture time is preferably 10 to 1000 hours, more preferably 15 to 480 hours, and still more preferably 20 to 240 hours. An increase in the effect is recognized within this range.
These culture conditions are appropriately selected or optimized for each strain so as to maximize the ratio of the amount of isobutyric acid ester produced to the amount of renewable raw materials and / or biomass used. In addition, the production amount of isobutyric acid ester can also be adjusted by appropriately adjusting the amount of carbon source and the culture conditions.

  As a suitable condition for accumulating 1 ppm or more of isobutyric acid ester, the concentration of renewable raw materials and / or biomass is directly or indirectly 0.1% or more under the condition of pH 5.5 to 7.5, and The concentration of alcohol or phenol is directly or indirectly maintained at 0.1% or more, the temperature is adjusted to a range of 20 to 40 ° C., and the cells are cultured for 3 hours or more. Furthermore, it is possible to obtain efficient productivity by maintaining the microorganism concentration in the culture solution at a high level within a range where the ratio of the culture solution environment becomes inappropriate for the growth of the microorganism or the cultured cells and the death rate is not increased. For example, by maintaining the dry weight at 2 g / L or more, good production efficiency can be obtained, and the accumulated concentration of the product can be improved.

[Production of isobutyric acid ester by resting cell reaction]
In the method for producing isobutyric acid ester according to the present invention, as described above, in addition to the method for culturing microorganisms accompanied by growth in an aqueous medium containing a renewable raw material and / or biomass, the following method can also be employed. Microorganisms may or may not have a proliferative ability, and a precultured microorganism is brought into contact with an aqueous medium containing a renewable raw material and / or biomass, and an isobutyric acid ester is produced by a resting cell reaction that is not substantially accompanied by proliferation. Can also be produced.
The renewable raw material used in the resting cell reaction and / or the renewable raw material contained in the aqueous medium (reaction solution) containing biomass and the concentration thereof may be the same as in the case of producing isobutyric acid ester by the above culture. .

The alcohol or phenol used for the resting cell reaction and the concentration thereof may be the same as those in the production of isobutyric acid ester by the above culture.
An inorganic metal salt or the like may be added to the reaction solution. Examples of the inorganic metal salt include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.
The density | concentration in the reaction liquid of inorganic salt will not be specifically limited if isobutyric acid ester can be produced. The concentration is, for example, 0.0001 to 2 (w / v)%, preferably 0.0003 to 1.3 (w / v)%, more preferably 0.001 to 1 (w / v)%.
In addition, trace metals, vitamins, and the like are added to the reaction solution as necessary. In addition, various organic substances, inorganic substances, surfactants or commonly used antifoaming agents necessary for the reaction can be added to the reaction solution as necessary.

  For the resting cell reaction, a culture solution of microorganisms cultured in advance is used as it is, or cells recovered by filtration or centrifugation are used. The collected microorganism can be resuspended in an appropriate buffer or the like and used at an arbitrary bacterial concentration. Examples of the buffer solution include physiological saline, potassium phosphate buffer, Tris-hydrochloric acid buffer, glycine-sodium hydroxide buffer, boric acid-sodium hydroxide buffer, and the like.

For the resting cell reaction, a collected processed product of microorganisms (for example, crushed material, crude enzyme or purified enzyme) can be used. Furthermore, the microorganism or the processed product thereof may be immobilized on a suitable carrier by a known method, and the immobilized product may be used for the reaction.
The reaction conditions are not particularly limited as long as isobutyric acid ester is produced. The reaction may be carried out under aerobic conditions or under anaerobic conditions. The reaction method is not particularly limited, and known methods such as shaking reaction, aeration stirring reaction, and stationary reaction can be used. It is also possible to carry out this reaction under reduced pressure or aeration conditions. This is because the produced isobutyric acid ester can be continuously separated under the above conditions, and as a result, the reaction may proceed efficiently.

The pH, temperature, and reaction time are not particularly limited as long as they can produce isobutyric acid, and may be the same as those in the production of isobutyric acid ester by the above culture. The pH is preferably 3 to 10, more preferably 4 to 9, and still more preferably 5 to 8. The temperature is preferably 10 to 45 ° C, more preferably 15 to 40 ° C, and still more preferably 20 to 37 ° C. The reaction time is preferably 10 to 1000 hours, more preferably 15 to 480 hours, and further preferably 20 to 240 hours under aerobic conditions.
In addition, for the purpose of separating the produced isobutyric acid ester, it is also possible to add an organic solvent in advance and react in a two-phase system. As the organic solvent, for example, linear, branched or cyclic, saturated or unsaturated aliphatic hydrocarbon, saturated or unsaturated aromatic hydrocarbon, etc. can be used alone or in admixture of two or more. Specifically, for example, hydrocarbon solvents (eg, pentane, hexane, cyclohexane, benzene, toluene, xylene, etc.), halogenated hydrocarbon solvents (eg, methylene chloride, chloroform, etc.), ether solvents (eg, diethyl ether, Dipropyl ether, diisopropyl ether, dibutyl ether, tert-butyl methyl ether, dimethoxyethane and the like), ester solvents (for example, methyl formate, methyl acetate, ethyl acetate, butyl acetate, methyl propionate) and the like. By adding these organic solvents, the produced isobutyric acid ester may move to the organic phase and the reaction may proceed efficiently.
These reaction conditions are appropriately selected or optimized for each strain so as to maximize the ratio of the amount of isobutyric acid ester produced to the amount of renewable raw materials and biomass used. In addition, the production amount of isobutyric acid ester can also be adjusted by adjusting the density | concentration of a raw material and reaction conditions suitably.

