JP2014113108A - Multimeric protein having protein solubilizing activity and application thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a multimeric protein having a protein solubilizing activity.SOLUTION: The multimeric protein having a solubilizing activity is associated with any subunit of the following (a), (b) and (c): (a) a subunit consisting of specific amino acid sequences; (b) a subunit consisting of amino acid sequences where one or some amino acids are deleted, substituted, inserted and/or added in the specific amino acid sequence; (c) a subunit consisting of amino acid sequences which is 70% or more identical to the specific amino acid sequence.

Description

  The present invention relates to a multimeric protein having protein solubilizing activity, a protein solubilizing agent using the protein, a solubilizing method, an analyzing method, an analytical reagent thereof, and an analysis method of disease risk.

  Frontotemporal dementia, Pick's disease, Alzheimer's disease, prion disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, etc. are neurodegenerative diseases that are difficult to detect and treat at an early stage. Is urgently needed. In recent years, the generation and accumulation of protein aggregates in the brain have been confirmed in patients with these neurodegenerative diseases, and it has been reported that they are involved in the induction and maintenance of pathological conditions.

  However, protein aggregates observed in the various neurodegenerative diseases such as frontal temporal dementia-derived TDP-43 bodies, Pick disease-derived pick balls, Alzheimer's disease senile plaques, prion disease-derived prion plaques, Parkinson Structures such as disease-derived Lewy bodies and amyotrophic lateral sclerosis-derived bunina bodies are extremely cohesive. For this reason, with existing protein denaturing agents and proteolytic enzymes, it is difficult to solubilize such protein aggregates, and general measures for solubilizing and analyzing proteins cannot be taken. As a result, there is a problem that it is still difficult to identify the component of the protein aggregate that causes the various neurodegenerative diseases.

  Therefore, a new method for solubilizing protein aggregates has been demanded, and a budding yeast-derived multimeric protein having solubilizing activity against the higher-order structure of the protein has been reported (Patent Document 1). According to this multimeric protein, since the folding in the higher order structure of the protein can be loosened, it can be expected to be used for the analysis of protein aggregates as described above. However, from the viewpoint of application in clinical medicine, a solubilization method that is more effective is required.

JP 2002-356497 A

  Therefore, an object of the present invention is to provide a multimeric protein having protein solubilizing activity.

The multimeric protein of the present invention is associated with at least one subunit selected from the group consisting of the following (a), (b) and (c), and has a solubilizing activity on the higher order structure of the protein. It is characterized by having.
(A) a subunit consisting of the amino acid sequence of SEQ ID NO: 1 (b) a subunit consisting of an amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 1 ( c) a subunit consisting of an amino acid sequence which is 70% or more identical to the amino acid sequence of SEQ ID NO: 1.

  The protein solubilizer of the present invention is characterized by containing the multimeric protein of the present invention.

  The protein solubilization method of the present invention includes a step of bringing the multimeric protein of the present invention into contact with a test protein.

  The protein analysis method of the present invention includes a step of solubilizing a test protein with the multimeric protein of the present invention, and a step of detecting a lysate of the test protein.

  The analytical reagent of the present invention is an analytical reagent used in the method for analyzing a test protein, and includes the multimeric protein of the present invention.

The disease risk analysis method of the present invention is a method for analyzing the disease risk of a disease in which a protein aggregate or a folding protein serves as an indicator protein,
Contacting the biological protein of the present invention with the multimeric protein of the present invention, solubilizing the indicator protein in the biological sample;
And a step of detecting a solubilized product of the indicator protein.

  Since the multimeric protein of the present invention exhibits solubilizing activity for higher-order structures of proteins, for example, protein aggregates and folding proteins can be solubilized. For this reason, according to the multimeric protein of the present invention, for example, the protein aggregates observed in the neurodegenerative disease and the like can be solubilized and analyzed. For this reason, the present invention is extremely useful in the fields of clinical medicine and biochemistry.

FIG. 1 is a photograph of a Western blot in Example 2. FIG. 2 is a photograph of a Western blot in Example 3. FIG. 3 is a prediction diagram of coiled-coil domains in Example 4. FIG. 4 is a prediction diagram of coiled-coil domains in Example 5.

<Multimeric protein>
As described above, the multimeric protein of the present invention is associated with at least one subunit selected from the group consisting of the following (a), (b) and (c), and has a higher-order structure of the protein. It has a solubilizing activity against.
(A) a subunit consisting of the amino acid sequence of SEQ ID NO: 1 (b) a subunit consisting of an amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 1 ( c) a subunit consisting of an amino acid sequence which is 70% or more identical to the amino acid sequence of SEQ ID NO: 1.

  In the present invention, the “solubilization activity for protein higher-order structure” includes, for example, the meaning of solubilization activity of protein aggregates, solubilization activity of folding proteins, and the like. The protein aggregate means, for example, a structure in which proteins having higher order structural changes are associated, and the folding protein means, for example, a folded protein.

