JP2014084283A - Therapeutic agent for urination disorder - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a therapeutic agent or a treatment method for urination disorder having a novel mechanism.SOLUTION: A therapeutic agent for urination disorder contains a function inhibitor of Piezo1. Further, the therapeutic agent for urination disorder contains a polypeptide containing one or more amino acid sequence selected from the group consisting of: (f) amino acid sequence represented by SEQ ID No.1; (g) amino acid sequence represented by SEQ ID No.1 in which one or more amino acid are deleted, substituted, inserted or added; (h) amino acid sequence having 90% or more of homology with the amino acid sequence represented by SEQ ID No.1; (i) amino acid sequence obtained by coding a nucleic acid composed of a base sequence complementary to a base sequence coding the amino acid sequence represented by SEQ ID No.1 with a nucleic acid which specifically hybridizes under a stringent condition, and (j) amino acid sequence represented by SEQ ID No.3, 4, 5, 6, or 7.

Description

  The present invention relates to a therapeutic agent or a therapeutic method for dysuria.

  If the urination mechanism in the living body does not function normally, urination disorders such as frequent urination, urgency and urinary incontinence may occur. This dysuria is known as a urological disease that significantly lowers the quality of life (QOL). Possible causes of dysuria include, for example, disorders of the bladder, urethra, cerebral blood vessels, or nerves, but many details remain unclear. As a conventional treatment strategy for dysuria, an anticholinergic agent is most widely employed (for example, Non-Patent Document 1). In recent years, the use of β3 adrenergic receptor agonists has increased (for example, Non-Patent Document 2).

"A comparison of the efficacy and tolerability of solifenacin succinate and extended release tolterodine at treating overactive bladder syndrome: results of the STAR trial." Chapple et al., Eur Urol. 2005 Sep; 48 (3): 464-70. "Beta3-adrenoceptor agonists: possible role in the treatment of overactive bladder." Igawa et al., Korean J Urol. 2010 Dec; 51 (12): 811-8. Epub 2010 Dec 21.

  However, even if an anticholinergic agent or a β3 adrenergic receptor agonist is used, some patients often do not achieve a sufficient improvement effect or discontinue administration due to side effects. For this reason, there are many patients who cannot be sufficiently treated with conventional therapeutic agents alone.

  The present invention has been made in view of the above circumstances, and an object thereof is to provide a therapeutic agent for urination disorder or a therapeutic method having a novel mechanism.

  The inventors of the present application noticed that Piezo1 was specifically expressed in the bladder epithelium during research on dysuria. Moreover, when the function of Piezo1 was inhibited in further research, it was discovered that dysuria was improved and the present invention was completed.

  That is, according to the present invention, there is provided a therapeutic agent for dysuria, which contains a substance that suppresses Piezo1 function.

  The Piezo1 is preferably Piezo1 expressed in the bladder epithelium. The function-suppressing substance is preferably a substance that inhibits Ca ions from flowing into the cells in the bladder epithelium. The function-suppressing substance is preferably a substance that does not substantially inhibit the function of TRPV4 in the bladder epithelium. The function-suppressing substance preferably has (a) an amino acid sequence represented by SEQ ID NO: 1, (b) one or more amino acids deleted, substituted, or inserted from the amino acid sequence represented by SEQ ID NO: 1, Or an added amino acid sequence, (c) an amino acid sequence having 90% or more homology to the amino acid sequence represented by SEQ ID NO: 1, and (d) a base sequence encoding the amino acid sequence represented by SEQ ID NO: 1. An amino acid sequence encoded by a nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid comprising a base sequence complementary to, and (e) an amino acid sequence represented by SEQ ID NO: 2, 3, 4, 5, or 6 A polypeptide comprising one or more amino acid sequences selected from the group consisting of: The function suppressing substance is preferably GsMTx-4.

  According to the present invention, (f) one or more amino acids are deleted, substituted, inserted or added to the amino acid sequence represented by SEQ ID NO: 1 and (g) the amino acid sequence represented by SEQ ID NO: 1. (H) an amino acid sequence having 90% or more homology to the amino acid sequence represented by SEQ ID NO: 1, and (i) complementary to the base sequence encoding the amino acid sequence represented by SEQ ID NO: 1. An amino acid sequence encoded by a nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid comprising a basic nucleotide sequence, (j) an amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7 There is provided a therapeutic agent for dysuria, comprising a polypeptide comprising one or more amino acid sequences selected from the group consisting of:

  According to the present invention, dysuria can be treated through a novel mechanism.

