JP2014166164A - Screening method for hair growth control substances - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new screening method for hair growth promotion substances or hair growth inhibition substances.SOLUTION: The screening method for hair growth promotion substances or hair growth inhibition substances is characterized in that a cell comprising a gene of which expression is controlled by Runx, and Runx are cultured in the presence and absence of test substances, and the yields of the gene under both conditions are compared.

Description

  The present invention relates to a method for screening a substance that promotes hair growth or a substance that suppresses hair growth.

  Hair is formed by the growth and differentiation of hair matrix cells located at the tip of the hair follicle. Hair follicles are formed during the embryonic period, and their number does not change after birth. Hair repeats growth and hair loss (hair cycle), and a state in which this cycle is stagnant or shortened is called alopecia.

  Alopecia seen on a daily basis in medical practice includes alopecia areata associated with aging and alopecia areata associated with mental stress, as well as those associated with diseases such as cancer and abnormal endocrine, and hair loss caused by drugs such as anticancer drugs. It has been known. Since hair loss greatly affects the patient's appearance, the development of a fundamental treatment and prevention method is desired. On the other hand, especially in the case of women, treatment of unwanted hair such as body hair and wrinkles in limbs, wrinkles, etc. is performed for aesthetic appearance. For example, mechanical hair removal using a shaver or the like, and removing unwanted hair using a hair removal agent. Hair removal methods such as chemical hair removal methods that remove hair roots are used.

  As drugs used for the treatment or prevention of alopecia, phenasteride (trade name: Propecia) or minoxidil (trade name: Riup (registered trademark)) is commercially available. There is a problem that effectiveness is not expected when the hair cycle is completely stagnant. Moreover, when using the apparatus and hair removal agent which are used for said mechanical and chemical hair removal methods, there exists a bad effect that a skin and a hair follicle are easy to be damaged by physical or chemical irritation | stimulation. Under such circumstances, provision of new hair growth agents and hair removal agents is desired.

  By the way, hedgehog molecules (Shh (Sonic hedgehog), Ihh (Indian Hedgehog), Dhh (Desert Hedgehog)) are known to have a very important role in vertebrate organogenesis and patterning, and 2 of Ptch1 and Ptch2 Hedgehog molecules bind to cell membrane receptors encoded by two genes, and information is transmitted to the transcription factor Gli family (Gli1, Gli2, and Gli3) working downstream thereof (Non-patent Document 1). Shh is the most well-known hair follicle formation-promoting factor. Shh regulates the growth and size of hair follicles because the skin of Shh-deficient mice exhibited a hairless phenotype due to hair follicle formation failure. (Non-patent Documents 2 and 3). The inventor has also been conducting research on the search for Runx2 target genes since around 2000, and has focused on the downstream signal of Runx2 in bone metabolism by microarray analysis. Expression of Ihh is regulated by Runx family transcription factors (Runx1, Runx2, and Runx3). It has been clarified that it is extremely important for the growth of bone in the long axis direction (Non-patent Document 4). The Runx family can function alternatively, and works by binding to specific DNA sequences. The promoter region of the Ihh gene contains seven Runx binding sequences conserved between species (human and mouse). (Non-Patent Document 4) Recently, a Runx1 conditional knockout mouse was created, and its role in hair growth of Runx1 after birth became clear from crossing with a keratin14 promoter Cre mouse (Non-patent Document 5). Moreover, the expression of all Runx family molecules was recognized by the hair follicle (nonpatent literature 6-8), and existence of the hair growth control mechanism by a Runx family was suggested. Furthermore, Tnfrsf19 has been shown to be involved in hair growth, and abnormal hair growth was observed in the gene-deficient mice, and it has been clarified that abnormalities occur during the follicle formation process, that is, around the 15th day of embryogenesis (non- Patent Document 9).