  The protein to be solubilized that can be solubilized by the multimeric protein of the present invention includes, for example, a peptide having a higher order structure.

  The method for measuring the solubilizing activity is not particularly limited. Hereinafter, an example of a measurement method using budding yeast-derived α-factor precursor protein (Pro αF) (NCBI accession number NP — 015137) as the protein to be solubilized as a substrate will be described. This is an example and does not limit the present invention.

A test sample of 200 ng Pro αF and 500 ng (protein amount) was added to 100 μL of Hepes buffer (20 mmol / L Hepes-KOH (pH 7.4), 10 mmol / L Mg (OAc) ₂ , 1 mmol / L DTT, 2 mmol / L. ATP) and incubate at 30 ° C. for 30 minutes. After the incubation, 2 μL of 50 μg / mL trypsin is added, mixed, and incubated at 16 ° C. for 15 minutes. Next, 100 μg / mL trypsin inhibitor is added and allowed to stand on ice for 5 minutes, then 5 μL of 2 mg / mL tRNA and 12 μL of 100% trichloroacetic acid (TCA) are added and stirred. After the stirring, the mixture is allowed to stand at −80 ° C. for 15 minutes or more, and further centrifuged at 4 ° C. and 15,000 krpm for 25 minutes. The obtained pellet is suspended in 8 μL of 2 mol / L Tris-base buffer to prepare an electrophoresis sample. Then, the electrophoresis sample is subjected to electrophoresis, and after the electrophoresis, Pro αF is quantified using an anti-Pro αF antibody. As a negative control, Pro αF is similarly detected except that the test sample is not added. When the amount of Pro αF in the system to which the test sample is added is significantly lower than that of the negative control, it is determined that the test sample has a solubilizing activity. The degree of activity can be evaluated from the ratio of the amount of Pro αF when the test sample is added to the amount of Pro αF in the negative control.

The amino acid sequence of the subunit (a) (SEQ ID NO: 1) and the base sequence of the polynucleotide encoding it (SEQ ID NO: 2) are shown below. The subunit (a) is a human-derived subunit.
(SEQ ID NO: 1)
MARLLRSATWELFPWRGYCSQKAKGELCRDFVEALKAVVGGSHVSTAAVVREQHGRDESVHRCEPPDAVVWPQNVEQVSRLAALCYRQGVPIIPFGTGTGLEGGVCAVQGGVCVNLTHMDRILELNQEDFSVVVEPGVTRKALNAHLRDSGLWFPVDPGADASLCGMAATGASGTNAVRYGTMRDNVLNLEVVLPDGRLLHTAGRGRHFRKSAAGYNLTGLFVGSEGTLGLITATTLRLHPAPEATVAATCAFPSVQAAVDSTVHILQAAVPVARIEFLDEVMMDACNRYSKLNCLVAPTLFLEFHGSQQALEEQLQRTEEIVQQNGASDFSWAKEAEERSRLWTARHNAWYAALATRPGCKGYSTDVCVPISRLPEIVVQTKEDLNASGLTGSIVGHVGDGNFHCILLVNPDDAEELGRVKAFAEQLGRRALALHGTCTGEHGIGMGKRQLLQEEVGAVGVETMRQLKAVLDPQGLMNPGKVL
(SEQ ID NO: 2)
atggcccgactgctcaggtctgcaacctgggagctgttcccctggaggggctactgctcccagaaggcaaagggagagctctgcagggacttcgtagaggctctgaaggccgtggtgggcggctcccacgtgtccactgccgcggtggtccgagagcagcacgggcgcgatgagtcggtgcacaggtgcgaacctcctgatgctgtggtgtggccccagaacgtggagcaggtcagccggctggcagccctgtgctatcgccaaggtgtgcccatcatcccattcggcaccggcaccgggcttgagggtggcgtctgtgctgtgcagggcggcgtctgcgttaacctgacgcatatggaccgaatcctggagctgaaccaggaggacttctctgtggtggtggagccaggtgtcacccgcaaagccctcaacgcccacctgcgggacagcggcctctggtttcccgtggacccaggcgcggacgcctctctctgtggcatggcggccaccggggcgtcggggaccaacgcggtccgctacggcaccatgcgggacaacgtgctcaacctggaggtggtgctgcccgacgggcggctgctgcacacggcgggccgaggccggcatttccggaagagtgcagccggctacaacctcacggggctcttcgtgggctccgaggggacgctgggcctcatcacagccaccaccctgcgcctgcaccctgcccctgaggccacagtggccgccacgtgtgcgttccccagtgtccaggctgctgtggacagcactgtacacatcctccaggctgcagtgcccgtagcccgcattgagttcctggatgaagtcatgatggatgcctgcaacaggtacagcaagctgaattgcttagtggcgcccacactcttcctggagttccatggctcccagcaggcactggaggagcagctgcagcgcacagaggagatagtccagcagaacggagcctctgacttctcctggg ccaaggaggccgaggagcgcagccggctttggacagcacggcacaatgcctggtacgcagccctggccacgcggccaggctgcaagggctactccacggatgtgtgtgtgcccatctcccggctgccggagatcgtggtgcagaccaaggaggatctgaatgcctcaggactcacaggaagcattgtcgggcatgtgggtgacggcaacttccactgcatcctgctggtcaaccctgatgacgccgaggaactgggcagggtcaaggcttttgcagaacagctgggcaggcgggcactggctctccacggaacgtgcacgggggagcatggcatcggaatgggcaagcggcagctgctgcaggaggaggtgggcgccgtgggcgtggagaccatgcggcagctcaaggccgtgctagacccccaaggcctcatgaatccaggcaaagtgctgtga