FIG. 1A is a diagram showing the results of measuring the mRNA expression level of Piezo1 for each tissue. FIG. 1B is a diagram showing the results of measuring the mRNA expression level of Piezo2 for each tissue. FIG. 2 is a diagram showing the results of fluorescent immunostaining on mouse bladder tissue. FIG. 3 is a diagram showing the results of fluorescent immunostaining on human bladder tissue. FIG. 4 is a graph showing the results of measuring mRNA expression levels of Piezo1, TRPV4, and Vnut in cultured human bladder epithelium or mouse bladder epithelium. FIG. 5 is a diagram showing the results of measuring the expression level of Piezo1 in bladder epithelium in patients with lower urinary tract obstruction and non-obstruction patients. FIG. 6 is a diagram showing the results of examining the correlation between the expression level of Piezo1 and age. FIG. 7 is a diagram showing the results of measuring the expression level of Piezo1 m-RNA in Piezo1 KD cells and the like. FIG. 8 is a diagram showing the results of measuring the protein expression level of Piezo1 in Piezo1 KD cells and the like. FIG. 9 is a diagram showing the results of Ca imaging before and after extension stimulation in control cells. FIG. 10 shows the results of Ca imaging before and after extension stimulation in Piezo1 KD cells. FIG. 11 is a graph showing the results of comparison of Ca ²⁺ influx into cells during extension stimulation between control cells and Piezo1 KD cells. FIG. 12 is a diagram showing the results of photographing extracellular ATP released upon extension stimulation in control cells and Piezo1 KD cells. FIG. 13 is a graph showing the results of comparing the amount of ATP released to the outside of cells during extension stimulation in control cells and Piezo1 KD cells. FIG. 14 is a diagram showing the results of measuring the amount of Ca 2+ inflow into cells during expansion stimulation in cultured bladder epithelial cells treated with GsMTx-4. FIG. 15A is a diagram showing the results of measuring the change in Ca ²⁺ inflow when the bladder epithelial cultured cells treated with GsMTx-4 were washed and GsMTx-4 was removed. FIG. 15B is a diagram showing the results of measuring the change in Ca ²⁺ inflow when the cultured bladder epithelial cells treated with GsMTx-4 were washed and GsMTx-4 was removed. FIG. 16 is a diagram showing the results of measuring the amount of ATP released to the outside of cells cultured in bladder epithelium treated with GsMTx-4 upon extension stimulation. FIG. 17 shows the results of evaluating whether GsMTx-4 inhibits TRPV4 in cultured bladder epithelial cells. FIG. 18 is a diagram showing the results of an experiment of administering GsMTx-4 to mice. FIG. 19 is a diagram showing a comparison result of urination records during the active period (dark period) 12 hours in the administration experiment of GsMTx-4 to mice. FIG. 20 is a diagram showing the results of comparing the number of urinations in the GsMTx-4 administration group and the control group in the GsMTx-4 administration experiment. FIG. 21 is a diagram showing the results of comparing the amount of single urination in the GsMTx-4 administration group and the control group in the GsMTx-4 administration experiment.

  Hereinafter, embodiments of the present invention will be described in detail. In addition, in order to avoid the repetition complexity about the same content, description is abbreviate | omitted suitably.

  One embodiment of the present invention is a novel therapeutic agent for dysuria. This therapeutic agent is, for example, a therapeutic agent for dysuria including a substance that suppresses Piezo1 function. This Piezo1 function-suppressing substance can promote a decrease in the number of urinations and an increase in the amount of urination once, as demonstrated in Examples described later. Therefore, urination disorder can be treated by using a therapeutic agent having the above configuration.

In one embodiment of the present invention, “Piezo” is a protein that functions as an ion channel that allows ions such as Ca ²⁺ to flow into cells. Piezo has Piezo1 and Piezo2. Piezo1 may have the amino acid sequence represented by SEQ ID NO: 8 or SEQ ID NO: 9, for example. Piezo1 is expressed in various places in the living body. In order to treat dysuria, it is preferable to suppress the function of Piezo1 expressed in the bladder epithelium.

  In one embodiment of the present invention, the “function suppressing substance” is a substance that suppresses the function of Piezo1. Alternatively, the function suppressing substance includes a function inhibitor of Piezo1. The form of the function inhibitor may be, for example, a polypeptide, an RNA chain, a DNA chain, an antibody, or a low molecular organic compound. As the polypeptide, GsMTx-4 can be purchased from PEPTIDE INSTITUTE, INC. As the RNA strand, for example, an RNA strand having an RNAi action on Piezo1 (eg, siRNA, shRNA, etc.) can be used. The RNA strand can be designed by, for example, Stealth RNAi designer (Invitrogen) or siDirect 2.0 (Naito et al., BMC Bioinformatics. 2009 Nov 30; 10: 392.). As the DNA chain, a DNA chain encoding the polypeptide, a DNA chain encoding the RNA chain, or a DNA aptamer that suppresses the function of Piezo1 can be used. The DNA aptamer can be produced by using, for example, the SELEX method. For the production of the antibody, a known antibody production method (for example, the method described in Clackson et al., Nature. 1991 Aug 15; 352 (6336): 624-628.) May be used, or a contract company ( For example, EVEC, Inc., ADVANCE CO., LTD. At this time, it is preferable to prepare an antibody library and select one having high activity suppression activity of Piezo1. The low molecular weight compound can be obtained by utilizing combinatorial chemistry or high throughput screening. The function-suppressing substance can inhibit Ca ion influx into the bladder epithelium through the function-suppressing action of Piezo1. Further, the function-suppressing substance is preferably a substance that does not substantially inhibit the function of TRPV4 in the bladder epithelium. In this case, side effects caused by the inhibition of the function of TRPV4 can be suppressed. The above “does not substantially inhibit the function” includes, for example, a state in which the function is maintained at 0.9, 0.95, 0.99% or more, or 100%.

