JP2014143949A - Shrimps-health examination method with multiplex gene analysis - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide means of simultaneously and rapidly diagnosing shrimps-health condition about polyspecimen.SOLUTION: A shrimps-health examination method comprises the steps of: measuring the expression level of biophylaxis related gene group (genes of Toll pathway and IMD pathway, JAK/STAT pathway, apoptosis-related pathway, RNA interference pathway, free radical production pathway and antimicrobial peptide production pathway, and cytokine-related genes) in a test sample collected from shrimps; and diagnosing the shrimps-health condition on the basis of the expression level of the measured biophylaxis-related gene. The method uses a primer set.

Description

  The present invention relates to a method for diagnosing the health condition of shrimps by multiplex gene analysis, and a primer set used for carrying out the method.

  The prawn aquaculture industry, including prawns, is thriving around the world, including Southeast Asia and Latin America. On the other hand, in shrimp farming, in order to increase production efficiency, intensive aquaculture that is raised at high density is the mainstream, and various chemicals such as antibiotics and nutrients are administered, so the environment of the aquaculture pond deteriorates. ing. From around the 1980s, viral epidemics have been repeated in major shrimp producing countries in Southeast Asia. Among them, prawn acute viremia (PAV: peneid acute viremia, white spot disease (WSS)) occurs in cultured shrimp in Japan and other Asian countries, as well as in Latin America, causing serious damage. ing. In particular, during the high water temperature period from July to September, it is caused by a decrease in pH and salinity due to heavy rain such as typhoons, sedimentation of sediment, residual food, feces and molting shells and silicification. As a result, the water quality and bottom quality deteriorate, and the immunity of the shrimps decreases, and the shrimp cause opportunistic infections due to vibrio bacteria that normally exist in the seawater.

  Such viral diseases, bacterial diseases, and environmental deterioration of farms will reduce the production of shrimp farming, so countermeasures are necessary. The damage caused by viral diseases is often already spread throughout the culture pond when dead shrimp are discovered. This is due to the cannibalism of shrimps, and by eating dead shrimps, infection spreads rapidly to healthy shrimps. Currently, there is no active countermeasures against viral diseases, and it is an important countermeasure to prevent juvenile shrimp infected with viruses from entering the aquaculture pond. However, many shrimp culture ponds are open-air ponds (nearly ponds) located near the coast, so viruses and crabs and shrimps infected in the natural waters invade the culture ponds and cause continuous virus infection. Bacterial diseases caused by opportunistic infections do not cause many deaths of shrimp at the same time as viral infections, but they often die for a long period of time and often notice the magnitude of the damage at the time of harvest. However, since there is no drug approved as an aquatic drug for such bacterial diseases, it is impossible to administer antibiotics, and there is no active countermeasure. In addition, although it is not an aggressive countermeasure, although natural immunity-derived immunostimulants are administered for the purpose of enhancing immunity and enhancing resistance to illness, administration of immunostimulants alone can prevent disease. Full control is difficult.

  As described above, in the current shrimp culture, there is no effective means for suppressing the occurrence of viral diseases and bacterial diseases. Therefore, in order to continuously develop appropriate shrimp farming, it is essential to understand the health status of shrimp and detect diseases early.

  Since invertebrates such as shrimps lack acquired immunity, biological defense is carried out through immune responses, mainly natural immunity, and various immune response systems are used to eliminate pathogens. Is present. In the case of Drosophila, for example, when a fungus is injected, a signal transduction pathway called Toll pathway is activated, and an antimicrobial peptide acting on the fungus called drosomycin is produced. This antibacterial peptide such as Lysozyme and ALF2 is a biological defense factor that is used from all animals including shrimp such as prawns to some plants, and its production is induced by invasion of microorganisms, and it is late in the immune response. It is considered to play the biggest role. In addition, when cells are infected with a virus, the virus is eliminated from the body by starting a program by an apoptosis-related factor and performing suicide and self-sacrifice so as not to cause any other damage. Other biological defense mechanisms include free radical-related factors such as Nox and NOS. These have the function of converting oxygen and nitrogen into reactive nitrogen species (RNS) and reactive oxygen species (ROS) that have bactericidal and virucidal activity due to pathogen invasion, stress, and ultraviolet rays.

  The shrimp biological defense mechanism also has a series of dynamic relationships from pathogen recognition by the host, through signal transduction and crosstalk between them, to induction of apoptosis and production of antibacterial molecules such as antibacterial peptides. Existing. Therefore, the elucidation and control of the biological defense mechanism of such shrimps is indispensable for developing a drug aimed at fundamental control of diseases.

  The present inventors have performed cloning and identification of the above-mentioned biological defense-related genes (Toll, NOS, Nox, Duox, Croquemort, ALF2, etc.) for prawns (Non-Patent Documents 1 to 3), In order to comprehensively analyze biological defense-related genes, we have been developing a multiplex gene expression quantitative analysis method that can simultaneously perform quantitative expression analysis of multiple genes and designing primer designs for use in such methods. However, a system that can simultaneously and rapidly quantitatively analyze a gene group that accurately reflects the health condition of shrimp has been not established.

Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus japonicus, Fish & Shellfish Immunology (2008) 24, 122-133 Molecular cloning and characterization of the NADPH oxidase from the kuruma shrimp, Marsupenaeus japonicus: Early gene up-regulation. Molecular and Cellular Probes (2012) 26 29-41 Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization, Fish & Shellfish Immunology, DOI: 10.1016 / j.fsi.2012.11.26.

  Accordingly, an object of the present invention is to provide means for diagnosing the health condition of shrimps simultaneously and quickly for multiple samples.

  As a result of intensive studies to solve the above problems, the present inventors have found that expression patterns of a plurality of biological defense-related genes are different in shrimp in conjunction with virus and bacterial infection and stress load. Along with the discovery, a system that can quantitatively analyze the dynamics of these multiple biological defense-related genes in one assay has been established, and the present invention has been completed.

The present invention includes the following inventions.
[1] A method for diagnosing the health condition of shrimps, comprising the following steps.
(1) In test samples collected from shrimps, Toll (SEQ ID NO: 1), Toll2 (SEQ ID NO: 2), Tollip (SEQ ID NO: 3), IMD (SEQ ID NO: 4), Relish (SEQ ID NO: 5), STAT ( SEQ ID NO: 6), Socs (SEQ ID NO: 7), Croquemort (SEQ ID NO: 8), ASK1 (SEQ ID NO: 9), JNK (SEQ ID NO: 10), p38 (SEQ ID NO: 11), p53 (SEQ ID NO: 12), IAP (sequence) No. 13), Caspase3 (SEQ ID NO: 14), Wengen (SEQ ID NO: 15), Argonaute1 (SEQ ID NO: 16), Argonaute2 (SEQ ID NO: 17), Dicer1 (SEQ ID NO: 18), Dicer2 (SEQ ID NO: 19), NOS (SEQ ID NO: 19) 20), Nox (SEQ ID NO: 21), Duox (SEQ ID NO: 22), Aox (SEQ ID NO: 23), ALF2 (SEQ ID NO: 24), Crustin (SEQ ID NO: 25), Lysozyme (SEQ ID NO: 26), Astakine (SEQ ID NO: 27) ), Cyclophilin-A (SEQ ID NO: 28), HDGF (SEQ ID NO: 29), MIF (SEQ ID NO: 30) ), PD-ECGF (SEQ ID NO: 31), VEGF (SEQ ID NO: 32), VEGF2 (SEQ ID NO: 33), VEGF-Rcp (SEQ ID NO: 34), BMP (SEQ ID NO: 35), and Myostatin (SEQ ID NO: 36). Measuring the expression level of at least one biological defense-related gene selected from the group
(2) A step of diagnosing the health condition of shrimp based on the measured expression level of the biological defense-related gene
[2] The method according to [1], wherein the expression level of the biological defense-related gene is measured from the amount of mRNA transcribed from the gene.
[3] The method according to [2], wherein the expression level of the mRNA level is measured by an RT-PCR method or a real-time RT-PCR method.
[4] The method according to [3], wherein the RT-PCR is multiplex RT-PCR.

[5] The method according to [4], wherein the gene is amplified using at least one primer set selected from the group consisting of the primer sets described in (p1) to (p37) below.
(p1) Toll gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 38 and a primer consisting of the base sequence shown in SEQ ID NO: 39
(p2) Toll2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 40 and a primer consisting of the base sequence shown in SEQ ID NO: 41
(p3) Tolllip gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 42 and a primer consisting of the base sequence shown in SEQ ID NO: 43
(p4) IMD gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 44 and a primer consisting of the base sequence shown in SEQ ID NO: 45
(p5) Relish gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 46 and a primer consisting of the base sequence shown in SEQ ID NO: 47
(p6) STAT gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 48 and a primer consisting of the base sequence shown in SEQ ID NO: 49
(p7) Socs gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 50 and a primer consisting of the base sequence shown in SEQ ID NO: 51
(p8) Croquemort gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 52 and a primer consisting of the base sequence shown in SEQ ID NO: 53
(p9) ASK1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 54 and a primer consisting of the base sequence shown in SEQ ID NO: 55
(p10) JNK gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 56 and a primer consisting of the base sequence shown in SEQ ID NO: 57
(p11) p38 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 58 and a primer consisting of the base sequence shown in SEQ ID NO: 59
(p12) p53 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 60 and a primer consisting of the base sequence shown in SEQ ID NO: 61
(p13) IAP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 62 and a primer consisting of the base sequence shown in SEQ ID NO: 63
(p14) Caspase3 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 64 and a primer consisting of the base sequence shown in SEQ ID NO: 65
(p15) Wengen gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 66 and a primer consisting of the base sequence shown in SEQ ID NO: 67
(p16) Argonaute1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 68 and a primer consisting of the base sequence shown in SEQ ID NO: 69
(p17) Argonaute2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 70 and a primer consisting of the base sequence shown in SEQ ID NO: 71
(p18) Dicer1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 72 and a primer consisting of the base sequence shown in SEQ ID NO: 73
(p19) Primer set for Dicer2 gene amplification comprising a primer consisting of the base sequence shown in SEQ ID NO: 74 and a primer consisting of the base sequence shown in SEQ ID NO: 75
(p20) NOS gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 76 and a primer consisting of the base sequence shown in SEQ ID NO: 77
(p21) Nox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 78 and a primer consisting of the base sequence shown in SEQ ID NO: 79
(p22) Duox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 80 and a primer consisting of the base sequence shown in SEQ ID NO: 81
(p23) Aox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 82 and a primer consisting of the base sequence shown in SEQ ID NO: 83
(p24) ALF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 84 and a primer consisting of the base sequence shown in SEQ ID NO: 85
(p25) A primer set for amplifying a crustin gene comprising a primer consisting of the base sequence shown in SEQ ID NO: 86 and a primer consisting of the base sequence shown in SEQ ID NO: 87
(p26) Lysozyme gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 88 and a primer consisting of the base sequence shown in SEQ ID NO: 89
(p27) Astakine gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 90 and a primer consisting of the base sequence shown in SEQ ID NO: 91
(p28) Cyclophilin-A gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 92 and a primer consisting of the base sequence shown in SEQ ID NO: 93
(p29) HDGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 94 and a primer consisting of the base sequence shown in SEQ ID NO: 95
(p30) MIF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 96 and a primer consisting of the base sequence shown in SEQ ID NO: 97
(p31) PD-ECGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 98 and a primer consisting of the base sequence shown in SEQ ID NO: 99
(p32) VEGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 100 and a primer consisting of the base sequence shown in SEQ ID NO: 101
(p33) VEGF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 102 and a primer consisting of the base sequence shown in SEQ ID NO: 103
(p34) VEGF-Rcp gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 104 and a primer consisting of the base sequence shown in SEQ ID NO: 105
(p35) VEGF-Rcp-STYKc gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 106 and a primer consisting of the base sequence shown in SEQ ID NO: 107
(p36) BMP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 108 and a primer consisting of the base sequence shown in SEQ ID NO: 109
(p37) Myostatin gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 110 and a primer consisting of the base sequence shown in SEQ ID NO: 111
[6] In the step (2), the gene expression level is analyzed by comparing the gene expression level in the test sample and the gene expression level in the control sample, thereby diagnosing the health condition of the shrimp. The method according to any one of 1] to [5].

