JP2014030392A - Method and kit for detecting target nucleic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method and kit for detecting a target nucleic acid which is capable of achieving highly accurate and sensitive detection.SOLUTION: A method for detecting a target nucleic acid comprises the steps of: amplifying; labeling; and detecting the target nucleic acid, where the amplifying, the labeling, and the detecting steps are performed in the same enclosed space. A kit for detecting a target nucleic acid comprises an amplifying agent for amplifying the target nucleic acid, a labeling agent for labeling the target nucleic acid, and a sealed container containing the amplifying agent and the labeling agent.

Description

  The present specification relates to a technique for detecting a target nucleic acid.

  Conventionally, methods for comprehensively detecting, identifying, and further quantifying nucleic acid sequences have been proposed as methods for gene analysis of individual organisms and for examining the presence of viruses, bacteria, and the like in biological samples. In such analysis, nucleic acid is extracted from a sample such as blood obtained from a living body, and a nucleic acid labeled with a target nucleic acid sequence is amplified by performing a PCR method or the like using the extracted nucleic acid. Usually, a nucleic acid amplification product is prepared, and a target nucleic acid is detected by using a test paper or a detection device.

  For example, a primer is designed to include a base sequence that allows a specific substance to bind to both ends of a DNA fragment amplified by the PCR method, and nucleic acid chromatography is performed using such a specific substance to detect the DNA fragment. A method is described (Patent Document 1).

International Publication No. WO2009 / 034842

  In order to detect the target nucleic acid with high accuracy and high sensitivity, it is preferable to perform detection in a state where no contaminants that contaminate the nucleic acid amplification product are mixed. In a conventional method for detecting a target nucleic acid, for example, between a step of extracting a nucleic acid and a step of amplifying a labeled nucleic acid, or a step of amplifying a labeled nucleic acid and a nucleic acid amplification product on a test paper or detection In general, the sample is transferred between the sample containers between the steps detected by the apparatus.

  In view of the above situation, the present specification provides a method for detecting a target nucleic acid capable of suppressing contamination with contaminants that contaminate nucleic acid amplification products and realizing highly accurate and sensitive detection.

The present specification discloses a method for detecting a target nucleic acid or a kit for detecting the target nucleic acid shown below.
(1) A method for detecting a target nucleic acid,
An amplification step of the target nucleic acid, a labeling step, a detection step,
Including
The method wherein the amplification step, the labeling step, and the detection step are performed in the same closed space.
(2) further comprising an extraction step of the target nucleic acid,
The method according to (1), wherein the extraction step, the amplification step, the labeling step, and the detection step are performed in the same closed space.
(3) a kit for detecting a target nucleic acid,
An amplifying agent for amplifying the target nucleic acid;
A labeling agent for labeling the target nucleic acid;
And a container that contains and seals the amplification agent and the labeling agent.
(4) It further comprises a partition partitioning the inside of the container,
In the sealed container, it is possible to shift from an initial state in which the amplification agent and the labeling agent are separated by the partition wall to a mixed state in which at least a part of the amplification agent and the labeling agent are mixed. The kit according to 3).
(5) The kit according to (4), wherein in the initial state, at least a part of the partition walls is opened and the mixed state can be transferred.
(6) The kit according to (5), wherein at least a part of the partition wall can be opened by pressure from the outside of the sealed container.
(7) The container is provided with a space communicating with both the side of the partition where the amplification agent is accommodated and the side where the labeling agent is accommodated.
The kit according to (4), wherein in the sealed container, at least a part of at least one of the amplification agent and the labeling agent can be transferred to the mixed state beyond the partition wall.
(8) The kit according to any one of (3) to (7), further comprising a detector capable of detecting the target nucleic acid in the container.
(9) The kit according to (8), wherein at least a part of the detector is immersed in at least one of the amplification agent and the labeling agent.
(10) a detector capable of detecting the target nucleic acid housed in the container;
Further comprising a partition partitioning the inside of the container,
In the sealed container, at least a part of the detector is immersed in the mixture from a first state where the mixture of the amplification agent and the labeling agent and the detector are isolated by the partition wall. The kit according to (3), which is capable of transitioning to two states.
(11) The kit according to (10), wherein in the first state, at least a part of the partition wall is opened and the state can be shifted to the second state.
(12) The kit according to (5), wherein at least a part of the partition wall can be opened by pressure from the outside of the sealed container.
(13) In the container, there is provided a space communicating with both the side of the partition where the amplification agent and the labeling agent are accommodated and the side of the detector.
In the sealed container, at least a part of the amplification agent and the labeling agent can immerse at least a part of the detector beyond the partition wall and shift to the second state. The described kit.
(14) The kit according to any one of (8) to (13), wherein the detector is a labeling agent including a luminescent substance or a chromogenic substance that presents luminescence or color development that can be detected visually.
(15) The kit according to any one of (14), wherein the detector is attached to an inner wall of the container.
(16) The kit according to (14), wherein the detector is integrated with an inner wall of the container.
(17) The kit according to (15) or (16), wherein the detector is a detection piece of a permeable material.
(18) It further comprises an extraction column for extracting the target nucleic acid in the container,
The extraction column partitions the inside of the container into an injection part for injecting a sample containing the target nucleic acid and a storage part in which the amplification agent and the labeling agent are stored. The kit according to any one.
(19) The kit according to (18), wherein the extraction column adsorbs a substance that inhibits amplification of the target nucleic acid.
(20) The extraction column is a membrane having at least one selected from the group consisting of zeolite, activated carbon, alumina, silica, acetylcellulose, and cellophane, and having an average pore diameter of 0.1 nm or more and 2 nm or less. A kit according to (18) or (19).
(21) In any one of (18) to (20), a tapered portion that is narrowed from the extraction column side toward the storage portion side is provided between the extraction column and the storage portion. The described kit.
(22) The kit according to (21), wherein at least a surface of the tapered portion is heat insulating.