  In the above (b), “1 or several” may be within a range in which the multimeric protein containing the subunit (b) has the solubilizing activity. The “one or several” is not particularly limited, and is, for example, 1 to 145, preferably 1 to 72, more preferably 1 to 24, particularly preferably 3, 2 or 1.

  In said (c), "identity" should just be the range in which the multimeric protein containing the subunit of said (c) has the said solubilization activity, for example. The “identity” is, for example, 75% or more, preferably 80% or more, more preferably 85% or more, and still more preferably 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

  The subunit preferably has a coiled coil domain. The position of the coiled coil domain is not particularly limited, and examples thereof include a central region and a C-terminal region of the subunit. For example, in the case of a human, the coiled coil domain is preferably in the central region. The central region is not particularly limited. For example, in the amino acid sequence of the (a) subunit, the N-terminal amino acid is preferably the 115th to 500th region, more preferably the 296th to 460th region. More preferably, it is the 327-451th region. As a specific example, in the case of the subunit (a), for example, in the amino acid sequence of SEQ ID NO: 1, the N-terminal amino acid is 1, which is 327 to 451.

  In the subunits (b) and (c), for example, the coiled coil domain in the subunit (a) is preferably highly conserved, and examples thereof include the central region and the C-terminal region. . As a specific example, the subunits (b) and (c) have a homology with the region of 327 to 451 of SEQ ID NO: 1, for example, 95%, 96%, 97%, 98%, 99% Preferably, it is 100%.

  The number of the associated subunits in one molecule of the multimeric protein is not particularly limited, and is, for example, 5 to 20, preferably 8 to 15, and more preferably 10 to 12. The subunit that forms the multimeric protein may be, for example, any one of (a), (b), and (c), or two or more.

  The form of the subunit association is not particularly limited, and may be, for example, a covalent bond association or a non-covalent bond association. Examples of the covalent bond include a disulfide bond and a peptide bond. Examples of the non-covalent bond include a hydrogen bond, an ionic bond, a hydrophobic bond, and a bond by van der Waals force.

  The origin of the subunit is not particularly limited. For example, human is preferable, and as described above, the subunit consisting of the amino acid sequence of SEQ ID NO: 1 is human.

In addition to this, the subunits in the multimeric protein of the present invention include, for example, those derived from non-human animals other than humans, and examples of the non-human animals include cattle and nematodes. The amino acid sequence (SEQ ID NO: 3) of a bovine-derived subunit and the nucleotide sequence (SEQ ID NO: 4) encoding the same are shown below as the subunit (a).
(SEQ ID NO: 3)

