JP2014113118A - Three-dimensional cultured tissue that perfuses culture medium to support layer containing cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide in vitro three-dimensional cultured tissue having more resembled status to in vivo tissue.SOLUTION: Three-dimensional cultured tissue in culture medium perfusion method is produced, as it is found that cells can be cultured in imitation of body fluid circulation environment by: adding tensile force to cells like a living body by inhibiting shrinkage in the horizontal direction of a supporting layer containing the cells; and supplying a fresh culture medium always in a constant flow rate. In the three-dimensional cultured tissue, it becomes possible to maintain cells for a prolonged period in a more resembled status to in vivo tissue.

Description

  The present invention relates to a three-dimensional cultured tissue similar to that in a living body, and more particularly to a three-dimensional cultured tissue characterized by perfusing a culture solution to a support layer containing cells.

  Cell culture is a useful technique as a method for scientifically investigating the properties of human cells in the body (in vivo) by separating them from the body and culturing them in an artificial environment (in vitro). It has been widely used among those. A typical method is a method of culturing on the surface of a plastic culture dish having a two-dimensional spread and is called flat culture. There are many variations of this technique, but the basic technique is known.

  A method of culturing in a support (cell scaffold, matrix) having a three-dimensional extent as compared to planar culture is called three-dimensional culture. Three-dimensional culture gives cells a more in vivo environment than planar culture, and a support containing cells cultured in this way is called a three-dimensional cultured tissue. There are many variations of the three-dimensional culture method (Patent Documents 1 and 2, Non-Patent Documents 1 to 3). Many of the three-dimensional cultures that have been disseminated replace the culture medium with a fresh culture medium as necessary, and are called stationary three-dimensional culture.

  A three-dimensional cultured tissue is a model of a living body useful for safety evaluation and effectiveness evaluation of pharmaceuticals and cosmetics. In recent years, its use has expanded as an alternative to animal experiments from the viewpoint of animal welfare.

JP2009-112277A Special table 2008-519598

Yoshizato K et al, Biomedical Res, 6: 287-296, 1985. Kawada N et al, Biochem Biophys Res Commun, 266 (2): 296-300, 1999. Hu T et al, Toxicol In Vitro, 24 (5): 1450-1463, 2010.

  An object of the present invention is to provide a three-dimensional cultured tissue that is closer to the living body.

  There is a “collagen gel culture method” as a method of culturing a three-dimensional cultured tissue approximate to a living body. Although this method is one in which cells are three-dimensionally enclosed in a hydrated gel-like collagen fiber lattice and cultured, there has been a basic problem that the in vivo state cannot be accurately reflected. One is the problem of cell necrosis due to insufficient penetration of oxygen and nutrients inside the gel, and the other is that the gel shrinks to reduce volume and aggregates that are not seen in the body. . Such a problem does not occur because the tissue in the living body is in a tensioned state and the blood vessel has developed to every corner.

  Furthermore, living cells do not perform their functions alone, but can perform their functions while being directly or indirectly influenced by neighboring or remote cells. Such a network between cells in the body largely depends on the body fluid circulation, but the three-dimensional culture tissue by in vitro culture method is a tissue from which the network between cells is removed, and the in vivo function of the cell can be reproduced. Absent.

  In the conventional culture method, the cultivatable period of the three-dimensional cultured tissue is about 10 days, and if the culture is performed for a longer period than that, the cell function is lowered or the cell is killed. Therefore, a cell culture device (Patent Document 2) for maintaining a cell function similar to that of a living body for a long period of time is disclosed, but the supply of the culture solution is due to diffusion from the liquid flowing in the channel (groove) of the device, There are differences from the in vivo state in that cells are held in a chamber defined by a plurality of protrusions, and the same tension as that of a living body is not applied due to the interaction with the extracellular matrix. Accordingly, there is a need for the development of a three-dimensional cultured tissue that can be cultured for a long period of time and contains cells that are more similar to the in vivo state.

  Living cells are entrained in the circulatory system and are constantly receiving hydrodynamic effects and nutrient / oxygen supplies. In addition, tension is applied by interaction with the extracellular matrix. As a result of intensive studies, the present inventors added a tension to the cells in the same manner as the living body by inhibiting the horizontal contraction of the support containing the cells, and constantly added a fresh culture solution at a constant flow rate. By supplying, it was discovered that cells can be cultured to resemble a body fluid circulation environment, and the present invention has been completed.

