JP2014207898A - Vector for protein production in actinomycete - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a vector for protein production in actinomycete.SOLUTION: This invention relates to a plasmid vector for expression of protein in actinomycete, wherein the plasmid vector comprises a promoter, a cloning site for insertion of DNA fragment encoding the protein, a terminator, and sti- or mini sti- containing fragment.

Description

  The present invention relates to a protein production vector in actinomycetes.

  Bacteria belonging to the genus Streptomyces are widely used industrially as a group of actinomycetes that produce various secondary metabolites such as antibiotics, and are extremely important. Considering the importance of production of useful substances in Streptomyces bacteria, it is desired to develop a technology for mass expression of proteins in actinomycetes.

  In an expression system using Streptomyces bacteria, a plasmid vector derived from pIJ101, which is an endogenous wild-type plasmid of Streptomyces bacteria, is used (Non-patent Document 1). Such a plasmid vector can be constructed by excising a part of pIJ101, but the region called “sti” is deleted at the construction stage. Almost all currently used vectors for Streptomyces bacteria such as pIJ702 (Non-patent document 2) and pIJ350 (Non-patent document 3) lack the sti region (Non-patent documents 1 and 2). .

  “Sti” is the name of a gene that was named because it causes “strong incompatibility” and was reported to be located on an approximately 200 bp DNA segment that is not an essential replication region of pIJ101 ( Non-patent document 4). The restriction enzyme map of pIJ101 (Non-Patent Documents 1, 4 and 5) and the position of the sti region in pIJ101 (Non-Patent Documents 1 and 4) are known.

  It has been found that some copy numbers of pIJ101 and its derivatives vary between 40-300 (Non-Patent Document 4). Plasmids lacking the sti region had an average copy number between 50 and 100 below the above range (Non-Patent Document 4). pIJ2743, one of the plasmid vectors obtained by inserting the fragment containing the sti region into the pIJ101-derived plasmid in the correct orientation, has an insert of about 0.6 kb, and its copy number is about 1000. Yes, and 10 times more than its parent strain, pIJ452, which does not contain the sti region, and 3 times more than pIJ101, pIJ355, or pIJ649, which contains the sti region (their copy numbers are about 300) Reference 4).

  As described above, the number of copies of the plasmid containing sti in the actinomycetes host has been studied. The usefulness of such a plasmid as an expression vector for the actinomycetes host, particularly the expression and production amount of the protein, The relationship is not clear.

PRACTICAL STREPTOMYCES GENETICS (Streptomyces Manual), D.A.Hopwood et al., John Innes Center Ltd, Chapter 11. Plasmids and their use for gene cloning Murooka et al., Appl. Environ. Microbiol., 1986, 52, 1382-1385 Koller et al., J. Bacteriol., 1989, 171, 4953-4957. Deng et al., Mol. Gen. Genet., 1988, 214, 286-294 Kieser et al., Mol. Gen. Genet., 1982, 185, 223-238

  It is an object of the present invention to provide a method for increasing protein production in actinomycetes and a vector therefor.

  The present invention provides a plasmid vector for expressing a protein in actinomycetes, the plasmid vector comprising a promoter, a cloning site for inserting a DNA fragment encoding the protein, a terminator, and a sti-containing fragment.

  In one embodiment, the sti-containing fragment is a DNA fragment comprising a base sequence from positions 27 to 226 of SEQ ID NO: 1; at least 80% sequence identity with the base sequence from positions 27 to 226 of SEQ ID NO: 1 A DNA fragment comprising a nucleotide sequence having a property and capable of increasing the copy number of the vector; or a DNA comprising a nucleotide sequence complementary to the nucleotide sequence of positions 27 to 226 of SEQ ID NO: 1 and stringent conditions A DNA fragment that contains DNA that can hybridize underneath and that can increase the copy number of the vector.

  In one embodiment, the promoter is at least one promoter selected from the group consisting of a phospholipase D gene promoter, a metalloendopeptidase gene promoter, and a xylose isomerase gene promoter.

  In one embodiment, the plasmid vector further comprises a DNA fragment encoding the protein inserted into the cloning site.

  In one embodiment, the protein is phospholipase A2, sphingomyelinase or chitobiase.

  The present invention also provides a recombinant actinomycetes in which the plasmid vector further comprising a DNA fragment encoding the protein is incorporated. Here, the term “integrated” includes a state in which the plasmid vector is integrated with the chromosomal DNA of actinomycetes, a state in which the plasmid vector is contained in the free plasmid state, and a state in which both coexist. Meaning.

The present invention further provides a method of producing a protein in actinomycetes, the method comprising:
Transforming actinomycetes with the plasmid vector further comprising a DNA fragment encoding the protein,
A step of culturing the transformed actinomycetes in a medium, and a step of recovering the protein from the obtained culture.

  The present invention is also a recombinant actinomycetes into which the plasmid is introduced. The term “introduced” means that the plasmid vector is integrated into the chromosomal DNA of actinomycetes, contained in the cytoplasm as a free plasmid, and both coexist. .

  According to the present invention, a method for increasing protein production in actinomycetes and a vector therefor are provided.

It is a schematic diagram which shows the structure of pIJ702. It is a schematic diagram which shows the structure of (a) pIJ702PLD and (b) pPLDH. It is a schematic diagram which shows the structure of (a) pIJ702SSMP and (b) pSSMPH. It is a schematic diagram which shows the structure of (a) pIJ702XYL and (b) pXYLH. It is a schematic diagram which shows the structure of pPLDHmini. It is a figure which shows PLA2 activity of actinomycetes transformed with the plasmid holding sti and mini sti.

  The present invention provides a plasmid vector for expressing a protein in actinomycetes (hereinafter, also simply referred to as “plasmid vector of the present invention”). The vector of the present invention includes a promoter, a cloning site for inserting a DNA fragment encoding a protein, a terminator, and a sty-containing fragment. Hereinafter, each element constituting the vector will be described.

  The plasmid vector of the present invention contains a sti-containing fragment. The sti-containing fragment is contained in the vector in a specific direction with respect to the autonomously replicable region (described below). “Sti” was originally found as an approximately 200 bp DNA segment that is not an essential replication region of pIJ101, an endogenous wild-type plasmid of Streptomyces bacteria (Non-patent Documents 1 and 4). “Sti” consists of, for example, a region from positions 27 to 226 of the base sequence described in SEQ ID NO: 1. The sti-containing fragment may be any fragment containing this “sti” region, for example, a DNA fragment comprising the nucleotide sequence from positions 27 to 226 of SEQ ID NO: 1 or a mutant form thereof. The size of the DNA fragment is, for example, 160 bp to 1300 bp, preferably 180 bp to 1250 bp, more preferably 200 bp to 1230 bp, and still more preferably 200 bp to 500 bp. The region other than the “sti” region of the sti-containing fragment is preferably derived from the base sequence described in SEQ ID NO: 1. The “fragment containing the base sequence from position 27 to position 226 of SEQ ID NO: 1” includes a fragment containing the entire length of the base sequence of SEQ ID NO: 1 (positions 1 to 1223 of SEQ ID NO: 1).