(SEQ ID NO: 4)
atgatgatgccccgtctggtgccccggtggcctgcgtggctcttctgctggcgggcagcctgcattcagggagcctctgtgagacagaagatgtgggcagggccgtccaagatccctgggctgggcggcccgcgaggggcctggggcaccagccccctggttccacgaggcagctgctcagcctcctcccgcactcctgaggtgacgctgaccccggagcggtaccctgtgcagcggctgcccttctccgtggtgtctgaggacgacctggccgccctggagcgagtcgtccctggcagggtcatcacagacccggaggagcttgagcctcccaacgtggactggctgaggacagtccgaggttccagcaaggtgctgctgaggccgcggacgacccaggaggtggcacacatcctcaggtactgccacgagcggaacctggctgtgaacccacaggggggcaacacaggcatggtgggcggcagcacacccgtcttcgacgagatcattctgtccaccgccctaatgaaccaggtcctcagctttcatgacgtgtcgggggtcctggtctgccaggcggggtgtgtcttggaggcgctgagccagtacgtggaggagcggggcttcatcatgcctttggacctcggggcgaagggcagctgccacatcggggggaatgtggccaccaacgcaggcggcctgcgggtcctgcgatacggctccctgcgggggacggtcctgggcctggaagtggtgctggccgacggaaccgtcctgaactgcctcacgtctcttcgaaaggacaacacgggctacgacctgaagcagctcttcattgggtcagagggcaccctgggggtcatcacggctgtgtccattctgtgtccgcccaagcccagcactgtgaacgtggccttcctcggctgtccgggctttgctgaagttctgcagaccttccgcacctgcagggcaatgctgggcgagatcctgtctgcgtttg agttcatggacgctgagtgcatgaagctggtcaggctccacctcggtctctcctgccccgtgcaagaaagccccttctacgtcctcattgagacggcgggctctgggccggggcacgatgccgaaaagctgggctgcttcctggagcaggtgctggattcggggctggtgaccgatgggaccctgggcagtgacgagaggaggatcaagatgctgtgggcactcagggagaggatcactgaggccctgagccatgacggctacgtgtacaagtacgacctctcgctgcccctggaccagctctacgacctcgtgggcgacctgcgtgcccggctcggcccaagcgccaagcacgtggtgggctacggccacctgggggacgggaacctgcatctcaacgtgacgtctgaggccttcagcacgtccctgctgggtgccctggagccctacgtgtacgagtggacagcggggcagcggggtagtgtcagcgccgagcacggcctgggcttcaagaagaaggacgtcctcggctacagcaagccccctgaggcgctgcagctcatgaggcagctcaaggccctcctggaccccaagggcatcctgaacccctacaagatgctgcccacccacgcctga

  The production method of the multimeric protein of the present invention is not particularly limited, and can be produced, for example, by a known genetic engineering technique or synthetic technique.

  For production of the multimeric protein of the present invention, for example, a polynucleotide encoding the subunit can be used. The polynucleotide is not particularly limited, and can be designed, for example, by replacing it with a codon based on the amino acid sequence of the subunit. As a specific example, the polynucleotide encoding the subunit (a) can be represented by the nucleotide sequence of SEQ ID NO: 2 as described above.

  When producing the multimeric protein of the present invention from the polynucleotide, the polynucleotide may be used, for example, in a cell-free protein synthesis system, or introduced into a non-human host (hereinafter also referred to as host). May be.

  The introduction target of the polynucleotide is not particularly limited, and for example, it is preferably introduced into the host. By introducing the polynucleotide into the host, for example, a transformant that expresses the multimeric protein of the present invention can be produced, and the multimeric protein of the present invention can be produced. The host is not particularly limited, and can be appropriately selected depending on, for example, the purpose of use of the polynucleotide of the present invention described above. Examples of the host include microorganisms, animal cells, insect cells, plant cells, and cultured cells thereof.

When the multimeric protein of the present invention is produced by the polynucleotide, the host is not particularly limited. The host is the same as described above, but among them, microorganisms, animal cells, insect cells, plant cells or cultured cells thereof are preferable. Examples of the microorganism include prokaryotes and eukaryotes. The prokaryotes, for example, E. coli (Escherichia coli) Escherichia genus such as Bacillus subtilis (Bacillus subtilis) Bacillus such as, Pseudomonas such as Pseudomonas putida (Pseudomonas putida), Rhizobium meliloti (Rhizobium meliloti), such as Examples include bacteria of the genus Rhizobium. Examples of the eukaryote include yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe . Examples of the animal cells include COS cells and CHO cells, and examples of the insect cells include Sf9 cells and Sf21 cells. For example, the multimeric protein can be produced by introducing the polynucleotide into the host.

  The method for introducing the polynucleotide into the host is not particularly limited, and can be performed by a known method. The introduction method can be appropriately set depending on, for example, the type of the host.

  Examples of the introduction method include introduction method using a gene gun such as particle gun, calcium phosphate method, polyethylene glycol method, lipofection method using liposome, electroporation method, ultrasonic nucleic acid introduction method, DEAE-dextran method, micro glass tube, etc. Examples include a direct injection method using a hydrogel, a hydrodynamic method, a cationic liposome method, a method using an introduction aid, and a method using Agrobacterium. Examples of the liposome include lipofectamine and cationic liposome, and examples of the introduction aid include atelocollagen, nanoparticles, and polymers. The polynucleotide may be introduced into the host by an expression vector as described below, for example.

  The expression vector is not particularly limited as long as the polynucleotide is functionally linked so that, for example, the subunit encoded by the polynucleotide can be expressed in the host. The host is not particularly limited and can be appropriately selected. Examples of the host include microorganisms, animal cells, insect cells, plant cells, or cultured cells thereof, as in the description of the polynucleotide.

  The expression vector can be prepared, for example, by inserting the polynucleotide into a backbone vector (hereinafter also referred to as “basic vector”). The type of the vector is not particularly limited, and can be appropriately determined according to the type of the host. When transforming bacteria such as E. coli, examples of the vector include a pET vector (Merck), a pCold vector (Takara Bio Inc.), a PQE vector (QIAGEN), and the like. In the case of transformation into eukaryotes such as yeast, examples of the vector include pYE22m, and commercially available yeast expression vectors such as pYES (Invitrogen) and pESC (Stratagene) can also be used. When the vector is transformed using the Agrobacterium method, for example, a binary vector is preferable, and examples thereof include pBI121, pPZP202, pBINPLUS, and pBIN19.