That is, the present invention
[1] A three-dimensional culture tissue produced by perfusing a culture solution onto a support layer containing cells.
[2] The three-dimensional cultured tissue according to [1], wherein the perfusion of the culture solution is performed by feeding a pressurized solution to a support layer containing cells through a tube in which the culture solution is inserted into the support.
[3] The three-dimensional cultured tissue according to [2], wherein the culture solution is fed from below the support layer.
[4] The three-dimensional culture tissue according to any one of [2] and [3], wherein the culture solution feeding speed is 0.1 to 10 μL / min per cm ^{3 of} the support.
[5] The three-dimensional cultured tissue according to any one of [1] to [4], wherein the cells are fibroblasts.
[6] The three-dimensional cultured tissue according to any one of [1] to [5], wherein the support layer is collagen.
[7] The three-dimensional cultured tissue according to any one of [1] to [6], wherein the lower and side surfaces of the support layer are adhered to the culture dish.
[8] A culture method and apparatus for obtaining the three-dimensional cultured tissue according to any one of [1] to [7].
About.

  The three-dimensional cultured tissue of the present invention inhibits horizontal contraction of a support containing cells, thereby applying tension to the cells in the same manner as a living body and perfusing the culture solution, thereby It can be maintained closer to in vivo.

  This method is a culture method characterized by promoting tissue construction similar to in vivo tissues according to the self-organizing ability inherently possessed by cells and matrices. That is, since a natural tissue-building ability (self-assembly) by the cell itself is used without using an artificial template as in the conventional method, it can be expected that the tissue formation is closer to that in the living body.

It is a figure which shows the culture apparatus of the three-dimensional culture tissue of this invention.

  The three-dimensional cultured tissue of the present invention is characterized in that a culture solution is perfused through a support layer containing cells. Here, perfusion generally refers to artificially sending blood to an organ, but in the present invention, artificially feeding a culture solution to a culture substrate using a tube or the like. . The culture medium is perfused by making a small hole in the culture surface of the plastic culture dish and inserting a thin tube connected to the liquid feeding pump into the small hole. After preparing the support body in which the cells are sealed in this culture dish, the pump is driven and the fresh culture solution is pressurized and fed into the support body at a constant speed, so that the culture solution gradually spreads uniformly from the bottom surface. It passes through the whole body and leaves the support from the upper surface of the support. In this way, a fresh culture solution that moves evenly at a slow flow rate can be supplied to cells distributed in the support.

  The in vivo support is in a state of contraction and repulsive tension. Shrinkage occurs when the cells attract the surrounding support as a scaffold. Tension is caused by the support repelling the attractive forces by the cells. In the present invention, in order to reproduce this tension, it is not left to the contraction of the support caused by the cells, but by adhering the support to a plastic culture dish and inhibiting the horizontal contraction of the support containing cells. It is characterized by applying tension to cells in the same way as a living body to create a more similar cell culture environment in vivo. The adhesion of the support to the plastic culture dish can be enhanced by applying a fibrotic collagen coating to the bottom of the culture dish and the front of the wall. In addition, the tethering efficiency can be increased by increasing the area where the support and the culture dish are in contact by protruding or scratching the bottom of the culture dish.

  Examples of the support of the three-dimensional cultured tissue of the present invention include collagen, gelatin, elastin, polysaccharides (hyaluronic acid, chondroitin sulfate, chitin, chitosan, etc.), artificial synthetic polymers (polylactic acid, peptides, polyesters, etc.), fibrin, etc. The properties include gels, sponges, sheets and the like.

  The size and shape of the support are not particularly limited and can be prepared according to the culture dish. However, it is preferable that the support is prepared according to the circular culture dish of 10 to 100 mm. It is particularly preferable to produce them together. The concentration of the component constituting the support is not particularly limited, but is preferably 0.05 to 5%, and particularly preferably 0.1 to 0.5%.

  Examples of cells used in the three-dimensional cultured tissue of the present invention include dermal fibroblasts, vascular endothelial cells, lymphatic endothelial cells, epithelial cells, pigment cells, fat cells, nerve cells, liver stellate cells, hair follicle cells, retinal vision. Examples thereof include cells.

