JP2014064472A - Method for producing glutathione - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing glutathione utilizing yeast genetically modified to improve the production of the glutathione.SOLUTION: In the method, expression of γ-glutamylcysteine synthetase and/or glutathione synthetase is intensified, and further, yeast in which expression of glutathione reductase is suppressed is cultivated.

Description

The present invention relates to a high production strain of glutathione used for pharmaceutical applications and the like, and a production method using the production strain.

Glutathione is a peptide composed of three amino acids, cysteine, glutamic acid, and glycine. It exists not only in the human body, but also in many living organisms such as other animals, plants, and microorganisms. It is an important compound for the living body such as metabolism. Therefore, it is attracting attention in the pharmaceutical, food and cosmetic industries. In recent years, it has been expected that the oxidized glutathione has an effect of promoting the growth of plants and is used in various fields including agriculture.

Glutathione is now industrially produced by fermentation using yeast. Since glutathione is accumulated in yeast cells, in practice, a method of culturing yeast and extracting glutathione from the cells is widely used. Therefore, so far, mutation treatment to yeast used for glutathione production (Patent Documents 1 to 3) and introduction of an enzyme involved in the synthesis of glutathione by genetic recombination (Patent Documents 4 to 8), Attempts to improve glutathione content in cultured cells and improve productivity by adding L-glutamic acid, L-cysteine and glycine, which are three types of amino acids constituting glutathione, to the medium (Patent Documents 9 to 12) Has been made.

However, the production of glutathione, which is industrially cheaper, requires the acquisition of yeast that produces glutatin more efficiently.

JP 59-151894 A Japanese Patent Laid-Open No. 03-18872 JP-A-10-191963 JP-A 61-52299 Japanese Patent Laid-Open No. Sho 62-275585 JP 63-129985 A JP-A 64-51098 JP-A-4-179484 JP 47-16990 A JP-A-48-92579 JP-A 51-139686 JP-A-53-94089

An object of the present invention is to provide a yeast in which a gene is modified so as to improve the production of glutathione under the above technical background, and a method for producing glutathione using the yeast.

As a result of intensive studies by the present inventors to solve the above-mentioned problems, it has been found that the content of glutathione including oxidized glutathione in the cells increases by enhancing the expression of glutathione peroxidase in yeast. In addition, in the strain in which the expression of glutathione peroxidase was enhanced, the expression of γ-glutamylcysteine synthetase (GSH1) and / or glutathione synthetase (GSH2) involved in the production of glutathione was enhanced. A synergistic increase in production was confirmed, and the glutathione content (oxidized glutathione + reduced glutathione) in the microbial cells was found to greatly increase, and the present invention was completed.

Furthermore, it was confirmed that the production of glutathione can be improved by suppressing the expression of glutathione reductase in the strain with enhanced expression of glutathione peroxidase.

That is, the present invention relates to a method for producing glutathione, which comprises culturing yeast in which expression of glutathione peroxidase is enhanced.

Glutathione peroxidase is the following (a) to (f):
(A) a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(C) a protein comprising an amino acid sequence having 60% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(D) a protein comprising an amino acid sequence encoded by the base sequence shown in any of SEQ ID NOs: 4 to 6 in the sequence listing;
(E) a protein consisting of an amino acid sequence encoded by DNA having a base sequence complementary to the base sequence shown in any one of SEQ ID NOS: 4 to 6 in the sequence listing, and DNA that hybridizes under stringent conditions; and ,
(F) a protein comprising an amino acid sequence encoded by a DNA in which one or more bases are substituted, missing, inserted and / or added in the base sequence shown in any one of SEQ ID NOs: 4 to 6 in the sequence listing;
Preferably it is selected from the group consisting of

The yeast is preferably a yeast in which expression of γ-glutamylcysteine synthetase and / or glutathione synthetase is enhanced.

The γ-glutamylcysteine synthetase is preferably an enzyme encoded by GSH1.

The glutathione synthetase is preferably an enzyme encoded by GSH2.

The yeast is preferably a yeast in which the expression of glutathione reductase is suppressed.

It is preferred that the glutathione reductase is an enzyme encoded by GLR1.

The yeast is preferably a yeast of the genus Saccharomyces, Candida or Pichia.

The present invention also relates to a yeast in which expression of glutathione peroxidase and γ-glutamylcysteine synthetase and / or glutathione synthetase is enhanced.

It is preferable that the expression of glutathione reductase is suppressed.

According to the method of the present invention, glutathione production efficiency can be improved, and the ratio of oxidized glutathione in the total glutathione produced can be increased.

Hereinafter, the present invention will be described in detail.
The present invention is a method for producing glutathione by a mutant microorganism in which the expression of a specific protein of a microorganism having the ability to produce glutathione is enhanced or suppressed. In the present invention, the protein whose expression is enhanced for high production of glutathione is glutathione peroxidase. Furthermore, the expression of γ-glutamylcysteine synthetase (GSH1) and / or glutathione synthetase (GSH2) is preferably enhanced. Moreover, it is preferable that the expression of glutathione reductase is suppressed for high production of glutathione.