[7] A primer set for diagnosing the health condition of the following shrimp (p1) to (p37).
(p1) Toll gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 38 and a primer consisting of the base sequence shown in SEQ ID NO: 39
(p2) Toll2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 40 and a primer consisting of the base sequence shown in SEQ ID NO: 41
(p3) Tolllip gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 42 and a primer consisting of the base sequence shown in SEQ ID NO: 43
(p4) IMD gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 44 and a primer consisting of the base sequence shown in SEQ ID NO: 45
(p5) Relish gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 46 and a primer consisting of the base sequence shown in SEQ ID NO: 47
(p6) STAT gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 48 and a primer consisting of the base sequence shown in SEQ ID NO: 49
(p7) Socs gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 50 and a primer consisting of the base sequence shown in SEQ ID NO: 51
(p8) Croquemort gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 52 and a primer consisting of the base sequence shown in SEQ ID NO: 53
(p9) ASK1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 54 and a primer consisting of the base sequence shown in SEQ ID NO: 55
(p10) JNK gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 56 and a primer consisting of the base sequence shown in SEQ ID NO: 57
(p11) p38 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 58 and a primer consisting of the base sequence shown in SEQ ID NO: 59
(p12) p53 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 60 and a primer consisting of the base sequence shown in SEQ ID NO: 61
(p13) IAP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 62 and a primer consisting of the base sequence shown in SEQ ID NO: 63
(p14) Caspase3 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 64 and a primer consisting of the base sequence shown in SEQ ID NO: 65
(p15) Wengen gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 66 and a primer consisting of the base sequence shown in SEQ ID NO: 67
(p16) Argonaute1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 68 and a primer consisting of the base sequence shown in SEQ ID NO: 69
(p17) Argonaute2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 70 and a primer consisting of the base sequence shown in SEQ ID NO: 71
(p18) Dicer1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 72 and a primer consisting of the base sequence shown in SEQ ID NO: 73
(p19) Primer set for Dicer2 gene amplification comprising a primer consisting of the base sequence shown in SEQ ID NO: 74 and a primer consisting of the base sequence shown in SEQ ID NO: 75
(p20) NOS gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 76 and a primer consisting of the base sequence shown in SEQ ID NO: 77
(p21) Nox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 78 and a primer consisting of the base sequence shown in SEQ ID NO: 79
(p22) Duox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 80 and a primer consisting of the base sequence shown in SEQ ID NO: 81
(p23) Aox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 82 and a primer consisting of the base sequence shown in SEQ ID NO: 83
(p24) ALF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 84 and a primer consisting of the base sequence shown in SEQ ID NO: 85
(p25) A primer set for amplifying a crustin gene comprising a primer consisting of the base sequence shown in SEQ ID NO: 86 and a primer consisting of the base sequence shown in SEQ ID NO: 87
(p26) Lysozyme gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 88 and a primer consisting of the base sequence shown in SEQ ID NO: 89
(p27) Astakine gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 90 and a primer consisting of the base sequence shown in SEQ ID NO: 91
(p28) Cyclophilin-A gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 92 and a primer consisting of the base sequence shown in SEQ ID NO: 93
(p29) HDGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 94 and a primer consisting of the base sequence shown in SEQ ID NO: 95
(p30) MIF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 96 and a primer consisting of the base sequence shown in SEQ ID NO: 97
(p31) PD-ECGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 98 and a primer consisting of the base sequence shown in SEQ ID NO: 99
(p32) VEGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 100 and a primer consisting of the base sequence shown in SEQ ID NO: 101
(p33) VEGF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 102 and a primer consisting of the base sequence shown in SEQ ID NO: 103
(p34) VEGF-Rcp gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 104 and a primer consisting of the base sequence shown in SEQ ID NO: 105
(p35) VEGF-Rcp-STYKc gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 106 and a primer consisting of the base sequence shown in SEQ ID NO: 107
(p36) BMP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 108 and a primer consisting of the base sequence shown in SEQ ID NO: 109
(p37) Myostatin gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 110 and a primer consisting of the base sequence shown in SEQ ID NO: 111
[8] A probe for diagnosing a health condition of a shrimp having a length of at least 15 bases for hybridizing to a polynucleotide comprising the base sequence shown in any one of SEQ ID NOs: 1 to 36 and detecting the polynucleotide.
[9] A kit for diagnosing the state of health of shrimp, comprising at least the primer set according to [7].

  According to the method of the present invention, by analyzing the expression patterns of a plurality of biological defense-related genes, it is possible to grasp the state of health of shrimps and to predict the cause and the occurrence of diseases affecting the state of health for multiple samples. It can be done simultaneously and quickly. According to the method of the present invention, it is possible to identify infectious agents and causative factors by patterning quantitative measurement values of the expression levels of a plurality of biological defense-related genes. Specifically, increased expression of Dicer 2, Argonaute2, and Socs genes suggests infection with viruses, particularly WSSV. Increased expression of Toll and Toll2 genes and antimicrobial peptide-related genes suggests bacterial infection. The deterioration of health due to stress caused by changes in water temperature or air exposure can be determined by an increase in apoptosis-related genes. That is, the method of the present invention does not directly detect individual genes of viruses and bacteria as in the prior art, but occurs when shrimps start a biological defense reaction against a weak virus / bacterial infection. "Amplified biological reactions" can be detected at the gene level. Therefore, the causal factor can be identified with higher sensitivity compared to virus detection and bacterial detection by conventional PCR. Furthermore, since a biological reaction caused by an environmental load such as stress can also be detected, the cause of opportunistic infection caused by stress can be specified by patterning each biological defense-related gene (stress reaction pattern + bacterial infection reaction pattern). Therefore, the method of the present invention can detect virus disease and bacterial disease infection and stress load in cultured shrimp very early and help prevent the spread of infection by taking preventive measures. It can also be used to evaluate the effectiveness of selected pharmaceuticals (antibacterial agents, vaccines, and immunostimulants), and is extremely useful for improving the productivity of cultured shrimps and ensuring food safety and security.

  The present invention provides a method for diagnosing the health condition of shrimp using as an index the expression levels of a plurality of biological defense-related genes in a test sample extracted from shrimp.

  Specifically, the method for diagnosing the state of health of shrimp of the present invention includes a step of measuring the expression level of a biological defense-related gene in a test sample extracted from the shrimp, and the expression of the measured biological defense-related gene Diagnosing the health status of shrimps based on the amount.

  The above-mentioned biodefense-related genes include Toll pathway and IMD pathway (foreign substance recognition mechanism), JAK / STAT (cytokine receptor) pathway, apoptosis-related pathway, RNA interference pathway, free radical production pathway, and antimicrobial peptide production pathway genes, And a gene selected from cytokine-related genes, specifically, Toll (SEQ ID NO: 1 AB333779.1), Toll2 (SEQ ID NO: AB385869.1), Tollip (SEQ ID NO: AB596880.1), IMD (SEQ ID NO: 4 AB478859.1), Relish (SEQ ID NO: 5), STAT (SEQ ID NO: 6: AB501344.1), Socs (SEQ ID NO: 7: AB516427.1), Croquemort (SEQ ID NO: 8: AB540123.1) , ASK1 (SEQ ID NO: 9), JNK (SEQ ID NO: 10: AB523402.1), p38 (SEQ ID NO: 11: AB618970.1), p53 (SEQ ID NO: 12: AB559569.1), IAP (SEQ ID NO: 13), Caspase3 ( SEQ ID NO: 14), Wengen (SEQ ID NO: 15), Argonaute1 (SEQ ID NO: 6: GU265732.1), Argonaute2 (SEQ ID NO: 17: AB665954.1), Dicer1 (SEQ ID NO: 18: GU265733.1), Dicer2 (SEQ ID NO: 19), NOS (SEQ ID NO: 20: AB485762.1), Nox (sequence) No. 21: AB594770.1), Duox (SEQ ID NO: 22), Aox (SEQ ID NO: 23), ALF2 (SEQ ID NO: 24: AB453738.1), Crustin (SEQ ID NO: 25: AB121740.1), and Lysozyme (SEQ ID NO: 26) : AB080238.1), Astakine (SEQ ID NO: 27: AB561905.1), Cyclophilin-A (SEQ ID NO: 28: AB755628), HDGF (SEQ ID NO: 29), MIF (SEQ ID NO: 30: AB755627), PD-ECGF (SEQ ID NO: 31), VEGF (SEQ ID NO 32: AB755625), VEGF2 (SEQ ID NO 33: AB755626), VEGF-Rcp (SEQ ID NO 34), BMP (SEQ ID NO 35), and Myostatin (SEQ ID NO 36). Means at least one gene.

  Diagnosis of the health condition of shrimp in the present invention is carried out by measuring the expression level of at least one, preferably at least two, of the above-mentioned biodefense-related genes. When measuring the expression level of at least two types of biological defense-related genes, but not limited, for example, 5, 10, 15, 20, 25, 30, and 36 biological defense-related genes What is necessary is just to select suitably according to the shrimp kind made into a diagnostic object, and the diagnostic objective. In order to improve the accuracy of diagnosis, a larger number is preferable. For example, preferably 20 or more types, more preferably 25 or more types, more preferably 30 or more types, and most preferably 36 types of genes may be used. .

  In the present invention, the biological defense-related gene is not limited to the gene having the base sequence shown in SEQ ID NOs: 1 to 36, but is substantially the same base sequence as the base sequences shown in SEQ ID NOs: 1 to 36 It also includes genes having “Substantially identical” means, for example, 85% or more, preferably 90% or more, more preferably 95% or more, even more preferably 98% or more, and most preferably 99% of the nucleotide sequence shown in SEQ ID NOs: 1 to 36. % Identity. Here, the identity is determined using, for example, the homology calculation algorithm NCBI BLAST (National Center for Biotechnology information Basic Local Alignment Search Tool) and the following conditions (expected value = 10; allow gap; filtering = ON; match score = 1; can be calculated by mismatch score = -3).