The density and dispersion state of the cells are not particularly limited, but a density of 1 × 10 ³ to 1 × 10 ⁷ cells / mL is preferable, and a density of 1 × 10 ⁵ to 2 × 10 ⁶ cells / mL is particularly preferable. Moreover, it is preferable that it is disperse | distributed uniformly.

  The tube inserted into the culture dish is fixed to the culture dish using the thickness of the bottom surface of the plastic culture dish. The number of tubes for liquid feeding to be inserted is not particularly limited, but 1 to 10 is preferable. The position for inserting the liquid feeding tube is not particularly limited, but in the case of one, the center of the culture surface of the plastic culture dish is preferable, and in the case of a plurality, the position where the culture surface can be covered uniformly is preferable. Examples of the material for the liquid feeding tube include fluororesin, silicon rubber, polyimide, polycarbonate, acrylic, plastic, polypropylene, and vinyl chloride resin. The inner diameter is preferably 0.5 to 2 mm.

  The culture solution used for the three-dimensional culture tissue of the present invention is not particularly limited, and a culture solution and an additive suitable for culturing the cells to be used can be used. For example, there is Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum.

Feed rate of the culture, 0.1~10μL / min preferably per support 1 cm ^3, in particular, 1~3μL / min is preferred per support 1 cm ^3.

  The culture solution is fed by connecting a pump to the other end of the tube inserted in the culture dish and operating the pump. As the pump, a syringe pump, an infusion pump, a blood circulation pump, a peristaltic pump, an HPLC pump, or the like can be used. For example, the culture solution can be delivered by connecting a syringe into which the culture solution has been injected to the other end of the tube, attaching the syringe to the delivery pump, and operating the delivery pump. In this case, the syringe used is preferably a medical polypropylene syringe. A commercially available syringe pump can be used as the liquid feed pump.

  To collect the culture solution that has left the support from the upper surface of the support, a small hole is made in the upper wall surface of the plastic culture dish, and a tube is inserted. The opposite end of the tube is connected to a syringe, and the culture solution that has been raised to the height of the small hole with a pump is sucked and collected at a rate slower than the feeding rate. Alternatively, the tube is hung at a position lower than the culture dish, connected to a waste tank, and the culture solution is collected using the height difference. As the material of the tube, the same material as the liquid feeding tube can be used.

  The three-dimensional cultured tissue of the present invention has properties similar to those of in vivo tissues, and can be cultured for a long period of one month or longer while maintaining this state. Therefore, it is possible to examine the intrinsic properties of cells in the in vivo tissue in vitro, and it can be used for evaluating the influence of the test substance on the in vivo tissue. It can be used for safety evaluation of pharmaceuticals and cosmetic materials against in vivo tissues. Further, it can be used for evaluating the effectiveness of a pharmaceutical or cosmetic material for a specific cell function in a living tissue. Furthermore, it can be used as an in vitro model of chronic diseases caused by long-term treatment of pharmaceuticals and the like.

  The three-dimensional cultured tissue of the present invention can be used as a tissue for transplantation into a living body. Examples of the use of the tissue for transplantation include skin transplantation, hair follicle transplantation, liver transplantation and the like.

  In order to describe the present invention in detail, examples of production of a three-dimensional cultured tissue and experimental examples are given as examples, but the present invention is not limited thereto.