Methods for overexpressing a protein-encoding gene are well known to those skilled in the art. For example, a method of strongly expressing an expression vector obtained by cloning a DNA comprising a base sequence encoding the protein into a vector DNA, or a yeast genome Incorporating the gene into the gene to increase the copy number, placing it under the control of a stronger promoter than that of the gene, or introducing a mutation into the promoter controlling the expression of the gene be able to.

It is also possible to obtain yeast overexpressing the gene encoding the protein by mutagenesis treatment usually used for mutation operations such as ethylmethane sulfonic acid, nitrosoguanidine, UV irradiation, radiation irradiation and the like.

In this specification, the expression of the protein being suppressed means that the gene encoding the protein is deleted from the genome, the expression of the gene encoding the protein is inhibited, and the activity of the protein is reduced. Including meaning.

More specifically, a method for deleting a gene encoding a specific protein is not particularly limited, but a method of substituting a target gene with another gene by homologous recombination (for example, see JP-A-2002-209574), transposon A method of destroying a target gene by using a method (see, for example, JP-A-2005-328769), a method of destroying a target gene using a selectable marker that cancels auxotrophy (for example, see Table 01/014522), etc. be able to. In addition, when a gene is deleted, the entire length of the gene may be deleted or a partial deletion may be performed. Further, the function may be lost by introducing a point mutation into the enzyme active domain or the regulatory domain.

In addition, the method for inhibiting the expression of a gene encoding a specific protein is not particularly limited, but a method for deleting a promoter that controls the expression of the gene, a promoter that controls the expression of the gene is expressed. A method of substituting an inducible promoter, a method of introducing a mutation into a promoter controlling the expression of the gene, a method of degrading the transcript of the gene using RNA interference, and using an antisense RNA The method of inhibiting the translation of the said gene can be mentioned.

Furthermore, as a method for reducing the activity of a specific protein, a function can be reduced or deleted by introducing a mutation into a gene encoding the protein. Moreover, the method of making the substance which has the function to couple | bond with the said protein specifically and suppress an activity act can be mentioned. Examples of the substance include antibodies and inhibitors that can inhibit the function of the protein.

Methods for introducing mutations into protein-encoding genes are well known to those skilled in the art, and include genetic manipulation techniques and ethyl methanesulfonic acid, nitrosoguanidine, or mutagenesis treatment commonly used for mutation operations such as UV irradiation and radiation irradiation. Can be done by.

Glutathione peroxidase enzyme is one of the enzymes involved in the removal of lipid peroxide in vivo. Lipid peroxides are generated in living tissues due to various causes. The increase in active enzyme generated by the decomposition of lipid peroxide is involved in so-called lifestyle-related diseases such as arteriosclerosis and diabetes, and diseases related to aging such as cataract. There are various enzyme systems in the living body that decompose and remove active enzymes, but glutathione peroxidase enzyme is one of them, and is an enzyme that catalyzes the reaction of Formula 1.

Glutathione peroxidase enzyme functions to reduce and remove lipid peroxides, which are the basis for the production of active oxygen. In this reaction, reduced glutathione is required as a hydrogen donor (Ryo Watanabe, Akira Hiratsuka: Protein Nucleic Acid Enzyme (Special issue)-Molecular mechanism of generation, elimination and action in active oxygen and living organisms, 33, pages 2949 to 2956 (1988)).

On the other hand, glutathione reductase is an enzyme that catalyzes the reaction of reducing oxidized glutathione of formula 2 using NADPH.

(1) Glutathione peroxidase The glutathione peroxidase according to the present invention uses reduced glutathione to reduce, for example, hydrogen peroxide or lipid hydroperoxide, thereby producing water or hydroxy lipid. Well, not particularly limited, for example, the following (a) to (f):
(A) a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(C) a protein comprising an amino acid sequence having 60% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(D) a protein comprising an amino acid sequence encoded by the base sequence shown in any of SEQ ID NOs: 4 to 6 in the sequence listing;
(E) a protein consisting of an amino acid sequence encoded by DNA having a base sequence complementary to the base sequence shown in any one of SEQ ID NOS: 4 to 6 in the sequence listing, and DNA that hybridizes under stringent conditions; and ,
(F) a protein comprising an amino acid sequence encoded by a DNA in which one or more bases are substituted, missing, inserted and / or added in the base sequence shown in any one of SEQ ID NOs: 4 to 6 in the sequence listing;
It is preferable that it is either.

In the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the Sequence Listing, a protein comprising an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added is “Current Protocols in Molecular Biology ( John Wiley and Sons, Inc., 1989) "and the like, and is included in the protein as long as it has glutathione peroxidase activity.