  In one embodiment of the present invention, “GsMTx-4” may be a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1. GsMTx-4 may be composed of L-type or D-type amino acids. GsMTx-4 composed of D-type amino acids and GsMTx-4 composed of L-type amino acids can exhibit the same activity, for example, Suchyna et al., Nature. 2004 Jul 8; 430 (6996 ): 235-40.

  In one embodiment of the present invention, “RNAi” suppresses the function of a target gene or mRNA or the like by siRNA, shRNA, miRNA, short or long single or multiple stranded RNA (eg, double stranded RNA), etc. Or it is a phenomenon that is silenced. In general, the suppression mechanism by RNAi is sequence-specific and exists in various biological species. The mechanism of RNAi in a typical mammal when siRNA or shRNA is used is as follows. First, a vector that expresses (or encodes) siRNA or shRNA is introduced into cells. Then, after siRNA or shRNA is expressed in the cell, siRNA or shRNA becomes single-stranded, and then RISC (RNA-induced Silencing Complex) is formed. RISC uses the incorporated single-stranded RNA as a guide molecule and recognizes a target RNA strand having a sequence highly complementary to this single-stranded RNA. The target RNA strand is cleaved by an enzyme such as AGO2 in RISC. Thereafter, the cleaved target RNA strand is degraded. The above is an example of the mechanism. As the RNA strand having an RNAi action on Piezo1, for example, a single-stranded or multiple-stranded RNA strand comprising the base sequence represented by SEQ ID NO: 2 can be used. This RNA chain may further contain the base sequence represented by SEQ ID NO: 12. This RNA strand may further contain a 3 ′ protruding end. As long as this RNA strand has an RNAi action on Piezo1, one or more amino acids may be deleted, substituted, inserted, or added.

  In addition, the function-suppressing substance comprises (a) an amino acid sequence represented by SEQ ID NO: 1, and (b) one or more amino acids deleted, substituted, inserted, or added to the amino acid sequence represented by SEQ ID NO: 1. (C) an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 1, and (d) complementary to the base sequence encoding the amino acid sequence represented by SEQ ID NO: 1. Consisting of an amino acid sequence encoded by a nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid comprising such a base sequence, and (e) an amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7. It may be a polypeptide comprising one or more amino acid sequences selected from the group.

  The “plurality” may be, for example, 10, 8, 6, 4, or 2, or may be any value or less. From the viewpoint of maintaining the activity of GsMTx-4 at a high level, the polypeptide is preferably as small as possible. In general, it is known that polypeptides that have been deleted, added, inserted, or replaced by other amino acids in one or more amino acid residues maintain their biological activity (Mark et al ., Proc Natl Acad Sci US A. 1984 Sep; 81 (18): 5662-5666., Zoller et al., Nucleic Acids Res. 1982 Oct 25; 10 (20): 6487-6500., Wang et al., Science. 1984 Jun 29; 224 (4656): 1431-1433.). In addition, a polypeptide that has been deleted, substituted, inserted, or added can be produced, for example, by site-directed mutagenesis or random mutagenesis. As a site-directed mutagenesis method, for example, KOD-Plus-Mutagenesis Kit (TOYOBO CO., LTD.) Can be used.

  The “90% or more” may be, for example, 90, 95, 98, 99, or 100%. Or it may be more than either value or in any two ranges. From the viewpoint of maintaining the activity of GsMTx-4 at a high level, the polypeptide is preferably as large as possible.

  The above-mentioned “homology” may be calculated according to a method known in the art, based on the ratio of the number of amino acids homologous in two or more amino acid sequences. Before calculating the ratio, the amino acid sequences of the group of amino acid sequences to be compared are aligned, and a gap is introduced into a part of the amino acid sequence when necessary to maximize the ratio of the same amino acids. Methods for alignment, percentage calculation, comparison methods, and related computer programs are well known in the art (eg, BLAST, GENETYX, etc.). In the present specification, “homology” can be represented by a value measured by BLAST of NCBI (http://www.ncbi.nlm.nih.gov/) unless otherwise specified. Blastp can be used as the default algorithm for comparing amino acid sequences with BLAST. Although the measurement result is quantified as Positives or Identities, this embodiment preferably employs Positives.

  For example, the following conditions can be adopted as the “stringent conditions”. (1) Use low ionic strength and high temperature for washing (eg, 50 ° C., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate), (2) during hybridization Use a denaturing agent such as formamide (eg, at 42 ° C., 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5, And 750 mM sodium chloride, 75 mM sodium citrate) or (3) 20% formamide, 5 × SSC, 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and 20 mg / ml denaturation Incubate overnight at 37 ° C. in a solution containing sheared salmon sperm DNA, then wash the filter with 1 × SSC at approximately 37-50 ° C. The formamide concentration may be 50% or higher. The wash time may be 5, 15, 30, 60, or 120 minutes, or longer. Multiple factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization reactions. For details, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). .