  In the present invention, diagnosis of the health condition of shrimps refers to the presence or absence of pathogenic microorganisms (viruses / bacteria), the elapsed time after infection, and the determination of whether or not the pathogenic microorganisms (viruses / bacteria) are retained. It means to determine whether or not there is a stress load due to the environment.

  The shrimp to be diagnosed in the present invention is not particularly limited as long as it is usually used for raw food or processed food. Specific examples include prawns, bull shrimp (black tiger), vaname shrimp, lobster, lobster, banana shrimp, buckwheat shrimp, pink shrimp, sweet shrimp, monkey shrimp, tiger shrimp, shrimp, moe shrimp, and tiger shrimp.

  The test sample used in the present invention is not particularly limited as long as it is a body fluid, tissue or organ extracted from shrimps, and varies depending on the shrimp species, for example, hemolymph, sputum, stomach, heart, head kidney, Examples include the spleen, thymus, lymphoid organ, hematopoietic organ, leg, and intestinal tract. In addition, examples of the control sample used in the present invention include the same tissues and body fluids as described above derived from shrimps that have been confirmed to be healthy. These samples may be subjected to pretreatment such as separation, extraction, concentration, and purification.

  The expression level of a gene refers to the amount of mRNA that is a transcription product of the gene. In the present invention, the gene expression level in the test sample and the control sample can be measured by any method known to those skilled in the art, and the measurement may be carried out according to a conventional method of each method. Various protocols have been reported for each method, and those skilled in the art can implement according to a known protocol or by appropriately modifying or changing the known protocol.

When measuring the amount of mRNA, extraction of RNA from shrimps can be performed according to techniques commonly used in the art, such as the guanidine thiocyanate-cesium trifluoroacetate method, the guanidine / cesium chloride method, and the like. In addition, RNA extraction is preferably performed according to a unique protocol obtained by improving the extraction protocol attached to a commercially available RNA extraction kit such as RNeasy. The mRNA is prepared by treating the obtained total RNA fraction by an affinity column method using oligo dT-cellulose, poly U-sepharose or the like, or a batch method. Furthermore, poly (A) ⁺ RNA may be further fractionated by sucrose density gradient centrifugation or the like.

  The measurement of the amount of mRNA is not particularly limited as long as it is a method capable of measuring a desired amount of mRNA, and can be appropriately selected from known methods. For example, a gene amplification method using an oligonucleotide that hybridizes to the above-mentioned biodefense-related gene as a primer, or a hybridization method using an oligo (poly) nucleotide that hybridizes to the above-mentioned biodefense-related gene as a probe Can do. Specific examples include RT-PCR method, real-time RT-PCR method, microarray method, Northern blot method, dot blot method, RNase protection assay method and the like. Primers and probes used in the above method can be labeled, and the amount of mRNA can be measured by examining the signal intensity of the label. Among these, the real-time RT-PCR method is preferable because RNA can be directly used for a sample and gene quantification can be performed from the number of temperature cycles required for amplification by optically measuring the gene amplification process. In addition, a multiplex RT-PCR method and a multiplex real-time RT-PCR method using a plurality of primer sets in the same reaction system are more preferable in that a plurality of biological defense-related genes can be simultaneously and rapidly quantified.

  In the measurement of gene expression level, it is preferable to obtain a plurality of data for each gene of the same test sample from the viewpoint of data reproducibility. In that case, the average value of these data can be used as the expression level of each gene. Also, reproducibility can be verified from the variance or standard deviation value of these data.

  Next, the health condition of the shrimp is diagnosed based on the measurement result of the expression level of the biological defense-related gene. Diagnosis is performed, for example, by calculating the gene expression level (relative expression level) in the test sample with respect to the gene expression level in the control sample for each of the above-described biological defense-related genes. Here, as the control sample, for example, the same tissues and body fluids (negative control) extracted from healthy shrimp and shrimp in a clean pond of shrimp farm, negative shrimp affected by viral diseases and bacterial diseases. Any of the same tissues and body fluids (positive control) as those described above, which are extracted from the above mentioned species, may be used. Further, it is preferable to measure the expression level in a test sample and a control sample using a housekeeping gene such as EF-1α having a constant expression level as an internal standard gene, and correct the RNA amount between the samples.

The expression patterns linked to the above-mentioned biodefense- related genes and virus (WSSV) infection, bacterial ( Vibrio penaeicida ) infection, and stress load in shrimp are as follows.
(A) Genes whose expression is enhanced during WSSV virus infection: Dicer2, Nox, Argonaute2, p38, Socs, Aox, Tollip, VEGF (132h)
Genes with decreased expression: p53, IAP, Wengen, Caspase3, Lysozyme, NOS, STAT, Toll, ASK1, VEGF (72h)

(B) Bacteria ( Vibrio penaeicida ) infected genes whose expression is enhanced: Toll, Toll2, Croquemort, ASK1, Duox, ALF2, Crustin, Lysozyme, Caspase3, NOS, Cyclophilin A, HDGF, MIF (24h), PD-ECGF
Genes with decreased expression: Tollip, IMD, JNK, MIF (108h), VEGF

(C) When stress is applied
(C-1) Genes whose expression increases during sludge stress: p38, ALF2
Genes with decreased expression: JNK, Argonaute2
(C-2) Genes whose expression increases during stress load at -8 ℃ water temperature decrease: NOS
Genes with decreased expression: Caspase3, Nox
(C-3) 24-hour air exposure stress:
Genes with enhanced expression: Toll, IMD, ASK1, JNK, p38, IAP, Dicer1, ALF2, Lysozyme
Gene whose expression decreases: Caspase3

  Therefore, as a result of measuring the expression level of the biological defense-related gene, if the expression pattern of the biological defense-related gene in the test sample is an expression pattern similar to (A), the shrimp from which the test sample was collected is If it is highly likely that the virus is infected with WSSV virus and the expression pattern is similar to (B) above, it is highly likely that the shrimp collected from the test sample is infected with Vibrio bacteria. If it is an expression pattern approximated to (C), it can be determined that stress is applied and the risk of developing a disease is high. In addition, for example, when compared with the expression pattern of the biological defense-related gene in the control sample (negative control), the expression pattern of the biological defense-related gene in the test sample approximates the expression pattern of the biological defense-related gene in the control sample. The more likely it is, the more likely the virus or bacterial infection is, the poorer the health condition is, and the closer to the expression pattern of the biological defense-related genes in the control sample, the less likely the virus or bacterial infection is, Can be determined to be good.

  In addition, a diagnosis can be made by setting in advance a cutoff value of the expression level of the biological defense-related gene and comparing the expression level of the biological defense-related gene in the test sample with the cutoff value. For example, when a gene whose expression level is increased by WSSV virus infection is used as an indicator, it may be infected with WSSV virus when the expression level of the biological defense-related gene in the test sample is equal to or higher than the set cutoff value. Diagnosis is relatively high.

  When quantifying gene expression by the RT-PCR method, the primer (set) used can be designed based on each base sequence of the above-mentioned biological defense-related genes and can be prepared through synthesis and purification steps. . The primer size (number of bases) is 20 to 40 bases in order to allow specific annealing with the template DNA. The primer is designed so that a pair of primers consisting of a sense strand (5 'end) and an antisense strand (3' end) or a pair (two) of primers does not anneal with each other. Avoid self-complementary sequences as well as avoid hairpin structures in the primer. Furthermore, in order to ensure stable binding to the template DNA, the GC content is set to about 50% so that GC-rich or AT-rich is not unevenly distributed in the primer. Since the annealing temperature depends on Tm (melting temperature), primers that are close to each other at a Tm value of 55 to 65 ° C. are selected in order to obtain a highly specific PCR product. It is also necessary to pay attention to adjusting the final concentration of primers used in PCR to be about 0.1 to 1 μM. Also, commercially available software for primer design such as Oligo ™ [manufactured by National Bioscience Inc. (USA)], GENETYX [manufactured by Software Development Co., Ltd. (Japan)], etc. can be used.

  Specific examples of the primer set that can amplify each of the above-mentioned biological defense-related genes in the present invention include the following primer sets. In the case of multiplex PCR, a plurality of biological defense-related genes can be simultaneously amplified in the same reaction solution by using a plurality of the following primer sets.

p1) Toll gene amplification primer set:
Fw: CTGTTCCCCAAGCATTCAGT (SEQ ID NO: 38)
Rv: ACGAGTGGGTTCTCCCCTAT (SEQ ID NO: 39)
p2) Toll2 gene amplification primer set:
Fw: TTCACCTTTTTGCAAGTCCC (SEQ ID NO: 40)
Rv: GACAATAACCATGGGTTGCC (SEQ ID NO: 41)
p3) Tollip gene amplification primer set:
Fw: CCTGAGTGGAAAGCTTGGAG (SEQ ID NO: 42)
Rv: GTGAGCAGGTGGCAAGGTAT (SEQ ID NO: 43)

p4) IMD gene amplification primer set:
Fw: CAGCTGGAGAACATGACAGC (SEQ ID NO: 44)
Rv: TTTGAGTGAGTCTGGCAACG (SEQ ID NO: 45)
p5) Relish gene amplification primer set:
Fw: GAGAGGTGACAGAGGTGGGA (SEQ ID NO: 46)
Rv: ATATGGGCGGTTGTAAGCAG (SEQ ID NO: 47)

p6) STAT gene amplification primer set:
Fw: CCACTGGAAGGGGACTAACA (SEQ ID NO: 48)
Rv: GCAAAGAACCACTCCCAAAA (SEQ ID NO: 49)
p7) Socs gene amplification primer set:
Fw: GGAGAGCGGCTGGTACTATG (SEQ ID NO: 50)
Rv: GTCTAACCTGAATTTGCCGC (SEQ ID NO: 51)