  Variants are not limited as long as they can be introduced into the host to increase the copy number of the vector. The increase in the copy number of the vector due to the introduction of the host can be confirmed, for example, by examining the activity of the expressed protein that can be used as an indicator of the copy number, based on the procedure described in the following Examples. In one embodiment, such a mutant type has a nucleotide sequence of positions 27 to 226, 1 to 411, or 1 to 1223 of SEQ ID NO: 1 as long as the copy number of the vector can be increased. It may be a sequence in which one or more bases are deleted, substituted, added and / or inserted. For example, the sti-containing fragment has a base sequence having at least 80%, preferably at least 90%, more preferably at least 95% sequence identity with the base sequence from position 27 to position 226 of SEQ ID NO: 1, and It may be a DNA fragment containing DNA that can increase the copy number of the vector. In one embodiment, the sti-containing fragment has a base sequence having at least 80%, preferably at least 90%, more preferably at least 95% sequence identity with the base sequence from position 1 to position 1223 of SEQ ID NO: 1. And a DNA fragment containing DNA that can increase the copy number of the vector. Regarding "sequence identity", for example, databases relating to amino acid sequences of proteins such as SWISS-PROT, PIR, DAD, or databases relating to DNA sequences such as DDBJ, EMBL, or Gene-Bank, and deduced amino acid sequences based on DNA sequences By using a program such as BLAST or FASTA for a database or the like, for example, sequence search and sequence identity determination can be performed through the Internet. The conditions at that time, for example, setting of an expected value, Wordsize, Gap and the like can be performed by a general method in the technical field. In addition, the sti-containing fragment includes DNA that can hybridize under stringent conditions with DNA consisting of a base sequence complementary to the base sequence from position 27 to position 226 or from position 1 to position 411 of SEQ ID NO: 1, It can also be a DNA fragment that can increase the copy number of the vector. In one embodiment, the sti-containing fragment comprises DNA that can hybridize under stringent conditions with DNA consisting of a base sequence complementary to the base sequence from position 1 to position 1223 of SEQ ID NO: 1, and a vector DNA fragments that can increase the copy number of. “DNA capable of hybridizing under stringent conditions” refers to any sequence of at least 20, preferably at least 30, for example, 40, 60 or 100, in the nucleotide sequence for hybridization. A probe is designed by selecting one or more, and refers to a polynucleotide that hybridizes under the conditions described in the manual using, for example, ECL direct nucleic acid labeling and detection system (manufactured by Amersham Biosciences). “Stringent conditions” means washing conditions after hybridization, for example, salt (sodium) concentration is 150 to 900 mM, temperature is 55 to 75 ° C., preferably salt concentration is 600 to 900 mM. The temperature is 60 to 70 ° C., but is not particularly limited to these conditions. Factors affecting the stringency of hybridization include a plurality of factors such as temperature and salt concentration, and those skilled in the art can realize optimum stringency by appropriately selecting these factors. Mutation can be introduced by a known method such as Kunkel method or Gappedduplex method using a site-directed mutagenesis kit such as TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km Etc. (manufactured by Takara Bio Inc.), Quik Change ™ Site-Directed Mutagenesis Kit (manufactured by Stratagene), Gene Tailor ™ Site-Directed Mutagenesis System (manufactured by Invitrogen) and the like.

  The plasmid vector of the present invention may contain a region capable of autonomous replication in an actinomycete host. The region capable of autonomous replication in an actinomycete host is not particularly limited as long as it contains the minimum region in which the plasmid can replicate when a plasmid containing the region is introduced into the host. Examples of the autonomously replicable region include, for example, autonomous replication region (origin of replication (“ori”)) derived from pIJ101 which is an endogenous wild type plasmid of Streptomyces bacteria or a plasmid vector derived from pIJ101, and replication protein a region including “rep”).

  The vector of the present invention enables replication of the vector in the cells of actinomycetes, and can suppress the vector from dropping due to the growth of actinomycetes. Moreover, the copy number of the vector in actinomycetes can be increased.

  The plasmid vector of the present invention comprises a promoter, a cloning site for inserting a DNA fragment encoding the protein, and a terminator. The cloning site is provided downstream of the promoter. The terminator is linked downstream of the cloning site. The downstream side is the 3 'side of the transcribed polynucleotide chain, and the upstream side is the 5' side of the transcribed polynucleotide chain.

  The promoter only needs to have promoter activity, and “promoter activity” refers to an activity that causes transcription factors to bind to the promoter region and cause transcription. The promoter can be excised from bacterial cells, phages and the like that possess the desired promoter region using restriction enzymes. A DNA fragment of the promoter region can be obtained by amplifying a desired promoter region by PCR using a primer provided with a restriction enzyme recognition site as necessary. In addition, a desired promoter may be chemically synthesized based on the already known base sequence information of the promoter region.

As the promoter, a promoter derived from any gene may be used as long as it can exhibit activity in the host bacterium. For example, the promoter of the phospholipase D (PLD) gene derived from Streptomyces cinnamoneus, the promoter of the metalloendopeptidase (SSMP) gene derived from Streptomyces septatus, the Streptomyces coelicolor (Streptomyces coelicolor) ) -Derived xylose isomerase (XylA) gene promoter and the like. Derived from Streptomyces cinnamoneus phospholipase D (PLD) gene promoter, Streptomyces septatus derived metalloendopeptidase (SSMP) gene promoter and Streptomyces coelicolor derived from Streptomyces coelicolor SEQ ID NO: 2 (positions 1 to 1366), SEQ ID NO: 3 (positions 1 to 412) and SEQ ID NO: 21 (positions 1 to 155) are shown respectively. . It is also possible to use a promoter mutant (mutant promoter) as long as it has promoter activity. Such mutant promoters include any of the following (a) and (b):
(A) One or several (for example, about 1 to 10, preferably about 1 to 5, more preferably 1) of nucleotide sequences of a desired promoter (for example, SEQ ID NOs: 2, 3 and 21) A mutant promoter DNA having 4 to 4 (particularly preferably 1 to 3) bases deleted, substituted, added and / or inserted and having promoter activity; or (b) desired It can hybridize under stringent conditions with a DNA comprising a nucleotide sequence complementary to the nucleotide sequence of the promoter (eg, SEQ ID NOs: 2 and 3) or the nucleotide sequence of the DNA of (a) above, and has promoter activity. DNA. “Stringent conditions” are as described above.