  In the above polypeptide, when one or a plurality of amino acids are substituted with another amino acid, it is preferably substituted with another amino acid that preserves the properties of the amino acid side chain. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G , H, K, S, T), an amino acid having an aliphatic side chain (G, A, V, L, I, P), an amino acid having a hydroxyl group-containing side chain (S, T, Y), a sulfur atom-containing side Amino acids with chains (C, M), amino acids with carboxylic acid and amide-containing side chains (D, N, E, Q), amino groups with base-containing side chains (R, K, H), and aromatics Amino acids having side chains (H, F, Y, W) can be mentioned (the parentheses represent single letter symbols of amino acids). Substitutions between amino acids within each of these groups are collectively referred to as “conservative substitutions”. In addition, when the polypeptide has a Cys residue capable of forming a disulfide bond, the Cys residue may be excluded from the target of substitution or the like.

  It has been described in International Publication No. 2004/085647 that a polypeptide comprising “the amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7” can exhibit a function equivalent to that of GsMTx-4. Yes. Therefore, the function-suppressing substance may be a polypeptide containing the “amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7”. The amino acid sequences of SEQ ID NOs: 3 to 7 are WKCNPNDDKC, CARPKLKC, WKCNPNDDKAARPKLKC, CAAPKLKC, and CARPKLAC in this order.

  In one embodiment of the present invention, the “polypeptide” includes those composed of a plurality of amino acids or their equivalents combined. In this embodiment, what are called oligopeptides and proteins are also included in the subordinate concepts of polypeptides. The chain length of the oligopeptide may be, for example, 5, 8, 10, 17, 20, 30, 34, 40, 50, 100, 300, 600, or 1000 amino acids, or more than any of these values, or It may be within any two ranges. Moreover, a chemical modification body, a salt, a solvate, etc. may be formed. For the production of the polypeptide, for example, a synthesizer (for example, PSSM-8 (SHIMADZU CORPORATION)) may be used, or a contract company (for example, GenScript USA Inc.) may be outsourced.

  In one embodiment of the present invention, “amino acid” is a general term for organic compounds having an amino group and a carboxyl group. When the polypeptide according to the embodiment of the present invention includes a “specific amino acid sequence”, any amino acid in the amino acid sequence may be chemically modified. Any amino acid in the amino acid sequence may form a salt or a solvate. Further, any amino acid in the amino acid sequence may be L-type or D-type. Even in such a case, it can be said that the polypeptide according to the embodiment of the present invention includes the above-mentioned “specific amino acid sequence”. That is, for example, R in the amino acid sequence may be arginine, or a chemically modified product, salt, or solvate thereof. Examples of the chemical modification that amino acids contained in the polypeptide undergo in vivo include, for example, N-terminal modification (for example, acetylation, myristoylation, etc.), C-terminal modification (for example, amidation, glycosylphosphatidylinositol addition, etc.) Chain modification (for example, phosphorylation, sugar chain addition, etc.) is known. The “salt” is not particularly limited, and includes, for example, an anion salt formed with any acidic (eg, carboxyl) group, or a cation salt formed with any basic (eg, amino) group. Salts include inorganic and organic salts such as those described in Berge et al., J. Pharm. Sci., 1977, 66, 1-19. Examples thereof include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, and the like. The “solvate” is a compound formed by a solute and a solvent. See, for example, J. Honig et al., The Van Nostrand Chemist's Dictionary P650 (1953) for solvates. If the solvent is water, the solvate formed is a hydrate. This solvent is preferably one that does not interfere with the biological activity of the solute. Examples of such preferred solvents include, but are not limited to water, ethanol, or acetic acid.

  The “DNA strand encoding the polypeptide” or the “DNA strand encoding the RNA strand” may be linked to a vector. This form is particularly suitable for gene therapy. Examples of the vectors include plasmids derived from E. coli (for example, pET-Blue), plasmids derived from Bacillus subtilis (for example, pUB110), yeast-derived plasmids (for example, pSH19), animal cell expression plasmids (for example, pA1-11), λ phage, and the like Bacteriophage, virus-derived vectors and the like can be used. These vectors may contain components necessary for protein expression, such as a promoter, a replication origin, or an antibiotic resistance gene. The vector may be an expression vector.

  The function inhibitor may be a substance that suppresses the function of mutant Piezo1. Variants include those resulting from differences in DNA sequences between individuals. The amino acid sequence of the mutant Piezo1 preferably has 90% or more homology with the amino acid sequence shown in SEQ ID NO: 8, particularly preferably 95% or more.