  As a suitable condition for accumulating 1 ppm or more of isobutyric acid ester, the concentration of renewable raw materials and / or biomass is directly or indirectly 0.1% or more under the condition of pH 5.5 to 7.5, and The concentration of alcohol or phenol is directly or indirectly maintained at 0.1% or more, the temperature is adjusted to a range of 20 to 40 ° C., and the reaction is performed for 3 hours or more. Furthermore, it is preferable to maintain a high concentration of microorganisms in the reaction solution in order to obtain efficient productivity. For example, good production efficiency can be obtained and maintained by maintaining the dry weight at 2 g / L or more. The accumulated concentration of the object can be improved.

  In the method for producing isobutyric acid ester according to the present invention, the production of isobutyric acid ester by culture and the production of isobutyric acid ester by resting cell reaction may be appropriately combined. By combining the two methods, more efficient production of isobutyric acid ester is possible. Furthermore, in the method for producing an isobutyric acid ester according to the present invention, in addition to the method of contacting the microorganism with an aqueous medium containing a renewable raw material and / or biomass prepared as a culture medium or a resting cell reaction solution, a renewable raw material and / or A method in which microorganisms are brought into direct contact with biomass can also be employed.

[Recovery of isobutyric acid ester]
The isobutyric acid ester produced | generated in the culture medium or the reaction liquid, and its production amount can be detected and measured using normal methods, such as a high performance liquid chromatography and LC-MS. Moreover, the isobutyric acid ester volatilized in the gas phase part (head space part) of the culture vessel or the reaction vessel and the amount of production thereof can be detected and measured using a usual method such as gas chromatography.
Isobutyric acid ester can be extracted from the medium or reaction solution by appropriately combining known operations such as filtration, centrifugation, vacuum concentration, ion exchange or adsorption chromatography, solvent extraction, distillation and crystallization as necessary. Can be separated and purified. Further, the obtained isobutyric acid ester can be used for conventional applications.
The isobutyric acid ester thus obtained can remarkably reduce the burden on energy, resources, and the environment, and it is very environmentally friendly as compared with conventional chemical products that use petroleum products as starting materials. It has great social value.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the scope of the present invention is not limited to the scope of these examples.

[Reference Example 1]
[Preparation of junction transmission recipient PR4KS]
Rhodococcus erythropolis PR4 (Product Evaluation Technology Organization, Biological Genetic Resources Division; Accession Number: NBRC 100877) was modified by the method described in Japanese Patent Application Laid-Open No. 2011-200133, and 120 mg / L chloramphenicol A derivative strain that was resistant to kanamycin and lacked the kanamycin resistance gene was prepared and named PR4KS strain.
Specifically, in order to enhance chloramphenicol resistance, MYK medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0 Spontaneous mutation was induced by subculturing the PR4 strain while gradually increasing the concentration of chloramphenicol in 2% K ₂ HPO ₄ ) starting from 10 mg / mL to 120 mg / mL. A derivative strain RhCmSR-09 having resistance to / mL chloramphenicol was obtained.
Next, the above RhCmSR-09 strain was mixed and cultured at a ratio of 1: 1 with an E. coli strain harboring the plasmid kKM043 for introducing a kanamycin resistance gene deletion mutation described in JP-A 2011-2001133. After introducing pKM043 into the RhCmSR-09 strain, MYK agar medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt containing kanamycin sulfate 200 mg / L and chloramphenicol 50 mg / L) (extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1.5% agar) to obtain a homologous recombination strain in which pKM043 is inserted into the RhCmSR-09 strain genome. Obtained. The homologous recombination strain was cultured on a 10% sucrose-containing MYK agar medium, and an induced strain that became a kanamycin sensitive strain from the obtained colonies, that is, a kanamycin resistant gene deletion mutant induced strain PR4KS was obtained.

[Reference Example 2]
[Cloning of LigD homolog gene and preparation of gene deletion plasmid]
The ligD homolog gene (accession no: YP — 002767969) of PR4KS strain was used as a target gene. After amplifying about 5.4 kb of DNA including the peripheral sequence of the LigD gene by PCR, the plasmid vector pK19mobsacB1 described in Japanese Patent Application Laid-Open No. 2011-200133 was introduced in the downstream and in the same direction of the kanamycin resistance gene. Cloning resulted in plasmid pTJ001. PCR conditions are as follows.