The amino acid sequence modified by substitution, insertion, deletion and / or addition may include only one type of modification (for example, substitution), or two or more modifications (for example, substitution and substitution). Insertion). In the case of substitution, the amino acid to be substituted is preferably an amino acid having a property similar to that of the amino acid before substitution (cognate amino acid). Here, amino acids in the same group of the following groups are regarded as homologous amino acids.
(Group 1: neutral nonpolar amino acids) Gly, Ala, Val, Leu, Ile, Met, Cys, Pro, Phe
(Group 2: neutral polar amino acids) Ser, Thr, Gln, Asn, Trp, Tyr
(Group 3: acidic amino acids) Glu, Asp
(Group 4: basic amino acids) His, Lys, Arg.

The plurality of amino acids is, for example, 60, preferably 20, more preferably 15, more preferably 10, still more preferably 5, 4, 3 and particularly preferably 2 or less. Of amino acids.

The sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing is preferably 60% or more, more preferably 70% or more, still more preferably 80% or more, and even more preferably 85% or more. Preferably, 90% or more is particularly preferable, and 95% or more is most preferable.

The sequence identity of amino acid sequences is determined by comparing the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing with the amino acid sequence to be evaluated, and comparing the number of positions where the amino acid matches in both sequences. It is expressed by a value obtained by dividing by 100 and multiplying by 100.

As long as it has glutathione peroxidase activity, an additional amino acid sequence can be bound to the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3. Moreover, it can also be set as a fusion protein with another protein. Moreover, as long as it has the peroxidase activity of glutathione, it may be a peptide fragment.

A DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in any of Sequence Listings 4 to 6 is the base sequence shown in any of SEQ ID NOs: 4 to 6 in the Sequence Listing DNA obtained by using a colony hybridization method, a plaque hybridization method, a Southern hybridization method, or the like under stringent conditions using a DNA consisting of a base sequence complementary to DNA as a probe.

Hybridization can be performed according to the method described in “Molecular Cloning, A laboratory manual, second edition (Cold Spring Harbor Laboratory Press, 1989)”. Here, DNA that hybridizes under stringent conditions is, for example, hybridization at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which colony or plaque-derived DNA is immobilized. After that, DNA that can be obtained by washing the filter under a condition of 65 ° C. using a 2 × concentration SSC solution (the composition of the 1 × concentration SSC solution consists of 150 mM sodium chloride and 15 mM sodium citrate) Can be mentioned. It is preferably washed at 65 ° C. with a 1-fold concentrated SSC solution, more preferably washed at 65 ° C. with a 0.5-fold concentrated SSC solution, more preferably washed at 65 ° C. with a 0.2-fold concentrated SSC solution, most preferably Is DNA that can be obtained by washing with an SSC solution of 0.1-fold concentration at 65 ° C.

Although the hybridization conditions have been described as described above, the hybridization conditions are not particularly limited to these conditions. A plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization, and those skilled in the art can realize optimum stringency by appropriately selecting these factors.

The DNA hybridizable under the above conditions has a sequence identity of 70% or more, preferably 74% or more, more preferably 79% or more, even more preferably, with the DNA shown in any of SEQ ID NOs: 4-6. May be 85% or more, even more preferably 90% or more, and most preferably 95% or more.

DNA sequence identity (%) is the optimal alignment of the two DNAs to be compared, where the nucleobase (eg, A, T, C, G, U, or I) is the position where both sequences match. The number is divided by the total number of comparison bases, and the result is expressed as a value obtained by multiplying by 100.

The sequence identity of DNA can be calculated using, for example, the following sequence analysis tool: GCG Wisconsin Package (Program Manual for The Wisconsin Package, Version 8, September 1994, Genetics Computer Group, 75, Genetics Computer Group. USA, 37711; Rice, P. (1996) Program Manual for EGCG Package, Peter Rice, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, England). e. xPASy World Wide Web Molecular Biology Server (Geneva University Hospital and University of Geneva, Geneva, Switzerland).

Here, DNA in which one or more bases are substituted, missing, inserted and / or added in the base sequence shown in any one of SEQ ID NOs: 4 to 6 in the Sequence Listing means “Current Protocols in Molecular Biology (John). Wiley and Sons, Inc., 1989) "and the like.

The base sequence modified by substitution, insertion, deletion and / or addition may contain only one type (for example, substitution) of modification, or two or more types of modification (for example, substitution and substitution). Insertion).

The plurality of bases described above is, for example, 150, preferably 100, more preferably 50, still more preferably 20, still more preferably 10, 5, 4, 3, or 2. The following bases are meant.

As the glutathione peroxidase in the present invention, among the above proteins, glutathione peroxidase 1 (GPX1) represented by SEQ ID NO: 1, glutathione peroxidase 2 (GPX2) represented by SEQ ID NO: 2, or glutathione peroxidase 3 represented by SEQ ID NO: 3 ( GPX3) is preferred. These enzymes are described in non-patent literature (J. Biochem. Vol. 274, pp. 27002-27009).

(2) γ-glutamylcysteine synthetase As γ-glutamylcysteine synthetase in the present invention,
[A] a protein having the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing;
[B] a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 7 in the sequence listing and having γ-glutamylcysteine synthase activity; and [c] the sequence listing A protein having 80% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having γ-glutamylcysteine synthase activity can be mentioned.

In the above, a protein having an amino acid sequence in which one or more amino acid residues are deleted, substituted or added and having γ-glutamylcysteine synthase activity is obtained by the same method as in (1) above, and the same number And a protein having an amino acid sequence in which the amino acid residues are deleted, substituted or added. The position, type, and the like of amino acid residues that are allowed to be deleted, substituted or added are the same as in (1) above.

Moreover, as γ-glutamylcysteine synthetase, the sequence identity with the amino acid sequence represented by SEQ ID NO: 7 is 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, Particularly preferred is a protein having an amino acid sequence of 98% or more, most preferably 99% or more and having γ-glutamylcysteine synthase activity. The sequence identity of amino acid sequences and base sequences is as defined in (1) above.

As a means for confirming that the protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 7 is a protein having γ-glutamylcysteine synthase activity, for example A transformant expressing a protein whose activity is to be confirmed using a DNA recombination method is prepared, and the protein, L-glutamic acid and L-cysteine are mixed with an aqueous medium after the protein is produced using the transformant. And a method of analyzing by HPLC or the like whether or not γ-glutamylcysteine is produced and accumulates in the aqueous medium.

As the γ-glutamylcysteine synthetase in the present invention, GSH1 represented by SEQ ID NO: 7 is preferable among the above proteins.

(3) Glutathione synthase As the glutathione synthase in the present invention,
[A] a protein having the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing;
[B] a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 8 in the sequence listing and having glutathione synthase activity; and [c] SEQ ID NO: 8 in the sequence listing And a protein having a glutathione synthase activity having 80% or more sequence identity with the amino acid sequence shown in FIG.

In the above, a protein having an amino acid sequence in which one or more amino acid residues are deleted, substituted or added and having glutathione synthase activity is obtained by the same method as in (1) above, and a similar number of amino acid residues are obtained. Mention may be made of proteins having an amino acid sequence in which a group is deleted, substituted or added. The position, type, and the like of amino acid residues that are allowed to be deleted, substituted or added are the same as in (1) above.

Further, as glutathione synthetase, the sequence identity with the amino acid sequence represented by SEQ ID NO: 8 is 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly preferably. A protein having an amino acid sequence of 98% or more, most preferably 99% or more, and having glutathione synthase activity can be mentioned. The sequence identity of amino acid sequences and base sequences is as defined in (1) above.

As a means for confirming that the protein comprising the amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 8 is a protein having glutathione synthase activity, for example, DNA recombination After preparing a transformant that expresses the protein whose activity is to be confirmed using the method, and producing the protein using the transformant, the protein, and γ-glutamylcysteine and glycine are present in an aqueous medium. And a method for analyzing whether or not glutathione is produced and accumulated in the aqueous medium by HPLC or the like.

As the glutathione synthetase in the present invention, GSH2 represented by SEQ ID NO: 8 is preferable.

(4) Glutathione reductase As the glutathione reductase in the present invention,
[A] a protein having the amino acid sequence shown in SEQ ID NO: 9 in the sequence listing;
[B] A protein having a glutathione reductase activity consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 9 in the Sequence Listing, and [c] SEQ ID NO: 9 in the Sequence Listing Mention may be made of proteins having 80% or more sequence identity with the amino acid sequence shown and having glutathione reductase activity.

In the above, a protein having an amino acid sequence in which one or more amino acid residues are deleted, substituted or added and having glutathione reductase activity is obtained by the same method as in (1) above, and a similar number of amino acid residues are obtained. Mention may be made of proteins having an amino acid sequence in which a group is deleted, substituted or added. The position, type, and the like of amino acid residues that are allowed to be deleted, substituted or added are the same as in (1) above.

The protein involved in glutathione reductase has a sequence identity with the amino acid sequence represented by SEQ ID NO: 9 of 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly A protein having an amino acid sequence of preferably 98% or more, most preferably 99% or more, and a protein having glutathione reductase activity can be mentioned. The sequence identity of amino acid sequences and base sequences is as defined in (1) above.

As a means for confirming that the protein comprising the amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 9 is a protein having glutathione reductase activity, for example, DNA recombination A transformant expressing a protein whose activity is to be confirmed using a method is prepared, and after producing the protein using the transformant, the protein, oxidized glutathione and NADPH are present in an aqueous medium, A method for analyzing by HPLC or the like whether reduced glutathione or NADP is produced and accumulated in the aqueous medium can be mentioned.

As the glutathione reductase in the present invention, among the above proteins, GLR1 represented by SEQ ID NO: 9 is preferable.

(5) Glutathione-producing yeast The yeast of the present invention is not particularly limited as long as it has the ability to produce glutathione. For example, Saccharomyces cerevisiae, Saccharomyces carlesbergens (Saccharomyces carlesbergens) , Saccharomyces fragilis, Saccharomyces rouxii, etc., Candida utilis, Candida tropicaris, Candida tropicari Maoses Pombe (Schizosaccaro) yces pombe) such as Schizosaccharomyces, Toluropsis versatilis, Toluropsis petrophyllum, etc. (Rhodotorula) genus, Hansenula (Hansenula) genus, Endomyces (Endomyces) genus yeast, etc. are mentioned.

Among them, yeasts of the genus Saccharomyces, Candida or Pichia are preferable, and Saccharomyces cerevisiae of the genus Saccharomyces and Candida utilis of the genus Candida are more preferable.

(6) Method for producing glutathione In the method for producing glutathione of the present invention, yeast may be cultured in the same manner as normal microorganism culture. That is, any of a synthetic medium, a semi-synthetic medium, and a natural (complex) medium can be used as long as it contains a carbon source, a nitrogen source, an inorganic substance, and other nutrients.

As the carbon source, various carbohydrate raw materials such as glucose, glycerol, fructose, sucrose, maltose, mannose, mannitol, xylose, galactose, starch, starch hydrolyzate, and molasses can be used. In addition, various organic acids such as pyruvic acid, acetic acid and lactic acid, and various amino acids such as aspartic acid and alanine can be used.

Nitrogen sources include various inorganic and organic ammonium salts such as ammonia or ammonium chloride, ammonium phosphate, ammonium sulfate, ammonium nitrate, ammonium carbonate, ammonium acetate, or other nitrogen-containing compounds such as urea, peptone, NZ amine, meat extract, yeast extract Corn steep liquor, casein hydrolyzate, fishmeal or digest thereof, nitrogenous organic substances such as defatted soybean or digested product or hydrolyzate thereof, and various amino acids such as aspartic acid, glutamic acid and threonine can be used.

Furthermore, as the inorganic substance, potassium hydrogen phosphate, potassium hydrogen phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, calcium carbonate and the like can be used.

Culturing is performed under aerobic culture conditions such as shaking culture and aeration / agitation deep culture. The culture pH is preferably controlled to 3.0 to 8.0, more preferably 4.0 to 6.0, and most preferably 5.0. Aqueous ammonia, sodium hydroxide, ammonium carbonate or the like can be used as a pH control neutralizing agent. The amount of air supplied to the medium during aerobic culture is preferably 0.2 L / min or more, more preferably 0.5 L / min or more, and further preferably 1 L / min or more with respect to 1 L of the medium. In addition, when culturing using a jar fermenter with a total volume of 2 L, as the aerobic culture conditions, in addition to the aeration amount, the number of stirring is preferably 200 rpm or more, more preferably 300 rpm or more, and still more preferably 400 rpm or more. is there. Moreover, the temperature at the time of culture | cultivation is 20-45 degreeC, Preferably it is 25-35 degreeC, Most preferably, it is 28-32 degreeC. The initial cell concentration (preparation concentration) in the medium varies depending on the type of yeast, medium composition, etc., but the initial turbidity (OD600) is preferably 0.01 to 2.0, more preferably 0.02 to 1.0. More preferably, it is 0.1-0.4.

As the culturing method, any of a batch system in which the above-mentioned carbon source such as glucose is charged and cultured in the initial stage of culture and a semi-batch system in which it is added little by little throughout the culture period can be applied. According to the examination results, although depending on the microorganism to be used, the semi-batch method is preferable because the growth rate is improved, the final bacterial concentration is higher, and the activity of glutathione synthesis-related enzymes in the bacterial cells is also increased. As an index to determine the flow acceleration of carbon sources such as glucose in a semi-batch method, the turbidity of the culture solution, oxygen consumption rate, carbon dioxide generation rate, consumption of neutralizing agent for pH adjustment, etc. can be effectively used and used By selecting an appropriate index according to the yeast to be used and changing the flow acceleration of the carbon source in response to the change, the yeast culture can be optimized, and the final bacterial concentration and the activity of glutathione synthesis-related enzyme are improved. Glutathione productivity can be improved.

By the production method of the present invention, a culture solution containing a high concentration of glutathione in the microbial cells can be obtained. Bacterial cells can be separated from the culture solution by filtration or centrifugation, and glutathione is extracted from the bacterial cells by hot water extraction, alkali extraction method, enzymatic decomposition method, autolysis method, physical disruption method, etc. be able to. Further, by purifying glutathione, it is possible to obtain a fraction highly containing glutathione and glutathione powder. In addition, by performing the above extraction and disruption operations directly on the culture solution, glutathione in the bacterial cells is extracted into the medium and further purified to obtain a fraction containing glutathione highly, and glutathione powder. be able to.