In one embodiment of the present invention, the state in which the function of Piezo1 is suppressed includes a state in which the activity of Piezo1 (for example, Ca ²⁺ influx activity) is significantly reduced as compared to normal. The “significantly decreased” may be, for example, a state in which the activity is decreased by 0.8, 0.75, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or 0 times. Alternatively, it may be less than any one of the values exemplified here, or may be within the range of any two values. From the viewpoint of clearly improving urination disorder, it is preferable that the urination disorder is reduced to 0.75 times or less. The Ca ²⁺ influx activity may be measured by Ca imaging. Further, in the present specification, “significantly” may include, for example, a case where statistical significance is evaluated using Student's t test (one-sided or two-sided) and p <0.05. Or the state in which the difference has arisen substantially is included.

  In one embodiment of the present invention, “urination disorder” is a disease caused by the in vivo urination mechanism not working normally. Urination disorders include urine storage disorders or discharge disorders. Urination disorders include frequent urination, urgency, urinary incontinence, overactive bladder, interstitial cystitis and the like. Overactive bladder is a disease with urgency due to involuntary contraction of the bladder, for example. Interstitial cystitis is an intractable disease that exhibits symptoms such as frequent urination and pain when the bladder is full.

  One embodiment of the present invention is a method for treating dysuria, comprising a step of suppressing the function of Piezo1. One embodiment of the present invention is a method for treating dysuria, which comprises a step of inhibiting Ca ions from flowing into cells in the bladder epithelium. In these treatment methods, the above-mentioned function-suppressing substances can be used.

  In one embodiment of the present invention, “treatment” refers to the ability to exert a symptom-improving effect or a preventive effect on a subject's disease or one or more symptoms associated with the disease. In one embodiment of the present invention, a “therapeutic agent” may be a pharmaceutical composition comprising one or more pharmacologically acceptable carriers. The pharmaceutical composition can be produced by any method known in the technical field of pharmaceutics, for example, by mixing an active ingredient (for example, a function inhibitor of Piezo1) and the above carrier. In addition, the form of use of the therapeutic agent is not limited as long as it is a substance used for treatment, and it may be an active ingredient alone or a mixture of an active ingredient and an arbitrary ingredient. The shape of the carrier is not particularly limited, and may be, for example, a solid or a liquid (for example, a buffer solution). The therapeutic agent includes a drug (prophylactic agent) used for prevention.

  The administration route of the therapeutic agent is preferably one that is effective for treatment, and may be, for example, intravenous, subcutaneous, intramuscular, intraperitoneal, or oral administration. The administration form may be, for example, an injection, capsule, tablet, granule or the like. When administering a polypeptide, it is effective to use it as an injection. An aqueous solution for injection may be stored in, for example, a vial or a stainless steel container. The aqueous solution for injection may contain, for example, physiological saline, sugar (for example, trehalose), NaCl, or NaOH. The therapeutic agent may contain, for example, a buffer (for example, phosphate buffer), a stabilizer and the like.

  The dose is not particularly limited, and may be, for example, 10, 27, 270, 1350, 2000, or 30000 μg / kg body weight per time. Alternatively, it may be any one of the values exemplified here or more, or within the range of any two values. Although the administration interval is not particularly limited, for example, it may be administered once or twice a day. The dose, administration interval, and administration method can be appropriately selected depending on the age, weight, symptom, target organ, etc. of the subject. It may also be administered in combination with an appropriate chemotherapeutic agent. The therapeutic agent preferably contains a therapeutically effective amount or an effective amount of an active ingredient that exhibits a desired action.

  If the number of urinations per day for patients with dysuria decreases compared to before treatment, and the average amount of urination per day increases compared to before treatment, it is determined that the urination disease has been treated. Also good. The reduced number of times may be, for example, 1, 2, 3, 4, or 5. Alternatively, it may be any one of the values exemplified here or more, or within the range of any two values. The increased average urination volume may be 1000, 2500, 5000, 10000, 20000, or 30000 μl / kg body weight. Alternatively, it may be any one of the values exemplified here or more, or within the range of any two values.

  In one embodiment of the present invention, a “subject” is a human or non-human mammal (eg, mouse, guinea pig, hamster, rat, mouse, rabbit, pig, sheep, goat, cow, horse, cat, dog, marmoset. , Monkeys, chimpanzees, etc.).

  One embodiment of the present invention is a therapeutic agent for dysuria, comprising a substance that inhibits the inflow of Ca ions into cells in the bladder epithelium. As this substance, the above-mentioned function-suppressing substance can be used.

  One embodiment of the present invention is a kit for treating dysuria, comprising the above-mentioned function inhibitor or GsMTx-4. The kit may further include, for example, a buffer solution, a package insert describing information on active ingredients, a container for containing the active ingredients, or a package.

  In the present embodiment, “or” is used when “at least one or more” of items listed in the sentence can be adopted.

  As mentioned above, although embodiment of this invention was described, these are illustrations of this invention and various structures other than the above are also employable. Moreover, it is also possible to adopt a combination of the configurations described in the above embodiments.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further, this invention is not limited to these.