Production Example 1 Production of culture medium perfusion system three-dimensional cultured skin 1 A culture apparatus was produced by the method outlined in FIG. A drill with a diameter of 2 mm was beaten with an alcohol lamp. The plastic culture dish to be used was vertically penetrated from the center of the bottom of the plastic dish. When the plastic softened by heat had cooled and solidified, a drill was turned to make a hole in the dish, and a 60 cm long fluororesin (PFA) tube was inserted there. The other end of the tube was connected to a 5 cm long silicon tube, and the other end of the silicon tube was connected to a luer fitting (Samplertech, FTLL210-6) and fixed with parafilm. The tube inserted into the dish was fixed with an epoxy adhesive (Araldee Rapid, Nichiban). The plate and the tube were connected and placed in a fume hood and air dried for about 2 hours. After the epoxy adhesive was dried, it was fixed and waterproofed with parafilm (Pechiny Plastic Packaging Company). A syringe (TERUMO 10 mL) was connected to the luer fitting and disinfected with 70% ethanol. DMEM (GIBCO), 10% (v / v) fetal bovine serum, 25 mM HEPES and antibiotics (penicillin, streptomycin) were passed through a syringe.
Fibrous collagen coating was applied to the bottom of the culture dish and the front of the wall. In the coating method, 0.1% collagen (I) was poured into a plastic culture dish in a clean bench and extracted. PBS was poured into a plastic culture dish and placed in a 37 ° C. carbon dioxide incubator for 1 hour, and then the PBS was removed. In the clean bench, the lid of the plastic culture dish was opened to dry the inside of the culture dish.
0.6 mL of 5-fold concentrated DMEM, 0.3 mL of fetal bovine serum, 0.9 mL of sterilized water and 1.2 mL of 0.5% atelocollagen (IPC-50 KOKEN) were mixed under ice cooling to obtain a sol. Produced. A total of 3 mL of sol was added to dermal fibroblasts (6 × 10 ⁵ cells) precipitated by centrifugation in advance and suspended until the cells became uniform, and cell suspension sol (cell density 2 × 10 ⁵ cells / mL) 3 mL was poured into a 35 mm culture dish of the culture apparatus. Gelation was carried out by standing for 2 hours in a 37 ° C. carbon dioxide incubator.
A hole was made on the wall of the culture dish above the gel in the same manner as in the bottom, a 60 cm long fluororesin (PFA) tube was inserted into the hole, and the end of the tube was fixed with parafilm. The other end of the tube was connected in the order of a 5 cm long silicon tube, a luer fitting, and a syringe. A syringe connected to the tip of a tube connected to the bottom of the culture dish of the culture apparatus was mounted on a gantry of a liquid feed pump (Isis Co., Ltd., CXF1020 Fusion 200), and liquid was fed at a rate of 0.7 μL / min. At the same time, a syringe connected to the tip of a tube connected to the wall surface of the culture dish was attached to a stand of another liquid feeding pump, and the culture liquid on the upper surface of the support was collected at a slower speed than the liquid feeding. This method was cultured for 6 days.

Production Example 2 Production of Culture Solution Perfusion Method 3D Culture Skin 2 In Production Example 1, the culture solution perfusion method 3D culture skin 2 was prepared for 30 days.

Comparative Example 1 Conventional three-dimensional cultured skin 1
In Production Example 1, DMEM containing 10% fetal bovine serum was not passed, and the culture medium in the culture dish was replaced once a day to obtain a conventional three-dimensional cultured skin 1.

Comparative Example 2 Conventional three-dimensional cultured skin 2
In Production Example 2, DMEM containing 10% fetal bovine serum was not passed, and the culture medium in the culture dish was changed once a day to obtain a conventional three-dimensional cultured skin 2.

Experimental Example 1 Measurement of the number of cell protrusions The culture solution perfusion method of Production Example 1 and the skin fibroblasts in the three-dimensional cultured skin 1 of Comparative Example 1 and the skin fibroblasts in the conventional three-dimensional cultured skin 1 of Comparative Example 1 are neutralized with the gel Formalin was fixed, paraffin sections were prepared according to a conventional method, and then stained with HE. Thereafter, the number of cell processes per cell was measured under a microscope.

  The experimental results are shown in Table 1. Culture fluid perfusion method In the skin fibroblasts in the three-dimensional culture skin 1, more cell protrusions were observed compared to the skin fibroblasts in the three-dimensional culture skin 1 that was not perfused with the conventional culture fluid. In in vivo tissues, fibroblasts bind to and interact with matrix components such as collagen fibers through a number of processes. Therefore, this result shows that the skin fibroblasts in the culture medium perfusion system three-dimensional culture skin 1 are closer to the cells in the tissue in the living body.

Experimental Example 2 Measurement of Viable Cell Percentage of Cultured Perfusion Method in Production Example 2 Skin Fibroblasts in 3D Cultured Skin 2 and Skin Fibroblasts in Conventional 3D Cultured Skin 2 in Comparative Example 2 are Neutral with Gel Formalin was fixed, paraffin sections were prepared according to a conventional method, and then stained with HE. Thereafter, live cells and dead cells were counted under a microscope to determine the viable cell rate.