C.A. Callahan, A.E.Oro Monstrous attempts at adnexogenesis: regulating hair follicle progenitors through Sonic Hedgehog signaling Current Opinion in Genetics & Development, 11 (2001): 541-546. St-Jacques, H.R.Dassule, I. Karavanova, V.A.Botchkarev, J. Li, P.S.Danilian et al. Sonic Hedgehog signaling is essential for hair development Current Biology: CB, 8 (1998): 1058-1068. C. Chiang, R.Z. Swan, M. Grachtchouk, M. Bolinger, Y. Litingtung, E.K. Robertson et al. Essential role for Sonic Hedgehog during hair follicle morphogenesis.Developmental Biology, 205 (1999): 1-9. Yoshida CA, Yamamoto H, Fujita T, Furuichi T, Ito K, Inoue K, Yamana K, Zanma A, Takada K, Ito Y, Komori T. Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog. Genes Dev. 2004 Apr 15; 18 (8): 952-63. Osorio KM, Lilja KC, Tumbar T. Runx1 modulates adult hair follicle stem cell emergence and maintenance from distinct embryonic skin compartments.J Cell Biol. 2011 Apr 4; 193 (1): 235-50. Osorio KM, Lee SE, McDermitt DJ, Waghmare SK, Zhang YV, Woo HN, Tumbar T. Runx1 modulates developmental, but not injury-driven, hair follicle stem cell activation.Development. 2008 Mar; 135 (6): 1059-68 . Glotzer DJ, Zelzer E, Olsen BR. Impaired skin and hair follicle development in Runx2 deficient mice. Dev Biol. 2008 Mar 15; 315 (2): 459-73. Raveh E, Cohen S, Levanon D, Groner Y, Gat U. Runx3 is involved in hair shape determination.DevDyn. 2005 Aug; 233 (4): 1478-87. Pispa J, Pummila M, Barker PA, Thesleff I, Mikkola ML.Edar and Troy signaling pathways act redundantly to regulate initiation of hair follicle development.Hum Mol Genet. 2008 Nov 1; 17 (21): 3380-91.

  It is an object of the present invention to provide a screening method for a hair growth promoting substance or a hair growth inhibiting substance, characterized by using a cell containing a gene whose expression is controlled by Runx and Runx.

The inventors identified Gli1, Ptch1 and Tnfrsf19 for the first time as target genes of the Runx family by microarray analysis using dominant-negative Runx (dnRunx), which inhibits the function of Runx2 and all Runx family molecules, We found that it is an upstream signal of hair follicle formation that regulates the expression of Ptch1 or Tnfrsf19 gene. In addition, by using a construct fused with the Gli1, Ptch1 or Tnfrsf19 promoter and the luciferase gene, a method for searching for extracts or compounds that promote hair growth by stimulating hair follicle formation was constructed. In addition, this method makes it possible to search for extracts or compounds that inhibit hair growth and have an inhibitory effect on hair follicle formation.
As a result of further research based on these findings, the present inventor has completed the present invention.

That is, the present invention
[1] A cell containing a gene whose expression is controlled by Runx and Runx are cultured in the presence and absence of a test substance, and the production amount of the gene under both conditions is compared. Screening method for hair promoting substance or hair growth inhibiting substance;
[2] The method for screening a hair growth promoting substance according to [1], comprising the following steps:
(A) culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B) measuring the production amount of the gene under both conditions, and (c) selecting a test substance that increases the production amount of the gene compared to the absence of the test substance;
[3] The method for screening a hair growth inhibitor according to [1], comprising the following steps:
(A) culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B) measuring the production amount of the gene under both conditions, and (c) selecting a test substance that reduces the production amount of the gene compared to the absence of the test substance;
[4] The screening method according to any one of [1] to [3], wherein the gene whose expression is controlled by Runx is a gene selected from the group consisting of Gli1, Ptch1, and Tnfrsf19;
[5] The screening method according to any one of [1] to [3], wherein the gene whose expression is controlled by Runx is a gene operably linked to a promoter of Gli1, Ptch1, or Tnfrsf19;
[6] The screening method according to [5], wherein the gene operably linked to the promoter of Gli1, Ptch1 or Tnfrsf19 is a reporter gene;
[7] A kit for use in the screening method according to [1], comprising a cell containing a gene whose expression is controlled by Runx and Runx;
I will provide a.

  The present invention can provide a screening method for a hair growth promoting substance or a hair growth inhibiting substance, characterized by using a cell containing a gene whose expression is controlled by Runx and Runx.

It is a figure which shows the base sequence (sequence number: 7) of the promoter region of Tnfrsf19. A solid line part shows a Runx coupling arrangement. It is a figure which shows the base sequence (sequence number: 8) of the promoter region of Ptch1. The solid line indicates the Runx coupling sequence. The broken line portion indicates a sequence that may be a Runx binding sequence. It is a figure which shows the base sequence (sequence number: 9) of the promoter region of Gli1. The solid line indicates the Runx coupling sequence. The broken line portion indicates a sequence that may be a Runx binding sequence. It is a figure which shows the expression level of the Runx family target gene in MEF of a Runx2 knockout mouse. MEFs were prepared independently from 4-5 individuals. Significance test was performed by Student T-test. ^* P <0.001 vs wt It is a figure which shows the expression level of a Runx family target gene in the skin fibroblast which stably expresses Runx family or DN-Runx. Cells were prepared 3 times independently. Here, representative results are shown. n = 3; Significance test was performed by Turkey-test. ^* P <0.05, ^** P <0.01 vs GFP A schematic diagram of the Tnfrsf19-luc construct is shown. It is a figure which shows the expression level of each luciferase reporter vector in the skin fibroblast which stably expresses Runx family or DN-Runx. Cells were prepared 3 times independently. Here, representative results are shown. n = 4; Significance test was performed by Turkey-test. ^* P <0.05, ^** P <0.01 vs GFP It is a figure which shows the list | wrist of the plant extract which enhances the reporter activity of Tnfrsf19-luc. DMSO was used as a vehicle control. Here, representative results are shown. n = 4 It is a figure which shows the list | wrist of the plant extract which suppresses the reporter activity of Tnfrsf19-luc. DMSO was used as a vehicle control. Here, representative results are shown. n = 4