Primer GB-138: 5′-GGCCTGCAGGTACCCGATCATCACATCATGGTGTC-3 ′ (SEQ ID NO: 9)
GB-139: 5′-GGTCTAGACTGAGCAGTGTTCCAATGCG-3 ′ (SEQ ID NO: 10)

Reaction solution composition:
Sterile water 22 μL
2 × PrimeSTAR (Takara Bio Inc.) 25 μL
GB-138 1 μL
GB-139 1 μL
PR4KS genome (50 ng / μL) 1 μL
Total volume 50 μL

Temperature cycle 98 ° C 10 seconds, 55 ° C 10 seconds and 72 ° C 120 seconds reaction 35 cycles

  A full length LigD homolog gene (about 2.3 kb) in pTJ001 was deleted, and a ligD homolog gene deletion plasmid pTJ002 was prepared in which only the upstream and downstream sequences of the LigD homolog gene remained (see FIG. 2). pTJ002 contains both the sequence near the start codon and the sequence near the stop codon of the target LigD homolog gene, and primer GB-140 designed to extend upstream from the start codon or downstream from the stop codon, respectively. It was obtained by transforming Escherichia coli JM109 strain with a PCR product not containing the LigD homolog gene obtained by amplifying the sequence inside pTJ001 with GB-141. The conditions for PCR are as follows.

Primer GB-140: GAGGAAAATGGTCACAGGGGCGAGAATAGGTTG (SEQ ID NO: 11)
GB-141: GCCCTGTGACCATTTCCTCATTGTCTGG (SEQ ID NO: 12)

Composition of reaction solution Sterile water 22 μL
2 × PrimeSTAR (Takara Bio Inc.) 25 μL
GB-140 1 μL
GB-141 1 μL
pTJ001 1 μL
Total volume 50 μL

Temperature cycle 98 ° C 10 seconds, 50 degrees 10 seconds and 72 ° C 180 seconds reaction 30 cycles

  After completion of PCR, the fragment was confirmed by 0.7% agarose gel electrophoresis using 1 μL of the sample. As a result, fragment amplification was observed. In the above procedure for producing plasmid pTJ002, Wizard Genomic DNA Purification Kit (manufactured by Promega) is used for genome extraction from PR4 strain, and Gel / PCR Purification Kit (manufactured by FAVORGEN) is used for purification of DNA fragments and PCR products cleaved with restriction enzymes. ), DNA Ligation Kit <Mighty Mix> (manufactured by Takara Bio Inc.) was used to connect DNAs, and QIAprep miniprep kit (manufactured by QIAGEN) was used for plasmid extraction.

[Reference Example 3]
[Preparation of PR4KS LigD homolog gene deletion-derived strain]
Conjugate transfer in the same manner as described in JP-A-2011-200133, using Escherichia coli S17-1λ pi transformed with pTJ002 as a donor and PR4KS obtained by the method of Reference Example 1 as a recipient. Thus, 13 strains of LigD homolog gene deletion induced by homologous recombination were obtained. One strain was selected from the deletion-derived strains and named PR4KSΔligD-derived strain.

[Example 1]
[Preparation of plasmid pLK005 for Rhodococcus bacteria and plasmid pSJ201 for expression of nitrile hydratase using the same]
(1) Acquisition and analysis of pLK005 Rhodococcus sp. N775 (National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary, Deposit No. FERM BP) by using the above-mentioned electroporation method using pK4 (see JP-A-5-64589) -961) was transformed. The obtained transformant was inoculated into 10 mL of MYK medium and cultured at 30 ° C. for 1 day. Mutation treatment was performed by irradiating this with ultraviolet rays in a clean bench. The culture solution subjected to the mutation treatment was applied to a MYK agar medium containing 50 to 400 μg / mL kanamycin and cultured at 30 ° C. for 3 days.
A plurality of colonies that appeared on the agar medium were each cultured in MYK medium, and the plasmid was recovered from the transformant. Rhodococcus sp. N775 was transformed again using the recovered plasmid, and it was examined whether or not the kanamycin resistance of the transformant was improved. As a result, several transformants with apparently improved kanamycin resistance were found.
Examination of the base sequence of the plasmid in which the kanamycin resistance level was found to be improved revealed that there was a change in the sequence upstream of the kanamycin resistance gene of pK4 (duplication of the 8-base sequence GTTGTAGG). The plasmid that was found to have improved kanamycin resistance was designated pLK005.

(2) Preparation of pSJ040 Plasmid pSJ034 was prepared from plasmid pSJ023 by the method described in JP-A-10-337185. There are three EcoRI restriction enzyme sites in pSJ034, and a plasmid pSJ040 was prepared by converting one of these sites into a SpeI site. In the production method, pSJ034 was partially decomposed with the restriction enzyme EcoRI, and the cut site was smoothed using a Takara Blunting kit. Ligation reaction was performed in the presence of SpeI linker, and Escherichia coli JM109 strain was transformed with the reaction solution. After culturing the transformant, the plasmid was extracted, and the plasmid into which the SpeI linker was inserted was selected. Of the three EcoRI sites of pSJ034, the one in which the SpeI linker was inserted into the EcoRI site downstream of the kanamycin resistance gene was named pSJ040.