It is a figure which shows typically an example of the kit which this specification discloses. It is a figure which shows typically an example of the kit which has a partition which this specification discloses, and an example of the detection method using the same. It is a figure which shows typically an example of the kit which has a mechanism which opens the partition which this specification discloses. It is a figure which shows typically an example of the kit which has a mechanism which opens the partition which this specification discloses. It is a figure which shows typically an example of the method of mixing the liquid of the both sides of a partition in the kit shown in FIG. It is a figure which shows typically an example of the method of mixing the liquid of the both sides of a partition in the kit shown in FIG. It is a figure which shows the kit which concerns on Example 4 typically. It is a figure which shows typically the column mounting tube of the kit which concerns on Example 4. FIG.

  The present invention relates to a method for detecting a target nucleic acid and the like. One of the methods for detecting a target nucleic acid disclosed in the present specification can include a target nucleic acid amplification step, a labeling step, and a detection step. The amplification step, the labeling step, and the detection step include: It is carried out in the same closed space. By performing each step in the detection of the target nucleic acid in the same flat space, it is possible to suppress contamination with contaminants that contaminate the nucleic acid amplification product, and to realize highly accurate and sensitive detection.

  One of the kits for detecting a target nucleic acid disclosed in the present specification is sealed by containing an amplification agent for amplifying the target nucleic acid, a labeling agent for labeling the target nucleic acid, and the amplification agent and the labeling agent. A container. Since the amplification agent and the labeling agent are contained in a container and sealed, the amplification process and the labeling process can be performed in this container, and contamination by contaminants that contaminate the nucleic acid amplification product is prevented. In addition, highly accurate and sensitive detection can be realized.

  Hereinafter, embodiments of the present invention will be described in detail.

  In the present specification, “nucleic acid” refers to all DNA and RNA including cDNA, genomic DNA, synthetic DNA, mRNA, total RNA, hnRNA and synthetic RNA, peptide nucleic acid, morpholino nucleic acid, methylphosphonate nucleic acid, and Includes artificially synthesized nucleic acids such as S-oligonucleic acid. Moreover, it may be single-stranded or double-stranded. In the present specification, the “target nucleic acid” is an arbitrary nucleic acid having an arbitrary sequence. Typically, it may have a base sequence that serves as a genetic indicator in humans or non-human animals, such as constitution, genetic disease, onset of specific diseases such as cancer, disease diagnosis, treatment prognosis, drug and treatment selection, etc. There may be mentioned nucleic acids with Examples of the index include polymorphisms such as SNP and congenital or acquired mutations. Further, nucleic acids derived from microorganisms such as pathogenic bacteria and viruses are also included in the target nucleic acid.

  As the target nucleic acid, a sample described later or a nucleic acid fraction thereof can be used as it is, but preferably, an amplification product obtained by amplifying a plurality of target nucleic acids by PCR amplification reaction, more preferably multiplex PCR amplification reaction is used. It is preferable to use it.

  As used herein, “sample” refers to a sample that may contain a target nucleic acid. Samples include cells, tissues, blood, urine, saliva and the like, and any sample containing nucleic acid can be used. Fractions containing nucleic acids from these various samples can be obtained by those skilled in the art with reference to conventional techniques as appropriate.

  As used herein, “target sequence” refers to a sequence consisting of one or more bases characteristic of a target nucleic acid to be detected. For example, it may be a partial sequence with low homology between target nucleic acids, or may be a sequence that is complementary or has low homology to other nucleic acids that may be contained in a sample. The target sequence may be a sequence characteristic of the target nucleic acid. Such target sequences may be artificially altered sequences.

  Hereinafter, representative and non-limiting specific examples of the disclosure of the present specification will be described in detail with reference to the drawings. This detailed description is intended merely to provide those skilled in the art with details for practicing the preferred embodiments of the present disclosure and is not intended to limit the scope of the present disclosure. Absent. Further, the additional features and disclosure disclosed below can be used separately from or together with other features and inventions to provide improved methods for detecting target nucleic acids and the like.

  In addition, the combination of features and steps disclosed in the following detailed description are not essential in carrying out the disclosure of the present specification in the broadest sense, and are particularly representative specific examples of the disclosure of the present specification. It is described only for the purpose of explaining. Furthermore, the various features of the exemplary embodiments described above and below, as well as those described in the independent and dependent claims, provide additional and useful embodiments of the disclosure herein. They do not have to be combined according to the specific examples described herein or in the order listed.

All features described in this specification and / or claims, apart from the configuration of the features described in the examples and / or claims, are individually disclosed as limitations on the original disclosure and claimed specific matters. And are intended to be disclosed independently of each other. Further, all numerical ranges and group or group descriptions are intended to disclose intermediate configurations thereof as a limitation to the original disclosure and claimed subject matter.
[Method for detecting target nucleic acid]

  The detection method disclosed in the present specification includes a target nucleic acid amplification step, a labeling step, and a detection step. These steps are performed in the same closed space.

  The amplification step here is a step of amplifying a conventionally known nucleic acid to produce a nucleic acid amplification product, and includes all known forms. As for the form of the amplified fragment to be obtained, all conventionally known forms (completely double-stranded, partially double-stranded having a single-stranded portion at one 5 ′ end, and having a single-stranded portion at both 5 ′ ends) Partial duplex etc.).