[Production Example 1] Production of strain with enhanced expression of GPX1 (GPX1-enhanced strain) Genomic DNA of Saccharomyces cerevisiae YPH499 strain was used as a template, 5'-GGCCGTCGGACATGACACACTCTTTTTATGATTTAGATCTATGTATGTATGTATGT PCR amplification was performed using -3 ′ (SEQ ID NO: 11), and the amplified product was digested with SalI and BamHI to obtain a glutathione peroxidase 1 (GPX1) gene SalI-BamHI fragment. This fragment was ligated to the SalI-BamHI digestion site of pGK405 described in non-patent literature (J. Biochem. (2009) 145: 701-708) to obtain a GPX1 expression plasmid pGK405-GPX1. The resulting plasmid pGK405-GPX1 was digested with the restriction enzyme EcoRV. Saccharomyces cerevisiae YPH499 strain was used as a host yeast strain for transformation to obtain a transformant YPH499 / GPX1 strain.

[Production Example 2] Production of strain with enhanced expression of GPX3 (GPX3-enhanced strain) Genomic DNA of Saccharomyces cerevisiae YPH499 strain was used as a template, and 5'-GGCCGTCGATACATTCCAATTCATAGCTCGCCC-3 '(SEQ ID NO: 12) and 5'-TCGATCGCTCCGCC PCR amplification was performed using -3 ′ (SEQ ID NO: 13), and the amplified product was digested with SalI and BamHI to obtain a glutathione peroxidase 3 (GPX3) gene SalI-BamHI fragment. This fragment was ligated to the SalI-BamHI digestion site of pGK405 described in non-patent literature (J. Biochem. (2009) 145: 701-708) to obtain a GPX3 expression plasmid pGK405-GPX3. The resulting plasmid pGK405-GPX3 was digested with the restriction enzyme EcoRV. Saccharomyces cerevisiae YPH499 strain was used as a host yeast strain for transformation to obtain a transformant YPH499 / GPX3 strain.

[Production Example 3] Production of strains with enhanced expression of GSH1 and GSH2 (GSH1-enhanced + GSH2-enhanced strains) Non-patent literature (Hara KY, Kiriyama K, Inagaki A, Nakayama H, Kondo A. emotrope. Metaengineering the sulfate assimilation pathway of Saccharomyces cerevisiae.Appl Microbiol Biotechnol, 94 (5): 1313-9).

[Production Example 4] Production of a strain with enhanced expression of GSH1 and GSH2 and further enhanced expression of GPX1 (GSH1-enhanced + GSH2-enhanced + GPX1-enhanced strain) Plasmid pGK405-GPX1 described in Production Example 1 was digested with restriction enzyme EcoRV . The digested product was transformed using the Saccharomyces cerevisiae YPH499 / GSH1 and GSH2 strains described in Production Example 3 as host yeast strains to obtain transformants YPH499 / GSH1, GSH2 and GPX1 strains.

[Production Example 5] Production of a strain with enhanced expression of GSH1 and GSH2 and further enhanced expression of GPX3 (GSH1-enhanced + GSH2-enhanced + GPX3-enhanced strain) Plasmid pGK405-GPX3 described in Production Example 2 was digested with restriction enzyme EcoRV . The digested product was transformed using the Saccharomyces cerevisiae YPH499 / GSH1 and GSH2 strains described in Production Example 3 as host yeast strains to obtain transformants YPH499 / GSH1, GSH2 and GPX3 strains.

[Production Example 6] Production of GLR1 gene disrupted strain Among the genomic sequences of Saccharomyces cerevisiae YPH499 strain, a sequence homologous to the 50 base upstream region of the gene sequence encoding GLR1 and homologous to 25 bases from the start codon of the HIS3 gene DNA (DNA-FH) 5′-TTTCCTTCATATGTATAATATCTTTTATACATTAGTAGTTTACAGAACTTTTAATTCCCCGTTTTAAGAGCTTGGTGA-3 ′ (SEQ ID NO: 14) was synthesized. On the other hand, a DNA (DNA-RH) 5′-TACAAAAGTCCAGTATAGCAACAGCAGATTGGACGTTCTAGTTTCGTGTGAGATCCAGAGA-3) sequence homologous to 50 bases downstream of the GLR1 gene sequence and a sequence homologous to 25 bases from the stop codon of the HIS3 gene Was synthesized. Next, PCR amplification was performed using a plasmid containing the HIS3 gene as a template and DNA-FH and DNA-RH as primers, and the amplified DNA was introduced into the Saccharomyces cerevisiae YPH499 strain by the lithium acetate method. The target genetically modified strain in which the GLR1 gene and the HIS3 gene are recombined can be selected by forming colonies on a selective medium plate not containing histidine. As a result, a recombinant yeast YPH499 / ΔGLR1 strain was obtained.

[Production Example 7] Production of a strain in which expression of GSH1, GSH2 and GPX1 is enhanced and the GLR1 gene is disrupted (GSH1-enhanced + GSH2-enhanced + GPX1-enhanced + GLR1-disrupted strain) Digested. The digestion product was used to transform Saccharomyces cerevisiae YPH499 / ΔGLR1, GSH1, and GSH2 strains as host yeast strains to obtain transformants YPH499 / ΔGLR1, GSH1, GSH2, and GPX1 strains.