(3) Construction of pSJ201 pLK005 was cleaved with HindIII to prepare a fragment of about 2.1 kb. On the other hand, pSJ040 was digested with HindIII to prepare a fragment of about 9.8 kb. Ligation reaction was performed using these two fragments, and Escherichia coli JM109 strain was transformed using the reaction solution. After culturing the transformant, the plasmid was extracted and the nucleotide sequence thereof was confirmed. As a result, a plasmid having a mutant sequence derived from pLK005 (overlapping of GTTGTAGG) and having the same sequence as pSJ040 was named pSJ201.

[Example 2]
[Preparation of PR4KSΔligD-derived strain RE_acd1 / RE_echA / RE_hchA / RE_mmsB gene deletion-derived strain]
(1) Preparation of plasmid for gene deletion using In Fusion method Plasmid for gene deletion by In-Fusion HD Cloning kit (manufactured by Takara Bio Inc.) using RE_acd1 / RE_echA / RE_hchA / RE_mmsB gene of PR4KS strain as a target gene Was made (see FIG. 3).
DNAs upstream and downstream of the target gene were amplified by PCR. PCR conditions are as follows.

Primer for fragment 1 MMA-061: CGACTCTAGAGGATCGCTCCATAGTACTCTACGAGAC (SEQ ID NO: 13)
MMA-062: AGTGTGAGGAAAGGTTCCCATCAGTTTCAT (SEQ ID NO: 14)
Primer for fragment 2 MMA-063: CACTTTCCCTCACACTCGTCGAGATAGTATGAG (SEQ ID NO: 15)
MMA-064: CGGTACCCGGGGATCAGCCGCGACGAACAACGAGAC (SEQ ID NO: 16)

Reaction solution composition Template (PR4 wild type genomic DNA) 1 μL
2 × PrimeStar Max Premix (manufactured by TAKARA) 25 μL
Fw Primer (20 μM) 1 μL
Rv Primer (20 μM) 1 μL
D. W. 22 μL
Total 50μL

Temperature cycle 98 ° C 10 seconds, 60 ° C 10 seconds and 72 ° C 120 seconds reaction 30 cycles

  After completion of PCR, the fragment was confirmed by 0.7% agarose gel electrophoresis using 1 μL of the sample. As a result, fragment amplification was observed. The PCR products (fragment 1 and fragment 2) were subjected to buffer replacement using Gel / PCR Purification Kit (manufactured by FAVORGEN), and used for the reaction by In-Fusion HD Cloning Kit shown below.

(2) Ligation and transformation of vector and target fragment using In-Fusion HD Cloning Kit The above fragment and vector were linked using In-Fusion HD Cloning Kit. The reaction conditions are as follows.

Reaction solution composition 5x In-Fusion HD Enzyme Premix 2μL
Vector fragment 1.5 μL
DNA fragment 1 1 μL
DNA fragment 2 2 μL
D. W. 3.5μL
Total 10μL

  The reaction solution was incubated at 50 ° C. for 15 minutes, cooled on ice, and used for transformation of Escherichia coli JM109 strain. The selection of E. coli transformants was performed using LB agar medium containing 1 mg bactotryptone, 0.5% bactoeast extract, 0.5% NaCl and 1.5% agar, And LB agar medium). A plasmid was prepared from the resulting transformant using Mini prep Kit (QIAGEN) to obtain the desired plasmid. Confirmation of the plasmid was performed by examining the fragment size after treatment with XbaI restriction enzyme and the sequence of the connecting region between the inserted fragment and the vector. The plasmid of interest was named pMMA302.

(3) Preparation of homologous recombination-inducing strain and gene deletion-inducing strain of PR4KSΔligD derivative strain 1 μL of pMMA302 was added to 20 μL of PR4KSΔligD strain competent cell and incubated on ice for 10 minutes. Transfer the entire amount of the incubated solution to an ice-cooled electroporation cuvette (0.1 cm), apply a high voltage of 1.5 kV (200 Ω), and immediately apply 600 μL of LB medium (1% bactotryptone, 0.5% bactoy). -A medium containing strike extract and 0.5% NaCl (hereinafter abbreviated as LB medium) was added, and the mixture was allowed to stand at 30 ° C for 6 hours. 200 μL was plated on an LB agar medium containing 10 mg / L kanamycin sulfate and cultured at 30 ° C. for 4 days. The grown colonies were streaked again on the same agar medium, cultured for 4 days, and then colony PCR was performed under the conditions shown below to confirm homologous recombination-derived strains.