  The expression vector preferably has a regulatory sequence that regulates, for example, the expression of the polynucleotide and the subunit encoded by the polynucleotide. Examples of the regulatory sequence include a promoter, terminator, enhancer, polyadenylation signal sequence, origin of replication sequence (ori) and the like. The origin of the promoter is not particularly limited, and examples thereof include cytomegalovirus (CMV), rous sarcoma virus (RSV), simian virus-40 (SV-40), muscle β-actin promoter, herpes simplex virus (HSV) and the like. can give. In addition to this, for example, a tissue-specific promoter such as a thymidine kinase promoter, a regulatory promoter such as a growth hormone regulatory promoter, a promoter under the control of the lac operon sequence, an inducible such as a zinc-inducible metallothionein promoter Promoters and the like. In the expression vector, the arrangement of the regulatory sequences is not particularly limited. In the expression vector, the regulatory sequence may be arranged based on a known method as long as it is functionally regulated, for example, the expression of the polynucleotide and the subunit encoded by the polynucleotide. . As the regulatory sequence, for example, a sequence provided in advance in the basic vector may be used, the regulatory sequence may be further inserted into the basic vector, and the regulatory sequence provided in the basic vector It may be replaced with the regulatory sequence.

  The expression vector may further include a selection marker coding sequence, for example. Examples of the selection marker include drug resistance markers, fluorescent protein markers, enzyme markers, cell surface receptor markers, and the like.

  The method for introducing the expression vector into the host is not particularly limited, and can be performed by a known method. The introduction method can be appropriately determined according to, for example, the type of host, the type of expression vector, and the like. The host and the introduction method are the same as those described for the polynucleotide, for example.

  The expressed multimeric protein may be used, for example, as it is after expression, or may be further purified. The purification method is not particularly limited, and examples thereof include salting out and various chromatography.

  The multimeric protein of the present invention thus obtained can be used, for example, for protein solubilization and protein analysis, as described later.

<Protein solubilizer>
As described above, the protein solubilizer of the present invention includes the multimeric protein of the present invention. The protein solubilizing agent of the present invention is characterized by containing the multimeric protein, and other configurations are not limited at all. The protein solubilizer of the present invention can be used for protein solubilization, protein analysis, etc., as described later.

  The protein solubilizer of the present invention may contain, for example, a known protein solubilizer in addition to the multimeric protein.

<Method of protein solubilization>
The protein solubilization method of the present invention includes a step of bringing the multimeric protein of the present invention into contact with a test protein. The protein solubilization method of the present invention is characterized by containing the multimeric protein, and other steps are not limited at all. According to the protein solubilization method of the present invention, a test protein can be solubilized.

  Examples of the test protein include protein aggregates and folding proteins as described above. Specific examples of the test protein include amyloid β, prion protein, α synuclein, actin, DNase I, α factor precursor protein, superoxide dismutase (SOD), and the like. Examples of the SOD include manganese-SOD (Mn-SOD).

  The test protein may be, for example, a purified protein or an unpurified protein, and the latter may be, for example, a tissue extract or a cell extract.

  The origin of the multimeric protein used in the protein solubilization method of the present invention is not particularly limited, and can be appropriately determined depending on, for example, the type of the test protein. When the test protein is derived from a human, the multimeric protein is preferably derived from a human.

  The contact of the multimeric protein with the test protein can be performed, for example, by adding the multimeric protein to the test protein or by adding the test protein to the multimeric protein. The addition amount of the multimeric protein is not particularly limited, and can be appropriately determined depending on the type of the test protein. The addition amount is, for example, 1: 0.5 to 10, preferably 1: 1 to 5 for the multimeric protein: the test protein (molar ratio).

  The reaction conditions between the multimeric protein and the test protein are not particularly limited, and can be appropriately determined depending on the type of the test protein. The reaction temperature of the said reaction conditions is 20-42 degreeC, for example, Preferably it is 25-37 degreeC, More preferably, it is 30 degreeC. The reaction time under the above reaction conditions is, for example, 10 minutes to 12 hours, preferably 20 minutes to 6 hours, and more preferably 30 minutes to 1 hour.

  The contact between the multimeric protein and the test protein is preferably performed, for example, in the presence of a solvent. As the solvent, for example, an aqueous solvent such as water or a buffer solution is preferable. The pH of the solvent is not particularly limited as long as the test protein exhibits a solubilizing activity. For example, the pH is 6.0 to 8.5, and preferably 6.8 to 7.4. When the multimeric protein and the test protein are contacted in the solvent, the ratio (molar ratio) of the multimeric protein to the test protein is, for example, the multimeric protein: the test protein, It is 1: 0.5-10, Preferably it is 1: 1-5.