P8) Croquemort gene amplification primer set:
Fw: TCACCCTCAATACAGTGCCA (SEQ ID NO: 52)
Rv: CGACAGCTTTTTCGTTGACA (SEQ ID NO: 53)
P9) ASK1 gene amplification primer set:
Fw: AGACAAAGGCCCACATGAAG (SEQ ID NO: 54)
Rv: AGGACAACATCACCCGAAAG (SEQ ID NO: 55)
p10) JNK gene amplification primer set:
Fw: TGCATAATGGGGGAGATGAT (SEQ ID NO: 56)
Rv: GTCGGCTGTAACCTCGACAT (SEQ ID NO: 57)
p11) Primer set for p38 gene amplification:
Fw: ATACCTGGCTCAGTATGCCG (SEQ ID NO: 58)
Rv: TTCTTTCCACTTCTCGGTGG (SEQ ID NO: 59)
p12) p53 gene amplification primer set:
Fw: AGAAGAGCAGGACTCCCACA (SEQ ID NO: 60)
Rv: AAGATTTCACTTCGGCCTCA (SEQ ID NO: 61)
p13) IAP gene amplification primer set:
Fw: TGTACACCAAGTCCCAGCAG (SEQ ID NO: 62)
Rv: TGATGCTTGCTCCAACAGTC (SEQ ID NO: 63)
p14) Caspase 3 gene amplification primer set:
Fw: TATGTGGGCTTCCTACCCAG (SEQ ID NO: 64)
Rv: ACCTTGAGAAGGATGGAGGC (SEQ ID NO: 65)
p15) Wengen gene amplification primer set:
Fw: TGTACACGCTGTCATGGTCC (SEQ ID NO: 66)
Rv: ATGACCACGTTCCTCTTTCG (SEQ ID NO: 67)

p16) Argonaute1 gene amplification primer set:
Fw: GAAGGACGTGACAGGGTGTT (SEQ ID NO: 68)
Rv: ATGTCATGGATGGCAGATGA (SEQ ID NO: 69)
p17) Argonaute2 gene amplification primer set:
Fw: ACCTGAAGAACCCAAAGCCT (SEQ ID NO: 70)
Rv: CCTATCATCTGCTGGTGGGT (SEQ ID NO: 71)
p18) Dicer1 gene amplification primer set:
Fw: CATCGGAGTATGGCCAAGAT (SEQ ID NO: 72)
Rv: AGCCCTGGGATCTTCCTTTA (SEQ ID NO: 73)
p19) Dicer2 gene amplification primer set:
Fw: AAAGGCCTCACAGGGAAAAT (SEQ ID NO: 74)
Rv: CGGAATCTGATGCCAAAAAT (SEQ ID NO: 75)

p20) NOS gene amplification primer set:
Fw: ATGTATGCCAAGAAGCTGGG (SEQ ID NO: 76)
Rv: AGACGTGACCACCAACACAA (SEQ ID NO: 77)
p21) Nox gene amplification primer set:
Fw: TGCACATGACAAGACAAGCA (SEQ ID NO: 78)
Rv: ATGAACCAGACTAGGTGCCG (SEQ ID NO: 79)
p22) Duox gene amplification primer set:
Fw: AGATCGCGAAAACAAACACC (SEQ ID NO: 80)
Rv: TCGTAGGTGAGCGACTCCTT (SEQ ID NO: 81)
P23) Aox gene amplification primer set:
Fw: AAGGAGCATCCTGAACGCTA (SEQ ID NO: 82)
Rv: GACCAACTCCGAGGTGAAGA (SEQ ID NO: 83)

p24) ALF2 gene amplification primer set:
Fw: GCACTCGGATGAAGTGGAGT (SEQ ID NO: 84)
Rv: AAGGTTTCTTTGCAGGGCTT (SEQ ID NO: 85)
p25) Crustin gene amplification primer set:
Fw: GCGGTGTAGGAGGTGTTCAT (SEQ ID NO: 86)
Rv: CGACCCACTACCACCTAAGC (SEQ ID NO: 87)
p26) Lysozyme gene amplification primer set:
Fw: CGATCTCATGTCCGACGATA (SEQ ID NO: 88)
Rv: AAGCCACCCATGCTGTGTAT (SEQ ID NO: 89)

p27) Astakine gene amplification primer set:
Fw: TCAGATTTCCGTAAGGGACG (SEQ ID NO: 90)
Rv: TCTTCGGAGACCGAGTTGTC (SEQ ID NO: 91)
p28) Cyclophilin-A gene amplification primer set:
Fw: CGTGATCCCCAACTTCATGT (SEQ ID NO: 92)
Rv: AACTGTGACCCGTTGGTGTT (SEQ ID NO: 93)
p29) HDGF gene amplification primer set:
Fw: ATGAAACGGCTTTGCTGAAG (SEQ ID NO: 94)
Rv: CAGAGACTTTCTGCCAGGCT (SEQ ID NO: 95)
p30) Primer set for MIF gene amplification:
Fw: ACCATTGGGAAACCAGAACA (SEQ ID NO: 96)
Rv: CACCTAATTTGCCAAGGCTC (SEQ ID NO: 97)
p31) PD-ECGF gene amplification primer set:
Fw: CACACTCGACAAGCTGGAGA (SEQ ID NO: 98)
Rv: GCCTTCTTGCTGATGATGGA (SEQ ID NO: 99)
p32) VEGF gene amplification primer set:
Fw: CATTCAGCTGGACCAGGAAT (SEQ ID NO: 100)
Rv: CCTGCACTCAAACTCCATCA (SEQ ID NO: 101)
p33) VEGF2 gene amplification primer set:
Fw: CTGTCCGTGGAAAAGAGGAA (SEQ ID NO: 102)
Rv: TTTTTGGCATCCACAACTCA (SEQ ID NO: 103)
p34) VEGF-Rcp gene amplification primer set:
Fw: GCGAGACAAAGTTCTCCTGG (SEQ ID NO: 104)
Rv: CTGGCCTCGATGGTGTAGTT (SEQ ID NO: 105)
p35) VEGF-Rcp-STYKc gene amplification primer set:
Fw: TCAAGATGATGAAGTCGCGT (SEQ ID NO: 106)
Rv: GTAGTCGAGGATGTTGCCGT (SEQ ID NO: 107)
p36) BMP gene amplification primer set:
Fw: TCGTCCAGGACCAATACCTC (SEQ ID NO: 108)
Rv: TCCTCACTTGGGATGTTCGT (SEQ ID NO: 109)
p37) Myostatin gene amplification primer set:
Fw: TCATTGCAAATGACTCCGAA (SEQ ID NO: 110)
Rv: ACTGGAATTCCGTCTGTTGC (SEQ ID NO: 111)

  In addition, the oligonucleotide consisting of the base sequences of SEQ ID NOs: 38 to 111 constituting the primer set has a base sequence within the range having substantially the same function as the oligonucleotide consisting of the base sequences of SEQ ID NOs: 38 to 111. The oligonucleotide may be modified. Such a modified oligonucleotide consists of a base sequence having 95% or more, preferably 98% or more identity to the base sequence of SEQ ID NOs: 38 to 111, and for amplification of each corresponding biological defense-related gene. Examples include oligonucleotides that can function as primers. Modification includes deletion, substitution, insertion, or addition, and the number of bases to be modified is 3 or less, preferably 2 or less, more preferably 1. The base may be added on the 3 ′ side or the 5 ′ side.

  Each oligonucleotide of the above primer set is prepared by a DNA / RNA automatic synthesizer (for example, Applied Biosystems) commonly used in the art by methods known in the art, for example, phosphotriethyl method, phosphodiester method, etc. It is possible to synthesize using Model 394 manufactured by the company.

  PCR amplification is performed using the above primer set using cDNA synthesized from RNA extracted from the sample as a template. PCR amplification is not particularly limited except that the above primer set is used, and may be performed according to a conventional method. Specifically, a cycle including denaturation of template DNA, annealing of the primer to the template, and primer extension reaction using a thermostable enzyme (DNA polymerase such as Taq polymerase or Tth DNA polymerase from Thermus themophilis) is repeated. Thus, a fragment containing a specific gene sequence of each target biological defense-related gene is amplified. The composition of the PCR reaction solution and the PCR reaction conditions (temperature cycle, number of cycles, etc.) should be determined by a person skilled in the art based on preliminary experiments, etc. under conditions such that a PCR amplification product can be obtained with high sensitivity in PCR using the above primer set. Can be selected and set appropriately. Methods for selecting appropriate PCR reaction conditions based on the Tm of the primer are well known in the art, for example, first a denaturation reaction at 94 ° C. for 5 minutes and then at 94 ° C. for 50 seconds (denaturation). The extension reaction can be carried out at 55 ° C. for 50 seconds (annealing), 72 ° C. for 1 minute (extension) for 30 cycles, and finally 72 ° C. for 1 minute. However, the conditions shown here are only examples, and the enzyme used, the reaction temperature, the reaction time, the number of cycles, etc. can be appropriately changed. Such a series of PCR operations can be performed using a commercially available PCR kit or PCR apparatus according to the operating instructions. For example, GeneAmp PCR System 9700 (Applied Biosystems), GeneAmp PCR System 9600 (Applied Biosystems) or the like can be used as the PCR apparatus. In the method of the present invention, RNA is converted to cDNA and PCR is performed (RT -PCR) The Takara One Step RT-PCR Kit AMV (manufactured by TAKARA), which can be carried out continuously in one tube, can be suitably used.

  PCR amplification products are detected using conventional methods such as agarose gel electrophoresis and capillary electrophoresis, methods such as DNA hybridization and real-time PCR. Alternatively, the amplification product can be detected by performing the PCR using a primer previously labeled with a fluorescent dye or the like. In DNA hybridization, a PCR amplification product is bound to an immobilization carrier such as a microarray, and the PCR amplification product is confirmed by fluorescence or enzymatic reaction. The immobilization carrier for detection is a support on which a DNA fragment having a sequence capable of hybridizing with a biological defense-related gene to be detected is immobilized. As the support, for example, a nylon film, a nitrocellulose film, glass, a silicon chip, or the like can be used.

  In addition, as a probe, a poly (oligo) nucleotide consisting of a continuous partial sequence of the base sequence of each biological defense-related gene, or a poly (oligo) consisting of a partial sequence of a complementary sequence to the base sequence of each biological defense-related gene ) Nucleotide fragments are used. The length of the probe is not particularly limited. For example, a specific hybrid can be formed between target genes as long as it is 15 bases or more, preferably 20 bases or more. The nucleotide fragment can be synthesized, for example, by cleaving a polynucleotide (cDNA) having each base sequence with an appropriate restriction enzyme or by a well-known chemical synthesis technique. In addition, since it is well known to those skilled in the art that an oligonucleotide that can be used as a primer for specifically amplifying the biological defense-related gene can also be used as a probe for specifically detecting the gene, An oligonucleotide that can be used as a probe may be designed based on this knowledge.

When the nucleotide fragment is used as a probe, it is labeled with a labeling substance. The labeling substance is not particularly limited, and for example, a fluorescent substance, a radioisotope, an enzyme, avidin, or biotin can be used. Examples of fluorescent substances include fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRIC), cyanine dyes (eg Cy3, Cy5 of Cy Dye ^TM series), acetylaminofluorene (AFF), etc. Examples include peroxidase, β-galactosidase, alkaline phosphatase and the like, and examples of the radioisotope include ¹²⁵ I and ³ H.

  The poly (oligo) nucleotide fragment used as the probe is characterized by hybridization with the biological defense-related gene under stringent conditions. Here, the stringent condition is a condition that enables selective and detectable specific binding between the biological defense-related gene and the poly (oligo) nucleotide fragment. Stringent conditions are defined by salt concentration, organic solvent (eg, formamide), temperature, and other known conditions. Stringency is increased by decreasing the salt concentration, increasing the organic solvent concentration, or increasing the hybridization temperature. For example, stringent salt concentrations are typically about 750 mM or less NaCl and about 75 mM or less trisodium citrate, more preferably about 500 mM or less NaCl and about 50 mM or less trisodium citrate, most preferably about 250 mM NaCl. And about 25 mM or less of trisodium citrate. The stringent organic solvent concentration is about 35% or more, preferably about 50% or more of formamide. The stringent temperature condition is about 30 ° C. or higher, preferably about 37 ° C. or higher, more preferably about 42 ° C. or higher. Other conditions include the hybridization time, the concentration of the detergent (for example, SDS), the presence or absence of carrier DNA, and various stringencies can be set by combining these conditions.