Primer MMA-069: GCGCATCTACAGAGAGAGAGTC (SEQ ID NO: 17)
MMA-070: GCGACGCTCATCGAGATTC (SEQ ID NO: 18)

Reaction solution composition Template 4.0 μL
2 × MightyAmpBuffer (manufactured by TAKARA) 5.0 μL
Fw Primer (20 μM) 0.25 μL
Rv Primer (20 μM) 0.25 μL
D. W. 0.3 μL
MightyAmpDNAPolymerase (manufactured by TAKARA) 0.2 μL
Total 10.0μL

Temperature cycle 98 ° C 10 seconds, 68 ° C 180 seconds reaction 30 cycles

  Colonies that were found to be homologous recombination-inducing strains were suspended in 200 μL of LB medium, and 100 μL were plated on LB medium + 10% sucrose agar medium and cultured for 3 days. From the grown colonies, kanamycin-sensitive ones were selected and the target gene deletion was confirmed by colony PCR. As a result, a PR4KSΔligD-derived strain in which four genes RE_acd1, RE_echA, RE_hchA, and RE_mmsB were deleted was obtained and named DMA008 strain.

[Example 3]
[Preparation of plant-derived AAT expression plasmid]
The plant-derived AAT genes shown in SEQ ID NOs: 2, 4, and 6 were commissioned and synthesized by Takara Bio Inc.
Apple AAT (MpAAT1): amino acid sequence (SEQ ID NO: 1), base sequence (SEQ ID NO: 2)
Strawberry AAT (SAAT): amino acid sequence (SEQ ID NO: 3), base sequence (SEQ ID NO: 4)
Strawberry AAT (VAAT): amino acid sequence (SEQ ID NO: 5), base sequence (SEQ ID NO: 6)
These synthesized gene fragments were inserted into vector pMD19 and named pAAT001-003, respectively. (Table 1) Using these pAAT001 to 003 as a template, oligonucleotides were designed so that a DNA fragment containing an AAT gene was added with a restriction enzyme recognition site that can be easily introduced into an expression vector, and PCR method It was prepared by.

Oligonucleotide primer MMA-044: 5′-GTTTGCACGCCCTGCCGTTCGACG-3 ′ (SEQ ID NO: 19)
MMA-045: 5′-CGGTACCGCGCGGATCTTCCAGAG-3 ′ (SEQ ID NO: 20)

Composition of reaction solution Sterile water 22 μL
2 × PrimeSTAR (Takara Bio Inc.) 25 μL
Forward primer 1 μL
Reverse primer 1 μL
Genomic DNA 1 μL
Total volume 50 μL

Temperature cycle 98 ° C 10 seconds, 55 ° C 15 seconds and 72 ° C 150 seconds reaction 30 cycles

  The resulting amplified product band was purified with QIAquick Gel Extraction Kit (QIAGEN). Each purified DNA was cleaved with restriction enzymes PagI (a cleavage recognition site is included in Forward Primer) and Sse8387I (a cleavage recognition site is included in Reverse Primer). Separation was performed by agarose gel electrophoresis, and the target band was excised from the gel and purified. For purification, Gel / PCR Purification Kit (manufactured by FAVORGEN) was used and eluted in 30 μL of sterilized water.

Purified DNA (5 μL), vector pTrc99A (1 μL), distilled water (4 μL) and solution I (DNA Ligation Kit ver. 2 (Takara Bio Inc.)) (10 μL) previously digested with NcoI and Sse8387I The PCR amplification product and the vector were ligated by mixing and incubating for 12 hours at 16 ° C.
2 μL of the above ligation solution is added to 20 μL of E. coli JM109 strain competent cell (purchased from Takara Bio Inc.), left at 0 ° C. for 30 minutes, and then subjected to heat shock at 42 ° C. for 30 seconds. After cooling for 1 minute, 1 mL of SOC medium was added and cultured with shaking at 37 ° C. for 1 hour.
After culturing, 100 μL each was applied to LB Amp100 agar medium (LB agar medium containing ampicillin 100 mg / L) and further cultured at 37 ° C. A plurality of transformant colonies grown on an agar medium were cultured overnight at 37 ° C. in 1.5 mL of LB Amp100 medium (LB medium containing ampicillin 100 mg / L), and after collection, QIAprep Spin Miniprep kit (QIAGEN Was used to prepare plasmid DNA.
The base sequences of the obtained recombinant plasmid DNAs were confirmed using CEQ DTCS Quick Start Kit and fluorescent sequencer CEQ 2000XL DNA Analysis (both BECKMAN COULTER, USA) and named plasmid pAAT101 to pAAT103 ( Table 1).

For the pET16b vector, the AAT gene was inserted in the same manner, and the resulting plasmids were named pAAT201 to pAAT203 (Table 1). However, since pET16b does not have an Sse8387I site, a pET16b BamHI site in which a linker containing an Sse8387I cleavage sequence was prepared in advance and used as a vector.
Plasmids pAAT101-pAAT103 were introduced into the JM109 strain to obtain recombinants JM109 / pAAT101-pAAT103. Plasmids pAAT201 to pAAT203 were introduced into the BL21 (DE3) strain to obtain recombinant BL21 (DE3) / pAAT201 to pAAT203.