  The present invention is characterized in that cells containing a gene whose expression is controlled by Runx and Runx are cultured in the presence and absence of a test substance, and the amount of the gene produced under both conditions is compared. A method for screening a hair growth promoting substance or a hair growth inhibiting substance is provided.

Specifically, the screening method of the present invention may be a method including the following steps.
(A) culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B) a step of measuring the production amount of the gene under both conditions, and (c) selecting a test substance that increases the production amount of the gene as a hair growth promoting substance compared to the absence of the test substance. Process or
(A ′) culturing a cell containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B ′) a step of measuring the production amount of the gene under both conditions, and (c ′) a test substance that decreases the production amount of the gene as compared with the absence of the test substance as a hair growth inhibitor. Process to select.

  “Runx” forms the Runx family, and the isoforms that form the family include Runx1, Runx2, and Runx3. In the present invention, Runx may be any of the above isoforms as long as it can regulate downstream genes involved in hair growth regulation.

  In the present invention, Runx1, Runx2, and Runx3 may each be a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, 4, or 6, and can be a human cell (for example, , Hair follicle stem cells, etc.) or any tissue in which those cells exist, for example, skin, etc., or may be a protein synthesized by chemical synthesis or a cell-free translation system. Alternatively, it may be a recombinant protein produced from a transformant introduced with a polynucleotide having a base sequence (SEQ ID NO: 1, 3 or 5) encoding the amino acid sequence.

  The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2, 4 or 6 is about 70% or more, preferably about 80%, with the amino acid sequence represented by SEQ ID NO: 2, 4 or 6. More preferably, amino acid sequences having homology of about 90% or more, particularly preferably about 95% or more, and most preferably about 98% or more are mentioned.

  The homology of amino acid sequences in the present specification is determined using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering) = OFF).

  Examples of the protein containing an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2, 4 or 6 are substantially the same as the amino acid sequence represented by SEQ ID NO: 2, 4 or 6 described above. And a protein having substantially the same quality of activity as a protein containing the amino acid sequence represented by SEQ ID NO: 2, 4 or 6 is preferable.

Examples of substantially the same activity include transcription promoting activities such as Ihh, Gli1, Ptch1, Tnfrsf19, osteocalcin, IL-11, p21, MMP-13, and the like. Substantially homogeneous indicates that their properties are qualitatively (eg, physiologically or pharmacologically) homogeneous. Therefore, it is preferable that the transcription promoting activity is equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times). Quantitative factors such as protein molecular weight may be different.
The measurement of transcription promotion activity can be performed using a known method, for example, Northern analysis or RT-PCR analysis of the target gene.

The “Runx” of the present invention includes, for example, (i) one or two or more (preferably about 1 to 30, preferably 1) in the amino acid sequence represented by SEQ ID NO: 2, 4 or 6. About 10 to 10 amino acids, more preferably several (1 to 5) amino acids, (ii) one or more amino acid sequences represented by SEQ ID NO: 2, 4 or 6 (preferably Is an amino acid sequence to which about 1 to 30, preferably about 1 to 10, more preferably (1 to 5) amino acids are added, and (iii) is represented by SEQ ID NO: 2, 4 or 6 An amino acid sequence in which one or more (preferably about 1 to 30, preferably about 1 to 10, more preferably several (1 to 5)) amino acids are inserted into the amino acid sequence, (iv) a sequence Number: 1 in the amino acid sequence represented by 2, 4 or 6 Is an amino acid sequence in which two or more (preferably about 1 to 30, preferably about 1 to 10, more preferably (1 to 5)) amino acids are substituted with other amino acids, or (v) Also included are so-called muteins such as proteins containing amino acid sequences combining them.
When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited as long as the activity of the protein is retained.
The “Runx” of the present invention is preferably a protein having the amino acid sequence represented by SEQ ID NO: 2, 4 or 6, ie, human Runx or a homolog thereof in other mammals.