  The labeling step here is a step of labeling a conventionally known nucleic acid, typically a nucleic acid amplification product, with a labeling agent, and includes all known forms. The labeling step may be performed separately from the nucleic acid amplification step or may be performed simultaneously in the nucleic acid amplification step. In this case, a labeling substance can be bound in advance to at least one primer of the primer set used for nucleic acid amplification, and this can be used as a labeling agent. Alternatively, a labeling substance may be bound in advance to nucleotides used for nucleic acid amplification and used as a labeling agent.

  As the labeling agent, known ones can be used, but it is preferable that the labeling agent contains a labeling substance that is a luminescent substance or a coloring substance that presents luminescence or color development that can be detected visually (with the naked eye). This is because the labeling substance itself can generate a signal that allows the naked eye to visually recognize the target nucleic acid without the need for other components, and the detection process can be performed only by visual observation. Such labeling substances typically include various colorants such as various pigments and dyes. Moreover, a chemiluminescent substance is mentioned. Furthermore, in addition to this, there are various precious metals such as gold and silver, various metals or alloys such as copper, or organic compounds containing the metal (may be complex compounds). Furthermore, inorganic compounds, such as mica, are mentioned.

  More specifically, this kind of labeling substance includes various dyes, various pigments, luminol, isoluminol, acridinium compound, olefin, enol ether, enamine, aryl vinyl ether, dioxene, aryl imidazole, lucigenin, luciferin and eclion. And chemiluminescent substances. Moreover, particles such as latex particles labeled with such a labeling substance can be mentioned. Furthermore, colloids or sols including gold colloids or sols or silver colloids or sols can be mentioned. Furthermore, a metal particle, an inorganic particle, etc. are mentioned.

  The average particle diameter of particles such as latex particles constituting a part of the labeling agent is not particularly limited, but is, for example, 20 nm to 20 μm, typically 40 nm to 10 μm, preferably 0.1 μm to 10 μm. The average particle diameter is particularly preferably 0.1 μm or more and 5 μm or less, and more preferably 0.15 μm or more and 2 μm or less. Preferred particles are particles that can be suspended in an aqueous solution and consist of a water-insoluble polymeric material. Examples include polyethylene, polystyrene, styrene-styrene sulfonate copolymer, acrylic acid polymer, methacrylic acid polymer, acrylonitrile polymer, acrylonitrile-butadiene-styrene, polyvinyl acetate-acrylate, polyvinyl pyrrolidone, or vinyl chloride-acrylate. Mention may also be made of latex particles having active groups on their surface, for example carboxyl, amino or aldehyde groups.

  Such a labeling substance can be obtained commercially, and the production of the labeling substance and the method of labeling the label on the particles are also known, and those skilled in the art can obtain them appropriately using known techniques. Furthermore, the labeling element or the particle labeled with the labeling element and an oligonucleotide such as DNA can be appropriately bound via a functional group such as an amino group, which is well known in the art.

  Examples of the labeling agent include those in which a nucleotide chain capable of specifically hybridizing with a part of the nucleic acid amplification product is bound to the labeling substance. Examples thereof include colored latex particles, colloidal gold particles, or colloidal silver particles to which such nucleotide chains are bound.

  The same closed space means a group of spaces that can be closed to the outside and maintained in a state. For example, the same closed space means one closed space in one container, one closed space that is partitioned into two or more in one container but partially communicates with each other, and each other in one container There are two or more closed spaces that are partitioned and do not communicate with each other and that are communicated as necessary for performing the process.

  Prior to the amplification step and the labeling step, the extraction step may also be performed in the same closed space. Since the extraction process is also performed in the same closed space, loss from the extraction process to the amplification process and contamination can be suppressed.

  The detection step here is a step of detecting the amplified and labeled nucleic acid amplification product with a conventionally known nucleic acid amplification product detector, and includes all known forms.

  The detection step may be performed after the amplification step and the labeling step are completed, or may be performed substantially in parallel with the labeling step and the amplification step. For example, the detector may be sequentially brought into contact with the amplified and labeled nucleic acid amplification product. In addition, when the extraction step is further performed, the labeling step and the amplification step may be performed after the extraction step is completed, and the nucleic acids extracted by the extraction step are sequentially used for the amplification step and the labeling step. You may do it.

  The kit disclosed in this specification is an example of a kit capable of realizing the detection method disclosed in this specification. This kit includes an amplification agent that amplifies the target nucleic acid, a labeling agent that labels the target nucleic acid, and a container that contains the amplification agent and the labeling agent and is sealed. The kit may further include a detector capable of detecting the target nucleic acid in the container. Alternatively, the kit can further include an extraction column for extracting the target nucleic acid.

  As shown in FIG. 1 as an example, the inside of the container that stores the amplification agent, the labeling agent, and the like may be a single storage chamber in which no member that divides the interior exists. The container 110 of the kit 11 is a tube-type container and has a single storage chamber 111. The container 110 can be sealed, for example, by fitting a detachable lid 112 into the opening above the container 110. When the container has a single storage chamber, the amplification agent and the labeling agent are mixed and stored in the container. That is, the mixture 117 of the amplification agent and the labeling agent is accommodated in the accommodation chamber 111. When the detector is further accommodated in the container, the detector may be partly or wholly immersed in a mixed solution of the amplification agent and the labeling agent. FIG. 1 shows a test piece-like detector 119 immersed in the mixed liquid 117. Or, for example, the amount of the liquid mixture is adjusted so that there is a space where no liquid mixture exists in the upper part of the container, the detector is fixed to that part, and the detector is mixed at an appropriate timing by tilting the container. It may be immersed in.