  The probe may be used by being immobilized on an immobilization carrier such as a microarray. The microarray formation method is not particularly limited, and any method available to those skilled in the art may be used. For example, a method of directly synthesizing a probe on the surface of a solid support (on-chip method), or a probe prepared in advance There are methods for binding to the surface of a solid support. When a probe is directly synthesized on the surface of a solid support, a protective matrix that is selectively removed by light irradiation is used, and a predetermined micromatrix is formed by combining photolithography technology and solid phase synthesis technology used for semiconductor manufacturing. A method for selective synthesis of oligonucleotides in a region is common. On the other hand, in the method of preparing the probe in advance and binding it to the surface of the solid phase carrier, depending on the type of probe nucleic acid or the type of solid phase carrier, a polycation compound, an amino group, an aldehyde group, an epoxy group, etc. can be used with a spotter device. A method of spotting on the surface of a solid phase carrier surface-treated with a silane coupling agent or the like, and synthesizing a probe nucleic acid into which a reactive group has been introduced and preliminarily forming a reactive group on the surface of the solid phase carrier surface For example, a method of spotting the probe nucleic acid and covalently binding and fixing the probe nucleic acid to the surface of the solid phase carrier can be used.

  Reagents for measuring the expression level of the biological defense-related gene used in the method of the present invention can be combined in advance to form a kit. For example, the kit may contain at least the poly (oligo) nucleotide used as the primer set and probe. In addition, the kit contains RNA extraction reagents, PCR reagents such as PCR buffers and DNA polymerase, detection reagents such as stains and electrophoresis gels, immobilization carriers, labeling substances, Substrate compounds used for detection of the label, positive and negative standard samples, instructions describing how to use the kit, and the like can also be included. The reagent in the kit may be a solution or a lyophilized product.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but these examples do not limit the present invention.
(Example 1) Construction of a multi-sample gene expression analysis system Method (1) Test Prawns Prawns with an average weight of 12.0 g were purchased from a prawn farm in Miyazaki Prefecture and used for experiments.

(2) Multiplex design (2-1) Gene selection In the construction of the gene expression analysis system for diagnosis of shrimp of the present invention, among the many biological defense-related gene groups in the prawns that have been identified so far 36 genes (Table 1), which are particularly important, were selected, and optimization was examined. EF-1α was used as an internal standard gene.

(2-2) Gene-specific primer design
GenomeLab ^™ GeXP eXpress Profiler software (Beckman Coulter, USA) was used. First, the full length sequence of the selected gene was registered. Next, the minimum interval between PCR products was set to 3 bp, the minimum size of PCR products was set to 100 bp, and the maximum size was set to 350 bp, and the gene primers shown below were designed within the ranges. However, for the VEGF-Receptor gene, two regions (VEGF-Rcp and VEGF-Rcp-STYKc) were targeted and primers were designed respectively. In addition to the specific sequences in each gene, the designed primers include universal sequences, AGGTGACACTATAGAATA (SEQ ID NO: 114) for the forward primer, and GTACGACTCACTATAGGGA (SEQ ID NO: 115) for the reverse primer. 'Incorporated on the distal side.

[Toll gene amplification primer set]
Fw: CTGTTCCCCAAGCATTCAGT (SEQ ID NO: 38)
Rv: ACGAGTGGGTTCTCCCCTAT (SEQ ID NO: 39)
[Toll2 gene amplification primer set]
Fw: TTCACCTTTTTGCAAGTCCC (SEQ ID NO: 40)
Rv: GACAATAACCATGGGTTGCC (SEQ ID NO: 41)
[Tollip gene amplification primer set]
Fw: CCTGAGTGGAAAGCTTGGAG (SEQ ID NO: 42)
Rv: GTGAGCAGGTGGCAAGGTAT (SEQ ID NO: 43)
[IMD gene amplification primer set]
Fw: CAGCTGGAGAACATGACAGC (SEQ ID NO: 44)
Rv: TTTGAGTGAGTCTGGCAACG (SEQ ID NO: 45)
[Relish gene amplification primer set]
Fw: GAGAGGTGACAGAGGTGGGA (SEQ ID NO: 46)
Rv: ATATGGGCGGTTGTAAGCAG (SEQ ID NO: 47)
[STAT gene amplification primer set]
Fw: CCACTGGAAGGGGACTAACA (SEQ ID NO: 48)
Rv: GCAAAGAACCACTCCCAAAA (SEQ ID NO: 49)
[Socs gene amplification primer set]
Fw: GGAGAGCGGCTGGTACTATG (SEQ ID NO: 50)
Rv: GTCTAACCTGAATTTGCCGC (SEQ ID NO: 51)
[Croquemort gene amplification primer set]
Fw: TCACCCTCAATACAGTGCCA (SEQ ID NO: 52)
Rv: CGACAGCTTTTTCGTTGACA (SEQ ID NO: 53)
[ASK1 gene amplification primer set]
Fw: AGACAAAGGCCCACATGAAG (SEQ ID NO: 54)
Rv: AGGACAACATCACCCGAAAG (SEQ ID NO: 55)
[JNK gene amplification primer set]
Fw: TGCATAATGGGGGAGATGAT (SEQ ID NO: 56)
Rv: GTCGGCTGTAACCTCGACAT (SEQ ID NO: 57)
[P38 gene amplification primer set]
Fw: ATACCTGGCTCAGTATGCCG (SEQ ID NO: 58)
Rv: TTCTTTCCACTTCTCGGTGG (SEQ ID NO: 59)
[Primer set for p53 gene amplification]
Fw: AGAAGAGCAGGACTCCCACA (SEQ ID NO: 60)
Rv: AAGATTTCACTTCGGCCTCA (SEQ ID NO: 61)
[IAP gene amplification primer set]
Fw: TGTACACCAAGTCCCAGCAG (SEQ ID NO: 62)
Rv: TGATGCTTGCTCCAACAGTC (SEQ ID NO: 63)
[Caspase 3 gene amplification primer set]
Fw: TATGTGGGCTTCCTACCCAG (SEQ ID NO: 64)
Rv: ACCTTGAGAAGGATGGAGGC (SEQ ID NO: 65)
[Wengen gene amplification primer set]
Fw: TGTACACGCTGTCATGGTCC (SEQ ID NO: 66)
Rv: ATGACCACGTTCCTCTTTCG (SEQ ID NO: 67)
[Argonaute1 gene amplification primer set]
Fw: GAAGGACGTGACAGGGTGTT (SEQ ID NO: 68)
Rv: ATGTCATGGATGGCAGATGA (SEQ ID NO: 69)
[Argonaute2 gene amplification primer set]
Fw: ACCTGAAGAACCCAAAGCCT (SEQ ID NO: 70)
Rv: CCTATCATCTGCTGGTGGGT (SEQ ID NO: 71)
[Dicer1 gene amplification primer set]
Fw: CATCGGAGTATGGCCAAGAT (SEQ ID NO: 72)
Rv: AGCCCTGGGATCTTCCTTTA (SEQ ID NO: 73)
[Dicer2 gene amplification primer set]
Fw: AAAGGCCTCACAGGGAAAAT (SEQ ID NO: 74)
Rv: CGGAATCTGATGCCAAAAAT (SEQ ID NO: 75)
[NOS gene amplification primer set]
Fw: ATGTATGCCAAGAAGCTGGG (SEQ ID NO: 76)
Rv: AGACGTGACCACCAACACAA (SEQ ID NO: 77)
[Nox gene amplification primer set]
Fw: TGCACATGACAAGACAAGCA (SEQ ID NO: 78)
Rv: ATGAACCAGACTAGGTGCCG (SEQ ID NO: 79)
[Duox gene amplification primer set]
Fw: AGATCGCGAAAACAAACACC (SEQ ID NO: 80)
Rv: TCGTAGGTGAGCGACTCCTT (SEQ ID NO: 81)
[Aox gene amplification primer set]
Fw: AAGGAGCATCCTGAACGCTA (SEQ ID NO: 82)
Rv: GACCAACTCCGAGGTGAAGA (SEQ ID NO: 83)
[ALF2 gene amplification primer set]
Fw: GCACTCGGATGAAGTGGAGT (SEQ ID NO: 84)
Rv: AAGGTTTCTTTGCAGGGCTT (SEQ ID NO: 85)
[Crustin gene amplification primer set]
Fw: GCGGTGTAGGAGGTGTTCAT (SEQ ID NO: 86)
Rv: CGACCCACTACCACCTAAGC (SEQ ID NO: 87)
[Lysozyme gene amplification primer set]
Fw: CGATCTCATGTCCGACGATA (SEQ ID NO: 88)
Rv: AAGCCACCCATGCTGTGTAT (SEQ ID NO: 89)
[Astakine gene amplification primer set]
Fw: TCAGATTTCCGTAAGGGACG (SEQ ID NO: 90)
Rv: TCTTCGGAGACCGAGTTGTC (SEQ ID NO: 91)
[Cyclophilin-A gene amplification primer set]
Fw: CGTGATCCCCAACTTCATGT (SEQ ID NO: 92)
Rv: AACTGTGACCCGTTGGTGTT (SEQ ID NO: 93)
[Primer set for HDGF gene amplification]
Fw: ATGAAACGGCTTTGCTGAAG (SEQ ID NO: 94)
Rv: CAGAGACTTTCTGCCAGGCT (SEQ ID NO: 95)
[MIF gene amplification primer set]
Fw: ACCATTGGGAAACCAGAACA (SEQ ID NO: 96)
Rv: CACCTAATTTGCCAAGGCTC (SEQ ID NO: 97)
[PD-ECGF gene amplification primer set]
Fw: CACACTCGACAAGCTGGAGA (SEQ ID NO: 98)
Rv: GCCTTCTTGCTGATGATGGA (SEQ ID NO: 99)
[Primer set for VEGF gene amplification]
Fw: CATTCAGCTGGACCAGGAAT (SEQ ID NO: 100)
Rv: CCTGCACTCAAACTCCATCA (SEQ ID NO: 101)
[Primer set for VEGF2 gene amplification]
Fw: CTGTCCGTGGAAAAGAGGAA (SEQ ID NO: 102)
Rv: TTTTTGGCATCCACAACTCA (SEQ ID NO: 103)
[Primer set for VEGF-Rcp gene amplification]
Fw: GCGAGACAAAGTTCTCCTGG (SEQ ID NO: 104)
Rv: CTGGCCTCGATGGTGTAGTT (SEQ ID NO: 105)
[Primer set for VEGF-Rcp-STYKc gene amplification]
Fw: TCAAGATGATGAAGTCGCGT (SEQ ID NO: 106)
Rv: GTAGTCGAGGATGTTGCCGT (SEQ ID NO: 107)
[BMP gene amplification primer set]
Fw: TCGTCCAGGACCAATACCTC (SEQ ID NO: 108)
Rv: TCCTCACTTGGGATGTTCGT (SEQ ID NO: 109)
[Myostatin gene amplification primer set]
Fw: TCATTGCAAATGACTCCGAA (SEQ ID NO: 110)
Rv: ACTGGAATTCCGTCTGTTGC (SEQ ID NO: 111)
[EF-1α gene amplification primer set]
Fw: GACATTGCCCTGTGGAAGTT (SEQ ID NO: 112)
Rv: CCTCAGAGTACTTGGGCTCG (SEQ ID NO: 113)

(3) Preparation of RNA samples to be used In order to optimize multiplex primers, RNA samples in which each gene is expressed in a certain amount are required. In this test, referring to the results of real-time PCR, each organ health prawns (Sample 1), Vibrio penaeicida killed stimulation after 6 hours of prawns gill (Sample 2), and blood prawns 40 hours after WSSV infection Lymph (sample 3) was used as a material for RNA sampling.