  <Example 1> Evaluation of expression level of Piezo

(1) Evaluation of m-RNA expression level Piezo m-RNA expression levels in mouse bladder epithelium and tissues other than bladder epithelium were determined by quantitative RT-PCR. The results are shown in FIGS. 1A and 1B. Piezo1 m-RNA was significantly expressed in bladder epithelium. On the other hand, Piezo2 m-RNA was hardly expressed in the bladder epithelium.

(2) Fluorescent immunostaining Fluorescent immunostaining was performed on mouse bladder tissue. The experimental conditions are as follows.
(i) Fixation: 100% methanol, -20 ° C, 20 minutes.
(ii) TritonX, 0.2% / blockace, 10 minutes at room temperature.
(iii) Primary anti-Piezo1 antibody (rabbit) 1: 400, 24 hours.
(iv) Secondary Alexa 488 antibody (donkey anti-rabbit IgG) 1: 500, 60 minutes at room temperature.

  As a result, the bladder epithelium was particularly strongly stained (the peripheral edge of the bladder tissue in FIG. 2). This indicates that Piezo1 protein is particularly highly expressed in mouse bladder epithelium. In addition, fluorescent immunostaining was also performed on mouse bladder epithelial cultured cells. As a result, expression of Piezo1 protein in cultured mouse bladder epithelial cells was confirmed (not shown).

  In addition, fluorescent immunostaining was performed on human bladder tissue. The experimental conditions are the same as above. As a result, the bladder epithelium (the periphery of the edge of the bladder tissue in FIG. 3) was particularly strongly stained. This indicates that Piezo1 protein is particularly highly expressed in human bladder epithelium. CK7 is a protein known to be specifically expressed in epithelial cells (anti-CK7 antibody was used for immunostaining).

(3) Comparison of expression levels of Piezo1, TRPV4 and Vnut Bladder mucosa was collected from 31 patients who underwent surgery for either prostatic hypertrophy or prostate cancer. Using these samples, mRNA expression levels of Piezo1, TRPV4, and Vnut in human bladder epithelium were measured by quantitative RT-PCR (upper figure 4). Similarly, mRNA was also measured in mouse bladder epithelial cultured cells (bottom of FIG. 4). TRPV4 is a protein known to be involved in Ca ion transport, and Vnut is a protein known to be involved in ATP transport. As a result, it was found that Piezo1 had a significantly higher expression level than TRPV4 and Vnut.

(4) Comparison between patients with lower urinary tract obstruction and non-obstruction patients Bladder mucosa was collected at the time of surgery from 29 patients who underwent surgery for either benign prostatic hyperplasia or prostate cancer. Using these samples, the mRNA expression level of Piezo1 in human bladder epithelium was measured by quantitative RT-PCR. As a result, there was no significant difference in the expression level of Piezo1 between patients with lower urinary tract obstruction (prostatic hypertrophy / prostate cancer patient) (obstructed) and non-obstructed patients (others) (FIG. 5). This suggests that a therapeutic drug targeting Piezo1 exerts a pharmacological action regardless of the presence or absence of lower urinary tract obstruction.

(5) Correlation between expression level and age
Bladder mucosa was collected at the time of surgery from 34 patients aged 58 to 82 who underwent surgery for benign prostatic hyperplasia and prostate cancer. Using these samples, the mRNA expression level of Piezo1 in human bladder epithelium was measured by quantitative RT-PCR. As a result, there was no significant difference in the expression level of Piezo1 (FIG. 6). This suggests that therapeutic agents targeting Piezo1 exert pharmacological effects regardless of age.

<Example 2> Functional evaluation of Piezo in bladder epithelium
(1) Preparation of Piezo1 KD cells
Piezo1 siRNA was introduced into bladder epithelial cells by the lipofection method to produce Piezo1 knockdown (KD) cells. Next, the expression level of Piezo1 m-RNA was measured by quantitative RT-PCR. In addition, the expression level of Piezo1 protein was measured by Western blotting (WB). The following experimental materials were used. The base sequence of the sense strand of the following Piezo1 siRNA is 5 ′ UCGGCGCUUGCUAGAACUUCATT 3 ′ (SEQ ID NO: 10). The base sequence of the antisense strand is 5 ′ UGAAGUUCUAGCAAGCGCCGATT 3 ′ (SEQ ID NO: 11). TT at the 3 ′ end of the sense strand is a protruding end, and the sequence excluding this TT is 5 ′ UCGGCGCUUGCUAGAACUUCA 3 ′ (SEQ ID NO: 2). TT at the 3 ′ end of the antisense strand is a protruding end, and the sequence excluding this TT is 5 ′ UGAAGUUCUAGCAAGCGCCGA 3 ′ (SEQ ID NO: 12).
(i) C57BL / 6 male mouse
(ii) Control siRNA
(iii) Piezo1 siRNA (stock at 2.0 μM)
(iv) Lipofectamine RNAi max
(v) OPTI-MEM
(vi) CnT-16 (however, penicillin / streptomycin uses 1/4 of the normal usage. Amphotericin uses 1/4 of the normal usage)