[Production Example 8] Production of a strain in which the expression of GSH1, GSH2 and GPX3 is enhanced and the GLR1 gene is disrupted (GSH1-enhanced + GSH2-enhanced + GPX3-enhanced + GLR1-disrupted strain) Digested. The digestion product was used to transform Saccharomyces cerevisiae YPH499 / ΔGLR1, GSH1, and GSH2 strains as host yeast strains to obtain transformants YPH499 / ΔGLR1, GSH1, GSH2, and GPX3 strains.

[Example 1] Production of glutathione by strains with enhanced expression of GPX1 and strains with enhanced expression of GPX3 Recombinant yeast YPH499 / with enhanced expression of GPX1 or GPX3 gene obtained in Production Examples 1 and 2 Seed mother by shaking GPX1 or YPH499 / GPX3 in SD medium (6.7 g / L Yeast nitrogen base w / o amino acids (Difco laboratories), 20 g / L glucose) at 30 ° C. for 16-24 hours Culture was performed.

Next, a baffle containing 20 ml of YPD medium (10 g / L yeast extract (Difco laboratories), 20 g / L polypeptone (Wako Pure Chemical Industries, Ltd.), 20 g / L glucose (Nacalai Tesque)) Inoculated to a conical flask with an OD600 of 0.03, and cultured for 24 hours under conditions of 30 ° C. and 150 rpm stirring, and 1 ml of the culture solution was collected.

The bacterial cells collected by centrifugation were washed twice with sterilized water and heat treated at 95 ° C. for 3 minutes to elute glutathione in the bacterial cells. Centrifugation was performed at 25 ° C. and 20000 × g for 5 minutes, and the glutathione concentration of the supernatant was analyzed by the HPLC method to determine the glutathione concentration per medium. The bacterial cell concentration was determined by measuring the absorbance at 600 nm. The dry cell weight was determined by measuring the weight after allowing the culture solution to stand at 80 ° C. for 12 hours or more, and subtracting the weight of the container weighed in advance. The glutathione weight per dry cell (glutathione content) was calculated by dividing the glutathione concentration by the cell concentration.

[Comparative Example 1] Culturing was carried out in the same manner as in Example 1 except that Saccharomyces cerevisiae YPH499 / HIS3 strain was used as the production yeast for glutathione by the parent strain (YPH499 strain), and the weight of glutathione per dry cell was calculated. did. The results are shown in Table 1.

As can be seen from Table 1, by enhancing the expression of the GPX1 or GPX3 gene, the oxidized glutathione content was increased and the total glutathione (reduced glutathione + oxidized glutathione) content was also improved.

[Example 2] Production of glutathione by a strain with enhanced expression of GSH1 and GSH2 and further enhanced expression of GPX1 The expression of GSH1 gene and GSH2 gene obtained in Production Example 4 was enhanced, and glutathione peroxidase activity was further enhanced. YPH499 / GSH1, GSH2, and GPX1 strains containing 0.5 μg / L aureobasidin A SD medium (6.7 g / L yeast nitrogen base w / o amino acids (manufactured by Difco Laboratories), 5 ml / glucose) Seed culture was performed by shaking at 30 ° C. for 16-24 hours.

Next, a baffle containing 20 ml of YPD medium (10 g / L yeast extract (Difco laboratories), 20 g / L polypeptone (Wako Pure Chemical Industries, Ltd.), 20 g / L glucose (Nacalai Tesque)) Inoculated into an attached Erlenmeyer flask so that OD600 = 0.03, cultured at 30 ° C. under stirring at 150 rpm for 24 hours, and the glutathione content in the cells was measured by the method described in Example 1. The results are shown in Table 2.

[Comparative Example 2] Recombinant yeast obtained in Production Example 3 with enhanced expression of GSH1 gene and GSH2 gene and improved glutathione synthesis activity as a yeast producing glutathione by a strain with enhanced expression of GSH1 and GSH2. Culturing was carried out in the same manner as in Example 2 except that YPH499 / GSH1 and GSH2 strains were used, and the glutathione content in the cells was measured. The results are shown in Table 2 together with the results of Comparative Example 1.

As can be seen from Table 2, the glutathione content per cell can be improved by enhancing the expression of the GSH1 gene and the GSH2 gene and improving the synthesis activity of glutathione, but by further enhancing the expression of the GPX1 gene, The content has improved dramatically.

[Example 3] Production of glutathione by a strain with enhanced expression of GSH1 and GSH2 and further enhanced expression of GPX3

YPH499 / GSH1, GSH2, and GPX3 strains having enhanced expression of the GSH1 gene and GSH2 gene obtained in Production Example 5 and further enhanced glutathione peroxidase activity were prepared in an SD medium containing 6.7 g / L aureobasidin A (6.7 g / Seed culture was performed by shaking at 5 ° C. for 16 to 24 hours in 5 ml of L yeast nitrogen base w / o amino acids (Difco laboratories, 20 g / L glucose).