Sample 1: Collection of each organ of healthy prawns Samples of stomach, lymphoid organs, midgut line, sputum, intestinal tract, muscles, brain, heart, blood cells and abdominal nerves were collected from healthy prawns.

Sample 2:.. V in in vivo conditions Penaeicida of killed stimulation prawns gill collection First, dissolve the V Penaeicida cultured in Marin'aga in PBS, and adjusted to 10 ⁶ cells / ml concentration. Heat treatment was performed at 75 ° C. for 30 minutes, and 100 μl each of 3 second prawn abdominal muscles was injected. After that, cocoon sampling was performed 6 hours later.

Sample 3: Harvesting WSSV-infected prawns under in vivo conditions
WSSV, adjusted to a concentration of 10 ⁴ copies / ml, was injected in 100 μl into 3 second prawn abdominal muscles. Thereafter, hemolymph was sampled 40 hours later.

(4) Forward / Reverse Singlet RT-PCR reaction was carried out with the primer pair of each gene alone, and the designed primer was confirmed.
(4-1) Total RNA extraction
Transfer the sample collected in (3) to a 1.5 ml tube, add 200 μl of RNAiso Plus (TaKaRa, Japan), homogenize well, add 800 μl of RNAiso Plus (TaKaRa, Japan) again, and use a 1.0 ml syringe (with 20G needle). The mixture was stirred about 20 times and allowed to stand at 22 ° C. for 5 minutes. Next, 200 μl of chloroform (Wako, Japan) was added, stirred vigorously, allowed to stand at room temperature for 3 minutes, and centrifuged at 12,000 G at 4 ° C. for 15 minutes. The supernatant was transferred to a new 1.5 ml Eppendorf tube, 500 μl of isopropyl alcohol (Wako, Japan) was added, the mixture was gently tumbled, allowed to stand at room temperature for 10 minutes, and then centrifuged at 12,000 G at 4 ° C. for 10 minutes. . The supernatant was removed, 1 ml of 75% ethanol (Wako, Japan) was added, gently mixed, and then centrifuged at 8,000 G and 4 ° C. for 5 minutes. The supernatant was removed, air-dried for 10 minutes, and the pellet (Total RNA) was dissolved in 10 μl of Nucleas Free Water (Wako, Japan) to obtain an RNA solution.

(4-2) Preparation of cDNA First, prepare DNase treatment solution (Table 2) using DNase I (Invitrogen, Japan), mix by tapping, and mix for 20 minutes at room temperature. I put it. DNase treatment was performed by adding 0.75 μl of 25 mM EDTA (pH: 8.0) and performing a reaction at 65 ° C. for 10 minutes using a thermal cycler (BIO RAD, Mycycler).

  Subsequently, reverse transcription reaction was performed using GenemeLab GeXP Start Kit (BECKMAN COULTER, USA). Prepare a reaction solution for cDNA synthesis (Table 3) and use a thermal cycler (BIO RAD, Mycycler) at 48 ° C for 1 minute, 37 ° C for 5 minutes, 42 ° C for 60 minutes, 95 ° C for 5 minutes, 4 Reverse transcription reaction was performed at 5 ° C. for 5 minutes.

(4-3) PCR reaction Using the prepared cDNA as a template, PCR was performed using a PCR reaction solution having the composition shown in Table 4, and each gene was amplified. PCR was carried out at 95 ° C for 10 minutes, followed by thermal denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension reaction at 68 ° C for 1 minute for 45 cycles, using a thermal cycler (BIO RAD, Mycycler) I went.

(4-4) Capillary electrophoresis
The PCR product amplified in (4-3) was diluted 10-fold with 10 mM Tris-HCl (pH 8.0). Transfer the total amount of the sample dissolved in SLS (Table 5) to the sample plate, put 8-9 drops of the dedicated separation buffer (BECKMAN COULTER, USA) on the buffer plate at the same position as the sample and place it in the CEQ8000. The plate was set and the method started.

(4-5) Data analysis For each gene, the RT-PCR reaction from (4-1) to (4-4) was performed, and only the target gene and Kan ^r peak were detected. It was confirmed whether or not the peak was detected at the designed size. Originally, if necessary, redesign the primer and perform the RT-PCR reaction from (4-1) to (4-4) again to construct the appropriate primer, but this time without redesigning, We proceeded to the next procedure using only available primer pair genes.

(5) Forward plex / Reverse plex
(5-1) Examination of 5 basic genes
Five basic genes were examined by the same method as (4-1) to (4-4). However, the reverse primer at the time of cDNA preparation and the forward primer at the time of PCR reaction were both mixed genes. Various gene combinations were examined, and only the target gene and Kan ^r peak were detected, and it was confirmed whether the peak derived from the target gene was detected at the designed size. Moreover, even when a non-specific peak was detected, it was determined that there was no effect on the result if it was 3 bp or more away from the target gene. Among them, the optimal 5 gene combination was selected.

(5-2) Addition of genes based on 5 genes
Based on the 5 genes selected in (5-1), one gene was added at a time, and the added genes were examined in the same manner as in (4-1) to (4-4). However, the reverse primer at the time of cDNA preparation and the forward primer at the time of PCR reaction were both mixed genes. We examined the addition of various genes, detected only the target gene and Kan ^r peak, and confirmed whether the peak derived from the target gene was detected at the designed size. Moreover, even when a non-specific peak was detected, it was determined that there was no effect on the result if it was 3 bp or more away from the target gene. By the above method, one gene was added step by step to the combination of 5 genes, and an attempt was made to become the target gene.

(6) Forward singlet / reverse plex
Using the same method as (4-1) to (4-4), the primer of the target gene combination selected in (5-2) was examined. However, the reverse primer at the time of cDNA preparation was a mix of each gene, and the forward primer at the time of PCR reaction was carried out with one gene for each gene. In the selected combination of genes, only the peak of the target gene and Kan ^r was detected, and it was confirmed whether the peak derived from the target gene was detected at the designed size. Moreover, even when a non-specific peak was detected, it was determined that there was no effect on the result if it was 3 bp or more away from the target gene. However, if it is not more than 3 bp away, repeat (5-1) and search for another optimal combination for the target number of genes, then perform forward singlet / reverse plex and check whether the combination is appropriate Went.

(7) Signal balance adjustment
(7-1) Determining the dilution rate of the PCR product Run the sample and dilute it so that each signal is within the optimal detection range for measuring expression fluctuations, and background noise or baseline is minimized. It was determined.

(7-2) Optimization of reverse primer concentration
When optimization was not possible with only the PCR product, the same method as in (4-1) to (4-4) was performed, and optimization of the reverse primer concentration was examined to balance each peak. However, the reaction solutions for cDNA synthesis at the time of preparation of cDNA differ from the methods (4-1) to (4-4), and the reaction solution composition at the time of optimizing the reverse primer concentration is shown in Table 6.

2. Results The following four packages (Tables 7-1 to 4) were constructed by combining a plurality of genes among the selected 36 genes by the above series of operations.

(Example 2) Kinetic analysis of gene group related to prawn biodefense due to stress load Method
(1) Test prawns Prawns with an average weight of 12.0g were purchased from a prawn farm in Kyushu and used for experiments.

(2) Dynamic analysis of the shrimp biodefense-related genes by stress loading
(2-1) Stress load test and RNA extraction In the sludge breeding area, prawns collected from the relatively large water quality of the shrimp ponds were used, and 200 μl of hemolymph was collected from 3 fish. Sampling. The sampled hemolymph was transferred to a 1.5 ml tube, 800 μl of RNAiso plus was added, and total RNA was extracted in the same manner as in (4-1) of Example 1.

  In the -8 ° C water temperature drop (18 ° C low water temperature) group, 200 µl of hemolymph was sampled from 3 fishes using the prawns in the shipping pool with a water temperature of 18 ° C for sorting work at the shrimp farm. The sampled hemolymph was transferred to a 1.5 ml tube, 800 μl of RNAiso plus was added, and total RNA was extracted in the same manner as in (4-1) of Example 1.

  In the 24-hour air-exposure plot, 200 μl of haemolymph was sampled from 3 tails using the prawns that were exposed to air in sawdust for 24 hours after landing from the pond at the prawn farm. The sampled hemolymph was transferred to a 1.5 ml tube, 800 μl of RNAiso plus was added, and total RNA was extracted in the same manner as in (4-1) of Example 1.

(2-2) Preparation of cDNA First, use DNase I (Invitrogen, Japan) to prepare a reaction solution for DNase treatment (same as Table 2 above), mix by tapping, and mix at room temperature. Let stand for 20 minutes. DNase treatment was performed by adding 0.75 μl of 25 mM EDTA (pH: 8.0) and performing a reaction at 65 ° C. for 10 minutes using a thermal cycler (BIO RAD, Mycycler).

  Subsequently, reverse transcription reaction was performed using GenemeLab GeXP Start Kit (BECKMAN COULTER, USA). Prepare a cDNA synthesis reaction solution (same as Table 6 above) and use a thermal cycler (BIO RAD, Mycycler) at 48 ° C for 1 minute, 37 ° C for 5 minutes, 42 ° C for 60 minutes, 95 ° C for 5 minutes. Reverse transcription reaction was performed for 5 minutes at 4 ° C for 5 minutes.

(2-3) PCR reaction Using the prepared cDNA as a template, each of the packages 1 to 4 constructed in Example 1 was used, and the Fw primer mixed solution in which the Fw primer of the gene of each package was mixed, and the Rv primer of the same gene Prepare mixed Rv primer mixtures (primer mixtures whose concentrations were optimized in Example 1 (6-2)), and perform PCR using these mixtures as Fw primers and Rv primers (PCR reaction). The composition of the solution was as shown in Table 4), and each gene was amplified. For PCR, heat-denaturation at 94 ° C for 30 seconds, heat denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension reaction at 68 ° C for 1 minute for 45 cycles, using a thermal cycler (BIO RAD, Mycycler) I went.

(2-4) Capillary electrophoresis
The PCR product amplified in (2-3) was diluted 10-fold with 10 mM Tris-HCl (pH 8.0). Transfer the total amount of the sample dissolved in SLS (same as Table 5 above) to the sample plate, put 8-9 drops of the dedicated separation buffer (BECKMAN COULTER, USA) in the same position as the sample, The sample plate was set in CEQ8000 and the method was started.

(2-5) Quantitative expression analysis of each gene
Based on the data obtained from (2-4), analysis was performed using GeXP Profiler software and GeXP Quant Tool software (BECKMAN COULTER, USA), and the expression level was summarized as a heat map.

2. Results Table 8 shows the results of quantitative analysis of expression of the gene group related to the prawn biodefense due to stress load.