  As shown in FIG. 2 as an example, the container that stores the amplification agent, the labeling agent, and the like may further include a partition that partitions the container. The container 120 of the kit 12 is a tube-type container, and includes a storage chamber 121 and a storage chamber 123 that are partitioned by a partition wall 125. The partition wall 125 extends from the lower end of the container 120 to the center, and the space 124 above the partition wall 125 communicates with the storage chamber 121 and the storage chamber 123. The container 120 can be sealed, for example, by fitting a detachable lid 122 into the opening above the container 120. When the kit has a partition wall that partitions the inside of the container, the amplification agent and the labeling agent may be isolated by the partition wall in the sealed container (initial state). That is, the amplifying agent 127 may be stored in the storage chamber 121 and the labeling agent 128 may be stored in the storage chamber 125. When the detector is further accommodated in the container, the detector may be isolated from the mixture of the amplification agent and the labeling agent by the partition wall (first state). Alternatively, at least a part of the detector may be immersed in either the amplification agent or the labeling agent separated from each other by the partition wall in the initial state. FIG. 2 shows a test piece-like detector 129 partly immersed in the amplification liquid 127.

  The partition may be a partition installed in the container, like the partition 125 shown in FIG. Moreover, the container which has a partition may integrate the some container in the vicinity of the entrance like the forked test tube, and may comprise one container as a whole.

  By opening at least a part of the partition wall, or by moving the contents isolated from each other across the partition wall, the initial state is changed to a mixed state in which at least a part of the amplification agent and the labeling agent are mixed. A transition or a transition from the first state to a second state in which at least a portion of the detector is immersed in the mixture of the amplification agent and the labeling agent is possible.

  The partition wall may be opened by destroying part or all of the partition wall by pressure from the outside of the container. Through the open part of the partition wall, it is possible to mix the contained items in a state where no foreign matter is mixed from the outside. For example, a labeled nucleic acid amplification product can be obtained by mixing an amplification agent and a labeling agent in a state where no foreign matter is mixed in from the outside.

  An example of specific means for applying pressure from the outside of the container is shown in FIGS. As shown in FIG. 3, instead of the lid 122 shown in FIG. 2, a lid 132 having a pressurizing tube 133 is used, and high-pressure gas is injected into the container 120 through a tube 133 by a pump. Can be destroyed and released. In addition, as shown in FIG. 4, instead of the lid 122 shown in FIG. 2, a lid 142 having a bellows structure portion 143 for pressurization is used. By injecting, the partition wall 125 can be broken and opened. Further, the pressure applied from the outside of the container is not limited to the pressure by such gas, but may be an external force applied to the outer wall of the container.

  In the case where a space is provided in the container so as to communicate with both of the storage chambers separated by the partition walls, the stored items can be mixed with each other across the partition walls. The mixing method can be realized, for example, by moving one or both of the items separated by the partition wall to the space side, for example, by tilting the container. For example, when the kit 12 in the state of FIG. 2 is turned upside down as shown in FIG. 5, the amplification agent 127 and the labeling agent 128 move to the space 124 and are mixed to become a mixed solution 157. As described above, when a plurality of storage chambers separated by the partition wall are provided below the container and a space communicating with the storage chambers is provided above the plurality of storage chambers, the container is turned upside down. Thus, the stored items can be mixed by moving the stored items in the storage chamber to the space.

  Alternatively, the contents can be mixed with each other across the partition wall by rotating the container while the space is above the container and the plurality of storage chambers are below the container. For example, if the kit 12 in the state shown in FIG. 2 is rotated as shown in FIG. 6, the liquid level of the amplification agent 127 and a part of the liquid level of the labeling agent 128 rise by centrifugal force, and the amplification agent 127 and the labeling agent 128 is mixed at least in part.

  In order to carry out the detection step, at least a part of the detector may be immersed in a liquid containing the nucleic acid amplification product. When a part of the detector is immersed in the nucleic acid amplification product, a detector for development-type hybridization such as so-called nucleic acid chromatography can be selected. When the detector is immersed in the nucleic acid amplification product, a detector for immersion hybridization such as a so-called DNA chip or DNA array can be selected.

  In general, the detector includes a carrier and a detection probe immobilized on the carrier. The carrier may be plastic or glass, and the material is not particularly limited. Moreover, porous bodies, such as a cellulose, a nitrocellulose, and nylon, may be sufficient.

  The detection probe is supplied to the solid phase carrier in a predetermined pattern according to the form of the detector. In immersion type hybridization, typically, a pattern in which dots corresponding to individual detection probes are arranged. Further, in the development type hybridization, typically, a dot shape or a streak shape (band-like body) corresponding to each detection probe is a pattern arranged at one or more development positions along the development direction.

  The immobilization form of the detection probe immobilized on the detector is not particularly limited. The 3 'end of the detection probe may be bound to a carrier, or the 5' end may be bound. It may be covalent or non-covalent. The detection probe can be immobilized on the surface of the carrier by various conventionally known methods. For example, the carrier is supplied so as to draw a predetermined plane form by a method of discharging a micro droplet of a solution containing a detection probe. And the probe for a detection is fix | immobilized by drying by heating etc. as needed. Furthermore, for example, in order to immobilize the detection probe on the solid phase carrier, an oligonucleotide such as poly T may be added to the detection probe, or a protein such as albumin may be linked to adhere to the carrier. Can also be increased. Further, the sticking property can be enhanced by various types of radiation such as heat treatment and UV irradiation.

  The detection probe may be provided with an appropriate linker sequence on the surface of the carrier. The linker sequence is preferably the same sequence with the same base length between the detection probes.