<Protein analysis method>
The protein analysis method of the present invention includes a step of solubilizing a test protein with the multimeric protein and a step of detecting a lysate of the test protein. The protein analysis method of the present invention is characterized by containing the multimeric protein, and other steps are not limited at all. According to the analysis method of the present invention, for example, the test protein can be qualitatively analyzed or quantitatively analyzed.

  The method for solubilizing the test protein is the same as described above for the protein solubilization method. The test protein is not particularly limited, and is as described above, for example.

  The detection of the solubilized product of the test protein is not particularly limited, and a known protein detection method can be employed. Examples of the protein detection method include antigen-antibody method, Western blot method, ELISA (Enzyme-Linked Immunosorbent Assay) method and the like.

<Analysis reagents>
The analytical reagent of the present invention is an analytical reagent used in the method for analyzing a test protein, and includes the multimeric protein of the present invention. The analysis reagent of the present invention is characterized by containing the multimeric protein, and other configurations are not limited at all. According to the analysis reagent, the test protein can be analyzed as described above. Moreover, the said analysis reagent can be used also for the analysis method of the morbidity risk of the disease of this invention mentioned later.

  In addition to the multimeric protein, the analysis reagent may further contain a detection reagent for the test protein. Examples of the detection reagent include an antibody against the test protein. In this case, it is preferable that a substance for detecting the binding between the test protein and the antibody is further included. Examples of the detection substance include a combination of a detectable labeled antibody against the antibody and a substrate for the label.

<Analyzing method of disease risk>
The disease risk analysis method of the present invention is a method for analyzing a disease risk of a disease in which a protein aggregate or a folding protein serves as an indicator protein,
Contacting the biological protein of the present invention with the multimeric protein of the present invention, solubilizing the indicator protein in the biological sample;
And a step of detecting a solubilized product of the indicator protein. The disease risk analysis method of the present invention is characterized by containing the multimeric protein, and other steps are not limited at all. According to the disease risk analysis method of the present invention, for example, the risk of disease of a subject can be analyzed using the expression level of the indicator protein as an index.

  Examples of the indicator protein include amyloid β, prion protein, α-synuclein, actin, SOD such as Mn-SOD, and the like.

  The method for solubilizing the indicator protein and the method for detecting the solubilized protein are as described above, for example.

  Next, examples of the present invention will be described. However, the present invention is not limited by the following examples.

[Example 1]
The multimeric protein of the present invention was prepared by the following method.

(1) Expression of a multimeric protein A polynucleotide operably linked to a polynucleotide of SEQ ID NO: 2 encoding a subunit of a human multimeric protein and a histidine tag polynucleotide is cloned into a pFastBac1 vector for production of baculovirus. did. This cloning vector was introduced into insect cells Sf9 using the Bac-to-Bac system (Invitrogen). After the introduction, the cells were cultured for 5 to 7 days, and the culture supernatant containing the baculovirus for subunit expression was recovered. The Sf9 cells were cultured at 27 ° C. using Grace medium containing 10% FBS (hereinafter the same).

  Next, the culture supernatant was added to new Sf9 cells so as to have an MOI of 2 to 5, and the baculovirus was infected. After the infection, the cells were cultured for 2 to 3 days, and Sf9 cells containing the multimeric protein were collected.

(2) Purification of multimeric protein Four times the weight of Ni-NTA equilibration buffer was added to the Sf9 cells to prepare a cell suspension. The composition of the Ni-NTA equilibration buffer was 100 mmol / L Tris-HCl (pH 8.5), 1 mmol / L PMSF (the same applies hereinafter). Next, an equal volume of glass beads was added to the cell suspension and homogenized. Then, the homogenized suspension is centrifuged at 5,000 rpm at 4 ° C. for 5 minutes, and after collecting the supernatant, the supernatant is again centrifuged at 50,000 rpm at 4 ° C. for 50 minutes. did. Further, after the centrifugation, an equal weight of the equilibration buffer for Ni-NTA was added to the obtained pellet, and a pellet suspension was prepared using a glass downs homogenizer (WHEATON).

  Ni-NTA agarose (QIAGEN) 1.2 to 1.3 times the volume of the pellet suspension was equilibrated with Ni-NTA equilibration buffer, and this was added to the pellet suspension to add multimeric protein. It bound to the Ni-NTA agarose. Next, the Ni-NTA agarose was packed in an Econo column (Bio-Rad), and the eluate containing the multimeric protein was recovered using an elution buffer for Ni-NTA. The composition of the elution buffer for Ni-NTA was 100 mmol / L Tris-HCl (pH 8.5), 1 mmol / L PMSF, and 100 mmol / L imidazole (the same applies hereinafter). The eluate was dialyzed against an equilibration buffer for ion exchange columns. The composition of the equilibration buffer for the ion exchange column was 50 mmol / L Tris-HCl (pH 6.8), 1 mmol / L PMSF, 1 mmol / L DTT (the same applies hereinafter).

  DEAE-Fast Flow resin (GE Healthcare) or MonoQ resin (GE Healthcare) was equilibrated with the equilibration buffer for the ion exchange column, and this was added to the eluate after the dialysis, and the multimeric protein in the eluate was added. Was adsorbed to the resin. The amount of the resin added to the eluate was 3 to 3.5 mL of the resin per 1 mg of the cell weight. Next, the resin was washed with the ion exchange column equilibration buffer, packed in an Econo column, and the multimeric protein was eluted from the resin using an ion exchange column elution buffer. The composition of the elution buffer for the ion exchange column was 50 mmol / L Tris-HCl (pH 6.8), 1 mmol / L PMSF, 1 mmol / L DTT, and NaCl. The concentration of NaCl in the ion exchange column elution buffer was 100 mmol / L, 300 mmol / L, or 500 mmol / L.

  The obtained eluate was concentrated to 60 μL using an ultrafiltration filter (trade name Amicon Ultra, Millipore) according to the attached protocol. The concentrated eluate is purified by gel filtration chromatography using a gel filtration column (trade name Superdex200 PC3.2 / 30, GE Healthcare) and Smart System (GE Healthcare) to purify fractions containing multimeric proteins. did.

[Example 2]
Using the multimeric protein prepared in Example 1, the pick bodies were solubilized and the solubilized product was detected.

  Pick bodies were prepared by the following method. First, a frozen section derived from an autopsy brain of Pick's disease was subjected to immunohistochemical staining with an anti-abnormal phosphorylated tau antibody (AT8, Thermo), and a pick body stained with the antibody was then subjected to laser microdisector (Naomi S. Hachiya and). Recovered using Kiyotoshi Kaneko, “CHAPTER12: Investigation of Laser-microdiscovered Inclusion Bodies”, Methods in Cell Biology, 2007, Vol. 82, pp. 355-375).

Next, the five pick bodies and the multimeric protein (protein amount 0.5 mg) were added to Hepes buffer and allowed to react for 1 hour. The composition of the Hepes buffer was 20 mmol / L Hepes-KOH (pH 7.4), 10 mmol / L Mg (OAc) ₂ , 1 mmol / L DTT, 2 mmol / L ATP. From the reaction solution, 1/5 volume corresponding to one pick body was sampled and subjected to SDS-PAGE. The gel after the electrophoresis is reacted with the antibody AT8, and then developed with a Western blotting reagent (trade name ECL Plus, GE Healthcare), and the color development is measured with a photochemical detection device (trade name VersaDoc5000, Bio-Rad). By doing so, abnormal phosphorylated tau protein was detected. As a negative control, electrophoresis was performed in the same manner except that the multimeric protein was not added.

  The result is shown in FIG. FIG. 1 is a photograph of a Western blot in which abnormal phosphorylated tau protein contained in a pick body was detected. In FIG. 1, lane 1 is a molecular weight marker, lane 2 is a sample buffer of SDS-PAGE only, lane 3 is a negative control to which the multimeric protein is not added, and lane 4 is an example in which the multimeric protein is added. Results are shown. As shown in FIG. 1, in the lane 3 negative control, the pick body-derived lysate band could not be detected, whereas in the lane 4 example, the pick body lysate band was not detected. It was detected. From these results, it was found that the multimeric protein exhibits an excellent solubilizing activity for protein aggregates.

[Example 3]
In Example 1, bovine multimeric protein was synthesized in the same manner except that the nucleotide of SEQ ID NO: 4 encoding the subunit of bovine multimeric protein was used instead of the nucleotide of SEQ ID NO: 2 encoding the subunit of human multimeric protein. Multimeric protein was prepared. Using this, Pro αF was solubilized and the solubilized product was detected.

First, 200 ng of Pro αF and 500 ng of the bovine multimeric protein were mixed with 100 μL of Hepes buffer (20 mmol / L Hepes-KOH (pH 7.4), 10 mmol / L Mg (OAc) ₂ , 1 mmol / L DTT, 2 mmol / L ATP ) And incubated at 30 ° C. for 30 minutes. After the incubation, 2 μL of 50 μg / mL trypsin was added, mixed, and incubated at 16 ° C. for 15 minutes. Next, 100 μg / mL trypsin inhibitor was added and allowed to stand on ice for 5 minutes, then 5 μL of 2 mg / mL tRNA and 12 μL of 100% trichloroacetic acid (TCA) were added and stirred. After the stirring, the mixture was allowed to stand at −80 ° C. for 15 minutes or more, and further centrifuged at 4 ° C. and 15,000 rpm for 25 minutes. The obtained pellet was suspended in 8 μL of 2 mol / L Tris-base buffer to prepare an electrophoresis sample. Then, the electrophoresis sample was subjected to electrophoresis, and after the electrophoresis, Pro αF was quantified using an anti-Pro αF antibody. As a negative control, Pro αF was detected in the same manner except that the bovine multimeric protein was not added.

  The result is shown in FIG. FIG. 2 is a photograph of a Western blot in which Pro αF was detected. In FIG. 2, lane 1 shows the molecular weight marker, lane 2 shows the negative control without the bovine multimer protein added, and lane 3 shows the result of the example with the bovine multimeric protein added. As shown in FIG. 2, the amount of Pro αF protein was decreased in the Example of Lane 3 with respect to the amount of Pro αF protein in the negative control in Lane 2. From this result, it was found that the bovine multimeric protein showed an excellent solubilizing activity with respect to the folding protein.

[Example 4]
For the human-derived multimeric protein, the coiled-coil domain was analyzed according to the protocol using COLIS (EMBnet) based on the amino acid sequence of SEQ ID NO: 1.

  The result is shown in FIG. FIG. 3 is a graph showing a predicted region of a coiled-coil domain of a human-derived multimeric protein. In FIG. 3, the vertical axis represents the formation probability of a coiled coil, the horizontal axis represents the amino acid number when the N-terminal amino acid is the first, and window = 14 was analyzed with 14 amino acid residues as one unit. As for the result, window = 21 shows the result of analyzing 21 amino acid residues as one unit, and window = 28 shows the result of analyzing 28 amino acid residues as one unit. As shown in FIG. 3, it was found that the human-derived multimeric protein has two coiled-coil domains in the central region.

[Example 5]
For the bovine derived multimeric protein, the coiled-coil domain was analyzed by the same method as in Example 4 based on the amino acid sequence of SEQ ID NO: 3.

  The result is shown in FIG. FIG. 4 is a graph showing the predicted region of the coiled-coil domain of the bovine-derived multimeric protein. In FIG. 4, the vertical axis represents the coiled-coil formation probability, the horizontal axis represents the amino acid number when the N-terminal amino acid is the first, and window = 14 was analyzed with 14 amino acid residues as one unit. As for the result, window = 21 shows the result of analyzing 21 amino acid residues as one unit, and window = 28 shows the result of analyzing 28 amino acid residues as one unit. As shown in FIG. 4, the bovine-derived multimeric protein was found to have one coiled-coil domain in the C-terminal region.

  The multimeric protein of the present invention exhibits solubilizing activity for protein higher-order structures, and can solubilize protein aggregates and folding proteins. According to the present invention, it is possible to solubilize and analyze the protein aggregates observed in neurodegenerative diseases and the like. For this reason, the present invention is extremely useful in the fields of clinical medicine and biochemistry.

Claims (11)

A multimer characterized in that at least one subunit selected from the group consisting of the following (a), (b) and (c) is associated, and has a solubilizing activity for a protein higher-order structure: protein.
(A) a subunit consisting of the amino acid sequence of SEQ ID NO: 1 (b) a subunit consisting of an amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 1 ( c) a subunit consisting of an amino acid sequence which is 70% or more identical to the amino acid sequence of SEQ ID NO: 1. The multimeric protein according to claim 1, wherein the number of the associated subunits in one molecule of the multimeric protein is 10 to 12. The multimeric protein according to claim 1 or 2, wherein the subunit is derived from a human. A protein solubilizer comprising the multimeric protein according to any one of claims 1 to 3. The protein solubilizer according to claim 4, wherein the protein to be solubilized is at least one of a protein aggregate and a folding protein. 6. The protein to be solubilized is at least one selected from the group consisting of amyloid β, prion protein, α-synuclein, actin, DNase I, α-factor precursor protein, and superoxide dismutase (SOD). Protein solubilizer. A method for solubilizing a protein comprising the step of bringing the multimeric protein according to any one of claims 1 to 3 into contact with a test protein. A protein comprising the steps of solubilizing a test protein with the multimeric protein according to any one of claims 1 to 3, and detecting a lysate of the test protein. Analysis method. The test protein is at least one selected from the group consisting of amyloid β, prion protein, α-synuclein, actin, DNase I, α-factor precursor protein, and superoxide dismutase (SOD). Analysis method. An analytical reagent for use in the method for analyzing a test protein according to claim 8 or 9, comprising the multimeric protein according to any one of claims 1 to 3. A method for analyzing the risk of developing a disease in which a protein aggregate or a folding protein serves as an indicator protein,
Contacting the biological protein of a subject with the multimeric protein according to any one of claims 1 to 3, and solubilizing the indicator protein in the biological sample;
And a method for analyzing the risk of morbidity of the disease, comprising the step of detecting a solubilized product of the indicator protein.