In the sludge pond, the expression of each gene of p38 (2.38 times) and ALF2 (2.07 times) increased remarkably, and the expression of each gene of JNK (0.11 times) and Argonaute2 (0.36 times) decreased remarkably.
The expression of NOS (2.50 times) gene was markedly increased in -8 ℃ water temperature decrease stress.

  For 24-hour air exposure stress, p38 (5.23 times), Toll (4.58 times), IAP (4.32 times), ALF2 (3.74 times), Dicer1 (3.55 times), JNK (3.47 times), ASK1 (2.74 times), The expression of Lysozyme (2.26 times) and IMD (2.08 times) genes was markedly increased, and the expression of Caspase3 (0.14 times) genes was markedly decreased.

  It was p38 and ALF2 that remarkable expression was seen in the sludge pond. p38 is one of the stress-responsive MAP kinase family in the endogenous apoptotic mechanism, and it is considered that a part of the apoptotic mechanism is activated by the deterioration of water quality. ALF2 is a kind of antibacterial peptide that is a protein with bactericidal and antibacterial activity, and it is suggested that it was activated due to opportunistic infection caused by deterioration of water quality.

  It was NOS that showed significant expression in the -8 ℃ water temperature drop stress. NOS is a nitric oxide synthase. The reason why the NOS gene was activated by water temperature lowering stress is unknown.

It was Toll, IMD, ASK1, JNK, p38, IAP, Dicer1, ALF2, and Lysozyme that showed significant expression in 24-hour air exposure stress. Although this population was alive, it was weakened, and opportunistic infections were more likely to occur. Therefore, it is thought that many genes had increased expression. Toll and IMD are factors located upstream of the Toll and IMD pathways that are activated by bacterial infection and induce the expression of antimicrobial peptides, respectively, and are thought to be activated by opportunistic infection. ASK1, JNK, p38, and IAP are factors of the apoptotic mechanism that, when subjected to various stresses, signals are transmitted into the nucleus and apoptosis is induced, and seems to be activated by stress exposed to air for a long time .
Dicer1 is known to act on endogenous RNA, and is thought to be activated by the leakage of endogenous RNA generated by a decline in the function of some cells due to weakness.
ALF2 and Lysozyme are antibacterial peptides that are bactericidal and antibacterial proteins, and are thought to have been activated by opportunistic infection caused by prolonged contact with air.

(Example 3) Kinetic analysis of genes related to the prawn biodefense due to WSSV infection Method
(1) Preparation of WSSV solution for infection test
Heart and lymphoid organs were excised from WSSV-infected prawns stored at -80 ° C., placed in a 1.5 ml tube into which 200 μl of PBS (Table 9) had been dispensed in advance, and homogenized with pestle. Then, centrifuge at 8,000 × rpm and 4 ° C for 15 minutes, transfer the supernatant to a new 1.5 ml tube, add PBS so that it will be diluted 10-fold with respect to the grinding solution, and pass through a 0.45 μm membrane filter to remove the protein. This was used as WSSV solution for infection test (infection solution A).

In addition, DNA was extracted from the infection solution A using Quick-gDNA ^™ MiniPrep (ZYMO, USA), a template was prepared, and a dilution series of a plasmid into which the vp28 gene, a component protein of WSSV prepared in advance, was introduced ( Simultaneously with 1.0 × 10 ¹ to 10 ⁹ ), real-time PCR was performed with the composition shown in Table 10, and the amount of virus was quantified. As a result, the number of viruses in the infectious solution A was 2.0 × 10 ⁶ copies / ml.

In virus purification using cryopreserved individuals, since the virus activity is relatively low, 100 μl (1.0 × 10 ⁴ copies) of this infection solution A is injected into muscles per carrage and infected 3 days later. WSSV solution for infection test (infection solution B) was prepared by the same method as the preparation method of solution A. The number of viruses in the infectious solution B was 4.0 × 10 ⁶ copies / ml.

(2) WSSV infection test and RNA extraction
In the WSSV-infected section, 100 μl (5.0 × 10 ² copies) of the infection solution B prepared in (1) was injected into each muscle prawn. 6, 12, 24, 48, 72, 120, and 144 hours after WSSV inoculation (6, 12, 24, 48, 72, 108, and 132 hours for cytokine-related genes) Sampling. The sampled hemolymph was transferred to a 1.5 ml tube, 800 μl of RNAiso plus was added, and total RNA was extracted in the same manner as in (4-1) of Example 1.

(3) Quantitative expression analysis of each gene Using the total RNA extracted above, the same operations as in (2-2) to (2-5) of Example 2 were performed, and quantitative expression analysis of each gene was performed. .

2. result
Tables 11 and 12 below show the results of quantitative expression analysis of the gene group related to the prawn biodefense due to WSSV infection.

  In the early stage of WSSV infection (~ 24 hours), the expression of Dicer2 (6.27 times), Nox (5.82 times), Argonaute2 (3.77 times), Aox (3.41 times), STAT (3.19 times) genes significantly increased. , P53 (0.18 times), IAP (0.21 times), Wengen (0.21 times), Caspase3 (0.27 times), and Lysozyme (0.40 times) genes were significantly reduced.

  In the middle stage of WSSV infection (48-72 hours), the expression of each gene of Dicer2 (9.63 times), Nox (7.49 times), p38 (5.84 times), Socs (3.40 times), Tollip (3.34 times) is remarkably increased. However, the expression of NOS (0.16 times) gene was remarkably decreased.

  In the late stage of WSSV infection (120-144 hours), the expression of Argonaute2 (9.31 times), p38 (5.79 times), and Socs (4.51 times) genes increased remarkably, p53 (0.13 times), STAT (0.13 times) ), Toll (0.14 times), ASK1 (0.16 times), IAP (0.11 times), and Caspase3 (0.15 times) were significantly reduced.

  It was Socs, p38, Argonaute2, Dicer2, and Nox that markedly increased expression due to WSSV infection. Socs is considered as a STAT inhibitor of the JAK / STAT pathway, and STAT is thought to be suppressed by WSSV infection. p38 is one of the stress-responsive MAP kinase families in the endogenous apoptotic mechanism, and it is considered that a part of the apoptotic mechanism is activated by WSSV infection. However, since no increase in the expression of other apoptosis-related genes is observed, it is considered that signaling downstream of p38 is inhibited and that crosstalk with other biological defense systems occurs.

  Argonaute2 and Dicer2 are factors related to RNA interference, which is a gene expression control mechanism by base sequence-specific RNA degradation or translational repression. In particular, Argonaute2 and Dicer2 are known to act on exogenous RNA such as viruses, and are thought to be activated by the invasion of exogenous RNA by WSSV infection. Nox is a NADPH oxidase that has a strong bactericidal and virucidal ability by the action of enzymes. Superoxide is produced by this enzyme. Another characteristic of WSSV infection is that most of the genes that are markedly expressed by bacterial infection are suppressed.

  The expression of VEGF markedly increased after 108 hours of WSSV infection, and other genes tended to decrease after 6 hours of infection.

(Example 4) Kinetic analysis of genes related to prawn biodefense due to Vibrio penaeicida infection Method
(1) Preparation of V. penaeicida bacterial solution for infection test
V. penaeicida that had been cultured on a marine broth agar medium (Becton Dickinson, USA) at 25 ° C. was dissolved in PBS to prepare a bacterial solution in which V. penaeicida was suspended. Quantify the number of bacteria using the McFarland turbidimetric method, which estimates the viable cell concentration of the bacterial solution from the turbidity, and the number of bacteria in the bacterial solution is 6.0 × 10 ⁸ CFU / ml A fungus solution was prepared (bacterial solution A).

Bacterial fluid using bacteria cultured on marine broth agar medium has relatively low bacterial activity. Therefore, 100 μl (5.0 × 10 ³ CFU / ml) of bacterial fluid A is injected into muscles per fish shrimp. Then, after 3 days, 6.0 × 10 ⁸ CFU / ml of a bacterial solution for infection test (bacterial solution B) was prepared in the same manner as the method for preparing bacterial solution A.

(2) V. penaeicida infection test and RNA extraction
In the V. penaeicida- infected section, 100 μl (5.0 × 10 ⁴ CFU / ml) of the bacterial solution B prepared in (1) was injected into each muscle prawn. 200 μl of 3 fish in each group at 6, 12, 24, 48, 72, 120 and 144 hours after v . Penaeicida inoculation (6, 12, 24, 48, 72, 108 and 132 hours for cytokine-related genes) Hemolymph was sampled. The sampled hemolymph was transferred to a 1.5 ml tube, 800 μl of RNAiso plus was added, and total RNA was extracted in the same manner as in (4-1) of Example 1.

(3) Quantitative expression analysis of each gene Using the total RNA extracted above, the same operations as in (2-2) to (2-5) of Example 2 were performed, and quantitative expression analysis of each gene was performed. .

2. result
Tables 13 and 14 below show the results of quantitative expression analysis of the prawn biodefense- related gene group caused by V. penaeicida infection.

In the early stage of Vibrio infection (up to 24 hours), the expression of Toll (7.63 times), Croquemort (6.70 times), ASK1 (5.87 times), and Lysozyme (7.51 times) genes significantly increased, and Toll2 (0.10 times) , Tollip (0.13 times) and IMD (0.17 times) genes were significantly reduced.
In the middle stage of Vibrio infection (48-72 hours), the expression of Toll2 (5.77 times), Caspase3 (4.28 times), ALF2 (4.22 times), and Crustin (6.70 times) genes increased remarkably.
In the late stage of Vibrio infection (120-144 hours), the expression of Toll (6.83 times), Croquemort (7.10 times), NOS (4.50 times), Duox (6.63 times) genes increased significantly, and JNK (0.04 times) ) Gene expression was significantly reduced.

It was Toll, Toll2, Croquemort, ASK1, Duox, ALF2, Crustin, and Lysozyme that markedly increased expression due to Vibrio penaeicida infection. Toll and Toll2 are Toll pathway-related factors that are activated by bacterial infection and activate the expression of antimicrobial peptides, both of which are thought to function as receptors for this pathway. Recognizing bacterial infection, activation may have occurred. Croquemort is a dead cell recognition receptor and an apoptosis-related factor. It is thought that it is activated by dead cells generated by phagocytosis on bacteria.

  ASK1 is one of the stress-responsive MAP3 kinase family in the endogenous apoptotic mechanism, and it is considered that a part of the apoptotic mechanism is activated by bacterial infection. Duox is a hydrogen peroxide-producing enzyme that has a strong bactericidal and virucidal ability due to the action of the enzyme. It is thought that phagocytic cells were activated by bacterial infection because they phagocytosed pathogens and foreign bodies when the infection occurred, and hydrogen peroxide generated inside was sterilized / destroyed. ALF2, Crustin, and Lysozyme are a type of antibacterial peptide that is a protein with bactericidal and antibacterial action, and are suggested to have been activated as final products of activation of various signals.

  Overall, there were many genes whose expression tended to increase. Among them, IMD, JNK, and RNA interference-related genes are among those that have not seen much expression trend.