The “gene whose expression is controlled by Runx” refers to a gene that is present downstream of the hair growth regulatory signal transduction pathway involving Runx and whose expression is directly controlled by Runx. Such genes include, for example, Ihh, Gli1, Ptch1, Tnfrsf19, and preferably Gli1, Ptch1, Tnfrsf19. Alternatively, “a gene whose expression is controlled by Runx” is a chimeric DNA containing a promoter of a gene that is present downstream of the hair growth regulatory signal transduction pathway involving Runx and whose expression is directly controlled by Runx. In this case, DNAs encoding various reporter proteins may be operably linked downstream of the promoter. Here, examples of the promoter of the gene include Gli1, Ptch1, and Tnfrsf19 promoters.
Examples of “cells containing genes whose expression is controlled by Runx” include hair follicle stem cells. Alternatively, when the “gene whose expression is controlled by Runx” is a reporter gene operably linked downstream of the promoter of a gene directly controlled by Runx, the cell is introduced with the gene. It may be a cell.

  A cell into which a gene whose expression is controlled by Runx has been introduced can be prepared by introducing a nucleic acid containing a gene whose expression is controlled by Runx into the cell.

  The nucleic acid containing a gene whose expression is controlled by Runx may be DNA, RNA, or a DNA / RNA chimera, preferably DNA. The nucleic acid may be double-stranded or single-stranded. In the case of a double strand, it may be a double-stranded DNA, a double-stranded RNA or a DNA: RNA hybrid.

  The DNA containing a gene whose expression is controlled by Runx may be any of genomic DNA, genomic DNA library, cell / tissue-derived cDNA, cell / tissue-derived cDNA library, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, it can be directly amplified by RT-PCR using an mRNA fraction prepared from the above cells / tissues.

  As described above, the DNA containing a gene whose expression is controlled by Runx in the present invention includes DNA containing Gli1, Ptch1, and Tnfrsf19.For example, the promoters of each gene are included in GenBank Accession No. NG_029564, NG_007664, and NG_018924 The nucleotide sequence information to be included is disclosed.

  In addition, when the DNA containing a gene whose expression is controlled by Runx in the present invention is a reporter gene operably linked downstream of the promoter of a gene directly controlled by Runx, Examples of the promoter of the gene to be controlled include Tnfrsf19, Ptch1 or Gli1 promoter, which are represented by SEQ ID NO: 7, 8 or 9, respectively. Examples of the DNA encoding the reporter protein operably linked to the promoter include β-galactosidase gene (lacZ), soluble alkaline phosphatase gene, luciferase gene and the like. The base sequences of these reporter genes can be obtained from commercially available DNA and the like.

  The cloned DNA can be used as it is or after digestion with a restriction enzyme or addition of a linker, if desired. The DNA may have ATG as a translation initiation codon on the 5 'end side, and may have TAA, TGA or TAG as a translation termination codon on the 3' end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.

  In addition to the above, an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like is used as desired. it can.

“A cell into which a gene whose expression is controlled by Runx has been introduced” can be produced by introducing a gene into a cell using an expression vector containing the DNA according to a known method.
Examples of cells include monkey cell COS-7, Vero, Chinese hamster cell CHO, dhfr gene-deficient Chinese hamster cell CHO, mouse L cell, mouse AtT-20, mouse myeloma cell, rat GH3, human FL, HEK293, HepG2, HeLa cells and the like are used.

  Gene transfer can be performed, for example, by Cell Engineering Annex 8 New Cell Engineering Experiment Protocol. 263-267 (1995) (published by Shujunsha), Virology, Volume 52, 456 (1973) can be used for gene introduction.

  The supply of Runx to the screening system can also be performed when “a cell containing a gene whose expression is controlled by Runx” further has the ability to produce Runx. Alternatively, the cell further having the ability to produce Runx may be a cell containing the DNA encoding Runx described above. In that case, DNA encoding Runx is obtained by converting the DNA fragment into an appropriate expression vector (for example, animal viruses such as retrovirus, vaccinia virus, baculovirus, adenovirus; pA1-11, pXT1, pRc / CMV, pRc / RSV). , PcDNAI / Neo, etc.) (eg, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, HSV-TK promoter, etc.) can be linked downstream and introduced into cells.

  Examples of test substances include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, low molecular compounds, siRNA, antisense oligonucleotides, antibodies, aptamers, etc. Is mentioned.

  Cell culture in the screening method of the present invention can be performed according to a known method. For example, MEM medium, DMEM medium, RPMI 1640 medium, 199 medium, etc. containing about 5 to 20% fetal bovine serum are used. The pH of the medium is preferably about 6-8. The culture is usually performed at about 30 ° C. to 40 ° C. for about 15 to 60 hours. You may perform ventilation | gas_flowing and stirring as needed.

  The production amount of the gene whose expression is controlled by Runx can be measured according to a known method.

For example, by using an antibody against a protein encoded by a gene whose expression is controlled by Runx, the amount of gene production can be quantified according to a method such as Western analysis, ELISA, or the like.
The antibody used here is a monoclonal antibody or a polyclonal antibody as long as it can recognize a protein encoded by a gene whose expression is controlled by Runx (for example, a protein encoded by Gli1, Ptch1, or Tnfrsf19 gene). Any of these may be used. The antibody may be the antibody molecule itself, or F (ab ′) ₂ , Fab ′, or Fab fraction of the antibody molecule. The antibody may be labeled.
As a labeling agent used for labeling an antibody, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of the radioisotope include [ ³⁵ S] [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C], and the like. As the enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used. Furthermore, a biotin- (strept) avidin system can also be used for binding of an antibody or antigen and a labeling agent.

Alternatively, the production amount of the gene can be measured by preparing an appropriate primer based on the base sequence of mRNA produced from the gene and performing RT-PCR to measure the amount of the transcription product of the gene. In addition, the amount of the transcription product is measured by Northern blotting using a probe prepared by labeling a polynucleotide containing all or part of the base sequence of mRNA produced from the gene according to a known method or a method analogous thereto. It can be measured by the method.
For example, total RNA or poly A (+) RNA is extracted from a culture of cells containing a gene whose expression is controlled by Runx according to a conventional method. For example, all or part of the base sequence of Gli1, Ptch1, Tnfrsf19 is extracted. It can be quantified by performing Northern hybridization using the contained polynucleotide as a probe, or by performing RT-PCR using a pair of oligonucleotides containing a part of the base sequences of Gli1, Ptch1, and Tnfrsf19 as primers.

Alternatively, if the “gene whose expression is controlled by Runx” is a reporter gene operably linked downstream of the promoter of the gene directly controlled by Runx, expression of the protein encoded by the reporter gene It can also be measured by checking.
For example, a gene whose expression is controlled by Runx is functionally linked to a β-galactosidase gene (lacZ) downstream of a promoter whose transcription activity is controlled by Runx (eg, promoters such as Ihh, Gli1, Ptch1, Tnfrsf19). Β-galactosidase is expressed instead of the gene whose expression is controlled by Runx. Therefore, for example, expression of β-galactosidase is easily performed by staining with a reagent that is a substrate of β-galactosidase such as 5-bromo-4-chloro-3-indolyl-β-galactopyranoside (X-gal). The state can be confirmed. Specifically, cells or tissue sections are fixed with glutaraldehyde or the like, washed with phosphate buffered saline (PBS), and then stained with X-gal at room temperature or around 37 ° C. for about 30 minutes to After the reaction for 1 hour, the tissue specimen is washed with a 1 mM EDTA / PBS solution to stop the β-galactosidase reaction and observe the coloration to confirm the expression state of β-galactosidase in the cells. it can. Moreover, you may detect mRNA which codes lacZ according to a conventional method.

With the screening method of the present invention, a hair growth promoting substance or a hair growth inhibiting substance can be screened.
For example, a test substance that increases the production amount of a gene whose expression is controlled by Runx by about 200% or more, preferably 500% or more, more preferably about 1000% or more, compared to the absence of the test substance. It can be selected as a promoter.
In addition, for example, a test substance that reduces the production amount of a gene whose expression is controlled by Runx by about 20% or more, preferably 50% or more, more preferably about 80% or more, compared to the absence of a test substance. It can be selected as a hair growth inhibitor.

The present invention also provides a screening kit that can be used in the screening method of the present invention. For example, (a) a cell containing a gene whose expression is controlled by Runx, (b) Runx and (c) a reagent capable of detecting the expression of the gene, for example, under conditions highly stringent with the gene When a polynucleotide capable of hybridizing, an antibody against a protein encoded by the gene, or a gene whose expression is controlled by Runx is a reporter gene, a reagent for its detection, preferably one containing all of it as its constituent It is done. The Runx in (b) may be produced by the cell in (a).
These kits can further contain other reagents and instruments necessary or preferable for carrying out the screening method of the present invention as desired.

  Hereinafter, the present invention will be described more specifically by way of examples. However, the present invention is not limited to these examples.

1. Cell (1) plat-E
(2) 293
2. Cell culture and viruses
10% fetal bovine serum (FBS) (Thermo Fisher Scientific Inc., Yokohama, Japan), antibiotic solution (64μg / ml penicillin G (NACALAI TESQUE, INC., Kyoto, Japan), 100μg / ml streptomycin (NACALAI TESQUE, INC .)) And Dulbecco's modified eagle medium (DMEM) (Wako Pure Chemical Industries, Ltd., Osaka, Japan).
For cell seeding, the cells were peeled off from the dish in culture using 0.25% trypsin, and the cells collected with a centrifuge LC-200 (TOMY, Tokyo, Japan) were seeded on a new dish.
Cells were frozen using a bunker (LYMPHOTEC Inc, Tokyo, Japan) in an ultra-low temperature refrigerator at -85 ° C, and stored in a liquid nitrogen tank for long-term storage.
Retroviral vectors expressing Runx family molecules and dnRunx were generated by PCR cloning. An adenovirus vector expressing Runx family molecules and dnRunx was prepared by recombination. Adenovirus was prepared by co-introducing pJM17 into 293 cells, and the amplified adenovirus was stored in an ultra-low temperature refrigerator at -85 ° C.
3. High Density Culture Limbs were removed from a mouse fetus (E12.5) and digested in 0.1% trypsin 0.1% collagenase at 37 ° C. for 30 minutes. The cells were suspended by pipetting, and the reaction was stopped with DMEM containing 10% FBS and an antibiotic solution (64 μg / ml penicillin G (NACALAI TESQUE, INC.), 100 μg / ml streptomycin (NACALAI TESQUE, INC.)). After suspending the cells, 20 μL each was seeded in a 12-well plate at a concentration of 2 × 10 ⁷ cells / ml. After 1 hour, 2 mL of DMEM containing 10% FCS was added after the cells adhered. After culturing for 3 days, the cartilage matrix product was stained by Alcian blue staining.
4). Establishment of stably expressing cells using retrovirus
Transfection
A 35 mm dish was seeded with plat-E, and the next day, gene transfer was performed using FuGENE6 transfection reagent (Roche Diagnostics, Tokyo, Japan). At the time of gene introduction, green fluorescent protein (GFP) and pMXs-neo (IG / pMXs-neo) containing neomycin resistance gene were introduced as a control experiment. A culture supernatant obtained from plat-E was prepared as a retrovirus solution. For Flag-Runx2 / pMXs-neo and Flag-Runx3 / pMXs-neo, cDNA inserts prepared from ddY mouse skeletal tissues were used as templates, and Flag-tagged cDNA inserts were prepared by PCR and cloned.
Infection
The retrovirus solution was filtered through a 0.2 μm filter (NIPPON Genetics Co., Ltd, Tokyo, Japan), and the target cells were cultured in a virus solution containing 8 ng / ml polybrene. The cells were selected for drug resistance for 1 week in a medium containing 400 μg / ml G418 (NACALAI TESQUE, INC.).
5. Creation of adenovirus
IRES-EGFP (pAC-CMV-IG) was incorporated into pAC-CMV and used as a negative control. Adenoviral vectors expressing Runx2 and dnRunx were subcloned into pAC-CMV-IG. The adenovirus vector was transfected into 293 cells together with pJM17, and the prepared virus confirmed the fluorescence of GFP.
6). RNA extraction
Total RNA was extracted using Seppazole RNA ISuperG (NacalaiTesque) according to the manual.
7). Reverse transcription reaction
1 μg of total RNA was reverse transcribed using ReverTra Ace (registered trademark) cDNA synthesis kit (TOYOBO). It was set in a thermal cycler (PC320) (ASTEC, Fukuoka, Japan), and reverse transcription reaction conditions were as follows.

8). Real-time PCR
KAPA SYBR FAST qPCR Master Mix (2X) 5 μL, 0.5 μM primer, 3.6 μL of dH ₂ O, 1 μL of cDNA were mixed and quantified using PikoReal PCR system (Thermo Fisher Scientific Inc.). The PCR product was corrected by the expression level of GAPDH, which is a housekeeping gene, and the number of cycles between each sample was compared. The target gene was searched from the gene bank and the primer was designed. Primer synthesis was outsourced to invitrogen.
[List of PCR primers]
Target mRNA Primer Sequences (5 '------------------ 3')
GAPDH (forward) TGCACCACCAACTGCTTAG SEQ ID NO: 10
GAPDH (reverse) GGATGCAGGGATGATGTTC SEQ ID NO: 11
Ihh (forward) TTCAAGGACGAGGAGAACACG SEQ ID NO: 12
Ihh (reverse) TTCAGACGGTCCTTGCAGC SEQ ID NO: 13
Tnfrsf19 (forward) CTGCGTTCTCCCACTACCCT SEQ ID NO: 14
Tnfrsf19 (reverse) ATCGTGTCCCCCACAGAAGC SEQ ID NO: 15
Gli1 (forward) GCTGTCGGAAGTCCTATT SEQ ID NO: 16
Gli1 (reverse) ACTGGCATTGCTAAAGG SEQ ID NO: 17
Gli2 (forward) CTGACCCGCAACGCCTACT SEQ ID NO: 18
Gli2 (reverse) CCGAATGCCGTCATCCAAG SEQ ID NO: 19
Gli3 (forward) AACCCTATTCTACCCTCCAAA SEQ ID NO: 20
Gli3 (reverse) GCTGATAGTGCTGGTATTGCT SEQ ID NO: 21
Ptch1 (forward) AAAGAACTGCGGCAAGTTTTTG SEQ ID NO: 22
Ptch1 (reverse) CTTCTCCTATCTTCTGACGGGT SEQ ID NO: 23
Ptch2 (forward) GGTCCTCCGCACCTCATATC SEQ ID NO: 24
Ptch2 (reverse) GCGCAGTCTGAATCAACATC SEQ ID NO: 25
9. Luciferase assay
Using the dual luciferase assay system (Promega), 300 μg of each reporter vector (p6OSE2-luc, p8Gli-luc, Tnfrsf19-luc) and 10 μg of pRL-CMV (Promega, Madison, Wl) were transiently introduced by electroporation. . The luciferase activity was determined by measuring the specific activity of renilla luciferase with respect to the signal using a 20/20 ⁿ luminometer (Turner BioSystems, Sunnyvale, CA) or a luminescence microplate reader (Berthold Tech., Tokyo, Japan).
10. Promoter cloning
Tnfrsf19-luc was amplified by KOD-FX neo (TOYOBO) using the following primers and genomic DNA obtained from healthy human volunteers as a template.
XhoI-hTnfrsf19 promoter-F GCCTCGAGCTAGTGACATTTCTATACCT SEQ ID NO: 26
XhoI-hTnfrsf19 promoter-R GCCTCGAGCAGATCCCATGACATCATTC SEQ ID NO: 27
The resulting PCR product was subcloned into PGL4.10 (Promega). Similarly, the base sequence of the obtained clone is identical to the upstream 2.5 kb estimated by the sequence analysis of the transcriptional regulatory region of the database (Official Symbol: TNFRSF19 (Gene ID: 55504) mRNA (AN: NM_018647.3). The sequence was recognized (FIG. 1). Human PTCH1 and Human GLI1 each have a variant with a different transcription start point, and all activities were measured using a Gli-responsive reporter vector p8Gli-luc. In the promoter regions of PTCH1 and GLI1, Runx family-reactive binding sequences were confirmed by in silico analysis.
11. TF Search analysis The Runx binding site was extracted by searching the TF Search program (http://www.cbrc.jp/research/db/TFSEARCH.html) for the binding of the Runx family in the human Tnfrsf19 promoter region (FIG. 1). Similarly, Runx binding site analysis was also performed for the human PTCH1 promoter region and the human GLI1 promoter region (FIGS. 2 and 3).
12 Statistical processing Significant difference was tested using student's unpaired t-test. When p <0.05, it was determined that the difference was significantly different. The Turkey test was conducted for multi-sample comparison.

Example 1 Search for Target Gene of Runx Family Runx2 and dominant-negative Runx (DN) were forcibly expressed in mouse limb high-density cultured cells using adenovirus, and RNA was prepared from the cells 24 hours later. Runx family target candidate genes were extracted from outsourced Agilent microarray analysis, and the target genes were extracted by real-time PCR analysis. First, by mining data from microarray data, we focused on the genes whose expression was increased 2 times or more by Runx2 and decreased by 0.5 times or less by DN, and narrowed down to 100 genes of interest. Microarray data and further data mining in the MEF of wild type mice and Runx2 knockout mice were performed and narrowed down to 28 genes. As a result, Ptch1, Gli1 and Tnfrsf19 were newly identified in addition to the known Runx family target gene Ihh (Table 2). For Runx family molecules, the expression of human and mouse hair follicle formation is very similar in space and time, and the group of molecules involved in hedgehog signals (Ptch1, Gli1) and Tnfrsf19 in mice are related to hair growth control. From the findings, it was inferred that Runx family molecules are located upstream of hair growth information during the process of hair follicle formation. Therefore, the Runx binding site in each human gene promoter region was searched for the expression control of these genes (FIGS. 1 to 3). In order to examine the control of Runx family in each gene expression, MEF (mouse embryonic fibroblasts: Runx2-//) derived from wild type (wt) or Runx2 gene-deficient mice prepared from embryonic 14.5 day old skull formation region -) As a result of real-time PCR analysis using cells, it was confirmed that each gene expression level in Runx2-/-MEF was lower than wt (Fig. 4).