  The experimental results are shown in Table 2. Culture fluid perfusion method The viable cell rate of dermal fibroblasts in the three-dimensional culture skin 2 was higher than that in the conventional three-dimensional culture skin 2 where the culture solution was not perfused. In in vivo tissues, fibroblasts survive for a long time. Therefore, this result shows that the culture medium perfusion system three-dimensional cultured skin 2 is in a state closer to the in vivo tissue.

Experimental Example 3 Measurement of Collagen and Hyaluronic Acid Production Ability Collagen and hyaluronic acid production ability in dermal fibroblasts was measured using mRNA expression levels of type 1 collagen, type 3 collagen and hyaluronic acid synthase HAS-2 as an index. That is, the collagen gel of the culture solution perfusion system 3D cultured skin 1 of Production Example 1 and the conventional 3D cultured skin 1 of Comparative Example 1 was decomposed with collagenase, and total RNA was extracted from the remaining cells. For the extraction of total RNA, RNAiso Plus (Takara Bio) and RNeasy Mini Kit (QIAGEN) were used. Based on the extracted total RNA, the expression levels of type 1 collagen, type 3 collagen and HAS-2 mRNA were measured by RT-PCR. For the RT-PCR method, SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen) was used. The PCR reaction was initially denatured at 95 ° C. for 2 minutes, followed by 40 cycles of 95 ° C .: 15 seconds and 60 ° C .: 31 seconds. GAPDH was used as an internal standard. Type 1 collagen, type 3 collagen, and HAS-2 mRNA expression levels were determined as a percentage of the GAPDH mRNA expression level. In addition, the primer used for the measurement is as follows.

Primer set AGGACAAGAGGGCATGTCTGGTT for type 1 collagen (SEQ ID NO: 1)
TTGCAGTGGGTAGGTGATGTCTG (SEQ ID NO: 2)

Primer set TCCTTGCTGTGGTGGTGTTG for type 3 collagen (SEQ ID NO: 3)
GGCAAAACCGCCCAGCTT (SEQ ID NO: 4)

Primer set TGGATGACCCTACGAAGCGATTA for HAS-2 (SEQ ID NO: 5)
GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 6)

Primer set TGAACGGGAAGCTCACTGG for GAPDH (SEQ ID NO: 7)
TCCACCACCCTGTTGCTTA (SEQ ID NO: 8)

  The experimental results are shown in Table 3. Culture fluid perfusion method The skin fibroblasts in the three-dimensional culture skin 1 are compared with the conventional type of skin fibroblasts in the three-dimensional culture skin 1 that is not perfused with the culture fluid, type 1 collagen, type 3 collagen and HAS-2 mRNA. Increased expression was observed. In in vivo tissues, fibroblasts produce collagen and hyaluronic acid synthase to construct an extracellular matrix. Therefore, this result shows that the skin fibroblasts in the culture medium perfusion system three-dimensional culture skin 1 are closer to the cells in the tissue in the living body.

  The three-dimensional cultured tissue characterized in that a culture solution is perfused through a support layer containing cells of the present invention is an in vitro cultured tissue whose tissue form is close to that of a living body. This three-dimensional cultured tissue can be used for more accurately evaluating in vitro the influence of cosmetic materials, pharmaceuticals and the like on living tissues.

Claims (9)

A three-dimensional culture tissue produced by perfusing a culture solution on a support layer containing cells. The three-dimensional cultured tissue according to claim 1, wherein the perfusion of the culture solution is carried out by feeding under pressure to a support layer containing cells through a tube in which the culture solution is inserted into the support. The three-dimensional cultured tissue according to claim 2, wherein the culture solution is fed from a lower portion of the support layer. The three-dimensional cultured tissue according to any one of claims 2 to ³ , wherein a feeding rate of the culture solution is 0.1 to 10 µL / min per 1 cm ^{3 of} the support. The three-dimensional cultured tissue according to any one of claims 1 to 4, wherein the cell is a fibroblast. The three-dimensional cultured tissue according to any one of claims 1 to 5, wherein the support layer is collagen. The three-dimensional cultured tissue according to any one of claims 1 to 6, wherein the lower and side surfaces of the support layer are adhered to the culture dish. The three-dimensional cultured tissue according to any one of claims 1 to 7, wherein the culture dish for preparing the support layer is coated with fibrotic collagen. The apparatus for obtaining the three-dimensional cultured tissue in any one of Claims 1-8.

Images