The experimental conditions for KD are as follows. KD was performed in a stretch chamber. This stretch chamber used a medium containing 250 μl.
(i) Preparation of culture by coating fibronectin.
(ii) Seeding 30 μl of bladder epithelium 2.0-5.0 × 10 ⁵ cells / ml collected from mice.
(iii) After incubating for 3 hours, 180 μl of CnT-16 warmed to 37 ° C. is gently added to the chamber, and then 40 μl of transfection complex is added (the total amount in the chamber is 250 μl).
(iv) Change medium as usual 48 hours after transfection.
(v) mRNA measurement 24 hours after medium change (72 hours after transfection).
(vi) The extension experiment described below was performed 84 hours after transfection.

The above transfection complex was adjusted by the following procedure (for one stretch chamber).
(i) Piezo1 siRNA (1.25 µl) + Lipofectamine RNAimax (0.4 µl) is added to OPTI-MEM (40 µl) and vortexed for 3 seconds.
(ii) Wait 20 minutes at room temperature until Complex is made. The final concentration will be about 10 nM.

  The above results are shown in FIGS. Quantitative RT-PCR showed a marked decrease in Piezo1 m-RNA expression in KD cells. In WB, a significant decrease in Piezo1 protein expression was also observed.

(2) Evaluation of Ca ²⁺ inflow into cells at the time of stretching stimulation Bladder epithelial culture cells (control cells or Piezo1 KD cells) were seeded in a stretch chamber. After culturing for 72 to 84 hours, Fura2 (10 μM) was loaded for 60 minutes, then the stretch chamber was extended, and the intracellular Ca concentration at the time of extension stimulation was measured by the Ca imaging method. The extension stimulation conditions during extension stimulation were an extension distance of 200 μm and an extension speed of 100 μm / sec. Finally, ionomycin (final concentration 5 μM) was added to confirm the cell reaction, and the value at this time was corrected. In addition, Ca imaging followed the method as described in "Mochizuki et al., J Biol Chem. 2009 Aug 7; 284 (32): 21257-64. Epub 2009 Jun 15.".

The above results are shown in FIGS. As a result, the amount of Ca ²⁺ influx was significantly reduced in Piezo1 KD cells compared to control cells. This indicates that Piezo1 is involved in Ca ²⁺ influx in the bladder epithelium.

(3) Evaluation of extracellular ATP release amount upon extension stimulation Bladder epithelial cultured cells (control cells or Piezo1 KD cells) were seeded on a stretch chamber. The stretch chamber was extended after 72-84 hours of culture, and the amount of extracellular ATP released from the bladder epithelial cultured cells was measured. The extension stimulation conditions during extension stimulation were an extension distance of 200 μm and an extension speed of 100 μm / sec. For ATP measurement, ATP Bioluminescene Assay Kit CLS II was used and photographed with Aqua cosmos. The captured ATO Photon images were analyzed using image analysis software photoshop and Image J.

  The above results are shown in FIGS. As a result, the amount of ATP released was significantly reduced in Piezo1 KD cells compared to control cells. This indicates that Piezo1 is involved in ATP release in the bladder epithelium.

<Example 3> Effect of GsMTx-4 on bladder epithelial cells
(1) Evaluation of Ca ²⁺ influx into cells at the time of extension stimulation Cultured bladder epithelial cells were seeded on a stretch chamber. After culturing for 72 to 84 hours, the medium was replaced with an extracellular solution in which GsMTx-4 (PEPTIDE INSTITUTE, INC.) Having the concentration shown in FIG. 14 was dissolved. After treatment with GsMTx-4 for 10 minutes, changes in intracellular Ca ²⁺ concentration were measured. GsMTx-4 is a polypeptide that has been reported to inhibit the function of Piezo1 (see Bae et al., Biochemistry. 2011 Jul 26; 50 (29): 6295-300. Epub 2011 Jun 29.). Thereafter, in the same procedure as in Example 2 (2), the amount of Ca 2+ inflow into the cells upon extension stimulation was measured. Further, as a control, the same treatment was performed without GsMTx-4 treatment. The amino acid sequence of GsMTx-4 is GCLEFWWKCNPNDDKCCRPKLKCSKLFKLCNFSF (SEQ ID NO: 1).

The above results are shown in FIG. As a result, Ca ²⁺ influx was significantly decreased in the GsMTx-4 treated cells compared to the untreated cells. This is considered to be because the function of Piezo1 was inhibited by GsMTx-4.

(2) Evaluation of reversibility of GsMTx-4 As shown in FIGS. 15A and 15B, the bladder epithelial cells were treated with GsMTx-4, washed and removed to measure the reversibility of GsMTx4. As a result, it was found that the effect of GsMTx-4 disappeared by washing and removing, and the effect of GsMTx-4 was excellent in reversibility.