  The plasmid vector of the present invention includes a cloning site for inserting a DNA fragment encoding a protein. The cloning site is provided downstream of the promoter. This cloning site is a site that is uniquely cleaved by a specific type of restriction enzyme (or combination thereof). A DNA fragment encoding a protein can be inserted into a site cleaved with the specific type of restriction enzyme (or a combination thereof).

  The cloning site may be a multiple cloning site (MCS). MCS is a DNA fragment having a plurality of types of restriction enzyme sites, and is used for linking a target gene for expression to MCS and inserting it into a vector. For example, MCS has restriction enzyme sites (at least one) such as NdeI, EcoRI, XbaI, HindIII, BglII, BamHI.

  The terminator is only required to have terminator activity, and “terminator activity” refers to the activity of terminating transcription in the terminator region. The terminator only needs to have terminator activity, and can be excised from bacterial cells, phages, and the like possessing a desired terminator region using a restriction enzyme. A DNA fragment of the terminator region can be obtained by amplifying a desired terminator region by PCR using a primer provided with a restriction enzyme recognition site as necessary. In addition, a desired terminator may be chemically synthesized based on the already known base sequence information of the terminator region.

  As the terminator, a terminator derived from any gene may be used as long as it can exhibit activity in the host fungus. For example, a TH-3 coll terminator, a phospholipase D (PLD) gene terminator derived from Streptomyces cinnamoneus, an fd phage terminator (fd-ter), a T4 terminator (T4-ter), or the like can be used. Preferably, the PLD terminator can be used. This base sequence is shown in SEQ ID NO: 4 (positions 1 to 200).

  In the present invention, a DNA fragment (structural gene) encoding a protein can be incorporated into the cloning site of the vector and used. A DNA fragment (structural gene) encoding a protein to be expressed is inserted into a cloning site provided downstream of the promoter in the plasmid vector of the present invention.

  In the present invention, the protein to be expressed is not particularly limited as long as it can be expressed in a host bacterium. The protein may be a desired enzyme, structural protein, regulatory factor, etc., and may be a natural protein, a mutant protein, an artificially created protein, or the like. The origin of the gene encoding the protein can be arbitrarily selected from, for example, animal-derived genes, plant-derived genes, microorganism-derived genes, virus-derived genes, and chemically synthesized genes, and is not limited. Cloning of a gene from a desired structural gene-bearing organism can be performed by any known technique. If necessary, a DNA fragment of a structural gene can be obtained by amplification using PCR with a primer provided with a restriction enzyme recognition site. Examples thereof include phospholipase A2, sphingomyelinase, chitobiase, amylase, cellulase, esterase, and protease. Hereinafter, phospholipase A2 (PLA2), sphingomyelinase (SM), and chitobiase (CTB) will be described.

  The PLA2 structural gene can be obtained from any organism having PLA2 activity. Examples of the organism having the PLA2 structural gene include Streptomyces avermitilis, Streptomyces hygroscopicus, Verrucosispora maris, Micromonospora aurantiaca, Acroantia Examples include Planes missouriensis and Amycolatopsis mediterranei. The SM structural gene can be obtained from any organism having SM activity. Examples of organisms having the SM structural gene include Streptomyces cinnamoneus, Streptomyces roseosporus, Kitasatospora setae, Salinispora tropica, Bacillus cereus (Bacillus cereus) Examples thereof include Staphylococcus epidermidis. The CTB structural gene can be obtained from any organism having CTB activity. Examples of organisms having a CTB structural gene include Streptomyces cinnamoneus, Streptomyces evamethyls, Streptomyces coelicolor, Streptomyces hygroscopicus and the like.

The base sequence of the structural gene of Streptomyces evamethylus-derived PLA2 is shown in SEQ ID NO: 5, and the amino acid sequence thereof is shown in SEQ ID NO: 6. The base sequence of the structural gene of SM derived from Streptomyces cinnamoneus is shown in SEQ ID NO: 7, and its amino acid sequence is shown in SEQ ID NO: 8. The base sequence of the structural gene of Streptomyces coelicolor-derived CTB is shown in SEQ ID NO: 24, and the amino acid sequence thereof is shown in SEQ ID NO: 25. It is also possible to use mutants (mutant genes) of these enzyme genes. Such mutant genes include any of the following (a) to (d):
(A) one or several amino acids (for example, about 1 to 10, preferably about 1 to 5 amino acids) in the amino acid sequences of the above enzymes (SEQ ID NOs: 6, 8 and 25 for PLA2, SM and CTB, respectively) A gene encoding a protein consisting of an amino acid sequence in which is deleted, substituted, added and / or inserted, and having the enzyme activity;
(B) at least 70%, more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95 with the amino acid sequence of the enzyme (SEQ ID NO: 6, 8 and 25 for PLA2, SM and CTB, respectively) %, Even more preferably, a gene consisting of an amino acid sequence having at least 99% sequence identity and encoding a protein having the enzyme activity;
(C) One or several (for example, about 1 to 10 and preferably about 1 to 5) of the base sequences of the above enzyme genes (SEQ ID NOs: 5, 7 and 24 for PLA2, SM and CTB, respectively) A gene that encodes a protein having the enzyme activity; or (d) a base sequence of the enzyme gene (for PLA2, SM, and CTB, respectively). It can hybridize under stringent conditions with DNA consisting of a base sequence complementary to the base sequence of SEQ ID NO: 5, 7, and 24) or any one of the above genes (a) to (c), and A gene encoding a protein having enzyme activity. “Sequence identity” and “stringent conditions” are as described above.

  The enzyme activities of PLA2, SM and CTB can be measured and confirmed according to the procedures described in Reference Examples 3, 4 and Example 15 below respectively, but the means for confirming the activity is not limited thereto.

  The vector of the present invention may previously encode a secretory signal sequence in the vector so that the protein encoded by the inserted gene is secreted. For example, if a secreted protein is expressed using the vector of the present invention, this protein can be secreted into the culture medium. Even a protein that is not secreted naturally can be secreted outside the cell by expressing it as a fusion protein to which a secretion signal is added. The DNA fragment encoding the secretory signal sequence can usually be “functionally” linked upstream of the DNA fragment encoding the protein. “Functionally” means that a DNA fragment is expressed or functioned, and means a state in which each gene can be expressed when introduced into a host.

  The vector of the present invention preferably contains an appropriate drug resistance gene or a selection marker gene such as a metabolic enzyme so that a host carrying the vector can be selected. Examples of the selection marker gene include a thiostrepton resistance gene, an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, and the like, all of which are well known to those skilled in the art. When the drug marker is an antibiotic resistance gene, culturing actinomycetes in a medium containing the corresponding antibiotic can suppress the vector from dropping from the cells of actinomycetes. Preferably, a thiostrepton resistance gene is used. Since general-purpose plasmid vectors pIJ350 and pIJ702 derived from pIJ101 have a thiostrepton resistance gene, they can be suitably used as backbone plasmids. The vector of the present invention may contain other elements (eg, transcription activation sequence, expression regulatory sequence (operator, enhancer, SD sequence, etc.) as necessary.

  As the backbone of the plasmid vector, a plasmid usually used for actinomycete hosts can be used. For example, a general-purpose plasmid vector derived from pIJ101 and a known plasmid vector suitable for other actinomycetes can be used. Examples include pIJ350, pIJ702, and pIJ487. Since pIJ350 and pIJ702 have a thiostrepton resistance gene and an autonomous replication region derived from pIJ101 (a region containing an origin of replication (“ori”) and a replication protein “rep”), they can be suitably used as backbone plasmids.

  Examples of the vector of the present invention when pIJ702 (FIG. 1) is used as a backbone plasmid are shown in FIG. 2 (b), FIG. 3 (b) and FIG. The regions in FIG. 1, FIG. 2 (b), FIG. 3 (b) and FIG. 4 are as follows: “sti”, sti-containing fragment; “rep pIJ101”, autonomous replication region derived from pIJ101 (replication) “PLDp”, the promoter of the PLD gene derived from Streptomyces cinnamoneus; “SSMPp”, the promoter of the SSMP gene derived from Streptomyces septatas; “PLDter” ”, Terminator of PLD gene from Streptomyces cinnamoneus;“ tsr ”, thiostrepton resistance gene;“ melC1 ”and“ melC2 ”, Styrotomyase gene from Streptomyces antibioticus;“ XylAp ”, xylose・ Isomera Promoter of zero gene. As seen in FIG. 2 (b), FIG. 3 (b) and FIG. 4 (b), the sti-containing fragment can be placed between the “promoter and terminator” and the autonomously replicating region derived from pIJ101. The cloning site for inserting the DNA fragment encoding the protein is, for example, the cleavage sites of restriction enzymes Aor51HI and EcoT22I between “PLDp” and “PLDter” in the vector of FIG. 2B, and FIG. In the vector of b), for example, the cleavage sites of restriction enzymes StuI and EcoT22I between “SSMPp” and “PLDter”, in the vector of FIG. 4B, for example, between “XylAp” and “PLDter” It is provided at the cleavage sites of restriction enzymes Aor51HI and EcoT22I.

  Ligation of each element constituting the vector can be performed by techniques that can be commonly used by those skilled in the art. The binding can be performed using an appropriate restriction enzyme, linker, DNA ligase and the like.

  The host used in the present invention is actinomycetes. In the present specification, actinomycetes refer to bacteria belonging to the order Actinomycetales. Actinomycetes are a taxonomic group belonging to Gram-positive bacteria and mainly inhabit soil. Although it is a prokaryotic organism, many actinomycetes show filamentous growth with branching and take various forms. In addition, there are species that generally form spores, including sporangia and motile spores. In addition, various antibiotics and other biologically important compounds have been discovered from actinomycetes.

  In the order of Actinomycetes, Frankiaceae, Micromonosporaceae, Propionibacteriaceae, Psuodonocardiaceae, Streptomyceae, Streptosporangiaceae (Streptosporanguaceae), Thermomonosporaceae, Corynebacteriaceae, Mycobacteriuaceae, and Nocaudiaceae. Preferably, it is a bacterium belonging to the family Streptomyces, more preferably belonging to the genus Streptomyces. Examples of the bacteria belonging to the genus Streptomyces include, for example, Streptomyces septus, Streptomyces lividans, Streptomyces griseus, Streptomyces lavendulae ), Streptomyces virginia, and Streptomyces coelicolor. In the present invention, Streptomyces lividans is particularly preferably used as the host cell.

  Such actinomycetes belonging to the genus Streptomyces and other actinomycetes are described in various catalogs such as the IFO catalog, ATCC catalog, JCM catalog, etc. It can be easily obtained by a vendor.

  The host actinomycetes can also be treated to introduce mutations. Examples of such treatment include the production of a mutant strain using N-methyl-N′-nitro-N-nitrosoguanidine (NTG). The production of an NTG mutant strain is, for example, Mutation research / fundamental and molecular mechanisms of mutagenesis. (1970) vol.9, 167-182.

  Introduction (transformation) of an expression vector into a host can be performed by a known method. In addition, as a method for transformation of actinomycetes host, protoplast / PEG method can be mentioned, but is not limited thereto. Confirmation that the vector DNA has been introduced into the host can be performed using a selectable marker gene (for example, a thiostrepton resistance gene).

  In the present invention, a target protein as an expression product can be obtained by culturing a transformant in which a target gene encoding the protein is introduced into a host and collecting it from the culture. “Culture” means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method of culturing the transformant can be carried out according to a usual method used for culturing a host.

  The medium for culturing the transformant of the present invention contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the host fungus, and any natural medium can be used as long as the transformant can be cultured efficiently. Either a medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, galactose, fructose, xylose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, and other nitrogen-containing compounds. In addition, peptone, meat extract, corn steep liquor, various amino acids, and the like may be used. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate. Moreover, you may add antifoamers, such as vegetable oil, surfactant, and silicone, as needed.

  The culture conditions may be appropriately selected depending on the type of culture medium, the culture method, and the like, and are not particularly limited as long as the host bacteria can grow and produce the target protein. Usually, it is carried out at 10 ° C. to 40 ° C., preferably at 28 ° C. for 12 to 120 hours under aerobic conditions such as shaking culture or aeration stirring culture in a liquid medium. The pH is adjusted to 4 to 10, preferably 6 to 8. The pH can be adjusted using an inorganic or organic acid, an alkaline solution, or the like.

  When using a promoter that induces gene expression, depending on the nature of the promoter used and the protein to be expressed, an inducer (eg, xylose) is added from the beginning of the culture, or after a certain amount of growth, the inducer To induce expression, or a method of inducing gene expression by collecting and transplanting to a medium containing an inducer can be selected. In the case of expressing a protein having toxicity, conditions for inducing after culturing without an inducer are preferably used.

  If the protein accumulates in the host cell, the transformed cells are collected by centrifugation after completion of the culture, and the resulting cell is disrupted by sonication or the like, and then the cell-free extract is obtained by centrifugation or the like. obtain. Using this as a starting material, it can be purified by a general protein purification method such as salting-out, various types of chromatography such as ion exchange chromatography, gel filtration chromatography, hydrophobic chromatography, and affinity chromatography. When the expressed protein is secreted extracellularly, it can be similarly purified from the culture supernatant.

  By transforming an actinomycete host using the plasmid vector of the present invention, the copy number of a gene encoding the target protein introduced into the actinomycete host is increased, and the expression and production of the protein are increased. Can be made. The plasmid vector of the present invention can be stably maintained in the host actinomycetes.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited by these Examples.

(Example 1 and Comparative Example 1)
A Streptomyces cinnamoneus-derived phospholipase D (PLD) gene promoter fragment (positions 1 to 1366 of SEQ ID NO: 2) and terminator fragment (positions 1 to 200 of SEQ ID NO: 4) were used as templates from Streptomyces cinnamoneus Obtained by PCR using the extracted primer with a primer pair of forward primer (SEQ ID NO: 9) and reverse primer (SEQ ID NO: 10), and a primer pair of forward primer (SEQ ID NO: 11) and reverse primer (SEQ ID NO: 12), respectively. did. The PCR reaction conditions for obtaining the PLD promoter fragment are as follows: 1 cycle of (98 ° C. for 2 minutes) followed by 30 cycles of (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 90 seconds) went. PCR reaction conditions for obtaining the PLD terminator fragment are as follows: (2 minutes at 98 ° C.) 1 cycle, then 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 30 seconds) went. The PLD promoter fragment was treated with PstI and EcoT22I, and the PLD terminator fragment was treated with EcoT22I and KpnI. pIJ702 (FIG. 1) was cleaved with PstI and KpnI, and the PstI- and EcoT22I-treated PLD promoter fragment and EcoT22I- and KpnI-treated PLD terminator fragment were ligated with DNA ligase to the plasmid after this cleavage, and pIJ702PLD (plasmid without sty) : Comparative example 1 and FIG. 2 (a)) were completed.

  A sti-containing fragment (positions 1 to 1223 of SEQ ID NO: 1) was obtained by PCR using pIJ101 as a template and a primer pair of a forward primer (SEQ ID NO: 13) and a reverse primer (SEQ ID NO: 14). The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 60 seconds). The obtained sti-containing fragment was treated with KpnI, pIJ702PLD was treated with KpnI, and then treated with alkaline phosphatase. The KpnI-treated sti-containing fragment was ligated with DNA ligase, and pPLDH (sti-containing plasmid: Example 1, FIG. 2 (b)) was completed.

(Example 2 and Comparative Example 2)
Using a DNA extracted from Streptomyces septatas as a template, a promoter fragment of the Streptomyces septatas-derived metalloendoprotease (SSMP) gene (SEQ ID NO: 3) as a template, forward primer (SEQ ID NO: 15 ) And a reverse primer (SEQ ID NO: 16) primer pair. The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 30 seconds). This SSMP promoter fragment, the above PLD terminator fragment, and pIJ702 were ligated in the same manner as in Example 1 to complete pIJ702SSMP (plasmid without sti: comparative example 2, FIG. 3 (a)).

  The sti-containing fragment and pIJ702SSMP were ligated in the same manner as in Example 1 to complete pSSMPH (sti-containing plasmid: Example 2, FIG. 3 (b)).

(Example 3 and Comparative Example 3: Construction of PLA2 expression vector using the plasmid vector for actinomycetes of Example 1 or Comparative Example 1)
Streptomyces evamethyls-derived PLA2 gene (base sequence is shown in SEQ ID NO: 5 and its amino acid sequence is shown in SEQ ID NO: 6) is used as a template and a forward primer (SEQ ID NO: 17) using DNA extracted from Streptomyces evamethyls. ) And a reverse primer (SEQ ID NO: 18) primer pair. The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 30 seconds). The obtained PLA2 gene was treated with EcoT22I, pPLDH of Example 1 was treated with Aor51HI and EcoT22I, and these were ligated with DNA ligase to obtain pPLDH-PLA2 (Example 3).

  On the other hand, PLA2 expression control plasmid vector pIJ702PLD-PLA2 (Comparative Example 3) was prepared in the same manner as above except that pPLDH in Example 1 was replaced with pIJ702PLD in Comparative Example 1.

(Example 4 and Comparative Example 4: Construction of a PLA2 expression vector using the plasmid vector for actinomycetes of Example 2 or Comparative Example 2)
The PLA2 gene was treated with EcoT22I, pSSMPH was treated with StuI and EcoT22I, and these were ligated with DNA ligase to obtain pSSMPH-PLA2 (Example 4).

  On the other hand, PLA2 expression control plasmid vector pIJ702SSMP-PLA2 (Comparative Example 4) was prepared in the same manner as above except that pSSMPH of Example 2 was replaced with pIJ702SSMP of Comparative Example 2.

(Example 5 and Comparative Example 5: Construction of a sphingomyelinase expression vector using the plasmid vector 1 for actinomycetes of Example 1 or Comparative Example 1)
Streptomyces cinnamoneus-derived sphingomyelinase gene (base sequence is shown in SEQ ID NO: 7 and its amino acid sequence is shown in SEQ ID NO: 8) is used as a template and a forward primer (sequence) No. 19) and obtained by PCR using a primer pair of reverse primer (SEQ ID NO: 20). The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 60 seconds). The obtained sphingomyelinase gene was treated with EcoT22I, pPLDH was treated with Aor51HI and EcoT22I, and these were ligated with DNA ligase to obtain pPLDH-SM (Example 5).

  On the other hand, a sphingomyelinase expression control plasmid vector pIJ702PLD-SM (Comparative Example 5) was prepared in the same manner as above except that pPLDH of Example 1 was replaced with pIJ702PLD of Comparative Example 1.

(Reference Example 1)
The procedure for preparing transformed actinomycetes using an enzyme expression vector based on the plasmid vector for actinomycetes of Example 1 or Comparative Example 1 and the composition of each medium used for this transformation are shown below:
TSB medium: 3% tryptic soy broth (manufactured by Becton Dickinson)
Expression medium: glucose 2%, K ₂ HPO ₄ 0.8%, polypeptone (manufactured by Nippon Pharmaceutical) 0.5%, yeast extract (manufactured by Difco) 0.5%, pH 7.0.