Next, a baffle containing 20 ml of YPD medium (10 g / L yeast extract (Difco laboratories), 20 g / L polypeptone (Wako Pure Chemical Industries, Ltd.), 20 g / L glucose (Nacalai Tesque)) Inoculated into an attached Erlenmeyer flask so that OD600 = 0.03, cultured at 30 ° C. under stirring at 150 rpm for 24 hours, and the glutathione content in the cells was measured by the method described in Example 1. The results are shown in Table 3 together with the results of Comparative Examples 1 and 2.

As can be seen from Table 3, by enhancing the expression of GSH1 gene and GSH2 gene and improving the synthesis activity of glutathione, the total glutathione content in the medium is also improved, but by further enhancing the expression of GPX3 gene, glutathione The content has improved dramatically.

[Example 4] Production of glutathione by a strain in which the expression of GSH1, GSH2 and GPX1 was enhanced and the GLR1 gene was disrupted The GLR1 gene obtained in Production Example 7 was disrupted and the expression of the GSH1, GSH2 and GPX1 genes Strengthened YPH499 / ΔGLR1, GSH1, GSH2, and GPX1 strains containing 0.5 μg / L aureobasidin A SD medium (6.7 g / L yeast nitrogen base w / o amino acids (Difco Laboratories) / glucose 20) Seed culture was performed by shaking at 5 ° C. at 30 ° C. for 16-24 hours.

Next, a baffle containing 20 ml of YPD medium (10 g / L yeast extract (Difco laboratories), 20 g / L polypeptone (Wako Pure Chemical Industries, Ltd.), 20 g / L glucose (Nacalai Tesque)) Inoculated into an attached Erlenmeyer flask so that OD600 = 0.03, cultured at 30 ° C. under stirring at 150 rpm for 24 hours, and the glutathione content in the cells was measured by the method described in Example 1. The results are shown in Table 4 together with the results of Example 2.

As can be seen from Table 4, the glutathione content was further improved by disrupting the GLR1 gene.

[Example 5] Production of glutathione by a strain in which the expression of GSH1, GSH2, and GPX3 was enhanced and the GLR1 gene was disrupted. The GLR1 gene obtained in Production Example 8 was disrupted to enhance the expression of the GSH1, GSH2, and GPX3 genes YPH499 / ΔGLR1, GSH1, GSH2, and GPX3 strains containing 0.5 μg / L aureobasidin A SD medium (6.7 g / L yeast nitrogen base w / o amino acids (Difco Laboratories L The seed culture was performed by shaking at 30 ° C. for 16 to 24 hours.

Next, a baffle containing 20 ml of YPD medium (10 g / L yeast extract (Difco laboratories), 20 g / L polypeptone (Wako Pure Chemical Industries, Ltd.), 20 g / L glucose (Nacalai Tesque)) Inoculated into an attached Erlenmeyer flask so that OD600 = 0.03, cultured at 30 ° C. under stirring at 150 rpm for 24 hours, and the glutathione content in the cells was measured by the method described in Example 1. The results are shown in Table 5 together with the results of Example 3.

As can be seen from Table 5, the glutathione content was further improved by disrupting the GLR1 gene.

Claims (10)

A method for producing glutathione, comprising culturing yeast in which expression of glutathione peroxidase is enhanced. Glutathione peroxidase is the following (a) to (f):
(A) a protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(C) a protein comprising an amino acid sequence having 60% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 3 in the sequence listing;
(D) a protein comprising an amino acid sequence encoded by the base sequence shown in any of SEQ ID NOs: 4 to 6 in the sequence listing;
(E) a protein consisting of an amino acid sequence encoded by DNA having a base sequence complementary to the base sequence shown in any one of SEQ ID NOS: 4 to 6 in the sequence listing, and DNA that hybridizes under stringent conditions; and ,
(F) a protein comprising an amino acid sequence encoded by a DNA in which one or more bases are substituted, missing, inserted and / or added in the base sequence shown in any one of SEQ ID NOs: 4 to 6 in the sequence listing;
The manufacturing method of Claim 1 selected from the group consisting of. The production method according to claim 1 or 2, wherein the yeast is a yeast in which expression of γ-glutamylcysteine synthetase and / or glutathione synthetase is enhanced. The production method according to claim 3, wherein the γ-glutamylcysteine synthetase is an enzyme encoded by GSH1. The production method according to claim 3, wherein the glutathione synthetase is an enzyme encoded by GSH2. The production method according to claim 1, wherein the yeast is a yeast in which expression of glutathione reductase is suppressed. The production method according to claim 6, wherein the glutathione reductase is an enzyme encoded by GLR1. The manufacturing method in any one of Claims 1-7 whose yeast is yeast of Saccharomyces genus, Candida genus, or Pichia genus. Yeast with enhanced expression of glutathione peroxidase and γ-glutamylcysteine synthetase and / or glutathione synthetase. The yeast according to claim 9, wherein the expression of glutathione reductase is suppressed.