Expression of Cyclophilin A, HDGF, MIF and PD-ECGF tended to increase 6-24 hours after Vibrio penaeicida infection, and MIF and VEGF tended to decrease 48 hours after infection. BMP and Myostatin were not expressed in hemolymph and could not be measured.

  INDUSTRIAL APPLICABILITY The present invention can be used in the field of shrimp aquaculture, research on shrimp drugs, and manufacturing and development.

Claims (9)

A method for diagnosing the health condition of shrimps, comprising the following steps.
(1) In test samples collected from shrimps, Toll (SEQ ID NO: 1), Toll2 (SEQ ID NO: 2), Tollip (SEQ ID NO: 3), IMD (SEQ ID NO: 4), Relish (SEQ ID NO: 5), STAT ( SEQ ID NO: 6), Socs (SEQ ID NO: 7), Croquemort (SEQ ID NO: 8), ASK1 (SEQ ID NO: 9), JNK (SEQ ID NO: 10), p38 (SEQ ID NO: 11), p53 (SEQ ID NO: 12), IAP (sequence) No. 13), Caspase3 (SEQ ID NO: 14), Wengen (SEQ ID NO: 15), Argonaute1 (SEQ ID NO: 16), Argonaute2 (SEQ ID NO: 17), Dicer1 (SEQ ID NO: 18), Dicer2 (SEQ ID NO: 19), NOS (SEQ ID NO: 19) 20), Nox (SEQ ID NO: 21), Duox (SEQ ID NO: 22), Aox (SEQ ID NO: 23), ALF2 (SEQ ID NO: 24), Crustin (SEQ ID NO: 25), Lysozyme (SEQ ID NO: 26), Astakine (SEQ ID NO: 27) ), Cyclophilin-A (SEQ ID NO: 28), HDGF (SEQ ID NO: 29), MIF (SEQ ID NO: 30) ), PD-ECGF (SEQ ID NO: 31), VEGF (SEQ ID NO: 32), VEGF2 (SEQ ID NO: 33), VEGF-Rcp (SEQ ID NO: 34), BMP (SEQ ID NO: 35), and Myostatin (SEQ ID NO: 36). Measuring the expression level of at least one biological defense-related gene selected from the group
(2) A step of diagnosing the health condition of shrimp based on the measured expression level of the biological defense-related gene   The method according to claim 1, wherein the expression level of the biological defense-related gene is measured from the amount of mRNA transcribed from the gene.   The method according to claim 2, wherein the expression level of the mRNA level is measured by an RT-PCR method or a real-time RT-PCR method.   The method according to claim 3, wherein the RT-PCR is multiplex RT-PCR. The method according to claim 4, wherein the gene is amplified using at least one primer set selected from the group consisting of the primer sets described in (p1) to (p37) below.
(p1) Toll gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 38 and a primer consisting of the base sequence shown in SEQ ID NO: 39
(p2) Toll2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 40 and a primer consisting of the base sequence shown in SEQ ID NO: 41
(p3) Tolllip gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 42 and a primer consisting of the base sequence shown in SEQ ID NO: 43
(p4) IMD gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 44 and a primer consisting of the base sequence shown in SEQ ID NO: 45
(p5) Relish gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 46 and a primer consisting of the base sequence shown in SEQ ID NO: 47
(p6) STAT gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 48 and a primer consisting of the base sequence shown in SEQ ID NO: 49
(p7) Socs gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 50 and a primer consisting of the base sequence shown in SEQ ID NO: 51
(p8) Croquemort gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 52 and a primer consisting of the base sequence shown in SEQ ID NO: 53
(p9) ASK1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 54 and a primer consisting of the base sequence shown in SEQ ID NO: 55
(p10) JNK gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 56 and a primer consisting of the base sequence shown in SEQ ID NO: 57
(p11) p38 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 58 and a primer consisting of the base sequence shown in SEQ ID NO: 59
(p12) p53 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 60 and a primer consisting of the base sequence shown in SEQ ID NO: 61
(p13) IAP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 62 and a primer consisting of the base sequence shown in SEQ ID NO: 63
(p14) Caspase3 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 64 and a primer consisting of the base sequence shown in SEQ ID NO: 65
(p15) Wengen gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 66 and a primer consisting of the base sequence shown in SEQ ID NO: 67
(p16) Argonaute1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 68 and a primer consisting of the base sequence shown in SEQ ID NO: 69
(p17) Argonaute2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 70 and a primer consisting of the base sequence shown in SEQ ID NO: 71
(p18) Dicer1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 72 and a primer consisting of the base sequence shown in SEQ ID NO: 73
(p19) Primer set for Dicer2 gene amplification comprising a primer consisting of the base sequence shown in SEQ ID NO: 74 and a primer consisting of the base sequence shown in SEQ ID NO: 75
(p20) NOS gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 76 and a primer consisting of the base sequence shown in SEQ ID NO: 77
(p21) Nox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 78 and a primer consisting of the base sequence shown in SEQ ID NO: 79
(p22) Duox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 80 and a primer consisting of the base sequence shown in SEQ ID NO: 81
(p23) Aox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 82 and a primer consisting of the base sequence shown in SEQ ID NO: 83
(p24) ALF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 84 and a primer consisting of the base sequence shown in SEQ ID NO: 85
(p25) A primer set for amplifying a crustin gene comprising a primer consisting of the base sequence shown in SEQ ID NO: 86 and a primer consisting of the base sequence shown in SEQ ID NO: 87
(p26) Lysozyme gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 88 and a primer consisting of the base sequence shown in SEQ ID NO: 89
(p27) Astakine gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 90 and a primer consisting of the base sequence shown in SEQ ID NO: 91
(p28) Cyclophilin-A gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 92 and a primer consisting of the base sequence shown in SEQ ID NO: 93
(p29) HDGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 94 and a primer consisting of the base sequence shown in SEQ ID NO: 95
(p30) MIF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 96 and a primer consisting of the base sequence shown in SEQ ID NO: 97
(p31) PD-ECGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 98 and a primer consisting of the base sequence shown in SEQ ID NO: 99
(p32) VEGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 100 and a primer consisting of the base sequence shown in SEQ ID NO: 101
(p33) VEGF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 102 and a primer consisting of the base sequence shown in SEQ ID NO: 103
(p34) VEGF-Rcp gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 104 and a primer consisting of the base sequence shown in SEQ ID NO: 105
(p35) VEGF-Rcp-STYKc gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 106 and a primer consisting of the base sequence shown in SEQ ID NO: 107
(p36) BMP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 108 and a primer consisting of the base sequence shown in SEQ ID NO: 109
(p37) Myostatin gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 110 and a primer consisting of the base sequence shown in SEQ ID NO: 111   In the step (2), the gene expression level is analyzed by comparing the gene expression level in the test sample and the gene expression level in the control sample, thereby diagnosing the health condition of the shrimp. 6. The method according to any one of 5. The following (p1) to (p37) shrimp health condition primer set.
(p1) Toll gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 38 and a primer consisting of the base sequence shown in SEQ ID NO: 39
(p2) Toll2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 40 and a primer consisting of the base sequence shown in SEQ ID NO: 41
(p3) Tolllip gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 42 and a primer consisting of the base sequence shown in SEQ ID NO: 43
(p4) IMD gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 44 and a primer consisting of the base sequence shown in SEQ ID NO: 45
(p5) Relish gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 46 and a primer consisting of the base sequence shown in SEQ ID NO: 47
(p6) STAT gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 48 and a primer consisting of the base sequence shown in SEQ ID NO: 49
(p7) Socs gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 50 and a primer consisting of the base sequence shown in SEQ ID NO: 51
(p8) Croquemort gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 52 and a primer consisting of the base sequence shown in SEQ ID NO: 53
(p9) ASK1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 54 and a primer consisting of the base sequence shown in SEQ ID NO: 55
(p10) JNK gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 56 and a primer consisting of the base sequence shown in SEQ ID NO: 57
(p11) p38 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 58 and a primer consisting of the base sequence shown in SEQ ID NO: 59
(p12) p53 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 60 and a primer consisting of the base sequence shown in SEQ ID NO: 61
(p13) IAP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 62 and a primer consisting of the base sequence shown in SEQ ID NO: 63
(p14) Caspase3 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 64 and a primer consisting of the base sequence shown in SEQ ID NO: 65
(p15) Wengen gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 66 and a primer consisting of the base sequence shown in SEQ ID NO: 67
(p16) Argonaute1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 68 and a primer consisting of the base sequence shown in SEQ ID NO: 69
(p17) Argonaute2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 70 and a primer consisting of the base sequence shown in SEQ ID NO: 71
(p18) Dicer1 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 72 and a primer consisting of the base sequence shown in SEQ ID NO: 73
(p19) Primer set for Dicer2 gene amplification comprising a primer consisting of the base sequence shown in SEQ ID NO: 74 and a primer consisting of the base sequence shown in SEQ ID NO: 75
(p20) NOS gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 76 and a primer consisting of the base sequence shown in SEQ ID NO: 77
(p21) Nox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 78 and a primer consisting of the base sequence shown in SEQ ID NO: 79
(p22) Duox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 80 and a primer consisting of the base sequence shown in SEQ ID NO: 81
(p23) Aox gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 82 and a primer consisting of the base sequence shown in SEQ ID NO: 83
(p24) ALF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 84 and a primer consisting of the base sequence shown in SEQ ID NO: 85
(p25) A primer set for amplifying a crustin gene comprising a primer consisting of the base sequence shown in SEQ ID NO: 86 and a primer consisting of the base sequence shown in SEQ ID NO: 87
(p26) Lysozyme gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 88 and a primer consisting of the base sequence shown in SEQ ID NO: 89
(p27) Astakine gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 90 and a primer consisting of the base sequence shown in SEQ ID NO: 91
(p28) Cyclophilin-A gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 92 and a primer consisting of the base sequence shown in SEQ ID NO: 93
(p29) HDGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 94 and a primer consisting of the base sequence shown in SEQ ID NO: 95
(p30) MIF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 96 and a primer consisting of the base sequence shown in SEQ ID NO: 97
(p31) PD-ECGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 98 and a primer consisting of the base sequence shown in SEQ ID NO: 99
(p32) VEGF gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 100 and a primer consisting of the base sequence shown in SEQ ID NO: 101
(p33) VEGF2 gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 102 and a primer consisting of the base sequence shown in SEQ ID NO: 103
(p34) VEGF-Rcp gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 104 and a primer consisting of the base sequence shown in SEQ ID NO: 105
(p35) VEGF-Rcp-STYKc gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 106 and a primer consisting of the base sequence shown in SEQ ID NO: 107
(p36) BMP gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 108 and a primer consisting of the base sequence shown in SEQ ID NO: 109
(p37) Myostatin gene amplification primer set comprising a primer consisting of the base sequence shown in SEQ ID NO: 110 and a primer consisting of the base sequence shown in SEQ ID NO: 111   A probe for diagnosing a health condition of a shrimp having a length of at least 15 bases for hybridizing to a polynucleotide comprising the base sequence shown in any one of SEQ ID NOs: 1 to 36 and detecting the polynucleotide.   A kit for diagnosing a health condition of shrimp, comprising at least the primer set according to claim 7.