The procedure for preparing transformed actinomycetes until the activity is measured is as follows:
Streptomyces lividans 1326 strain (National Institute of Technology and Evaluation, Biotechnology Headquarters, Biogenetic Resource Division (NBRC): NBRC No. 15675) was transformed with each plasmid. Transformation of actinomycetes is the method described in “Genetic Manupulation of Streptomyces” (Hopwood, DA et al., 1985, Genetic Manupulation of Streptomyces: a Laboratory Manual, the John Innes Foundation, Norwich) on genetic engineering techniques for actinomycetes. Went according to. Colonies obtained with TSB plates (containing thiostrepton 50 μg / mL) were transplanted into 6 mL of TSB medium, cultured in a test tube (72 hours at 28 ° C.), and 0 mL of the test tube culture solution was added to 50 mL of expression medium. 4% inoculated and cultured in baffle flask (28 ° C. for 48 hours). Thereafter, 1 mL of the culture solution is collected, and the supernatant is collected by centrifugation (14,000 rpm, 10 minutes, 4 ° C.), and this supernatant is subjected to activity measurement.

(Reference Example 2)
The procedure for preparing transformed actinomycetes using an enzyme expression vector based on the plasmid vector for actinomycetes of Example 2 or Comparative Example 2 is shown below. The composition of each medium used for this transformation is the same as in Reference Example 1.

The procedure for preparing transformed actinomycetes until the activity is measured is as follows:
Streptomyces lividans 1326 strain was transformed with each plasmid in the same manner as in Reference Example 1, and colonies obtained with TSB plates (containing 50 μg / mL thiostrepton) were transplanted into 6 mL TSB medium. Then, the tube was cultured in a test tube (at 28 ° C. for 72 hours), and 3% of the test tube culture solution was inoculated into 50 mL of the expression medium, followed by baffle flask culture (at 28 ° C. for 120 hours). 1 mL of the culture solution is collected, and the supernatant is collected by centrifugation (14,000 rpm, 10 minutes, 4 ° C.), and this supernatant is subjected to activity measurement.

(Reference Example 3: Phospholipase A2 (PLA2) activity measurement)
1.0 g of lecithin is accurately weighed and gradually added to and dissolved in 50 mL of a 4% polyoxyethylene octylphenyl ether (Triton X-100) solution to obtain a substrate solution. Place exactly 0.5 mL of the substrate solution, 0.25 mL of 0.2 mol / L acetate buffer (pH 4.0) and 0.05 mL of 0.1 mol / L calcium chloride solution into a test tube, and add about 37 ± 0.5 ° C. Preheat for 5 minutes. Add exactly 0.1 mL of 1 mol / L hydrochloric acid and shake well, add 0.1 mL of sample solution accurately and mix well, then accurately measure 0.03 mL of this solution into another test tube, and add 3 mL of color reagent. Add exactly, mix well, cover, and leave at 37 ± 0.1 ° C. for 10 minutes. With respect to this solution, the absorbance at 660 nm was measured using water as a control. The unit of the enzyme activity was defined as the amount of enzyme that liberates 1 μmol of fatty acid per minute when tested under the operating conditions.

(Reference Example 4: Sphingomyelinase (SM) activity measurement)
0.5 mL of 10 mM p-nitrophenyl phosphorylcholine (manufactured by Sigma) consisting of 50 mM glycine-sodium hydroxide buffer (pH 9.0), 2 mM magnesium chloride, 0.2% bovine serum albumin and 0.2% Triton X-100 0.4 mL of the solution was added and incubated at 35 ° C. for 5 minutes. Next, 0.1 mL of the enzyme solution was added, incubated at 35 ° C. for 30 minutes, and then the enzyme was inactivated by adding 0.1 mL of 5% trichloroacetic acid. Furthermore, 1 mL of 0.08N sodium hydroxide was added to develop liberated p-nitrophenol, and the absorbance at a wavelength of 400 nm was measured. For sphingomyelinase, the amount of enzyme that produces 1 nmol of p-nitrophenol per hour under the above conditions was defined as 1 unit.

(Example 6 and Comparative Example 6)
Using pPLDH-PLA2 of Example 3 or pIJ702PLD-PLA2 of Comparative Example 3 and transforming Streptomyces lividans according to the procedure described in Reference Example 1, a pPLDH-PLA2 transformed strain (Example 6) or A pIJ702PLD-PLA2 transformant (Comparative Example 6) was produced, and PLA2 activity was measured for each transformant according to the procedure described in Reference Example 3.

  The average activity of the pPLDH-PLA2 transformed strain (Example 6) and pIJ702PLD-PLA2 transformed strain (Comparative Example 6) is 3212 units / mL and 2190 units / mL (n = 4), respectively, and pPLDH-PLA2 transformation The activity ratio of the strain to the pIJ702PLD-PLA2 strain was 1.5.

(Example 7 and Comparative Example 7)
Using pSSMPH-PLA2 of Example 4 or pIJ702SSMP-PLA2 of Comparative Example 4 and transforming Streptomyces lividans according to the procedure described in Reference Example 2, pSSMPH-PLA2 transformed strain (Example 7) or A pIJ702SSMP-PLA2 transformant (Comparative Example 7) was produced, and PLA2 activity was measured for each transformant according to the procedure described in Reference Example 3.

  The average activity of the pSSMPH-PLA2 transformant (Example 7) and pIJ702SSMP-PLA2 transformant (Comparative Example 7) is 5167 units / mL and 4352 units / mL (n = 6), respectively, and pSSMPH-PLA2 transformation The activity ratio of the strain to the pIJ702SSMP-PLA2 transformant was 1.2.

(Example 8 and Comparative Example 8)
Using pPLDH-SM of Example 5 or pIJ702PLD-SM of Comparative Example 5 and transforming Streptomyces lividans according to the procedure described in Reference Example 1, a pPLDH-SM transformed strain (Example 8) or A pIJ702PLD-SM transformant (Comparative Example 8) was produced, and SM activity was measured for each transformant according to the procedure described in Reference Example 4.

  The average activities of the pPLDH-SM transformed strain (Example 8) and the pIJ702PLD-SM transformed strain (Comparative Example 8) are 3203 units / mL and 2462 units / mL (n = 8), respectively, and pPLDH-SM transformation The activity ratio of the strain to the pIJ702PLD-SM transformant was 1.2.