  As already described, the detection of the nucleic acid amplification product is preferably performed by a labeling agent that can visually recognize the presence or absence of detection by luminescence or color development. In order to visually recognize the presence or absence of the amplification product, it is preferable that the container is transparent to the extent that the detector inside the product and the identified amplification product are visible. Furthermore, the detector may be attached to the inner wall of the container. By doing so, since the position of the detector is fixed, it is easy to visually recognize the position of the amplification product. From the same viewpoint, the detector may be integrated with the inner wall of the container (that is, the inner wall material functions as a solid phase carrier of the detection probe). Furthermore, it is preferable that the detector has a form such as a detection piece made of a transparent material. By doing so, the nucleic acid amplification product can be penetrated and hybridized from any direction of the front and back surfaces of the detector, and the labeled amplification product can be visually recognized from any direction.

  The kit disclosed in the present specification can further include an extraction column for extracting a target nucleic acid in a container. This extraction column partitions the inside of a container into an injection part for injecting a sample containing a target nucleic acid and a storage part in which an amplification agent and a labeling agent are stored. The container is sealed in a state where the amplification agent and the extraction column are accommodated. When a sample is injected into the injection portion of the container using a syringe or the like, the extract containing nucleic acid or the like that has passed through the extraction column moves to the storage portion in which the amplification agent and the labeling agent are stored. Although the sealing of the container is impaired when the sample is injected, the injection part and the storage part are partitioned by the extraction column, and only the extract that has passed through the extraction column can move to the storage part. It is possible to prevent contamination. Moreover, it is possible to prevent the loss of the sample due to the transfer of the container.

  The extraction column may have a configuration capable of highly inhibiting foreign matter contamination. For example, the extraction column preferably adsorbs a substance that inhibits amplification of the target nucleic acid. Specifically, the extraction column is made of at least one selected from the group consisting of zeolite, activated carbon, alumina, silica, acetylcellulose, and cellophane, and has an average pore size of 0.1 nm or more and 2 nm or less. It is preferable to include a certain film.

  It is preferable that a tapered portion that is narrowed from the extraction column side toward the storage portion side is provided between the extraction column and the storage portion. The taper part can suppress the amplification agent or the labeling agent accommodated in the accommodating part from moving to the extraction column side. In the tapered portion, it is preferable that at least the surface has a heat insulating property. Heat insulation can be imparted to the tapered portion by forming the whole or the surface of the tapered portion with a heat insulating material, or coating the surface of the tapered portion with a heat insulating agent.

(Preparation of detector)
Synthetic oligo DNA (manufactured by Nippon Genetic Laboratory Co., Ltd.) having a 20-base long oligonucleotide chain consisting of the following base sequence on the 5 ′ end or 3 ′ end side using a polyethersulfone membrane manufactured by Nippon Pole as a carrier. The dissolved aqueous solution was used as a detection probe, and spotted at NGK Corporation using a GENESHOT (registered trademark) spotter.

Detection probe base sequence: ACAAGAGACTGGTTACTTAGACG

  After the spot, baking was performed at 80 ° C. for 1 hour. Furthermore, the synthetic oligo DNA was immobilized by the procedure described below. That is, after washing with 2 × SSC / 0.2% SDS for 15 minutes, washing with 2 × SSC / 0.2% SDS at 95 ° C. for 5 minutes, and then washing with sterilized water (shaking up and down 10 times) 3 Repeated times. Then, it dehydrated by centrifugation (1000 rpm x 3 minutes). The obtained detection membrane was cut into 2 mm × 2 mm to obtain a detection piece.

  In addition, as a labeling agent containing a substance that presents a color that can be detected visually, a latex bead solution that is colored blue and that has oligo DNA (polyA (20A)) that reacts with sample DNA via a carboxyl group on the surface is attached. Got ready.

(Amplification process, labeling process, and detection process in the kit container)
As genomic DNA to be amplified, Cosmo Bio Corp. human normal tissue genomic DNA (Cat. No. D1234148) was prepared. A KAPA2G Fast HotStart PCR Kit (Cat. No. KK5502) from Nippon Genetics was prepared as a PCR amplification reagent. As a STH amplification primer, a synthetic product of the Japan Genetic Research Institute having the following sequence was prepared. The nucleic acid amplification product by this primer set corresponds to the probe ACAAGAGACTGGTTACTTAGACG.
<STH amplification primer sequence>
Modifying group: X = SpacerC3
Primer (Forward):
5 '-(TGTTCTCTGACCAATGAATCTGCXACCAAAGAATATGGCTGAATTTAGTAGTGTTTTAAATAATTTTAA) -3'
Primer (Reverse):
5 '-(TTTTTTTTTTTTTTTTTTTTXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA) -3'

The following PCR reaction solution 1 (10.0 μl), the above detection piece, and 1 μl latex bead solution are contained in a tube-shaped container having a single storage chamber as shown in FIG. It was put on and covered, and a thermal cycle reaction was performed using GeneAmp PCR System 9700 (Applied Biosystems) as a thermal cycler. In the thermal cycle, one cycle of 3 minutes at 95 ° C. was performed, and then 40 cycles were repeated with 95 seconds at 15 ° C. and 2 minutes at 68 ° C. as one cycle. Ten minutes after the end of the thermal cycle, a blue color was observed in the spot region of the detection probe corresponding to the amplification product of the primer set on the detection piece. An amplification agent, a labeling agent, and a container that contains and seals the amplification agent and the labeling agent, and in a kit having a single storage chamber, the amplification process and the labeling process are performed in the container. The target nucleic acid could be detected.
<PCR reaction solution 1>
5xKAPA2B Buffer: 3.0 μl
STH amplification primer (500 nM, each): 0.5 μl
dNTP Mixture (10 mM each): 0.2 μl
MgCl ₂ (25 mM): 0.9 μl
DNA polymerase (5 U / μl): 0.08 μl
RNase-free water: 2.82 μl
Genomic DNA (10 ng / μl): 2.5 μl

(Amplification process, labeling process, and detection process in the kit container)
A tube-type container having a partition wall (with an internal volume of 200 μl) as shown in FIG. 3 and a lid provided with a pressurizing tube are prepared, and the PCR solution 1 used in Example 1 is placed on one side of the partition wall as 10. 0 μl was added, 1 μl of the latex bead solution used in Example 1 and the detection piece were put on the other side, the lid was covered, and the thermal cycle reaction was carried out in the same manner as in Example 1. After completion of the thermal cycle, pressure was applied by a pump from a tube attached to the lid to break the partition wall. Ten minutes after the destruction, a blue color was observed in the spot region of the detection probe corresponding to the amplification product of the primer set on the detection piece. After amplifying the target nucleic acid by performing a PCR reaction in a state where the mixture of the amplification agent and the labeling agent (PCR solution) and the detector are separated by the partition wall, the partition wall is destroyed and a PCR reaction solution containing the nucleic acid amplification product is obtained. The target nucleic acid could be detected by immersing the detector.

(Preparation of detector)
A detection membrane similar to that in Example 1 was cut into 2 mm × 4 mm to form a detection piece. In addition, as a labeling agent containing a substance that exhibits visually detectable color development, a labeling agent that develops blue color and a labeling agent that develops red color were prepared. Each of these labeling agents is a latex bead solution having an oligo DNA (polyA (20A)) that reacts with sample DNA via a carboxyl group on the surface. The labeling agent that develops blue color and the labeling agent that develops red color are adjusted so as to color each different nucleic acid amplification product.

(Amplification process, labeling process, and detection process in the kit container)
As genomic DNA to be amplified, Cosmo Bio Corporation human normal tissue genomic DNA (Cat. No. D1234148) was prepared. As a PCR amplification reagent, Multiplex PCR Master Mix manufactured by QIAQEN was prepared. As a STH amplification primer, a synthetic product of the Japan Genetic Research Institute having the following sequence was prepared. In addition, the nucleic acid amplification product by the following primer 1 is detected by a labeling agent that develops blue color, and the nucleic acid amplification product by the following primer 2 is detected by a labeling agent that develops red color. The amplification products by these primer sets correspond to the probes ACAAGAGACTGGTTACTTAGACG and TCCAAAAAGATCTCACCTGTGCC.
<STH amplification primer sequence>
Modifying group: X = SpacerC3
Primer (Forward):
1 (blue)
5 '-(TGTTCTCTGACCAATGAATCTGCXACCAAAGAATATGGCTGAATTTAGTAGTGTTTTAAATAATTTTAA) -3'
2 (red)
5-AGGTTTTTCTAGAGTGGACACGGXAGCCTAGATTCATTATTCAAAGATATGAAATTTTAAAATGCATA-3 '
Primer (Reverse):
1 (blue)
5 '-(TTTTTTTTTTTTTTTTTTTTXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA) -3'
2 (red)
5'-CATCTAAAGCGTTCCCAGTTCCAXCTAGAGATACTACAGAGCCTGTCCGTCCAAGGTCATA-3 '

The following PCR reaction solution 2 (10.0 μl), the above detection piece, and red and blue latex beads are contained in a tube-type container having a single storage chamber as shown in FIG. 1 and an internal volume of 200 μl. The solution (1.0 μl of each) was put and covered, and a thermal cycle reaction was performed using GeneAmp PCR System 9700 (Applied Biosystems) as a thermal cycler. The thermal cycle was carried out at 95 ° C. for 3 minutes for 1 cycle, then at 95 ° C. for 30 seconds, at 80 ° C. for 1 second, and at 64 ° C. for 6 minutes, 40 cycles were repeated. Ten minutes after the end of the thermal cycle, blue and red coloration was observed in the spot region of the detection probe corresponding to the amplification product of the primer set on the detection piece. Even when a plurality of target nucleic acids were detected, the target nucleic acid could be detected by carrying out the amplification step and the labeling step in a container having a single storage chamber, as in Example 1.
<PCR reaction solution 2>
2x Multiplex PCR Master Mix: 5.0 μl
STH amplification primer (500 nM, each): 0.5 μl
RNase-free water: 2.0 μl
Genomic DNA (10 ng / μl): 2.5 μl

(Preparation of detector)
A detection membrane similar to that in Example 1 was cut into 5 mm × 3 mm to form a detection piece.

(Evaluation of impact of container transfer)
Three tube-type containers having a single storage chamber as shown in FIG. 1 and having the same volume and shape were prepared. A 10 nM detection sample solution (the same oligo DNA solution as in Example 1) was prepared. After the detection piece was put in the first container in advance, 10 μl of the detection sample solution was put and covered. A detection piece was placed in the second container. In the third container, 10 μl of the detection sample solution was put without the detection membrane. Then, the solution in the third container was transferred to the second container, and the second container was covered. For the first and second containers, 10 minutes after adding the sample solution, the lid was opened, the detection membrane was taken out, and the density of the detection line was compared and evaluated by absorbance using a chromatographic reader (manufactured by Hamamatsu Photonics). . Absorbance was 0.30 for the detection piece of the first container (without solution transfer) and 0.28 for the detection piece of the second container (with solution transfer). It was found that a higher detection sensitivity can be obtained when the solution is not transferred.

(Evaluation of stirring effect)
Two tube-type containers having a single storage chamber as shown in FIG. 1 and having the same volume and shape were prepared. 10 ng / μl of genomic DNA similar to that in Example 1 was prepared. After putting 10 μl of genomic DNA solution in the first container, it was covered and vigorously stirred for 5 minutes using a vortex mixer. Thereafter, the lid was opened and the detection piece and the following PCR reaction solution 3 were put in, the lid was capped again, and the amplification step was performed in the same temperature cycle as in Example 1. In the second container, 10 μl of the genomic DNA solution, the detection piece and the following PCR reaction solution 3 were put and capped, and the amplification step was performed in the same temperature cycle as in Example 1. After completion of the amplification step, the first and second containers are allowed to stand at room temperature for 10 minutes, and then the lid is opened to remove the detection piece, and the density of the detection line is measured using a chromatograph reader (manufactured by Hamamatsu Photonics). Comparative evaluation was carried out. The absorbance was 0.33 for the detection piece of the first container (with stirring) and 0.35 for the detection piece of the second container (without stirring). From this evaluation, it was found that high detection sensitivity can be obtained without stirring. When a pipetting operation or the like is performed in order to transfer a solution containing DNA, the solution may be stirred, causing DNA to be cleaved and the like, which may be a cause of a decrease in detection sensitivity. When the solution is not transferred, stirring of the solution containing DNA can be avoided, and reduction in detection sensitivity can be suppressed.
<PCR reaction solution 3>
2x Multiplex PCR Master Mix: 20.0 μl
STH amplification primer (500 nM, each): 2.0 μl
RNase-free water: 8.0 μl

(Evaluation of the impact of the number of processes)
A tube-type container dedicated to DNA extraction with a DNA purification column made of zeolite was prepared. 10 μl of 10 nM detection sample solution (oligo DNA solution complementary to the detection probe described in Example 1) was added, and then allowed to stand at room temperature for 10 minutes. The solution that passed through the DNA purification column was put into a detection vessel and a tube-type container containing the PCR reaction solution 3, and the amplification step was performed in the same temperature cycle as in Example 1. After completion of the amplification step, the sample was allowed to stand at room temperature for 10 minutes, and then the detection piece was taken out, and the density of the detection line was compared and evaluated based on the absorbance using a chromatograph reader (manufactured by Hamamatsu Photonics). Absorbance was 0.22.

  As shown in FIG. 7, a column mounting tube 510 having a tapered portion 516 having a taper shape was prepared and installed so as to be inserted from above a tube-type container 520 having a single storage chamber. A DNA purification column 512 made of zeolite is installed so as to be in contact with the inner wall surface of the column mounting tube 510, and a space 522 above and a space 524 below the column mounting tube 510 are partitioned by the DNA purification column 512. A lid 514 is fitted on the upper part of the column mounting tube 510, thereby sealing the upper space 522. The lower space 524 is sealed by inserting the column mounting tube 510 into the tube-type container 520. The tapered portion 516 is narrowed in a funnel shape from the DNA purification column 512 toward the lower space 524.

  The lid 514 was opened, and 10 μl of a 10 nM detection sample solution (an oligo DNA solution complementary to the detection probe described in Example 1) was placed in the upper space 522, and then allowed to stand at room temperature for 10 minutes. The solution that has passed through the DNA purification column 512 and moved to the lower space 524 is placed in another tube-type container containing the detection piece and the PCR reaction solution 3, and the amplification process is performed in the same temperature cycle as in Example 1. It was. After completion of the amplification step, the sample was allowed to stand at room temperature for 10 minutes, and then the detection piece was taken out, and the density of the detection line was compared and evaluated based on the absorbance using a chromatograph reader (manufactured by Hamamatsu Photonics). Absorbance was 0.26. It was found that high detection sensitivity can be obtained when the extract obtained in the extraction step is directly dropped onto a liquid containing an amplifying agent or the like.

(Evaluation of influence of column mounting tube shape)
As shown in FIG. 8, three types of column mounting tubes (tube 530, tube 540, and tube 550) were prepared. Upper portions 531, 541 and 551, which are portions from the upper ends of the tubes 530, 540, and 550 to the lower end of the zeolite DNA purification column 512, have the same shape and material. The lower part 532 of the tube 530 has a tapered shape like the column mounting tube 510 of FIG. 5, and the surface thereof is coated with a heat insulating agent. The lower part 542 of the tube 540 has the same tapered shape as the lower part 532 of the tube 530, and the same material as that of the upper part 541 is used. The tube 550 does not have a lower part.

  Three tube-type containers having the same volume and shape were prepared, and 100 μl of water was added. Similarly to FIG. 5, tubes 530, 540, and 550 were fitted over the respective containers, covered, and a thermal cycle similar to the amplification step was performed at the same temperature cycle as in Example 1. When the tubes 530, 540, and 550 were used, the amounts of liquid remaining in the tube-type container were 90 μl, 85 μl, and 60 μl, respectively. It has been found that when the column mounting tube has a tapered portion on the outlet side, it is possible to suppress the liquid containing the amplification agent or the like from diffusing to the column side. Furthermore, it has been found that when the surface of the tapered portion is coated with a heat insulating agent, the effect of suppressing the diffusion of the liquid containing the amplifying agent or the like to the column side becomes higher.

(Preparation of detector)
A detection membrane similar to that in Example 1 was cut into 2 mm × 2 mm to form a detection piece.
Further, a latex bead solution similar to that in Example 1 was prepared as a labeling agent that develops a blue color.

(Execution process, amplification process, labeling process, detection process in the kit container)
The same genomic DNA, PCR amplification reagent, and STH amplification primer as those of Example 1 were prepared.