  It was examined that these genes are regulated by all Runx family molecules (FIG. 5). Using wild-type dermal fibroblasts prepared from embryonic day 15.5 mouse skin, GFP-expressing retrovirus was used as a control experiment, and Runx1, Runx2, Runx3, or dominant-negative Runx (DN) -expressing retrovirus was used. Cells infected and screened for drugs with 400 μg / mL G418 were established, and gene expression in these cells was examined by real-time PCR analysis. In cells expressing Runx1, Runx2, and Runx3, the expression of Ihh and Tnfrsf19 was increased and the expression was decreased by DN-Runx compared to cells transfected with GFP. Similar results were observed in the expression of Gli1, but no change in expression was observed in other Gli family molecules (Gli2, Gli3) that were expected to bind to the Runx family as in Gli1 by TF Search analysis. In other words, although all Gli families have Runx family binding regions, only Gli1 was affected by Runx. However, Gli2 was significantly enhanced by Runx1, but both Cq values were high and the copy number of the endogenous gene expression was quite low (Gapdh Cq value was around 15 compared to Gli2 Cq value). (About 38). Ptch1 was also up-regulated by Runx1, Runx2, and Runx3 and decreased by DN-Runx. On the other hand, Ptch2, which was predicted to bind to the Runx family in the same way as Ptch1 in TF Search analysis, was not affected by any Runx gene.

Example 2 Tnfrsf19 promoter responsiveness To examine Runx family activity, Gli family activity and Tnfrsf19 activation by reporter analysis, p6OSE2-luc, p8Gli-luc, or Tnfrsf19-luc were introduced into GFP, Runx family, or DN-Runx-introduced cells, respectively. Transiently expressed strongly, and luciferase activity was examined (FIGS. 6 and 7). As a result of the examination, in correlation with real-time PCR analysis, all Runx family molecules were observed to significantly enhance the respective reporter activity, and conversely, DN-Runx showed an inhibitory effect.

Example 3 Construction of a High Throughput Screening System Using Promoter Responsiveness as an Index In order to screen for compounds and extracts that efficiently induce or suppress hair growth signals using a large number of samples, An attempt was made to construct a high-throughput screening system in a hole format. Gene transfer was performed by electroporation, and 96-well plates were seeded with cultured skin fibroblasts prepared from embryonic 15.5-day-old ddY mouse skin, and Tnfrsf19-luc activity was examined using luciferase activity as an indicator 24 hours later. (FIGS. 8 and 9). There were many extracts that showed responsiveness to Tnfrsf19-luc activity. In addition, the real-time PCR analysis and the reporter activity by the Runx family were highly correlated.

  A screening method for a new hair growth promoting substance or hair growth inhibiting substance can be provided. If a substance that directly activates the Runx family can be found, hair growth regulation that regulates stem function activity of hair follicle stem cells becomes possible, and it is expected to be a revolutionary product.

Claims (7)

  A hair growth promoting substance characterized by culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance, and comparing the amount of the gene produced under both conditions Alternatively, a screening method for a hair growth inhibitor. The method for screening a hair growth promoting substance according to claim 1, comprising the following steps:
(A) culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B) measuring the production amount of the gene under both conditions, and (c) selecting a test substance that increases the production amount of the gene compared to the absence of the test substance. The method for screening a hair growth inhibitor according to claim 1, comprising the following steps:
(A) culturing cells containing a gene whose expression is controlled by Runx and Runx in the presence and absence of a test substance;
(B) measuring the production amount of the gene under both conditions, and (c) selecting a test substance that decreases the production amount of the gene compared to the absence of the test substance.   The screening method according to any one of claims 1 to 3, wherein the gene whose expression is controlled by Runx is a gene selected from the group consisting of Gli1, Ptch1, and Tnfrsf19.   The screening method according to any one of claims 1 to 3, wherein the gene whose expression is controlled by Runx is a gene operably linked to a promoter of Gli1, Ptch1, or Tnfrsf19.   The screening method according to claim 5, wherein the gene operably linked to the promoter of Gli1, Ptch1 or Tnfrsf19 is a reporter gene.   The kit for using for the screening method of Claim 1 containing the cell containing the gene by which expression is controlled by Runx, and Runx.

Images