Example 9
When the DNA amount of the plasmid expressed about the pPLDH-PLA2 transformed strain of Example 6 and the pIJ702PLD-PLA2 transformed strain of Comparative Example 6 was measured using a NanoDrop 1000 spectrophotometer, it was 154.0 ng / μL and 104, respectively. 0.9 ng / μL (average: n = 4). Since the plasmid DNA size ratio between pPLDH-PLA2 and pIJ702PLD-PLA2 is 1.16: 1, the number of copies was calculated based on the DNA size ratio and the amount of DNA, and pPLDH-PLA2 transformation was performed. The copy number ratio of the strain to the pIJ702PLD-PLA2 transformant was 1.27.

(Example 10)
PPLDH-PLA2 of Example 3 or pIJ702PLD-PLA2 of Comparative Example 3 is produced according to the procedure described in Reference Example 1 to produce pPLDH-PLA2 transformed actinomycetes or pIJ702PLD-PLA2 transformed actinomycetes, including each transformed actinomycetes 250 μL of 50% glycerol was added to 1 mL of the culture solution of baffle flask culture, and two glycerol stocks were stored at −80 ° C.

  0.2 mL of a glycerol stock of the test strain (pPLDH-PLA2 transformed strain or pIJ702PLD-PLA2) is inoculated into the expression medium (500 mL rectifying flask) of Reference Example 1 and shake culture at 28 ° C. for 72 hours. Then, PLA2 activity of the culture broth was measured according to the procedure described in Reference Example 3 (first passage).

  Subsequently, 0.15 mL of the culture solution after 72 hours of culture was inoculated into the expression medium (500 mL baffle flask) of Reference Example 1 and cultured at 28 ° C. for 24 hours with shaking, followed by PLA2 of the culture solution. Activity was measured as above (passage 2).

  Further, 1.5 mL of the culture solution after the above 24-hour culture was inoculated into 50 mL of the expression medium (500 mL baffle flask) in Reference Example 1, and cultured with shaking at 28 ° C. for 48 hours. Activity was measured as above (3rd passage). The results are shown in Table 1 below.

  As can be seen from Table 1, in both cases of the plasmid of Example 3 and the plasmid of Comparative Example 3, PLA2 activity did not decrease over 3 passages. The PLA2 activity ratio of the third generation strain of pPLDH-PLA2 transformed actinomycete strain in this example to the third generation strain of pIJ702PLD-PLA2 transformed actinomycete strain was 1.5, as was the PLA2 activity ratio of Comparative Example 6 in Example 6. Met. Therefore, it was confirmed that pPLDH-PLA2 of Example 3 was stably held by the host actinomycetes.

(Example 11)
For the Streptomyces lividans strain 1326, N-methyl-N′-nitro-N-nitrosoguanidine (in accordance with the procedure described in Mutation research / fundamental and molecular mechanisms of mutagenesis (1970) vol. 9, 167-182) NTG) mutant strain (“NTG mutant strain”) was created. Using this NTG mutant strain as a host, pPLDH-PLA2 of Example 3 or pIJ702PLD-PLA2 of Comparative Example 3 was transformed according to the procedure described in Reference Example 1, and pPLDH-PLA2 transformed NTG mutant or pIJ702PLD -PLA2 transformed NTG mutants were produced, and PLA2 activity was measured for each transformant according to the procedure described in Reference Example 3. As a result, about 2 times higher PLA2 activity was observed in the pPLDH-PLA2 transformed NTG mutant than in the pIJ702PLD-PLA2 transformed NTG mutant.

(Construction of Example 12 pXYLH)
DNA containing the promoter of the xylose isomerase (XylA) gene was obtained by PCR using the total DNA of Streptomyces coelicolor and using the forward primer (SEQ ID NO: 22) and reverse primer (SEQ ID NO: 23). The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 30 seconds). The amplified DNA fragment containing the XylA promoter was treated with PstI and EcoT22I, and the PLD terminator fragment was treated with EcoT22I and KpnI. pIJ702 (FIG. 1) was digested with PstI and KpnI, and the PstI- and EcoT22I-treated XylA promoter fragment and EcoT22I- and KpnI-treated PLD terminator fragment were ligated with DNA ligase to the plasmid after this digestion, and pIJ702XYL (FIG. 4 (a )) Completed.

  A sti-containing fragment (positions 1 to 1223 of SEQ ID NO: 1) was obtained by PCR using pIJ101 as a template and a primer pair of a forward primer (SEQ ID NO: 13) and a reverse primer (SEQ ID NO: 14). The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 60 seconds). The obtained sti-containing fragment was treated with KpnI, pIJ702XYL was treated with KpnI, then treated with alkaline phosphatase, and the KpnI-treated sti-containing fragment was ligated with DNA ligase, and pXYLH (sti-containing plasmid: Example 1, FIG. 4 (b)) was completed.

(Example 13: Construction of enzyme activity measurement vector)
DNA containing the chitobiase (CTB) gene was obtained by PCR using the total DNA of Streptomyces coelicolor, using the forward primer (SEQ ID NO: 26) and the reverse primer (SEQ ID NO: 27). The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 120 seconds). The CTB gene was treated with Ecot22I to obtain fragment 1. pIJ702XYL and pXYLH were treated with Aor51H and EcoT22I to obtain fragment 2 and fragment 3, respectively.

  Fragments 1 and 2 and fragments 1 and 3 were ligated with DNA ligase to obtain pIJ702XYL-CTB and pXYLH-CTB.

(Example 14: Culture method)
Streptomyces lividans 1326 strain was transformed with each plasmid. Transformation was performed in the same manner as in Reference Example 1. The obtained colonies were transplanted to a TSB plate (containing 50 μg / ml thiostrepton), transplanted from the plate to 6 ml of TSB medium, and cultured in a test tube at 28 ° C. for 72 hours. 0.2 ml of the test tube culture solution was transferred to 50 ml of the expression medium (Table 2), and cultured in a baffle flask at 28 ° C. for 120 hours. 1 ml of the culture solution was collected, and the supernatant was collected by centrifugation (14000 rpm, 10 minutes, 4 ° C.) and used for activity measurement.