The same PCR reaction solution (10.0 μl) as described below, the above detection piece, and 1 μl latex bead solution are placed in a tube-type container having an internal volume of 200 μl, and the column shown in FIG. 5 is attached to the opening side. A column mounting tube similar to the tube 510 was inserted. In a portion separated from the PCR reaction solution storage chamber by the DNA purification column (on the DNA purification column at the top of the column mounting tube), 5 μl of pseudo blood containing genomic DNA and a DNA extract (0.3 M NaOH, 1 % SDS) and added for 10 minutes. Thereafter, pressure was applied by covering the column mounting tube, and the DNA extract that passed through the DNA purification column was dropped into the PCR reaction chamber. Further, a thermal cycle reaction was performed under the same conditions as in Example 1. Ten minutes after the end of the thermal cycle, blue color was observed on the detection piece. By attaching an extraction column for extracting the target nucleic acid to the upper part of the container containing the amplification agent, labeling agent and detector, and introducing pseudo blood containing genomic DNA through the extraction column into the container, The target nucleic acid could be detected.
<PCR reaction solution>
5xKAPA2B Buffer: 3.0 μl
STH amplification primer (500 nM, each): 0.5 μl
dNTP Mixture (10 mM each): 0.2 μl
MgCl ₂ (25 mM): 0.9 μl
DNA polymerase (5 U / μl): 0.08 μl
RNase-free water: 2.82 μl

11, 12, 12a, 12b Kit 110, 120, 520 Container 111, 121, 123, 524 Storage chamber 112, 122, 132, 142, 514 Lid 124 Space 127 Amplifying agent 128 Labeling agent 117, 157 Mixed solution 119 Detector 125 Separator 133 Pressurizing tube 143 Bellows structure 510, 530, 540, 550 Column mounting tube 512 DNA purification column 516, 532, 542 Taper 522 Upper space 524 Lower space

Sequence number 1,4: Probe sequence number 2, 3, 5, 6: Primer

Claims (22)

A method for detecting a target nucleic acid, comprising:
An amplification step of the target nucleic acid, a labeling step, a detection step,
Including
The method wherein the amplification step, the labeling step, and the detection step are performed in the same closed space. Further comprising the step of extracting the target nucleic acid,
The method according to claim 1, wherein the extraction step, the amplification step, the labeling step, and the detection step are performed in the same closed space. A kit for detecting a target nucleic acid,
An amplifying agent for amplifying the target nucleic acid;
A labeling agent for labeling the target nucleic acid;
And a container that contains and seals the amplification agent and the labeling agent. Further comprising a partition partitioning the inside of the container,
In the sealed container, it is possible to shift from an initial state in which the amplification agent and the labeling agent are separated by the partition wall to a mixed state in which at least a part of the amplification agent and the labeling agent are mixed. Item 4. The kit according to Item 3.   The kit according to claim 4, wherein at least a part of the partition wall is opened in the initial state and can be shifted to the mixed state.   The kit according to claim 5, wherein at least a part of the partition wall can be opened by pressure from the outside of the sealed container. In the container, there is provided a space communicating with both the side of the partition where the amplification agent is accommodated and the side where the labeling agent is accommodated.
The kit according to claim 4, wherein in the sealed container, at least a part of at least one of the amplification agent and the labeling agent can move to the mixed state beyond the partition wall.   The kit according to any one of claims 3 to 7, further comprising a detector capable of detecting the target nucleic acid in the container.   The kit according to claim 8, wherein at least a part of the detector is immersed in at least one of the amplification agent and the labeling agent. A detector capable of detecting the target nucleic acid contained in the container;
Further comprising a partition partitioning the inside of the container,
In the sealed container, at least a part of the detector is immersed in the mixture from a first state where the mixture of the amplification agent and the labeling agent and the detector are isolated by the partition wall. The kit according to claim 3, which is capable of transitioning to two states.   The kit according to claim 10, wherein in the first state, at least a part of the partition wall is opened to allow the transition to the second state.   The kit according to claim 5, wherein at least a part of the partition wall can be opened by pressure from the outside of the sealed container. In the container, there is provided a space communicating with both the side where the amplification agent and the labeling agent are accommodated and the side where the detector is accommodated.
In the sealed container, at least a part of the amplification agent and the labeling agent can immerse at least a part of the detector beyond the partition wall and shift to the second state. The described kit.   The kit according to any one of claims 8 to 13, wherein the detector is a labeling agent containing a luminescent substance or a coloring substance that presents luminescence or color development that can be detected visually.   The kit according to claim 14, wherein the detector is attached to an inner wall of the container.   The kit according to claim 14, wherein the detector is integrated with an inner wall of the container.   The kit according to claim 15 or 16, wherein the detector is a detection piece made of a permeable material. An extraction column for extracting the target nucleic acid in the container;
The extraction column partitions the inside of the container into an injection part for injecting a sample containing the target nucleic acid and a storage part in which the amplification agent and the labeling agent are stored. The kit according to one item.   The kit according to claim 18, wherein the extraction column adsorbs a substance that inhibits amplification of the target nucleic acid.   The extraction column includes at least one selected from the group consisting of zeolite, activated carbon, alumina, silica, acetylcellulose, and cellophane, and includes a membrane having an average pore size of 0.1 nm or more and 2 nm or less. Item 20. The kit according to Item 18 or 19.   21. The kit according to any one of claims 18 to 20, wherein a taper portion that is narrowed from the extraction column side toward the storage portion side is provided between the extraction column and the storage portion. .   The kit according to claim 21, wherein at least a surface of the tapered portion is heat insulating.

Images