Plant-derived AAT gene expression plasmid

[Example 4]
[Preparation of AAT expression plasmid in Rhodococcus bacteria]
A plasmid for expressing AAT in a microorganism belonging to the genus Rhodococcus was prepared. In order to prepare an AAT expression plasmid, gene DNA was amplified by PCR. PCR conditions are as follows.

Primer for MpAAT1 MMA-109 GGTCTAGAATGAAATCATTCTCAGTACTTCAG (SEQ ID NO: 21)
MMA-045 CGGTACCGCGGGATTCTCCAGAG (SEQ ID NO: 20)

SAAT primer MMA-113 GTGCTAGCATGAACAAAAATTGAGGTCAGTAT (SEQ ID NO: 22)
MMA-045 CGGTACCGCGGGATTCTCCAGAG (SEQ ID NO: 20)

Template for MpAAT1 Plasmid pAAT001 (see Example 3)
SAAT template plasmid pAAT002 (see Example 3)

Reaction solution composition Template 1μL
2 × PrimeStar Max Premix (manufactured by TAKARA) 25 μL
Fw Primer (20 μM) 1 μL
Rv Primer (20 μM) 1 μL
D. W. 22 μL
Total 50μL

Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 60 ° C for 10 seconds, 72 ° C for 60 seconds

  After completion of PCR, the PCR product was subjected to buffer replacement using Gel / PCR Purification Kit (manufactured by FAVORGEN), and the resulting fragment was replaced with restriction enzyme XbaI (in the case of MpAAT1) or NheI (in the case of SAAT), and Sse8387I. Processed. Moreover, pSJ201 produced in Example 1 was treated with XbaI and Sse8387I, ethanol precipitated, dissolved again with sterilized water, and subjected to Shrim Alkaline Phosphase (SAP) treatment. The PCR fragment and the large fragment derived from pSJ201 were purified using Gel / PCR Purification Kit (manufactured by FAVORGEN) after 0.7% agarose gel electrophoresis. Restriction enzyme treatment reaction conditions, SAP treatment conditions, and ligation reaction conditions are as follows.

Restriction enzyme treatment reaction composition PCR amplified fragment 20 μL
10 × M 5μL
0.1% BSA 5 μL
XbaI or NheI (manufactured by TAKARA) 2 μL
Sse8387I (manufactured by TAKARA) 2μL
D. W. 16μL
Total 50μL

SAP treatment reaction composition Vector fragment (pSJ201) 44 μL
10 × SAP Buffer 5 μL
SAP (manufactured by Promega) 1 μL
Total 50μL

Ligation reaction composition Vector fragment 4 μL
Target fragment 1μL
Ligation Mix (manufactured by TAKARA) 3μ L
Total 8μL

  Escherichia coli JM109 strain was transformed using the ligation reaction mixture mixed with the above composition. A plasmid was extracted from the obtained transformant and subjected to agarose electrophoresis after treatment with restriction enzymes XbaI and Sse8387I to confirm that a fragment of the desired size was inserted. In addition, the plasmid was confirmed to be the target plasmid by analyzing the nucleotide sequence of the connection region between the inserted fragment and the vector. The plasmids into which the MpAAT1 gene and the SAAT gene were introduced were named pAAT301 and pAAT302, respectively.

[Example 5]
[Preparation of Rhodococcus bacteria capable of producing isobutyric acid ester]
Plasmids pAAT301 and pAAT302 were transformed into the DMA008 strain obtained in Example 2, respectively. The resulting recombinants (DMA008 / pAAT301 and DMA008 / pAAT302) were cultured under the following conditions. One platinum ear inoculated into 2 mL LB Km50 liquid medium (LB medium containing kanamycin sulfate 50 mg / L) and cultured for 2 days under aerobic conditions at 30 ° C., rotary shaker (180 rpm) (pre-culture) ). 1 mL of the preculture solution was inoculated into 100 mLLB Km50 (100 mL / 500 mL Erlenmeyer flask), and cultured for 3 days at 30 ° C., a rotary shaker (230 rpm) and aerobic conditions (main culture).
After completion of the culture, 40 mL of the culture solution was transferred to a 50 mL tube and centrifuged (12000 rpm, 10 minutes), and the cells were collected.

[Example 6]
[Synthesis of butyl isobutyrate]
The DMA008 strain was transformed with the plasmids pAAT301 and pAAT302 obtained in Example 5, respectively. Isobutyric acid ester was produced by resting cell reaction using the obtained recombinants (DMA008 / pAAT301 and DMA008 / pAAT302). Further, 1 platinum ear was inoculated into 10 mLLB Km50 liquid medium (24φ test tube), and cultured for 3 days at 30 ° C., rotary shaker (350 rpm) and aerobic conditions (preculture). 1 mL of the preculture solution was inoculated into 100 mLLB Km50 (100 mL / 500 mL Erlenmeyer flask), and cultured for 3 days at 30 ° C., a rotary shaker (230 rpm) and aerobic conditions (main culture).
After the main culture, 40 mL of the main culture solution was transferred to a 50 mL conical tube and centrifuged (12000 rpm, 10 minutes) to obtain bacterial cells. The following reaction was performed using this microbial cell. 1 mL of the reaction solution was added to a 10 mL capacity glass sample bottle, and the reaction was performed at 30 ° C., a rotary shaker (180 rpm), under aerobic conditions for 20 hours.

Composition of reaction solution OD630 = 10 cells (final concentration)
4 g / L 2-oxoisovaleric acid (final concentration)
40 mM alcohol (final concentration)
10 mM phosphate buffer / pH 7.5 (final concentration)
10 mM fluoride 4- (2-aminoethyl) benzenesulfonyl hydrochloride As alcohol, n-butanol and isobutanol were used.

After the reaction, a head space of 150 μL was collected and analyzed under the GC conditions shown below.
Column: DB / WAX, 30m x 0.32mm
Column temperature: 50 ° C., 5 min → 5 ° C./min→100° C. (15 min in total)
Carrier gas: He
Inject: 200 ° C splitless (sampling time 1 min)
Detect: 250 ° C FID
Injection volume: 150 μL

  Table 2 shows the analysis results of the product after 20 hours.

Production of butyl isobutyrate by Rhodococcus spp.

[Example 7]
[Cloning of BCKAD gene from Pseudomonas aeruginosa PAO1]
<Preparation of genomic DNA>
Pseudomonas aeruginosa PAO1 strain (NBRC106052) grown on an LB agar medium was inoculated into 10 mL of LB liquid medium, and cultured with shaking at 37 ° C. for 15 hours. After completion of the culture, the cells were collected from 2 mL of the culture solution by centrifugation, and 50 μL of genomic DNA was obtained using Wizard Genomic DNA Purification Kit (Promega Corporation).

<Cloning into expression vectors>
Using the obtained genomic DNA as a template, a DNA fragment containing the entire gene operon encoding the BCKAD complex gene was prepared by PCR using the primers shown below. The obtained fragment was digested with restriction enzymes BspHI and Sse8387I, and inserted into vector pTrc99A (digested with restriction enzymes NcoI and Sse8387I) in the same manner as in Example 3 to obtain plasmid pWA108.

Oligonucleotide primer MAA-15: 5′-GGCCGTGTCATGAGTGATTACGAGCCG-3 ′ (SEQ ID NO: 23)
MAA-16: 5'- CGGCCCTGCAGGTTCGCGGGAATCAGAGTGC-3 '(SEQ ID NO: 24)

[Example 8]
[Preparation of BCKAD and AAT co-expression plasmid for E. coli]
Using the plasmids pAAT201, pAAT202 and pAAT203 prepared in Example 3 as templates, fragments containing MpAAT1, SAAT and VAAT genes were amplified by PCR.
The PCR primer was designed to connect to the Sse8387I site of the plasmid pWA108 by the In-Fusion method. The sequence is as follows, and the other PCR conditions are the same as in Example 4.

Fw primer MMA-042 TAGAGTCGACCTGCACCTCTAGAAATAATTTTGTTTTA (SEQ ID NO: 25)
Rv primer MMA-040 GCTTGCATGCCCTGCACAGCAGCCAACTCAGCCTTCCTTT (SEQ ID NO: 26)

On the other hand, plasmid pWA108 prepared in Example 7 was treated with restriction enzyme Sse8387I to obtain linear DNA.
These fragments were purified using agarose gel electrophoresis and Gel / PCR Purification Kit (manufactured by FAVORGEN), and both fragments were ligated using In-Fusion HD Cloning Kit in the same manner as in Example 2. The resulting plasmids were named pBAT001, pBAT002 and pBAT003.
Recombinants obtained by introducing these plasmids into E. coli strain JM109 were subjected to isobutyric acid ester production reaction.

[Example 9]
[Synthesis of isobutyric acid ester]
E. coli JM109 was transformed with the plasmids pBAT001, pBAT002, and pBAT003 obtained in Example 8, respectively. Using the obtained recombinants (JM109 / pBAT001, JM109 / pBAT002 and JM109 / pBAT003), a methacrylic ester was produced by a resting cell reaction. One platinum ear was inoculated into 2 mLLB Amp100 liquid medium (Waselman test tube), and cultured for 6 hours at 37 ° C. under a rotary shaker (180 rpm) under aerobic conditions (preculture). 1 mL of the preculture was inoculated into the same medium (medium 100 mL / 500 mL Erlenmeyer flask), and cultured for 20 hours at 37 ° C., rotary shaker (230 rpm), aerobic conditions (main culture).
After the main culture, 40 mL of the main culture solution was transferred to a 50 mL conical tube and centrifuged (12000 rpm, 10 minutes) to obtain bacterial cells. The following reaction was performed using this microbial cell. 1 mL of a reaction solution prepared to have the following composition was added to a 10 mL capacity glass sample bottle, and the reaction was performed at 30 ° C., a rotary shaker (180 rpm), and aerobic conditions for 20 hours.

Composition of reaction solution OD630 = 10 cells (final concentration)
4 g / L 2-oxoisovaleric acid (final concentration)
40 mM alcohol (final concentration)
10 mM phosphate buffer / pH 7.5 (final concentration)
Methanol, ethanol, n-butanol, and isobutanol were used as alcohols.

  After the reaction, 150 μL of headspace was collected and analyzed in the same manner as in Example 6. Table 3 shows the analysis results of the product after 20 hours.

Production of isobutyrate by recombinant A. coli expressing both ACD and AAT

[Comparative Example 1]
[Synthesis of isobutyric acid ester from isobutyryl-CoA and alcohol using yeast-derived AAT gene recombinant cell extract]
Yeast-derived AAT gene expression plasmids were prepared in the same manner as in Example 3 (Table 4), and E. coli was transformed using these plasmids to obtain AAT-expressing recombinants.

Yeast-derived AAT gene expression plasmid

The obtained E. coli recombinants JM109 / pAAT105 and JM109 / pAAT106 were inoculated into LB medium containing 1 mL of 100 μg / mL ampicillin, and precultured at 37 ° C. for 6 hours. 0.1 mL of the culture solution was taken, added to 100 mL of the same medium (100 μg / mL ampicillin), IPTG was added so that the final concentration was 1 mM, and cultured with shaking for 18 hours. Bacterial cells were collected from the obtained culture broth by centrifugation (5000 rpm, 10 minutes, 4 ° C.), washed with 10 mM phosphate-sodium buffer (pH 7.5), and then washed with OD6 (630 nm) in the same buffer. Suspended. JM109 / pTrc99A was used as a control strain. A cell extract was prepared from the obtained cell suspension. Using an ultrasonic crusher 250D (Branson), the cell suspension was crushed for 5 minutes while cooling with ice under conditions of Amplitude 17%, ON / OFF: 1 s / 1 s. The following reaction was performed using the obtained cell lysate.
A 10 mL volume septum containing 0.6 mL of a solution of isobutyryl CoA and alcohol (27 mM phosphate-sodium buffer (pH 7.5) solution) so that the final concentration of the reaction solution is 1 mM isobutyryl CoA and 40 mM n-butanol. The reaction was started by adding 0.4 mL of the cell extract to the attached sample bottle (for GC). The sample bottle with a septum was allowed to react by incubating at 30 ° C. for 3 hours.
The gas in the headspace of the sample bottle with a septum was analyzed in the same manner as in Example 6. The results are shown in Table 5. As a result, formation of butyl isobutyrate was not recognized. On the other hand, when acetyl CoA and n-butanol were used as substrates and reacted in the same manner, the formation of butyl acetate was observed.

Production of esters using yeast AAT gene recombinants

SEQ ID NO: 9: GB-138
SEQ ID NO: 10: GB-139
SEQ ID NO: 11: GB-140
SEQ ID NO: 12: GB-141
SEQ ID NO: 13: MMA-061
SEQ ID NO: 14: MMA-062
SEQ ID NO: 15: MMA-063
SEQ ID NO: 16: MMA-064
SEQ ID NO: 17: MMA-069
SEQ ID NO: 18: MMA-070
Sequence number 19: MMA-044
SEQ ID NO: 20: MMA-045
SEQ ID NO: 21: MMA-109
Sequence number 22: MMA-113
SEQ ID NO: 23: MAA-15
SEQ ID NO: 24: MAA-16
SEQ ID NO: 25: MMA-042
SEQ ID NO: 26: MMA-040

Claims (9)

  A microorganism capable of producing isobutyric acid ester. The microorganism according to claim 1, wherein the isobutyric acid ester is any of isobutyric acid methyl ester, isobutyric acid ethyl ester, or isobutyric acid butyl ester.   3. The microorganism according to claim 1, wherein an alcohol acyltransferase gene having an activity of synthesizing isobutyric acid ester from isobutyryl CoA and alcohol or phenol is introduced.   The microorganism according to claim 3, further comprising a gene encoding 2-oxoisovalerate dehydrogenase having an activity of synthesizing isobutyryl CoA from 2-oxoisovalerate.   The microorganism according to any one of claims 1 to 4, wherein the microorganism belongs to the genus Rhodococcus or the genus Escherichia.   The microorganism according to any one of claims 1 to 5, which has an ability to accumulate 1 ppm or more of isobutyric acid ester. A method for producing an isobutyric acid ester comprising a step of producing an isobutyric acid ester in the presence of an alcohol or a phenol by the action of the microorganism according to any one of claims 1 to 6.   A method for producing an isobutyric acid ester, comprising a step of producing an isobutyric acid ester from 2-oxoisovaleric acid in the presence of an alcohol or a phenol by the action of the microorganism according to any one of claims 1 to 6. The method for producing an isobutyric acid ester according to claim 7 or 8, wherein 1 ppm or more of the isobutyric acid ester is accumulated.