(Example 15: Measurement of chitobiase activity)
<Measurement method of chitobiase activity>
0.2 ml of 20 mM potassium dihydrogen phosphate was added to 0.75 ml of 0.5 mM p-nitrophenyl N-acetyl-β-D-glucosaminide (manufactured by Sigma) and incubated at 37 ° C. for 5 minutes. Next, 0.05 ml of the enzyme solution was added, incubated at 37 ° C. for 10 minutes, and then the enzyme was inactivated by adding 1.4 ml of 0.5 M sodium carbonate. Furthermore, in order to quantify the released p-nitrophenol, the absorbance at a wavelength of 400 nm was measured. For this chitobiase, the amount of enzyme that produces 1 μmol of p-nitrophenol per minute under the above conditions was 1 unit. Table 3 shows the measurement results. When the average value of chitobiase activity in the table is compared, when the plasmid pXYLH containing the sti region is used, the average 1 / average 2 = 1.96 times and about twice as much as pIJ702XYL-CTB not containing the sti region. Was rising.

(Example 16: amplification of mini sti and construction of pPLDHmini)
A mini sti-containing fragment (positions 1 to 411 of SEQ ID NO: 1) was subjected to PCR using pIJ101 as a template and a primer pair of a forward primer (SEQ ID NO: 28: TTTTGGTACCAGTCATCCTGACCGACTGTG) and a reverse primer (SEQ ID NO: 29: TTTTGGTACCGCGGCAGCAGGTGCTCCCCA) I got it. The PCR reaction conditions were (cycle at 98 ° C. for 2 minutes) after 1 cycle, followed by 30 cycles (98 ° C. for 10 seconds, 55 ° C. for 10 seconds, 68 ° C. for 60 seconds). The obtained mini sti-containing fragment was treated with KpnI, pIJ702PLD was treated with KpnI, and then treated with alkaline phosphatase. The KpnI-treated mini sti-containing fragment was ligated with DNA ligase, and pPLDHmini (mini sti-owned plasmid: FIG. ) Completed.

(Example 17: Construction of enzyme activity measurement vector)
The PLA2 gene was amplified by PCR in the same manner as in paragraph 0057, and pPLDHmini-PLA2 was constructed by ligating the DNA fragment treated with EcoT22I and the DNA fragment treated with pPLDHmini with Aor51HI and EcoT22I with DNA Ligase. Similarly, the PLA2 gene is amplified by PCR in the same manner as in paragraph 0057, and the DNA fragment treated with EcoT22I and the DNA fragment treated with pORDH treated with Aor51HI and EcoT22I are combined with DNA Ligase to obtain pPLDH-PLA2 (sti ) Was built.

(Example 17: Measurement of enzyme activity of mini sty-containing plasmid-carrying actinomycetes)
Protoplasts of 1326 strain were transformed with plasmids pIJ702PLD-PLA2 (control), pPLDH-PLA2 (sti) and pPLDHmini-PLA2 (mini sti), respectively. The transformed strain was fished, transplanted to a TSB (ts50) plate, and cultured. The grown bacteria were inoculated into 7 ml of PLD medium and cultured (4 strains each). 0.2 ml of the culture that reached the stationary phase was cultured in a baffle flask containing 50 ml of PLD medium. PLA2 activity was measured after 72 hours of culture. The results are shown in Table 4 and FIG. As shown in Table 4, actinomycetes transformed with a plasmid inserted with sti and mini sti were about 1.5 times more active than non-transformant controls. This was considered to indicate that insertion of sti or mini sti increased the number of copies of the plasmid per cell and improved protein productivity.

  According to the present invention, the expression level of a protein can be increased in actinomycetes. Therefore, a desired protein can be expressed in large quantities by using the plasmid vector of the present invention. In particular, actinomycetes are very important microorganisms in the production of useful enzymes, and thus the method of the present invention can provide proteins such as enzymes more efficiently.

Claims (15)

  A plasmid vector for expressing a protein in actinomycetes, comprising a promoter, a cloning site for inserting a DNA fragment encoding the protein, a terminator, and a sti-containing fragment.   A DNA fragment, wherein the sti-containing fragment comprises a base sequence from positions 27 to 226 of SEQ ID NO: 1; a base sequence having at least 80% sequence identity with the base sequence from positions 27 to 226 of SEQ ID NO: 1 A DNA fragment that contains and can increase the copy number of the vector; or can hybridize under stringent conditions with DNA comprising a base sequence complementary to the base sequence from positions 27 to 226 of SEQ ID NO: 1 The plasmid vector according to claim 1, which is a DNA fragment containing DNA and capable of increasing the copy number of the vector.   The promoter according to any one of claims 1 and 2, wherein the promoter is a fragment containing at least one promoter selected from the group consisting of a promoter of a phospholipase D gene, a promoter of a metalloendopeptidase gene, and a promoter of a xylose isomerase gene. Plasmid vector.   The plasmid vector according to any one of claims 1 to 3, further comprising a DNA fragment encoding the protein inserted into the cloning site.   The plasmid vector according to any one of claims 1 to 4, wherein the protein is phospholipase A2, sphingomyelinase or chitobiase.   A recombinant actinomycetes into which the plasmid vector according to claim 4 or 5 is incorporated. A method for producing proteins in actinomycetes,
Transforming actinomycetes with the plasmid vector according to claim 4 or 5,
A method comprising culturing the transformed actinomycetes in a medium, and recovering the protein from the obtained culture.   A recombinant actinomycetes into which the plasmid vector according to claim 4 or 5 has been introduced.   A DNA fragment wherein the sti-containing fragment comprises a base sequence from positions 1 to 411 of SEQ ID NO: 1; a base sequence having at least 80% sequence identity with the base sequence from positions 1 to 411 of SEQ ID NO: 1 A DNA fragment containing the above vector and capable of increasing the copy number of the vector; or capable of hybridizing under stringent conditions with DNA comprising a base sequence complementary to the base sequence from position 1 to position 411 of SEQ ID NO: 1 The plasmid vector according to claim 1, which is a DNA fragment containing DNA and capable of increasing the copy number of the vector.   The promoter according to any one of claims 1 and 9, wherein the promoter is a fragment comprising at least one promoter selected from the group consisting of a promoter of a phospholipase D gene, a promoter of a metalloendopeptidase gene, and a promoter of a xylose isomerase gene. Plasmid vector.   The plasmid vector according to any one of claims 1, 9 and 10, further comprising a DNA fragment encoding the protein inserted into the cloning site.   The plasmid vector according to any one of claims 1 and 9 to 11, wherein the protein is phospholipase A2, sphingomyelinase, or chitobiase.   A recombinant actinomycetes in which the plasmid vector according to claim 11 or 12 is incorporated. A method for producing proteins in actinomycetes,
Transforming actinomycetes with the plasmid vector according to claim 11 or 12,
A method comprising culturing the transformed actinomycetes in a medium, and recovering the protein from the obtained culture.   A recombinant actinomycetes into which the plasmid vector according to claim 11 or 12 is introduced.

Images