(3) Evaluation of the amount of ATP released to the outside during extension stimulation The cultured bladder epithelial cells were seeded on a stretch chamber. The cells were treated with 10 μM GsMTx-4. Thereafter, the amount of ATP released outside the cells at the time of extension stimulation was measured in the same procedure as in Example 2 (3). Further, as a control, the same treatment was performed without GsMTx-4 treatment.

  The above results are shown in FIG. As a result, the amount of ATP released was significantly decreased in the GsMTx-4 treated cells compared to the untreated cells. This is considered to be because the function of Piezo1 was inhibited by GsMTx-4.

(4) Evaluation of whether GsMTx-4 inhibits TRPV4
TRPV4 (Transient receptor potential cation channel subfamily V member 4) is a protein known to be involved in Ca ion transport. TRPV4 causes Ca ions to flow into cells by stimulation with GSK 1016790A, which is an agonist of TRPV4. It was investigated whether GsMTx-4 inhibits the inflow of Ca ions (FIG. 17). As a result, GsMTx-4 showed no inhibitory effect. This suggests that GsMTx-4 does not act on TRPV4.

<Example 4> GsMTx-4 administration experiment GsMTx-4 was administered to mice (8-12 weeks old, male) under the experimental conditions shown below and in Fig. 18. At this time, urination parameters were measured before the administration, immediately after the administration, and in the active period (dark period) on the first day of administration.
(i) Mouse urinary metabolism cage (measuring system for urinary function for small animals, distributor: Shin Factory Co., Ltd.)
(ii) Setting that automatically switches between dark and light periods every 12 hours.
(iii) The measurement chamber is soundproof and windless and constant at room temperature of 25 ° C and humidity of around 40%.
(iv) Meals and drinking water can be taken freely.
(v) After a 48-hour acclimatization period, measure water consumption and urination continuously.
(vi) Collect urination data the day before GsMTx-4 administration.
(vii) GsMTx-4 was intraperitoneally administered 22 hours after the measurement (physiological saline was intraperitoneally administered to the control group).
(viii) Collect urination data 1 day after GsMTx-4 administration.
(ix) Comparison of 12-hour urination records during the active period (dark period)

  The above results are shown in FIGS. 18 to 21 (FIGS. 18 and 19 use different mice). GsMTx-4 administration decreased the number of urinations and increased the amount of urination once (μl). Before and after GsMTx4 administration, there was no change in total urine output or water consumption. This means that GsMTx-4 is useful as a therapeutic agent for dysuria. In addition, one day after administration, the effect of GsMTx4 disappeared, and the urination parameter returned to the same level as before administration. This means that GsMTx-4 has an effect in the short term, so that the therapeutic effect can be easily adjusted. Moreover, even if some side effects are accompanied after administration, it means that the side effects can be prevented from occurring for a long time.

  In the above, this invention was demonstrated based on the Example. It is to be understood by those skilled in the art that this embodiment is merely an example, and that various modifications are possible and that such modifications are within the scope of the present invention.

Claims (7)

  Drugs for dysuria, including substances that suppress the function of Piezo1.   2. The therapeutic agent for dysuria according to claim 1, wherein the Piezo1 is Piezo1 expressed in a bladder epithelium.   3. The therapeutic agent for dysuria according to claim 1 or 2, wherein the function-suppressing substance is a substance that inhibits Ca ions from flowing into cells in the bladder epithelium.   4. The therapeutic agent for dysuria according to claim 3, wherein the function-suppressing substance is a substance that does not substantially inhibit the function of TRPV4 in the bladder epithelium. The function inhibitor is
(A) the amino acid sequence represented by SEQ ID NO: 1,
(B) an amino acid sequence in which one or more amino acids have been deleted, substituted, inserted or added to the amino acid sequence represented by SEQ ID NO: 1,
(C) an amino acid sequence having 90% or more homology to the amino acid sequence represented by SEQ ID NO: 1,
(D) an amino acid sequence encoded by a nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid comprising a base sequence complementary to the base sequence encoding the amino acid sequence represented by SEQ ID NO: 1,
(E) an amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7,
The therapeutic agent for dysuria according to any one of claims 1 to 4, which is a polypeptide comprising one or more amino acid sequences selected from the group consisting of:   The therapeutic agent for dysuria according to any one of claims 1 to 5, wherein the function inhibitor is GsMTx-4. (F) the amino acid sequence represented by SEQ ID NO: 1,
(G) an amino acid sequence in which one or more amino acids are deleted, substituted, inserted, or added to the amino acid sequence represented by SEQ ID NO: 1,
(H) an amino acid sequence having 90% or more homology to the amino acid sequence represented by SEQ ID NO: 1,
(I) an amino acid sequence encoded by a nucleic acid that specifically hybridizes under stringent conditions to a nucleic acid comprising a base sequence complementary to the base sequence encoding the amino acid sequence represented by SEQ ID NO: 1;
(J) an amino acid sequence represented by SEQ ID NO: 3, 4, 5, 6, or 7,
A urination disorder therapeutic agent comprising a polypeptide comprising one or more amino acid sequences selected from the group consisting of: