JP2013255496A - Dna associated with hydroxylation of vitamin d - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a hydroxylated vitamin D derivative more efficiently and inexpensively, from demand in a pharmaceutical production or pharmaceutical creation by improving the method for producing the hydroxylated vitamin D.SOLUTION: There are provided an isolated pure DNA including at least one region encoding a polypeptide associated with the hydroxylation of vitamin D and the like, a polypeptide encoded by the DNA, an autonomously or integratively replicating recombinant plasmid carrying the DNA, a transformant holding the DNA, and a method for producing a hydroxylated vitamin D derivative by culturing the transformant in a medium and collecting the hydroxylated vitamin D derivative from its culturing liquid.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from Japanese Patent Application No. 2007-25153 filed on Feb. 5, 2007, all of those described here are specifically incorporated as disclosure.
Technical field

  The present invention relates to polypeptides involved in hydroxylation of vitamin Ds, DNAs encoding these polypeptides and variants thereof, and transformants that retain some or all of these DNAs and variants, And a method for producing a hydroxylated vitamin D derivative using these transformants.

  Vitamin D is a fat-soluble vitamin group that is essential in higher organisms and is biosynthesized from cholesterol. Its physiological effects are diverse, such as calcium absorption promotion, metabolism promotion, cell differentiation induction, immunoregulatory action, and play an important role in the living body.

The main pathway of biosynthesis of vitamin D in humans is that 7-dehydrocholesterol (provitamin D ₃ ) is first synthesized from cholesterol, and then vitamin D ₃ is produced in the skin from ultraviolet rays and a heat reaction. Vitamin D ₃ undergoes hydroxylation at position 25 by cytochrome P450 (CYP27A1) localized in the mitochondria of the liver to become 25-hydroxyvitamin D ₃ . Thereafter, it is further hydroxylated at the 1α position by another cytochrome P450 (CYP27B1) in the proximal tubule of the kidney to produce 1α, 25-dihydroxyvitamin D ₃ (activated vitamin D ₃ ). It has been known that this substance regulates the expression of specific genes in the nucleus involved in the expression of physiological effects by binding to intracellular receptors (receptors).

Thus, normal vitamin D metabolism may be inhibited when the liver or kidney becomes dysfunctional. Such patients in the blood is 25-hydroxyvitamin D ₃ and l [alpha], 25-may-dihydroxyvitamin D ₃ is extremely reduced, for treatment 25-hydroxyvitamin D ₃ and l [alpha], 25-dihydroxyvitamin D ₃ needs to be supplemented by administration.

On the other hand, l [alpha] by hydroxide dysfunction due to that there is a congenital mutations in cytochrome P450 genes involved in hydroxylation of vitamin D _3, 25-dihydroxyvitamin D ₃ is known rickets occurring missing . As well as 1α, 25-dihydroxyvitamin D ₃ and similar physiological effects as a treatment for diseases caused by deficiency of 1α, 25-dihydroxyvitamin D ₃ , including acquired rickets and osteoporosis The importance of related compounds is very high.

  Furthermore, various derivatives of vitamin D have been studied as drug candidates due to their various physiological activities, and there are expectations for the development of antitumor drugs, therapeutic agents for psoriasis, immunostimulatory drugs, and the like. From such a viewpoint, the hydroxylation reaction is important as one method for derivatizing vitamin Ds. In this case, the position of hydroxylation is not limited to the 1α-position and the 25-position, and there is a case where high necessity is required for hydroxylation at other positions. As described above, it is strongly desired in the pharmaceutical industry to improve the production method of hydroxylated vitamin D compounds from pharmaceutical or drug discovery demand, and to produce and supply hydroxylated vitamin D derivatives more efficiently and cheaply. It has been rare.

Regarding 1α, 25-dihydroxyvitamin D ₃ , which has particularly strong physiological activity among vitamin Ds, and mentions it as an organic synthesis method, a method using human cytochrome P450, and hydroxylation of microorganisms. Examples include a method using an enzyme. Among these, the organic synthesis method is known to be synthesized from cholesterol through about 20 steps (see Non-Patent Documents 6 and 7). Moreover, in the method using human cytochrome P450, there is accumulation of biological and biochemical knowledge regarding the gene involved, the expression technique, and the properties of the cytochrome P450 enzyme (see Non-Patent Document 1). However, both of these two methods are extremely unsuitable for practical use due to problems of high manufacturing cost and low productivity.

In addition, as a method of utilizing the hydroxylase of the microorganism, by Bacillus megaterium, a method for producing a 25-hydroxyvitamin D ₃ by hydroxylating the 25-position of vitamin D ₃ is disclosed (Patent Document 1 reference). However, the accumulated amount of 25-hydroxyvitamin D _{3 in} the medium by this method is small, and there is no description about the production of 1α, 25-dihydroxyvitamin D ₃ .

On the other hand, as for the knowledge about the vitamin D ₃ hydroxylation gene derived from microorganisms, a hydroxyvitamin D ₃ 25-position hydroxylase gene derived from Pseudonocardia autotrophica was reported in 1994 (non-patent document). However, it is clearly different from the gene of the present invention in view of the nucleotide sequence and the properties of the enzyme encoded thereby. Furthermore, Sawada et al 1α 2004 P450SU-1 cytochrome P450 gene from Streptomyces & Guriseorasu ATCC11796 encoded (CYP105A1) is vitamin D ₃ 25-hydroxy vitamin D ₃ and hydroxyvitamin D _3, 25 - it has reported to have a weak hydroxide activity to dihydroxyvitamin D ₃ (see non-Patent Document 5).

As described above, various knowledge about the hydroxylation reaction of vitamin D ₃ using microorganisms has been shown so far. However, the actinomycete Pseudonocardia autotrophica found by Sasaki et al. (see non-Patent documents 2 and 3, Patent Document 2 and Patent Document 3) l [alpha], 25-only method for producing dihydroxyvitamin D ₃ have been industrially commercialized vitamin D ₃ using as. In this method, after culturing Pseudonocardia genus actinomycetes in a fermentor, vitamin D ₃ is added as a reaction substrate to the culture solution, and the reaction proceeds by the action of hydroxylase of the cells, The accumulated 1α, 25-dihydroxyvitamin D ₃ is recovered and purified from the culture solution.

In this production method, actinomycetes having a long growth time are used as conversion microorganisms, so that the production period becomes long, and in addition to the target hydroxylation reaction, the conversion bacteria have undesirable vitamin D ₃ conversion action. There are also side reactions. Examples of the side reaction include hydroxylation at the 26th or 24th position. In addition, there is a degradation activity against vitamin D _{3 as} a substrate and 1α, 25-dihydroxyvitamin D ₃ as a target product. In particular, the degradation of 1α, 25-dihydroxyvitamin D ₃ is a very important problem that is directly related to the amount of accumulated target substance. In addition, the presence of by-products increases the number of steps for recovering and purifying 1α, 25-dihydroxyvitamin D ₃ from the culture solution after the conversion reaction, resulting in a decrease in the yield of the target product. Therefore, development of a more efficient method for producing a hydroxylated vitamin D derivative has been desired.

JP 2003-325175 A JP-A-2-469 JP-A-2-31089

Review by T. Sakaki et al., Frontiers in Bioscience, 10, 119-134, 2005 J. Sasaki et.al, Applied Microbiology and Biotechnology, 38,152-157,1992 K. Takeda et.al, J. Ferment. Bioeng., 78, 380-382, 1994 H. Kawauchi et.al, Biochimica et Biophysica Acta, 179-183, 1994 N. Sawada et.al, Biochemical and Biophysical Research Communications 320,156-164,2004 Kametani T., Furuyama H., Med. Res. Rev. 7, 147-171 (1987). Zunk G-D., Okamura W.H.Norman A.W., Chem. Rev. 95, 1877-1952 (1995).

  The entire descriptions of Non-Patent Documents 1 to 7 and Patent Documents 1 to 3 are specifically incorporated herein by reference.

  The object of the present invention is to suppress the side reaction and degradation activity as described above in the current production method of hydroxylated vitamin D derivative, and to increase the amount of the target product to be produced more efficiently. To provide a law.

The present inventors have found that in order to solve the above problems, first, a gene encoding an enzyme that selectively hydroxide 1α and 25-position of vitamin D _3, and decomposed hydroxide vitamin D ₃ nonselectively Searched for possible microorganisms. Specifically, among the hundreds of P450 genes of these microorganisms, P450 genes (CYP105 family and CYP107 family of actinomycetes) that are presumed to be involved in catabolism are selected and homologous among the P450 genes A hydroxylase gene having high selectivity was found and obtained by PCR using a primer that created a unique region. Subsequently, this gene was incorporated into Escherichia coli, which is a host having no or very little side reaction and degradation activity, and the target hydroxylation activity was expressed to complete the present invention.

That is, the present invention relates to the following [1] to [17].
[1] Proteins having hydroxylase activity of at least one vitamin D selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ Or DNA encoding as a whole.
[2] DNA represented by the following (a), (b), (c) or (d).
(a) DNA encoding a protein having hydroxylase activity of at least one vitamin D selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ Because
A continuous base sequence from base 1 to base 1254 of SEQ ID NO: 1,
A continuous base sequence from base 1 to base 1200 of SEQ ID NO: 2,
A continuous base sequence from base 1 to base 1224 of SEQ ID NO: 3,
A continuous base sequence from base 1 to base 1254 of SEQ ID NO: 4,
A continuous base sequence from base 1 to base 1197 of SEQ ID NO: 5,
A continuous base sequence from base 1 to base 1269 of SEQ ID NO: 6,
A continuous base sequence from base 1 to base 1197 of SEQ ID NO: 7,
A continuous base sequence from base 1 to base 1215 of SEQ ID NO: 8,
A continuous base sequence from base 1 to base 1227 of SEQ ID NO: 9,
A continuous base sequence from base 1 to base 1185 of SEQ ID NO: 10,
DNA selected from the group consisting of a continuous base sequence from base 1 to base 1248 of SEQ ID NO: 11 and a continuous base sequence from base 1 to base 1242 of SEQ ID NO: 86.
(b) a modified form of the DNA shown in (a) above,
(i) hybridizes with the DNA represented by (a) under stringent conditions; and
(ii) DNA encoding a protein having hydroxylase activity of vitamin Ds.
(c) Due to the degeneracy of gene codons, it does not hybridize under stringent conditions with the DNA shown in (a) above, but is the same as the protein encoded by the DNA shown in (a) or (b) above DNA encoding a protein having an amino acid sequence.
(d) a protein having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA shown in (a) and having hydroxylase activity of vitamin Ds DNA encoding
[3] A protein encoded by the DNA according to [2].

[4] At least selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ , having the amino acid sequence of any of (1) to (3) below: DNA encoding a protein having hydroxylase activity of one kind of vitamin D.
(1) the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the Sequence Listing;
(2) deletion, substitution and / or deletion of 1 to several amino acids in the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Or (3) 70% or more relative to the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Amino acid sequence having homology of
[5] At least selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ having the amino acid sequence of any of the following (1) to (3) A protein having hydroxylase activity of one kind of vitamin D.
(1) the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the Sequence Listing;
(2) deletion, substitution and / or deletion of 1 to several amino acids in the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Or (3) 70% or more relative to the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Amino acid sequence having homology of
[6] A self-sustaining replicating or integrating replicating recombinant plasmid carrying the DNA of [1], [2] or [4].
[7] A transformant obtained by transforming a host with the recombinant plasmid according to [6].
[8] Using DNA described in [1], [2] or [4] or a DNA comprising a part thereof as a probe or primer, from a DNA library, vitamin D ₃ , vitamin D ₂ , 25-hydroxy Searching for DNA encoding a protein having hydroxylase activity of at least one vitamin D selected from the group consisting of vitamin D ₃ and 25-hydroxyvitamin D ₂ A screening method for DNA encoding a protein having oxidase activity.

[9] DNA represented by the following (e), (f), (g) or (h).
(e) DNA encoding ferredoxin,
A continuous base sequence from base 1200 to base 1388 of SEQ ID NO: 2,
A continuous base sequence from base 1197 to base 1385 of SEQ ID NO: 5,
A continuous base sequence from base 1200 to base 1385 of SEQ ID NO: 7,
A DNA selected from the group consisting of a continuous base sequence from base 1198 to base 1410 of SEQ ID NO: 10 and a continuous base sequence from base 1245 to base 1451 of SEQ ID NO: 11.
(f) a modified form of the DNA shown in (e) above,
(i) hybridizes with the DNA represented by (e) above under stringent conditions; and
(ii) DNA encoding a protein having a ferredoxin function.
(g) Due to the degeneracy of the gene codon, it does not hybridize with the DNA shown in (e) above under stringent conditions, but is the same as the protein encoded by the DNA shown in (e) or (f) above DNA encoding a protein having an amino acid sequence.
(h) A DNA encoding a protein having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA represented by (e) and having a ferredoxin function.
[10] A protein encoded by the DNA according to [9].
[11] A DNA encoding a protein having an amino acid sequence of any one of (4) to (6) below and having a ferredoxin function.
(4) the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 in the sequence listing;
(5) an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids in the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 of the sequence listing; or (6) of the sequence listing An amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 14, 18, 21, 25 or 27.
[12] A protein having the amino acid sequence of any one of (4) to (6) below and having a ferredoxin function.
(4) the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 in the sequence listing;
(5) an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids in the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 of the sequence listing; or (6) of the sequence listing An amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 14, 18, 21, 25 or 27.

[13] The autonomously replicating or integrating replicating recombinant plasmid according to [6], further carrying the DNA according to [9] or [11].
[14] A transformant obtained by transforming a host with the recombinant plasmid according to [13].
[15] The transformant according to [7] or [14], wherein the host is Escherichia coli containing an actinomycete-derived ferredoxin gene and a ferredoxin reductase gene in an expressible state.
[16] A method for searching for DNA encoding a protein having a ferredoxin function from a DNA library using the DNA described in [9] or [11] or a DNA comprising a part thereof as a probe or primer. A method for screening DNA encoding a protein having a ferredoxin function.
[17] The transformant according to [7], [14] or [15] is cultured in a medium, and during or after the culture, the grown transformant is brought into contact with vitamin Ds to obtain hydroxylated vitamin D A method for producing a hydroxylated vitamin D derivative, which comprises converting to a derivative and collecting the thus converted hydroxylated vitamin D derivative.

  The meaning of terms, symbols, and the like described in the present specification will be described below, and the present invention will be described in detail.

“Vitamin D” used in the specification of the present application means a substance that is recognized as a substrate by the hydroxylase of the present invention and that can be added with 1 oxygen atom to 1α-position, 25-position, and other carbons, The following compounds are included.
(1) Vitamin D such as vitamin D ₃ and vitamin D ₂
(2) Precursors, metabolites, and other derivatives of vitamin D (including 25-hydroxyvitamin D ₃ , 1α-hydroxyvitamin D _3, etc.)
(3) Cholestanic steroids or modified compounds thereof (including cholesterol, 7-dehydrocholesterol, etc.)

  As used herein, “hydroxylated vitamin D derivative” means a compound in which a monooxygen atom is added to the carbon atoms at 1α, 25, and other positions of vitamin D by the hydroxylase of the present invention. To do.

  As used herein, “hydroxylase activity of vitamin D” means an enzyme activity that hydroxylates vitamin D and converts it to a hydroxylated vitamin D derivative.

  As used herein, “ferredoxin function” refers to a protein function that transfers electrons to the hydroxylase of the vitamin Ds and is responsible for hydroxylation together with the hydroxylase of the vitamin Ds.

  As used herein, “modified DNA” refers to a derivative modified by deletion, conversion, addition, or insertion of a constituent base, or a derivative thereof, and DNA that exhibits the same effect as the original. Means. Also, “homology” of DNA or peptide means the percentage of matching bases or amino acids shared between two sequences when two base sequences or two amino acid sequences are aligned in an optimal manner. . That is, homology = (number of matched positions / total number of positions) × 100, and can be calculated using a commercially available algorithm. Such an algorithm is also incorporated into the blastn and blastp programs.

  According to the present invention, it is possible to isolate a DNA encoding a protein or ferredoxin having vitamin D hydroxylase activity, determine its base sequence, and further transform the plasmid carrying the DNA and the plasmid. Thus, a transformant was prepared, and a hydroxylated vitamin D derivative could be efficiently produced using the transformant. As a result, from the previous limited range of attempts to conveniently control the complex physiological and metabolic mechanism of the whole cell of the transforming bacterium Pseudocardia autotrophica for the production of hydroxylated vitamin D derivatives. I was able to escape. That is, by isolating a gene encoding an enzyme that hydroxylates the 1α-position and the 25-position, it is possible to express the hydroxylase in a host optimal for production using genetic engineering technology. We were able to solve the technical problem. In addition, technologies that can be used for breeding transformed bacteria include the construction of advanced gene expression systems and the improvement of enzyme functions through gene modification. These technologies are also possible only when the genes of the present invention are used. It will be. Among the hydroxylases such as vitamin D reported so far, the hydroxylase is novel and has properties that are extremely suitable for industrial use. Therefore, the present invention provides a method for producing a hydroxylated form of vitamin D that is extremely useful and efficient in the industry.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, embodiments of the present invention will be described in detail.

Microorganisms having hydroxylase activity of vitamin Ds In the present invention, hydroxylation of vitamin Ds is carried out from bacterial cells collected from a culture medium in which microorganisms having the ability to convert vitamin Ds to hydroxylated vitamin D derivatives are cultured. A DNA encoding a protein having an enzyme activity or ferredoxin in part or in whole can be isolated and the nucleotide sequence can be determined. Then, a self-sustaining replicating or integrating replicating recombinant plasmid carrying the DNA is constructed, and a transformant is prepared using the plasmid.

  The transformant thus prepared is cultured in a medium, and during or after the culture, the transformed transformant is converted into a hydroxylated vitamin D derivative by contacting vitamin Ds with the grown transformant, and converted water. By collecting the oxidized vitamin D derivative, a hydroxylated vitamin D derivative can be obtained.

  As microorganisms having the ability to convert vitamin Ds to hydroxylated vitamin D derivatives, any microorganisms having such ability can be used regardless of species and strains. Dactylosporangium variesporum IFO14104 strain, Streptomyces roseoviolaceus NBRC13081 strain, Streptomyces citreofluorescens NBRC12853 strain, saccharix capreolus) NBRC12847 strain, Pseudonocardia autotrophica NBRC12743 strain, Streptomyces chrysomallus HUT6141 strain, Pseudonocardia autotropica ATCC35204 strain, Streptomyces fascicula NBRC12765 share, and the like can be given. Of these, Streptomyces reseviolaceus NBRC13081, Streptomyces citreofluorescens NBRC12853, Nocardia Capreola NBRC12847, Pseudonocardia autotrophica NBRC12743 and Streptomyces facikratus NBRC12765 It is stored in the Bioresources Division (NBRC) of the National Institute for Product Evaluation and Technology Biotechnology Headquarters and can be easily obtained. Streptomyces chrysalius HUT6141 strain is stored in Hiroshima University HUT Culture Collection and can be easily obtained. Pseudocardia autotrophica ATCC 35204 strain is stored in the American Type Culture Collection (ATCC) and can be easily obtained. As for the Dactyrosporangium valiesporum IFO14104 strain, the ATCC31203 strain of the same origin is stored in the American Type Culture Collection (ATCC) and can be easily obtained.

DNA of the present invention
The inventors of the present invention describe a DNA encoding a protein involved in hydroxylation of vitamin Ds from the microorganism, that is, a DNA encoding a protein having a hydroxylase activity of vitamin Ds and a DNA encoding a protein having a ferredoxin function. Was isolated and its nucleotide sequence was determined. Hereinafter, DNA encoding a protein having hydroxylase activity of vitamin Ds and DNA encoding a protein having a ferredoxin function may be collectively referred to as “vitamin D hydroxylase-related DNA”.

  Obtaining the vitamin D hydroxylase-related DNA of the present invention has a problem that cannot be easily solved by methods generally attempted by those skilled in the art. It is considered that about 20 to 40 P450 genes are present in one individual's genomic DNA in actinomycetes to which microorganisms having the ability to convert vitamin Ds into hydroxylated vitamin D derivatives belong. Therefore, Southern hybridization using a probe using a homologous region of a general P450 gene and degenerate PCR using a primer using a homologous region of a general P450 gene are used for the target vitamin D hydroxylase. It was very difficult to isolate the relevant DNA. Therefore, as a result of intensive studies, the inventors selected P450 genes (CYP105 family and CYP107 family of actinomycetes) that are presumed to be involved in catabolism among hundreds of P450 genes possessed by microorganisms, and were limited to them. Primers were made from regions that were homologous only between P450 genes. By PCR using these, a DNA encoding a P450 enzyme having hydroxylase activity of vitamin D was found with high probability, and the present invention was completed.

The thus obtained DNA encoding the protein having the hydroxylase activity of vitamin D of the present invention is represented by the following (a), (b), (c) or (d).
(a) DNA encoding a protein having hydroxylase activity of vitamin D, and a continuous base sequence from base 1 to base 1254 of SEQ ID NO: 1, and a continuous base sequence from base 1 to base 1200 of SEQ ID NO: 2 Sequence, base sequence from base 1 to base 1224 in SEQ ID NO: 3, base sequence from base 1 to base 1254 in SEQ ID NO: 4, continuous base from base 1 to base 1197 in SEQ ID NO: 5 Sequence, a continuous base sequence from base 1 to base 1269 of SEQ ID NO: 6, a continuous base sequence from base 1 to base 1197 of SEQ ID NO: 7, a continuous base sequence from base 1 to base 1215 of SEQ ID NO: 8, Sequential base sequence from base 1 to base 1227 of SEQ ID NO: 9, continuous base sequence from base 1 to base 1185 of SEQ ID NO: 10, continuous base sequence from base 1 to base 1248 of SEQ ID NO: 11 and SEQ ID NO: 86 bases 1 to 1242 in sequence A DNA selected from the group consisting of a plurality of base sequences.

(b) a modified form of the DNA shown in (a), which has a base sequence that hybridizes with any of the DNAs shown in (a) under stringent conditions, DNA encoding a protein having oxidase activity.

(c) A protein encoded by the DNA shown in (a) or (b) above, but does not hybridize under stringent conditions with any of the DNA shown in (a) because of the degeneracy of the gene codon. DNA encoding a protein having the same amino acid sequence as

(d) a protein having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA shown in (a) and having hydroxylase activity of vitamin Ds DNA encoding

Further, the DNA encoding the protein having the hydroxylase activity of vitamin D of the present invention has an amino acid sequence of any one of the following (1) to (3): vitamin D ₃ , vitamin D ₂ , 25-hydroxy vitamin D ₃ and 25-DNA encoding a protein having at least one hydroxylase activity of vitamin D is selected from the group consisting of hydroxy vitamin D _2.
(1) the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the Sequence Listing;
(2) deletion, substitution and / or deletion of 1 to several amino acids in the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Or (3) 70% or more relative to the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, 26 or 87 in the sequence listing Amino acid sequence having homology of

The DNA encoding the protein having the ferredoxin function of the present invention is represented by the following (e), (f), (g) or (h).
(e) DNA encoding ferredoxin, comprising a continuous base sequence from base 1200 to base 1388 of SEQ ID NO: 2, a continuous base sequence from base 1197 to base 1385 of SEQ ID NO: 5, and base 1200 of SEQ ID NO: 7 A DNA selected from the group consisting of a continuous base sequence from base 1385 to base 1385, a continuous base sequence from base 1198 to base 1410 of SEQ ID NO: 10, and a continuous base sequence from base 1245 to base 1451 of SEQ ID NO: 11.

(f) a protein having a ferredoxin function, which is a modified form of the DNA represented by (e), has a base sequence that hybridizes with any of the DNAs represented by (e) under stringent conditions DNA encoding

(g) A protein encoded by the DNA shown in (e) or (f) above, but does not hybridize under stringent conditions with any of the DNA shown in (e) above due to the degeneracy of the gene codon. DNA encoding a protein having the same amino acid sequence as

(h) A DNA encoding a protein having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA represented by (e) and having a ferredoxin function.

  In the description of the DNA, “base sequence that hybridizes under stringent conditions” means using the DNA of either (a) or (e) as a probe, colony hybridization method, plaque hybridization method Or a base sequence of DNA obtained by using Southern blot hybridization or the like, for example, 0.7 to 1.0 M NaCl using a filter on which colony or plaque-derived DNA or a fragment of the DNA is immobilized. After hybridization at 65 ° C. in the presence, the filter is washed under conditions of 65 ° C. using 0.1 to 2 × SSC solution (1 × SSC solution is 150 mM sodium chloride, 15 mM sodium citrate). Can be identified by DNA. Hybridization is performed according to the method described in Molecular Cloning: A laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989 (hereinafter abbreviated as "Molecular Cloning 2nd Edition"). be able to.

  Examples of DNA that hybridizes under stringent conditions include DNA having a certain degree of homology with the base sequence of DNA used as a probe, for example, 85% or more, preferably 90% or more, more preferably 93%. More preferably, DNA having homology of 95% or more, most preferably 98% or more is mentioned.

  The range of “1 to several” in the “base sequence having deletion, substitution and / or addition of 1 to several bases” as used herein is not particularly limited, but for example, 1 to 40, preferably Means 1 to 30, more preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, and particularly preferably about 1 to 3.

The method for obtaining the vitamin D hydroxylase-related DNA of the present invention is not particularly limited.
For example, the hydroxylase activity of vitamin Ds can be determined from a DNA library using the DNA of the present invention encoding a protein having hydroxylase activity of vitamin Ds or a DNA comprising a part thereof as a probe or primer. By searching for a DNA encoding a protein having the protein, a DNA encoding a protein having a hydroxylase activity of vitamin Ds can be screened. The screened DNA can be isolated by a conventional method. Furthermore, using the DNA of the present invention encoding a protein having a ferredoxin function or a DNA comprising a part thereof as a probe or primer, a DNA encoding a protein having a ferredoxin function is searched from a DNA library. DNA encoding a protein having a ferredoxin function can be screened. The screened DNA can be isolated by a conventional method.

  More specifically, an appropriate probe or primer is prepared based on the nucleotide sequence information described in any one of SEQ ID NO: 1 to SEQ ID NO: 11 and SEQ ID NO: 86 in the sequence listing, and a DNA library using them The DNA of the present invention searched by screening can also be isolated. A DNA library can be prepared by a conventional method from a microorganism that expresses the hydroxylase activity of vitamin D, for example, a microorganism belonging to Actinomyces.

  The vitamin D hydroxylase-related DNA of the present invention can also be obtained by PCR. PCR is performed using the above-described microorganism-derived DNA library as a template, and using a pair of primers designed to amplify the base sequence described in any of SEQ ID NO: 1 to SEQ ID NO: 11 and SEQ ID NO: 86 . PCR reaction conditions can be set as appropriate. For example, one cycle of a reaction step consisting of 94 ° C for 30 seconds (denaturation), 55 ° C for 30 seconds to 1 minute (annealing), and 72 ° C for 2 minutes (extension) For example, after 30 cycles, the reaction is allowed to proceed at 72 ° C. for 7 minutes. The amplified DNA fragment can then be cloned into a vector that can be amplified in a suitable host.

  The above-described procedures such as probe or primer preparation, DNA library construction, DNA library screening, and target gene cloning are known to those skilled in the art. For example, Molecular Cloning 2nd Edition, Current Protocols in Molecular Biology, It can be carried out according to the method described in Supplement 1 to 38, John Wiley & Sons (1987-1997) and the like.

Protein of the present invention The protein having the hydroxylase activity of vitamin D of the present invention includes the protein represented by the above (a), (b), (c) or (d) and encoded by DNA, and the following (1 ) To (3) and having at least one amino acid sequence selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ It is a protein having the hydroxylase activity of
(1) the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, or 26 in the sequence listing;
(2) deletion, substitution and / or deletion of 1 to several amino acids in the amino acid sequence described in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, or 26 in the sequence listing An amino acid sequence having an addition; or (3) 70% or more homology to the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, or 26 in the sequence listing Amino acid sequence having sex.

The protein having the ferredoxin function of the present invention is a protein encoded by DNA represented by the above (e), (f), (g) or (h), and any one of the following amino acids (4) to (6) A protein having a sequence and having a ferredoxin function.
(4) the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 in the sequence listing;
(5) an amino acid sequence having a deletion, substitution and / or addition of one to several amino acids in the amino acid sequence set forth in SEQ ID NO: 14, 18, 21, 25 or 27 of the sequence listing; or (6) of the sequence listing An amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 14, 18, 21, 25 or 27.

  The range of “1 to several” in the “amino acid sequence having 1 to several amino acid deletions, substitutions and / or additions” as used herein is not particularly limited. For example, 1 to 20, preferably Means 1 to 10, more preferably 1 to 7, further preferably 1 to 5, particularly preferably about 1 to 3.

  As used herein, “an amino acid having 70% or more homology to the amino acid sequence set forth in SEQ ID NO: 12, 13, 15, 16, 17, 19, 20, 22, 23, 24, or 26 in the Sequence Listing. The homology in the “sequence” and “amino acid sequence having 70% or more homology with the amino acid sequence described in SEQ ID NO: 14, 18, 21, 25 or 27 of the sequence listing” is particularly limited as long as it is 70% or more. However, it is more preferably 80% or more, further preferably 85% or more, further preferably 90%, particularly preferably 95% or more.

  The method for obtaining the protein of the present invention is not particularly limited, and may be a protein synthesized by chemical synthesis or a recombinant protein produced by a gene recombination technique. When producing a recombinant protein, first, DNA encoding the protein described above in this specification is obtained. The protein of the present invention can be produced by introducing this DNA into an appropriate expression system. The expression of the protein in the expression system will be described later in this specification.

The recombinant vector of the present invention The DNA encoding the protein having the hydroxylase activity of the vitamin D of the present invention is inserted into a suitable vector alone or together with the DNA encoding the protein having the ferredoxin function. Can be used. The type of vector used in the present invention is not particularly limited. For example, the vector may be a self-replicating vector (for example, a plasmid), or may be integrated into the host cell genome when introduced into the host cell. An expression vector is preferable, although it may be replicated together with other chromosomes. In the expression vector, the DNA of the present invention is functionally linked to elements necessary for transcription (for example, a promoter and the like). A promoter is a DNA sequence that exhibits transcriptional activity in a host cell, and can be appropriately selected depending on the type of host.

Production of transformant of the present invention and recombinant protein using the transformant A transformant can be produced by introducing the DNA or recombinant vector of the present invention into a suitable host. The host cell into which the DNA or recombinant vector of the present invention is introduced may be any cell as long as it can express the gene of the present invention, and examples thereof include bacteria, yeast, fungi and higher eukaryotic cells. Examples of bacterial cells include Gram positive bacteria such as Bacillus or Streptomyces or Gram negative bacteria such as E. coli. Transformation of these bacteria may be performed by using competent cells by a protoplast method, an electroporation method or a known method. For example, the electroporation method can be performed as follows. The plasmid into which the foreign gene has been inserted is added to a suspension of competent cells, this suspension is placed in a cuvette dedicated to the electroporation method, and a high voltage electric pulse is applied to the cuvette. Thereafter, the cells are cultured in a selective medium, and the transformant is isolated on a plate agar medium.

  Examples of yeast cells include cells belonging to Saccharomyces or Schizosaccharomyces, such as Saccharomyces cerevisiae or Saccharomyces kluyveri. Examples of the method for introducing a recombinant vector into a yeast host include an electroporation method, a spheroblast method, and a lithium acetate method. Examples of other fungal cells are cells belonging to filamentous fungi such as Aspergillus, Neurospora, Fusarium, or Trichoderma. When filamentous fungi are used as host cells, transformation can be performed by integrating the DNA construct into the host chromosome to obtain a recombinant host cell. Integration of the DNA construct into the host chromosome can be performed according to known methods, for example, by homologous recombination or heterologous recombination.

  The host used to obtain the transformant of the present invention is preferably, for example, Escherichia coli containing the actinomycete-derived ferredoxin gene and ferredoxin reductase gene in a state capable of being expressed. Such E. coli are described in WO03 / 087381 and the corresponding US application publication 2006234337A1 (all of which are specifically incorporated herein by reference), and the ferredoxin gene from actinomycetes is preferably microtetra It can be a gene derived from any strain belonging to a microorganism belonging to Spora (Microtetraspora) or a microorganism belonging to Pseudomonas, and the ferredoxin reductase gene is a microorganism belonging to Streptomyces or Pseudomonas (Pseudomonas) It can be a gene derived from any strain belonging to the microorganism belonging to.

  As described in WO03 / 08738, E. coli containing a ferredoxin gene derived from actinomycetes and a ferredoxin reductase gene in a state in which these genes can be expressed in a plasmid in which these genes can autonomously replicate in E. coli, A promoter sequence, terminator sequence, drug resistance gene, etc. are inserted in an appropriate sequence and exist in the host, or in a state where it can be expressed functionally via a chromosomal DNA-integrated vector. It means that it is embedded in.

  In the above expression system in E. coli, the DNA encoding the protein having the hydroxylase activity of the vitamin D of the present invention, the ferredoxin gene, and the ferredoxin reductase gene are included in the host E. coli in an operable form. The “operable form” means that all the above genes are present in the host in a state where they can be expressed functionally. A typical example of such a state is that the DNA encoding the protein having hydroxylase activity of the vitamin D of the present invention, the ferredoxin gene, and the ferredoxin reductase gene are arranged in any order in the plasmid. In general, however, it is preferable that DNA encoding a protein having hydroxylase activity of vitamin Ds is arranged at the most upstream. Even when the DNA encoding the protein having the hydroxylase activity of vitamin D and the ferredoxin gene are used as gene cluster fragments of the same origin, for example, it encodes the protein having the hydroxylase activity of vitamin D They can be arranged in the order of DNA-ferredoxin gene-ferredoxin reductase gene. In this case, the ferredoxin gene contained in the gene cluster fragment and the ferredoxin gene derived from actinomycetes may be duplicated and contained in the transformant of the present invention.

  The transformant is cultured in an appropriate nutrient medium under conditions that allow expression of the introduced gene. In order to isolate and purify the protein of the present invention from the culture of the transformant, ordinary protein isolation and purification methods may be used.

  For example, when the protein of the present invention is expressed in a dissolved state in the cell, after the culture is completed, the cell is collected by centrifugation, suspended in an aqueous buffer, and then disrupted by an ultrasonic crusher or the like. A cell-free extract is obtained. From the supernatant obtained by centrifuging the cell-free extract, an ordinary protein isolation and purification method, that is, a solvent extraction method, a salting-out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, Anion exchange chromatography using a resin such as diethylaminoethyl (DEAE) Sepharose, cation exchange chromatography using a resin such as SP-Sepharose FF (Amersham Biosciences), butyl sepharose, phenyl sepharose, etc. Purified samples using methods such as hydrophobic chromatography using resins, gel filtration using molecular sieves, affinity chromatography, chromatofocusing, and electrophoretic methods such as isoelectric focusing alone or in combination Can be obtained.

Method for producing hydroxylated vitamin D derivative The present invention uses a transformant introduced with a DNA encoding a protein having hydroxylase activity of vitamin D or a DNA encoding a protein having a ferredoxin function, and the transformant A method for producing a hydroxylated vitamin D derivative, comprising hydroxylating vitamin Ds in the presence of

Conditions for hydroxylating vitamin Ds in the presence of the transformant are as follows.
First, if necessary, an inducer is added to the vitamin D hydroxylase-related DNA in the transformant and expressed in the microbial cells. The bacterial cells in which these DNAs are expressed are brought into contact with vitamin D as a substrate to cause a conversion reaction. The temperature of the conversion reaction can be appropriately determined in consideration of the optimum temperature of the transformant. The reaction time can also be appropriately determined in consideration of the conversion rate to the hydroxy vitamin D derivative (reaction progress) and the like. For example, 20 to 31 ° C. and 1 to 5 days are preferable. Further, the reaction mode can be carried out either in a batch mode or a continuous mode.

  For the isolation and purification of the produced hydroxylated vitamin D derivative, separation and purification methods generally used for isolating microbial metabolites from the culture broth can be used. For example, organic solvent extraction using methanol, ethanol, acetone, butanol, ethyl acetate, butyl acetate, chloroform, toluene, etc., adsorption / desorption treatment using hydrophobic adsorption resin such as Diaion HP-20, Sephadex LH-20 This includes all known methods such as gel filtration chromatography using an activated carbon, adsorption chromatography using activated carbon, silica gel, etc., adsorption / desorption treatment using thin layer chromatography, or high performance liquid chromatography using a reverse phase column. Moreover, it is not specifically limited to the method shown here. The target hydroxylated vitamin D derivative can be isolated and purified by combining these methods singly or in any order and using them repeatedly.

  Hereinafter, the present invention will be described in more detail with specific examples, but the present invention is not intended to be limited to these examples. In the following examples, the percentage (%) indicates weight percent in the description of the medium, and volume percent in the description of the mobile phase of HPLC.

Example 1: Determination of the base sequence of the P450 gene dvaA derived from Dactyrosporangium variesporum IFO14104 and preparation of a transformant having the gene
(1) Preparation of DNA of Dactyrosporangium variesporam IFO14104 strain Chromosome 1% glucose, malt extract 0.4%, yeast extract 1% was inoculated with IFO14104 strain and cultured at 28 ° C. for 3 days. The obtained culture solution was centrifuged at 3000 rpm for 10 minutes to collect bacterial cells. Chromosomal DNA was prepared from the cells using Blood & Cell Culture kit (QIAGEN).

(2) Cloning of a partial sequence of DNA encoding one of the proteins having hydroxylation activity of vitamin D ₃ (DvaA) The following primers with reference to the amino acid sequence of cytochrome P450 belonging to the CYP105 family of actinomycetes (5Dm-3F and B1R-105) were designed and prepared (see SEQ ID NO: 28 and SEQ ID NO: 29 in the Sequence Listing).
5Dm-3F: 5'-TTCGCSCTSCCSGTCCCSTCSATGGTSAT-3 '
B1R-105: 5'-GGCCAGCTGCTCGGGGTGTTCCAGCAG-3 '
A mixed base S (= C + G) was used in order to increase reactivity in consideration of codon fluctuation.

  Next, PCR reaction was carried out using these two kinds of primers (5Dm-3F and B1R-105) and the IFO14104 strain chromosomal DNA obtained in (1) above as a template. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 360 bp (hereinafter referred to as DNA fragment-A1) was amplified. There is a high possibility that this DNA fragment-A1 is a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-A1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain a sufficient amount of DNA fragment-A1 for analyzing the nucleotide sequence of the obtained DNA fragment-A1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). DNA fragment-A1 was ligated to transform E. coli JM109 strain. Then, ampicillin (50 μg / mL), X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside; 40 μg / mL), IPTG (isopropyl-β-D-thiogalactopyranoside; 100 μM) Transformed E. coli was selected using L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar). The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli cells using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-A1.

(3) Analysis of the base sequence of the cloned DNA fragment-A1 The base sequence of the DNA fragment-A1 obtained in the previous section (2) was analyzed using a DNA base sequence analyzer (Applied Biosysteme; 310). The analysis was performed by the cycle sequence method. As a result of nucleotide sequence analysis, DNA fragment-A1 amplified by PCR reaction was measured to be about 360 bp by electrophoresis, but as a result of nucleotide sequence analysis, it was revealed that it was exactly 351 bp (SEQ ID NO: 1 Base 487 to base 837). Since DNA sequences corresponding to the two types of primers used in the PCR reaction were found at both ends of the cloned 351 bp DNA sequence, the two DNA fragments-A1 were found in the PCR reaction. Specific primers (5Dm-3F and B1R-105).

(4) Analysis of the peripheral region of DNA fragment-A1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (DvaA) derived from IFO14104 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. That is, IFO14104 strain chromosomal DNA (see (1)) was digested with restriction enzyme XhoI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (3413-1F and 3413-1R) were designed and prepared from the base sequence of DNA fragment-A1 (see SEQ ID NO: 30 and SEQ ID NO: 31).
3413-1F: 5'-GTGTGATCTCCCTGCTGCTGTTGAT-3 '
3413-1R: 5'- AGGGTGCCGGACCGTTCCTGGAACT -3 '
Next, a PCR reaction was carried out using these two types of primers (3413-1F and 3413-1R) and the aforementioned self-circulated IFO14104 strain chromosomal DNA as a template. The PCR reaction was repeated 30 times using a Takara LA Taq (Takara Bio Inc.) and PCR amplification apparatus (Biometra T Gradient) in a two-stage reaction in which denaturation was performed at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 5 minutes. It was.

  As a result, a DNA fragment (DNA fragment-B1) having a size of about 3.6 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-B1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the nucleotide sequence of the obtained DNA fragment-B1, the plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(5) Analysis of base sequence of DNA fragment-B1 (about 3.6 kbp size) Using the base sequence of DNA fragment-B1 obtained in the previous section (4) using a DNA base sequence analyzer (Applied Biosystems; 310) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed and the information of the 1257 bp base sequence shown by sequence number 1 among DNA fragment-B1 was obtained.

  When the open reading frame (ORF) in this 1257 bp was searched, it was found that one protein was encoded. As a result of searching the amino acid sequence of the protein by BLAST search, ORF encoding a protein (SEQ ID NO: 12) consisting of 418 amino acids having high homology with cytochrome P450 in base 1 to base 1254 of SEQ ID NO: 1 dvaA) existed. And dvaA has the highest homology to the deduced amino acid sequence of cytochrome P450 (ORF16) of Amycolatopsis mediterranei S699 (59% homology), and relatively high homology to cytochrome P450 of Streptomyces tubercidicus (CYP105S1) (Homology 53%). This suggests that dvaA is likely to be a gene encoding cytochrome P450 type hydroxylase.

(6) Preparation of DNA fragment containing dvaA derived from IFO14104 strain Referring to the nucleotide sequence of SEQ ID NO: 1 analyzed in the previous section (5), the primer dvaA-NdeF (5'-) with an NdeI site added to the 5 'end GCGCATATGACCAGCCCCACCGGTTC-3 ′: see SEQ ID NO: 32) and a primer dvaA-SpeR (5′-CGCACTAGTCAGTCCCAGGCGACCGGGAGGCT-3 ′: see SEQ ID NO: 33) with a SpeI site added to the 5 ′ end was designed and prepared. Next, PCR reaction was performed using these two types of primers (dvaA-NdeF and dvaA-SpeR) and the IFO14104 strain chromosomal DNA obtained in Example 1 (1) as templates. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment containing dvaA and having a size of about 1.3 kbp (hereinafter referred to as DNA fragment-C1) was amplified. From this PCR amplification reaction solution, DNA fragment-C1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(7) Construction of plasmid pSC-dvaA
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-C1 obtained in (6) above was digested with the restriction enzymes NdeI and SpeI, and the resulting DNA fragment-C1 digest and plasmid digest were used as DNA Ligation Kit ver.2 (Takara Bio Inc. ). As a result, a plasmid (referred to as plasmid pSC-dvaA) having a size of about 9.3 kbp was constructed by ligating DNA fragment-C1 containing dvaA and plasmid pT7NS-CamAB.

(8) Preparation of E. coli transformed strain BL21 (DE3) / pSC-dvaA E. coli BL21 (DE3) competent cell (Novagen) was transformed with the plasmid pSC-dvaA prepared in the previous section (7). Thus, Escherichia coli BL21 (DE3) / pSC-dvaA strain transformed with the plasmid pSC-dvaA was obtained.

Example 2: Determination of the base sequences of P450 gene dvbA and ferredoxin gene dvbB derived from Dactyrosporangium variesporam IFO14104 and preparation of transformants having those genes
(1) Cloning of a partial sequence of DNA encoding one of the proteins with hydroxylation activity of vitamin D ₃ (DvbA) With reference to the amino acid sequence of ferredoxin associated with cytochrome P450 belonging to the CYP105 family of actinomycetes Primers (5Dm-4F and H2R-105) were designed and prepared (see SEQ ID NO: 34 and SEQ ID NO: 35 in the Sequence Listing).
5Dm-4F: 5'-CACGAGACSACSGCSAACATGAT-3 '
H2R-105: 5'-GTCGTCCTGGTCGAA-3 '
A mixed base S (= C + G) was used in order to increase reactivity in consideration of codon fluctuation.

  Next, PCR reaction was performed using these two types of primers (5Dm-4F and H2R-105) and the IFO14104 strain chromosomal DNA obtained in Example 1 (1) as templates. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 580 bp (hereinafter referred to as DNA fragment-D1) was amplified. There is a high possibility that this DNA fragment-D1 is a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-D1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain an amount of DNA fragment-D1 sufficient to analyze the nucleotide sequence of the obtained DNA fragment-D1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). DNA fragment-A1 was ligated to transform E. coli JM109 strain. Then, L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar) containing ampicillin (50 μg / mL), X-gal (40 μg / mL), IPTG (100 μM) Used to select transformed E. coli. The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-D1.

(2) Analysis of the base sequence of the cloned DNA fragment-D1 The base sequence of the DNA fragment-D1 obtained in the previous section (1) was analyzed using a DNA base sequence analyzer (Applied Biosystems; 310). The analysis was performed by the cycle sequence method. As a result of the base sequence analysis, the DNA fragment-D1 amplified by the PCR reaction was measured to be about 580 bp by electrophoresis, but the base sequence analysis revealed that it was exactly 569 bp (SEQ ID NO: 2 Bases 715 to 1286). Since DNA sequences corresponding to the two kinds of primers used in the PCR reaction were found at both ends of the cloned 569 bp DNA sequence, the two DNA fragments-D1 were found in the PCR reaction. Specific primers (5Dm-4F and H2R-105).

(3) Analysis of the peripheral region of DNA fragment-D1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (DvbA) derived from IFO14104 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. That is, IFO14104 strain chromosomal DNA (see Example 1 (1)) was digested with the restriction enzyme NcoI in K buffer (20 mM Tris-HCl, pH 8.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM KCl). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (34457-3F and 34457-2R) were designed and prepared from the base sequence of DNA fragment-D1 (see SEQ ID NO: 36 and SEQ ID NO: 37).
34457-3F: 5'- CTGCCGGTGACGTTCTCATGAGGAT -3 '
34457-2R: 5'- GGCCGAGCAGGGTGAGCGTGCCGAT -3 '
Next, PCR reaction was carried out using these two types of primers (34457-3F and 34457-2R) and the above-mentioned self-circulated IFO14104 strain chromosomal DNA as a template. The PCR reaction was repeated 30 times in a two-stage reaction using Takara LA Taq (Takara Bio) and a PCR amplification device (Biometra T Gradient), denaturing at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 6 minutes. It was.

  As a result, a DNA fragment (DNA fragment-E1) having a size of about 5.2 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-E1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the nucleotide sequence of the obtained DNA fragment-E1, the plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(4) Analysis of the base sequence of DNA fragment-E1 (about 5.2 kbp size) Using the base sequence of DNA fragment-E1 obtained in the previous section (3) using a DNA base sequence analyzer (Applied Biosystems; 310) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed, and information on the base sequence of 1391 bp shown in SEQ ID NO: 2 in DNA fragment-E1 was obtained.

  When the open reading frame (ORF) in this 1391 bp was searched, it was found that two types of proteins were encoded. As a result of searching the amino acid sequences of these proteins by BLAST search, an ORF (SEQ ID NO: 13) encoding a protein consisting of 400 amino acids having high homology with cytochrome P450 at bases 1 to 1200 of SEQ ID NO: 2 ( (Hereinafter referred to as dvbA). And dvbA had the highest homology with the amino acid sequence of Streptomyces tubercidicus cytochrome P450 (CYP105S1) (homology 54%), and also had a relatively high homology with Streptomyces tubercidicus cytochrome P450 (CYP105S2) ( Homology 51%). This suggests that dvbA is likely to be a gene encoding cytochrome P450 type hydroxylase.

  Further, ORF (hereinafter referred to as dvbB) encoding a protein having high homology to 2F-2S type ferredoxin was present immediately downstream of dvbA (base 1200 to base 1388 of SEQ ID NO: 2). The protein encoded by dvbB consists of 63 amino acids (SEQ ID NO: 14), has the highest homology to the amino acid sequence of ferredoxin suaB of Streptomyces griseolus (53% homology), and ferredoxin fdxB of Streptomyces avermitilis MA-4680 Also had a relatively high homology (50% homology). For this reason, dvbB is thought to encode ferredoxin, which is responsible for electron transfer and hydroxylates together with dvbA.

(5) Preparation of DNA fragment containing dvbA and dvbB derived from IFO14104 strain Referring to the nucleotide sequence of SEQ ID NO: 2 analyzed in the previous section (4), primer dvbAB-NdeF with NdeI site added to the 5 ′ end (5 '-GGCCATATGACCGAAACGCTGTACCCCGA-3': see SEQ ID NO: 38) and a primer dvbAB-SpeR (5'-GCCACTAGTTACTCGATCACCTTGAT-3 ': see SEQ ID NO: 39) with an SpeI site added to the 5' end were designed and prepared. Next, PCR reaction was performed using these two types of primers (dvbAB-NdeF and dvbAB-SpeR) and the IFO14104 strain chromosomal DNA obtained in Example 1 (1) as templates. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment having a size of about 1.4 kbp containing dvbA and dvbB (hereinafter referred to as DNA fragment-F1) was amplified. From this PCR amplification reaction solution, DNA fragment-F1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(6) Construction of plasmid pSC-dvbAB
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-F1 obtained in (5) above was digested with restriction enzymes NdeI and SpeI, and the resulting DNA fragment-F1 digest and plasmid digested product were combined with DNA Ligation Kit ver. 2 (Takara Bio Inc.). ). As a result, a plasmid (referred to as plasmid pSC-dvbAB) having a size of about 9.4 kbp was constructed by ligating DNA fragment-F1 containing dvbA and dvbB inside and plasmid pT7NS-CamAB.

(7) Preparation of E. coli transformed strain BL21 (DE3) / pSC-dvbAB The plasmid pSC-dvbAB prepared in the previous section (6) was used to transform E. coli BL21 (DE3) competent cells (Novagen). Thus, Escherichia coli BL21 (DE3) / pSC-dvbAB transformed with the plasmid pSC-dvbAB was obtained.

Example 3: Determination of the base sequence of the P450 gene dvcA derived from Dactyrosporangium variesporam IFO14104 and preparation of a transformant having the gene
(1) the amino acid sequence of cytochrome P450 belonging to the CYP105 family and CYP107 family of cloning actinomycetes partial sequence of DNA encoding one (dvca) of a protein having the hydroxylating activity to the vitamin D ₃ below with reference Primers (5Dm-4F and N1R-107) were designed and prepared (see SEQ ID NO: 34 and SEQ ID NO: 40 in the Sequence Listing).
5Dm-4F: 5'-CACGAGACSACSGCSAACATGAT-3 '
N1R-107: 5'-AGCCGGGCCAGCGGGGCGCCCAGGCA-3 '
A mixed base S (= C + G) was used in order to increase reactivity in consideration of codon fluctuation.

  Next, PCR reaction was performed using these two kinds of primers (5Dm-4F and N1R-107) and the IFO14104 strain chromosomal DNA obtained in Example 1 (1) as templates. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 350 bp (hereinafter referred to as DNA fragment-G1) was amplified. This DNA fragment-G1 is likely to be a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-G1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain an amount of DNA fragment-G1 sufficient to analyze the nucleotide sequence of the obtained DNA fragment-G1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). The DNA fragment-G1 was ligated to transform E. coli strain JM109. Then, L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar) containing ampicillin (50 μg / mL), X-gal (40 μg / mL), IPTG (100 μM) Used to select transformed E. coli. The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-G1.

(2) Analysis of the base sequence of the cloned DNA fragment-G1 The base sequence of the DNA fragment-G1 obtained in the previous section (1) was analyzed using a DNA base sequence analyzer (Applied Biosystems; 310). The analysis was performed by the cycle sequence method. As a result of the base sequence analysis, the DNA fragment-G1 amplified by the PCR reaction was measured to be about 350 bp by electrophoresis, but the base sequence analysis revealed that it was exactly 354 bp (SEQ ID NO: 3 Base 727 to base 1080). Since DNA sequences corresponding to the two kinds of primers used in the PCR reaction were found at both ends of the cloned 354 bp DNA sequence, the two DNA fragments-G1 were found in the PCR reaction. Specific primers (5Dm-4F and N1R-107).

(3) Analysis of the peripheral region of DNA fragment-G1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (DvcA) derived from IFO14104 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. That is, IFO14104 strain chromosomal DNA (see Example 1 (1)) was digested with the restriction enzyme KpnI in L buffer (10 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (3457-1F and 3457-1R) were designed and prepared from the base sequence of DNA fragment-G1 (see SEQ ID NO: 41 and SEQ ID NO: 42 in the Sequence Listing).
3457IN-1F: 5'- TTCCCCGACGCGGACACCTTCGACATCA -3 '
3457IN-1R: 5'-GCAGCTTCTCCAGCTGGTCGGGGTGCTT-3 '
Next, PCR reaction was performed using these two kinds of primers (3457IN-1F and 3457IN-1R) and the above-mentioned self-circulated IFO14104 chromosomal DNA as a template. The PCR reaction was repeated 30 times in a two-stage reaction using Takara LA Taq (Takara Bio) and a PCR amplification device (Biometra T Gradient), denaturing at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 6 minutes. It was.

  As a result, a DNA fragment (DNA fragment-H1) having a size of about 1.9 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-H1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the base sequence of the obtained DNA fragment-H1, the plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(4) Analysis of base sequence of DNA fragment-H1 (about 1.9 kbp size) Using the base sequence of DNA fragment-H1 obtained in the previous section (3) using a DNA base sequence analyzer (Applied Biosystems; 310) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed, and information on the base sequence of 1227 bp shown in SEQ ID NO: 3 in DNA fragment-H1 was obtained.

  When an open reading frame (ORF) in this 1227 bp was searched, it was found that one kind of protein was encoded. As a result of searching the amino acid sequence of this protein by BLAST search, ORF encoding a protein (SEQ ID NO: 15) consisting of 408 amino acids having high homology with cytochrome P450 in base 1 to base 1224 of SEQ ID NO: 3 , DvcA). And dvcA had the highest homology with the amino acid sequence of Saccharopolyspora erythraea cytochrome P450 (CYP107B1) (homology 57%), and also had relatively high homology with Streptomyces collinus cytochrome P450 (RubU) ( Homology 52%). This suggests that dvcA is likely to be a gene encoding cytochrome P450 type hydroxylase.

(5) Preparation of DNA fragment containing dvcA derived from IFO14104 strain With reference to the nucleotide sequence of SEQ ID NO: 3 analyzed in the above (4), primer dvcA-NdeF (5′- CCCCATATGGGGGAGACTGCGACGGGTGCGAT-3 ′: see SEQ ID NO: 43) and a primer dvcA-SpeR (5′-CCCACTAGTCAGTGCGCTCCACGGTCCGA-3 ′: see SEQ ID NO: 44) with a SpeI site added to the 5 ′ end were designed and prepared. Next, PCR reaction was performed using these two kinds of primers (dvcA-NdeF and dvcA-SpeR) and the IFO14104 strain chromosomal DNA obtained in Example 1 (1) as templates. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment (hereinafter referred to as DNA fragment-J1) having a size of about 1.3 kbp containing dvcA was amplified. From this PCR amplification reaction solution, DNA fragment-J1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(6) Construction of plasmid pSC-dvcA
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-J1 obtained in (5) above was digested with restriction enzymes NdeI and SpeI, and the resulting DNA fragment-J1 digest and plasmid digest were combined with DNA Ligation Kit ver. 2 (Takara Bio Inc. ). As a result, a plasmid (referred to as plasmid pSC-dvcA) having a size of about 9.3 kbp was constructed by ligating DNA fragment-J1 containing dvcA and plasmid pT7NS-CamAB.

(7) Preparation of E. coli transformed strain BL21 (DE3) / pSC-dvcA Using the plasmid pSC-dvcA prepared in the previous section (6), E. coli BL21 (DE3) competent cell (Novagen) was transformed. Thus, Escherichia coli BL21 (DE3) / pSC-dvcA strain transformed with the plasmid pSC-dvcA was obtained.

Example 4: Determination of the base sequence of the P450 gene ncaA derived from Saccharomycus mutabilis NBRC12847 and preparation of a transformant having the gene
(1) Preparation of Saccharolyticus mutabilis NBRC12847 Chromosome DNA A medium consisting of 1% glucose, 0.4% malt extract and 1% yeast extract was inoculated with NBRC12847 strain and cultured at 28 ° C. for 3 days. The obtained culture solution was centrifuged at 3000 rpm for 10 minutes to collect bacterial cells. Chromosomal DNA was prepared from the cells using Blood & Cell Culture kit (QIAGEN).

(2) Cloning of partial sequence of DNA encoding one of the proteins having hydroxylation activity to vitamin D ₃ (NcaA) With reference to the amino acid sequence of cytochrome P450 belonging to the CYP105 family of actinomycetes, the following Primers (A1F-105 and G1R-105) were designed and prepared (see SEQ ID NO: 45 and SEQ ID NO: 46 in the Sequence Listing).
A1F-105: 5'-GAGTTCACCGTGAAGCGGAT-3 '
G1R-105: 5'-TCACCAGGTGACCGGCAG-3 '

  Next, PCR reaction was performed using these two types of primers (A1F-105 and G1R-105) and the NBRC12847 strain chromosomal DNA obtained in (1) above as a template. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 900 bp (hereinafter referred to as DNA fragment-K1) was amplified. This DNA fragment-K1 is likely to be a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-K1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain a sufficient amount of DNA fragment-K1 for analyzing the nucleotide sequence of the obtained DNA fragment-K1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). The DNA fragment-K1 was ligated to transform E. coli JM109 strain. Then, L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar) containing ampicillin (50 μg / mL), X-gal (40 μg / mL), IPTG (100 μM) Used to select transformed E. coli. The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-K1.

(3) Analysis of the base sequence of the cloned DNA fragment-K1 Using the DNA base sequence analyzer (Applied Biosystems; 310), the DNA fragment-K1 base sequence obtained in the previous section (2) The analysis was performed by the cycle sequence method. As a result of the base sequence analysis, the DNA fragment-K1 amplified by the PCR reaction was measured to be about 900 bp by electrophoresis, but the base sequence analysis revealed that it was exactly 879 bp (SEQ ID NO: 4 Bases 376 to 1254). Since DNA sequences corresponding to the two kinds of primers used in the PCR reaction were found at both ends of the cloned 879 bp DNA sequence, the two DNA fragments-K1 were found in the PCR reaction. Specific primers (A1F-105 and G1R-105) were found to be specifically amplified.

(4) Analysis of the peripheral region of DNA fragment-K1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (NcaA) derived from the NBRC12847 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. That is, NBRC12847 strain chromosomal DNA (see (1)) was digested with restriction enzyme SphI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (20622-1F and 20622-1R) were designed and prepared from the base sequence of DNA fragment-K1 (see SEQ ID NO: 47 and SEQ ID NO: 48 in the Sequence Listing).
20622-1F: 5'-GCGCGGTGGAGGAGCTGCTGCGCTA-3 '
20622-1R: 5'- CGGAGGTGCCGTTGCGCTCGGACAT -3 '
Next, PCR reaction was carried out using these two kinds of primers (20622-1F and 20622-1R) and the above-mentioned NBRC12847 strain chromosomal DNA that had been self-circulated as a template. The PCR reaction was repeated 30 times using a Takara LA Taq (Takara Bio Inc.) and PCR amplification apparatus (Biometra T Gradient) in a two-stage reaction in which denaturation was performed at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 5 minutes. It was.

  As a result, a DNA fragment (DNA fragment-L1) having a size of about 4.1 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-L1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the nucleotide sequence of the obtained DNA fragment-L1, the plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(5) Analysis of base sequence of DNA fragment-L1 (about 4.1 kbp size) Using the base sequence of DNA fragment-L1 obtained in the previous section (4) using a DNA base sequence analyzer (Applied Biosystems; 310) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed and the information of the 1257 bp base sequence shown by sequence number 4 among DNA fragment-L1 was obtained.

  When the open reading frame (ORF) in this 1257 bp was searched, it was found that one protein was encoded. As a result of searching the amino acid sequence of the protein by BLAST search, ORF encoding a protein (SEQ ID NO: 16) consisting of 418 amino acids having high homology with cytochrome P450 in bases 1 to 1254 of SEQ ID NO: 4 ncaA) existed. NcaA has the highest homology to the deduced amino acid sequence of Amycolatopsis mediterranei S699 cytochrome P450 (ORF16) (59% homology), and also has a relatively high homology to cytochrome P450 of Streptomyces tubercidicus (CYP105S1) (Homology 53%). This suggests that ncaA is likely to be a gene encoding cytochrome P450 type hydroxylase.

(6) Preparation of DNA fragment containing ncaA derived from NBRC12847 strain With reference to the nucleotide sequence of SEQ ID NO: 1 analyzed in the previous section (5), primer ncaA-NdeF (5'-) CCGCATATGACCAGCCCCACCGTTTC-3 ′: refer to SEQ ID NO: 49) and a primer ncaA-SpeR (5′-CCGACTAGTCAGTCCCAGGCGACCGGCAGGCT-3 ′: refer to SEQ ID NO: 50) having a SpeI site added to the 5 ′ end were designed and prepared. Next, PCR reaction was performed using these two types of primers (ncaA-NdeF and ncaA-SpeR) and the NBRC12847 strain chromosomal DNA obtained in (1) above as a template. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment containing ncaA and having a size of about 1.3 kbp (hereinafter referred to as DNA fragment-M1) was amplified. From this PCR amplification reaction solution, DNA fragment-M1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(7) Construction of plasmid pSC-ncaA
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-M1 obtained in the previous section (6) is digested with restriction enzymes NdeI and SpeI, and the resulting DNA fragment-M1 digest and plasmid digest are used as DNA Ligation Kit ver.2 (Takara Bio Inc. ). As a result, a plasmid (referred to as plasmid pSC-ncaA) having a size of about 9.3 kbp was constructed by ligating the DNA fragment-M1 containing ncaA and the plasmid pT7NS-CamAB.

(8) Preparation of E. coli transformed strain BL21 (DE3) / pSC-ncaA E. coli BL21 (DE3) competent cell (Novagen) was transformed with the plasmid pSC-ncaA prepared in the previous section (7). Thus, Escherichia coli BL21 (DE3) / pSC-ncaA strain transformed with the plasmid pSC-ncaA was obtained.

Example 5: Determination of the nucleotide sequence of P450 gene ncbA derived from Saccharomycus mutabilis NBRC12847 strain and preparation of transformant having the gene
(1) Cloning of partial sequence of DNA encoding one of the proteins having hydroxylation activity to cyclosporin A (NcbA) With reference to the amino acid sequence of ferredoxin associated with cytochrome P450 belonging to CYP105 family of actinomycetes Primers (E1F-105 and H1R-105) were designed and prepared (see SEQ ID NO: 51 and SEQ ID NO: 52 in the Sequence Listing).
E1F-105: 5'- CACCAGTGCCTGGGGCAGAA-3 '
H1R-105: 5'- GTCGAAGACGTCGGGCGCGGTCA-3 '

  Next, PCR reaction was performed using these two types of primers (E1F-105 and H1R-105) and the NBRC12847 strain chromosomal DNA obtained in Example 4 (1) as a template. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 250 bp (hereinafter referred to as DNA fragment-N1) was amplified. This DNA fragment-N1 is likely to be a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-N1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain a sufficient amount of DNA fragment-N1 for analyzing the nucleotide sequence of the obtained DNA fragment-N1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). DNA fragment-N1 was ligated to transform E. coli JM109 strain. Then, L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar) containing ampicillin (50 μg / mL), X-gal (40 μg / mL), IPTG (100 μM) Used to select transformed E. coli. The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-N1.

(2) Analysis of the base sequence of the cloned DNA fragment-N1 The base sequence of the DNA fragment-N1 obtained in the previous section (1) was analyzed using a DNA base sequence analyzer (Applied Biosystems; 310). The analysis was performed by the cycle sequence method. As a result of the base sequence analysis, the DNA fragment-N1 amplified by the PCR reaction was measured to be about 250 bp by electrophoresis, but the base sequence analysis revealed that it was exactly 239 bp (SEQ ID NO: 5 Base 1033 to base 1271). Since DNA sequences corresponding to the two kinds of primers used in the PCR reaction were found at both ends of the cloned DNA sequence of 239 bp, the DNA fragment-D1 was found in the PCR reaction. Specific primers (E1F-105 and H1R-105).

(3) Analysis of the peripheral region of DNA fragment-N1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (NcbA) derived from the NBRC12847 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. That is, NBRC12847 strain chromosomal DNA (see Example 4 (1)) was digested with restriction enzyme NheI in M buffer (10 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 50 mM NaCl). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (2071-2F and 2071-2R) were designed and prepared from the base sequence of DNA fragment-N1 (see SEQ ID NO: 53 and SEQ ID NO: 54 in the Sequence Listing).
2071-2F: 5'-CGGAGCGCTGCGCCGGTTCGGGCAT-3 '
2071-2R: 5'- CCACCCGCATCTCGATGCGCGCCAA-3 '
Next, PCR reaction was carried out using these two kinds of primers (2071-2F and 2071-2R) and the above-mentioned self-circulated NBRC12847 strain chromosomal DNA as a template. The PCR reaction was repeated 30 times in a two-stage reaction using Takara LA Taq (Takara Bio) and a PCR amplification device (Biometra T Gradient), denaturing at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 6 minutes. It was.

  As a result, a DNA fragment (DNA fragment-P1) having a size of about 3.5 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-P1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the nucleotide sequence of the obtained DNA fragment-P1, the plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(4) Analysis of base sequence of DNA fragment-P1 (about 3.5 kbp size) Using the base sequence of DNA fragment-P1 obtained in the previous section (4) using a DNA base sequence analyzer (Applied Biosystems; 310) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed and the information of the 1388 bp base sequence shown by sequence number 5 among DNA fragment-P1 was obtained.

  When the open reading frame (ORF) in this 1388 bp was searched, it was found that two types of proteins were encoded. As a result of searching the amino acid sequences of these proteins by BLAST search, ORF encoding a protein (SEQ ID NO: 17) consisting of 399 amino acids having high homology with cytochrome P450 in bases 1 to 1197 of SEQ ID NO: 5 (Hereinafter referred to as ncbA). And ncbA has the highest homology with the amino acid sequence of cytochrome P450 (CYP105S1) of Streptomyces tubercidicus (homology 55%), and it is relatively also compared to the amino acid sequence predicted to be cytochrome P450 (ORF0) of Amycolatopsis mediterranei S699 Has high homology (homology 49%). This suggests that ncbA is likely to be a gene encoding cytochrome P450 type hydroxylase.

  Further, an ORF (hereinafter referred to as ncbB) encoding a protein having high homology to the 2F-2S type ferredoxin was present immediately downstream of ncbA (base 1197 to base 1385 of SEQ ID NO: 5). The protein encoded by ncbB consists of 63 amino acids (SEQ ID NO: 18), has the highest homology to the amino acid sequence of ferredoxin suaB from Streptomyces griseolus (56% homology), and also compared to ferredoxin Fd229 from Streptomyces tubercidicus High homology (homology 54%). Therefore, it was considered that ncbB encodes ferredoxin that is responsible for electron transfer and hydroxylates together with ncbA.

(5) Preparation of DNA fragment containing ncbA and ncbB derived from NBRC12847 strain With reference to the nucleotide sequence of SEQ ID NO: 2 analyzed in the previous section (4), primer ncbAB-NdeF (5) added with NdeI site '-GGCCATATGACCGAAACGCTGTACCCCGAA-3': refer to SEQ ID NO: 55) and a primer ncbAB-SpeR (5'-CGGACTAGTCTACTCGATCACCTTGAT-3 ': refer to SEQ ID NO: 56) having a SpeI site added to the 5' end were designed and prepared. Next, PCR reaction was performed using these two types of primers (ncbAB-NdeF and ncbAB-SpeR) and the NBRC12847 strain chromosomal DNA obtained in Example 4 (1) as templates. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment having a size of about 1.4 kbp containing ncbA and ncbB (hereinafter referred to as DNA fragment-Q1) was amplified. From this PCR amplification reaction solution, DNA fragment-Q1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(6) Construction of plasmid pSC-ncbAB
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-Q1 obtained in the previous section (5) is digested with restriction enzymes NdeI and SpeI, and the resulting DNA fragment-Q1 digest and plasmid digest are used as DNA Ligation Kit ver.2 (Takara Bio Inc. ). As a result, a plasmid (referred to as plasmid pSC-ncbAB) having a size of about 9.4 kbp was constructed by ligating DNA fragment-Q1 containing ncbA and ncbB inside and plasmid pT7NS-CamAB.

(7) Preparation of E. coli transformed strain BL21 (DE3) / pSC-ncbAB The plasmid pSC-ncbAB prepared in the previous section (6) was used to transform E. coli BL21 (DE3) competent cells (Novagen). Thus, Escherichia coli BL21 (DE3) / pSC-ncbAB strain transformed with the plasmid pSC-ncbAB was obtained.

Example 6: Determination of base sequence of P450 gene paaA derived from Pseudonocardia autotrophica NBRC12743 and preparation of transformant having the gene
(1) Preparation of chromosome of Pseudocardia autotrophica NBRC12743 strain NBRC12743 strain was inoculated into a medium consisting of glucose 1%, malt extract 0.4%, yeast extract 1% and cultured at 28 ° C. for 3 days. The obtained culture solution was centrifuged at 3000 rpm for 10 minutes to collect bacterial cells. Chromosomal DNA was prepared from the cells using Blood & Cell Culture kit (QIAGEN).

(2) Cloning of partial sequence of DNA encoding one of the proteins having hydroxylation activity to vitamin D ₃ (PaaA) With reference to the amino acid sequence of cytochrome P450 belonging to CYP107 family of actinomycetes, the following Primers (J1F-107 and M1R-107) were designed and prepared (see SEQ ID NO: 57 and SEQ ID NO: 58 in the Sequence Listing).
J1F-107: 5'- CTCGCCGACCCGCGGCTGTCGAAGGA -3 '
M1R-107: 5'- GCGACCAGCAGGAGGAAGGCCAT -3 '

  Next, PCR reaction was performed using these two types of primers (J1F-107 and M1R-107) and the NBRC12743 strain chromosomal DNA obtained in (1) above as a template. PCR reaction is performed using Takara LA Taq (Takara Bio) and PCR amplification apparatus (Biometra T Gradient), denaturing at 98 ° C. for 20 seconds, annealing at 50 ° C. for 2 minutes, and extension at 68 ° C. for 1 minute 3 The step reaction was repeated 35 times. As a result, a DNA fragment having a size of about 540 bp (hereinafter referred to as DNA fragment-R1) was amplified. This DNA fragment-R1 is likely to be a part of DNA encoding a protein having hydroxylation activity. The DNA fragment-R1 amplified by the PCR reaction was recovered from the reaction solution by Wizard SV Gel and PCR Clean-Up System (Promega).

  Next, in order to obtain a sufficient amount of DNA fragment-R1 for analyzing the base sequence of the obtained DNA fragment-R1, DNA Ligation kit ver.2 (Takara Bio Inc.) was used for plasmid vector pT7Blue T (Novagen). The DNA fragment-R1 was ligated to transform E. coli JM109 strain. Then, L-Broth agar medium (1.0% bactotryptone, 0.5% yeast extract, 0.5% NaCl, 1.5% agar) containing ampicillin (50 μg / mL), X-gal (40 μg / mL), IPTG (100 μM) Used to select transformed E. coli. The thus isolated colonies of transformed Escherichia coli were cultured in an L-Broth liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% NaCl) containing ampicillin (50 μg / mL). Plasmid DNA was separated and purified from the grown transformed Escherichia coli using a plasmid purification kit (Labo Pass Mini, Hokkaido System Science) to obtain a certain amount of DNA fragment-R1.

(3) Analysis of the base sequence of the cloned DNA fragment-R1 The base sequence of the DNA fragment-R1 obtained in (2) above was analyzed using a DNA base sequence analyzer (Applied Biosystems; 310). The analysis was performed by the cycle sequence method. As a result of the base sequence analysis, the DNA fragment-R1 amplified by the PCR reaction was measured to be about 540 bp by electrophoresis, but the base sequence analysis revealed that it was exactly 557 bp (SEQ ID NO: 6 Bases 163 to 720). Since DNA sequences corresponding to the two types of primers used in the PCR reaction were found at both ends of the cloned 557 bp DNA sequence, the two DNA fragments-R1 were found in the PCR reaction. Specific primers (J1F-107 and M1R-107) were found to be specifically amplified.

(4) Analysis of the peripheral region of DNA fragment-R1 As described above, a partial sequence of DNA encoding one of the proteins having hydroxylation activity (PaaA) derived from the NBRC12743 strain was determined. Engineering Volume 14, p.591-593, 1995) amplified, cloned, and sequenced the base sequence of the peripheral region extending upstream and downstream of the cloned fragment. Specifically, NBRC12743 strain chromosomal DNA (see (1)) was digested with restriction enzyme XhoI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl). The obtained restriction enzyme-cleaved DNA fragment was self-circularized using DNA Ligation Kit ver. 2 (Takara Bio Inc.).

On the other hand, the following primers (7023-1F and 7023-1R) were designed and prepared from the base sequence of DNA fragment-R1 (see SEQ ID NO: 59 and SEQ ID NO: 60 in the Sequence Listing).
7023-1F: 5'- ACGGCGACTCGCTGAGCCCCGGCGAGACGA -3 '
7023-1R: 5'-TGGCCCGGACTCCTGACGGGCCAGCAGCTC -3 '
Next, a PCR reaction was carried out using these two types of primers (7023-1F and 7023-1R) and the above-mentioned self-circulated NBRC12743 strain chromosomal DNA as a template. The PCR reaction was repeated 30 times in a two-stage reaction using Takara LA Taq (Takara Bio) and a PCR amplification device (Biometra T Gradient), denaturing at 98 ° C for 20 seconds, annealing and extension at 68 ° C for 6 minutes. It was.

  As a result, a DNA fragment (DNA fragment-S1) having a size of about 3.0 kbp was amplified. These were DNA encoding a protein having hydroxylation activity and DNA having a DNA sequence including upstream and downstream regions. There is a high possibility.

  From this PCR amplification reaction solution, DNA fragment-S1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega). Next, in order to obtain an amount of each DNA fragment sufficient for analyzing the nucleotide sequence of the obtained DNA fragment-S1, plasmid vector pT7Blue T (Novagen), DNA Ligation kit ver. (Takara Bio Inc.), Escherichia coli JM109 strain and plasmid purification kit (Labo Pass Mini, Hokkaido System Science Co., Ltd.) were used to obtain a certain amount of each DNA fragment.

(5) Analysis of the base sequence of DNA fragment-S1 (about 3.0 kbp size) Using the DNA base sequence analyzer (Applied Biosystems; 310), the base sequence of DNA fragment-S1 obtained in the previous section (4) The analysis was performed by the dye terminator cycle sequence method. Thus, the base sequence was analyzed and the information of the 1272 bp base sequence shown by sequence number 6 among DNA fragment-S1 was obtained.

  When an open reading frame (ORF) in this 1272 bp was searched, it was found that one kind of protein was encoded. As a result of searching the amino acid sequence of the protein by BLAST search, ORF encoding a protein (SEQ ID NO: 19) consisting of 424 amino acids having high homology with cytochrome P450 in base 1 to base 1269 of SEQ ID NO: 6 paaA) existed. And paaA has the highest homology to the amino acid sequence of cytochrome P450 (RubU) of Streptomyces collinus (homology 53%), and also has relatively high homology to cytochrome P450 of Saccharopolyspora erythraea (CYP107B1) ( Homology 49%). This suggests that paaA is likely to be a gene encoding cytochrome P450 type hydroxylase.

(6) Preparation of DNA fragment containing paaA derived from NBRC12743 strain With reference to the nucleotide sequence of SEQ ID NO: 6 analyzed in the above (5), primer paaA-NdeF (5'-) with an NdeI site added to the 5 'end CCGCATATGACAGACACCACCGAAC-3 ′: refer to SEQ ID NO: 61) and a primer paaA-SpeR (5′-CGGACTAGTCACCTGGCCGCCGGTCCCGTTG-3 ′: refer to SEQ ID NO: 62) with a SpeI site added to the 5 ′ end. Next, PCR reaction was performed using these two types of primers (paaA-NdeF and paaA-SpeR) and the NBRC12743 strain chromosomal DNA obtained in (1) above as a template. The PCR reaction was repeated 30 times using KOD plus (Toyobo) and a PCR amplification apparatus (Biometra T Gradient), in which two steps of denaturation were performed at 98 ° C. for 20 seconds and annealing and extension at 68 ° C. for 2 minutes.

  As a result, a DNA fragment containing paaA and having a size of about 1.3 kbp (hereinafter referred to as DNA fragment-T1) was amplified. From this PCR amplification reaction solution, DNA fragment-T1 was recovered by Wizard SV Gel and PCR Clean-Up System (Promega).

(7) Construction of plasmid pSC-paaA
pT7NS-CamAB (see WO03 / 087381) is digested with restriction enzymes NdeI and SpeI in H buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 1 mM dithiothreitol, 100 mM NaCl) Obtained. Similarly, the DNA fragment-T1 obtained in (6) above was digested with restriction enzymes NdeI and SpeI, and the resulting DNA fragment-T1 digest and plasmid digested product were combined with DNA Ligation Kit ver. 2 (Takara Bio Inc. ). As a result, a plasmid (referred to as plasmid pSC-paaA) having a size of about 9.3 kbp was constructed by ligating DNA fragment-T1 containing paaA and plasmid pT7NS-CamAB.

(8) Preparation of E. coli transformed strain BL21 (DE3) / pSC-paaA E. coli BL21 (DE3) competent cell (Novagen) was transformed with the plasmid pSC-paaA prepared in the previous section (7). Thus, Escherichia coli BL21 (DE3) / pSC-paaA strain transformed with the plasmid pSC-paaA was obtained.

Example 7: Determination of nucleotide sequences of P450 gene pabA and ferredoxin gene pabB derived from Pseudonocardia autotrophica NBRC12743 strain Using the NBRC12743 strain chromosomal DNA obtained in Example 6 (1) as a template, the following two types of primers ( Using E1F-105 (see SEQ ID NO: 51) and H2R-105 (see SEQ ID NO: 35)), a PCR reaction was carried out in the same manner as in Example 2 to amplify the partial sequence of the target gene and determine its base sequence.
E1F-105: 5'- CACCAGTGCCTGGGGCAGAA-3 '
H2R-105: 5'-GTCGTCCTGGTCGAA-3 '

Furthermore, the following primers (43N-1F (see SEQ ID NO: 63) and 43N-1R (see SEQ ID NO: 64)) were prepared based on the obtained partial sequence information of the target gene.
43N-1F: 5'- ACCAGCTTCCGGTGACCTGGTGATGAAGAT-3 '
43N-1R: 5'- CAGGGTGTCGAACACGATCTGCAGCTCCAT-3 '

Using these primers, the same operation as in Example 2 was carried out, and the SEQ ID NO: containing P450 gene pabA (base 1 to base 1197 of SEQ ID NO: 7) and ferredoxin gene pabB (base 1200 to base 1385 of SEQ ID NO: 7) The 1388 bp DNA fragment shown in 7 was obtained and its sequence information was obtained. The amino acid sequences of proteins pabA and pabB are set forth in SEQ ID NOs: 20 and 21, respectively. Furthermore, referring to the nucleotide sequence of SEQ ID NO: 7, primer pabAB-NdeF (see SEQ ID NO: 65) with an NdeI site added to the 5 ′ end and primer pabAB-SpeR (see SEQ ID NO: 66) with a SpeI site added to the 5 ′ end Designed and created.
pabAB-NdeF: 5'- CCCCATATGACGACCGTCGACGAGTT-3 '
pabAB-SpeR: 5'- CCCACTAGTCAGTCGCAGGACAGGGCCT-3 '

  Using these primers, the same operation as in Example 2 was performed to prepare plasmid pSC-pabAB incorporating pabA and pabB from the DNA fragment of SEQ ID NO: 7, and using this plasmid, E. coli BL21 (DE3) competent cell ( Novagen) was transformed to obtain transformed E. coli strain BL21 (DE3) / pSC-pabAB.

Example 8: Determination of the base sequence of the P450 gene sraA derived from Streptomyces reseobialaceus NBRC13081 Strain Streptomyces reseobialaceus NBRC13081 strain Using the chromosomal DNA as a template, the following two primers (5Dm-3F ( Using SEQ ID NO: 28) and 5D-1R (see SEQ ID NO: 67)), the same procedure as in Example 2 was performed to amplify a partial sequence of the target gene and determine its base sequence.
5Dm-3F: 5'-TTCGCSCTSCCSGTCCCSTCSATGGTSAT-3 '
5D-1R: 5'-GGTGCCCAGCGAGATCATGAA-3 '

Furthermore, the following primers (6412-1F (see SEQ ID NO: 68) and 6412-2R (see SEQ ID NO: 69)) were prepared based on the obtained partial sequence information of the target gene.
6412-1F: 5'-GCCAGCACCGGGGTCCTGCTGCTGA-3 '
6412-2R: 5'-CTGGAAGCGGTCGCGGTCCTCGTA-3 '

Using these primers, the same operation as in Example 2 was performed to obtain the 1218 bp DNA fragment shown in SEQ ID NO: 8 containing the P450 gene sraA (base 1 to base 1215 of SEQ ID NO: 8), and its sequence information Got. The amino acid sequence of protein sraA is described in SEQ ID NO: 22, respectively. Furthermore, with reference to the nucleotide sequence of SEQ ID NO: 8, primer sraA-NdeF (see SEQ ID NO: 70) with an NdeI site added to the 5 ′ end and primer sraA-SpeR (see SEQ ID NO: 71) with an SpeI site added to the 5 ′ end Designed and created.
sraA-NdeF: 5'-CCCCATATGACCACCACACCCACCGCCCA-3 '
sraA-SpeR: 5'-GGGACTAGTCACCAGGTCACGGGCAGCGA-3 '

  Using these primers, the same operation as in Example 2 was performed to prepare plasmid pSC-sraA incorporating sraA from the DNA fragment of SEQ ID NO: 8, and using this plasmid, E. coli BL21 (DE3) competent cell (Novagen) ), And transformed E. coli BL21 (DE3) / pSC-sraA strain was obtained.

Example 9: Determination of the base sequence of the P450 gene scaA derived from Streptomyces citreofluorescens NBRC12853 strain Using the chromosomal DNA of Streptomyces citreofluorescens NBRC12853 strain as a template, the following two primers (K2F-107 ( (See SEQ ID NO: 72) and N1R-107 (see SEQ ID NO: 40)). The same procedure as in Example 2 was performed to amplify a partial sequence of the target gene and determine its base sequence.
K2F-107: 5'-CACACCCGGCTGCGCAAGCTGGT-3 '
N1R-107: 5'-AGCCGGGCCAGCGGGGCGCCCAGGCA-3 '

Furthermore, the following primers (21188-1F (see SEQ ID NO: 73) and 21188-1R (see SEQ ID NO: 74)) were prepared based on the obtained partial sequence information of the target gene.
21188-1F: 5'-CCAGCACGTTGCCTTCGGGCACGGCAT-3 '
21188-1R: 5'-CACCTCGTCGAGCAGCGCATCGGTGAT-3 '

Using these primers, the same operation as in Example 2 was performed to obtain the 1230 bp DNA fragment shown in SEQ ID NO: 9 containing the P450 gene scaA (base 1 to base 1227 of SEQ ID NO: 9), and its sequence information Got. The amino acid sequence of the protein scaA is described in SEQ ID NO: 23, respectively. Furthermore, with reference to the nucleotide sequence of SEQ ID NO: 9, primer scaA-NdeF (see SEQ ID NO: 75) with an NdeI site added to the 5 ′ end and primer scaA-SpeR (see SEQ ID NO: 76) with a SpeI site added to the 5 ′ end Designed and created.
scaA-NdeF: 5'-CCCCATATGAGCGACCTTGTGACGTT-3 '
scaA-SpeR: 5'-CCGACTAGTCAGCGTCCCCGGCCGCCGGGGGT-3 '

  Using these primers, the same operation as in Example 2 was carried out to prepare plasmid pSC-scaA incorporating scaA from the DNA fragment of SEQ ID NO: 9, and this was used to prepare Escherichia coli BL21 (DE3) competent cell (Novagen). ), And transformed E. coli BL21 (DE3) / pSC-scaA strain was obtained.

Example 10: Determination of the base sequences of P450 gene pazA and ferredoxin gene pazB derived from Pseudonocardia autotrophica ATCC35204 strain Pseudonocardia autotropica ATCC35204 strain chromosomal DNA was used as a template, and the following two types of primers (K1F- 107 (see SEQ ID NO: 77) and N1R-107 (see SEQ ID NO: 40)) were performed in the same manner as in Example 2 to amplify the partial sequence of the target gene and determine its base sequence.
K1F-107: 5'-GACCCGCCGGAGCACACCCGGCT-3 '
N1R-107: 5'-AGCCGGGCCAGCGGGGCGCCCAGGCA-3 '

Furthermore, the following primers (62182-1F (see SEQ ID NO: 78) and 62182-1R (see SEQ ID NO: 79)) were prepared based on the partial sequence information of the target gene obtained.
62182-1F: 5'-TTCGACGCGCCCGAAGAGGTGAAGTT-3 '
62182-1R: 5'-TCGACGCGCCGTACGGTGAAGCCGTT-3 '

Using these primers, the same operation as in Example 2 was carried out, and the sequence number containing P450 gene pazA (base 1 to base 1185 of SEQ ID NO: 10) and ferredoxin gene pazB (base 1198 to base 1410 of SEQ ID NO: 10) The 1413 bp DNA fragment shown in 10 was obtained and its sequence information was obtained. The amino acid sequences of proteins pazA and pazB are set forth in SEQ ID NOs: 24 and 25, respectively. Furthermore, referring to the nucleotide sequence of SEQ ID NO: 10, primer pazAB-NdeF (see SEQ ID NO: 80) with an NdeI site added to the 5 ′ end and primer pazAB-SpeR (see SEQ ID NO: 81) with a SpeI site added to the 5 ′ end Designed and created.
pazAB-NdeF: 5'- CCCCATATGACCACCACGTCCGAACCCGT-3 '
pazAB-SpeR: 5'- CCCACTAGTCAGCTCCGGGGGCCGATCA-3 '

  Using these primers, the same operation as in Example 2 was performed to prepare plasmid pSC-pazAB incorporating pazA and pazB from the DNA fragment of SEQ ID NO: 10, and using this plasmid, E. coli BL21 (DE3) competent cell ( Novagen) was transformed to obtain transformed E. coli BL21 (DE3) / pSC-pazAB strain.

Example 11: Determination of nucleotide sequences of P450 gene sxaA and ferredoxin gene sxaB derived from Streptomyces chrysomarius HUT6141 strain Using the chromosomal DNA of Streptomyces chrysomarius HUT6141 strain as a template, the following two types of primers (5Dm-3F ( Using SEQ ID NO: 28) and H1R-105 (see SEQ ID NO: 52)), the partial sequence of the target gene was amplified and its base sequence was determined.
5Dm-3F: 5'-TTCGCSCTSCCSGTCCCSTCSATGGTSAT-3 '
H1R-105: 5'-GTCGAAGACGTCGGGCGCGGTCA-3 '

Furthermore, the following primers (kin29-F (see SEQ ID NO: 82) and kin29-R (see SEQ ID NO: 83)) were prepared based on the obtained partial sequence information of the target gene.
Kin29-F: 5'-AGCGGCATGGGCATCGAGGTCGACAAGGAA-3 '
Kin29-R: 5'-GCAGCCCTCGAAGAACTCGTGGTCGGCGTA-3 '

Using these primers, the same operation as in Example 2 was carried out, and the P450 gene sxaA (base 1 to base 1248 of SEQ ID NO: 11) and the ferredoxin gene sxaB (base 1245 to base 1451 of SEQ ID NO: 11) were included. The 1454 bp DNA fragment shown in 11 was obtained, and its sequence information was obtained. The amino acid sequences of the proteins sxaA and sxaB are set forth in SEQ ID NOs: 26 and 27, respectively. Furthermore, with reference to the nucleotide sequence of SEQ ID NO: 11, primer sxaAB-NdeF (see SEQ ID NO: 84) with an NdeI site added to the 5 ′ end and primer sxaAB-SpeR (see SEQ ID NO: 85) with a SpeI site added to the 5 ′ end Designed and created.
sxaAB-NdeF: 5'-CCCCATATGACGGAATCCACGACGGACCCGGCCCGCCAGG-3 '
sxaAB-SpeR: 5'-CCCACTAGTCAGTCGGAGGAGAGGACCACCGCCCCG-3 '

  Using these primers, the same operation as in Example 2 was performed to prepare plasmid pSC-sxaAB incorporating sxaA and sxaB from the DNA fragment of SEQ ID NO: 11, and using this plasmid, E. coli BL21 (DE3) competent cell ( Novagen) was transformed to obtain transformed E. coli strain BL21 (DE3) / pSC-sxaAB.

Example 12: Determination of the base sequence of the P450 gene sfaA derived from Streptomyces facikratus NBRC12765 strain Using the chromosomal DNA of Streptomyces facikratus NBRC12765 as a template, the following two primers (5Dm-3F (see SEQ ID NO: 28)) G1R-105 (see SEQ ID NO: 46)) was used to amplify a partial sequence of the target gene and determine its base sequence.
5Dm-3F: 5'-TTCGCSCTSCCSGTCCCSTCSATGGTSAT-3 '
G1R-105: 5'-TCACCAGGTGACCGGCAG-3 '

Furthermore, the following primers (489B-1F (see SEQ ID NO: 88) and 489B-1R (see SEQ ID NO: 89)) were prepared based on the obtained partial sequence information of the target gene.
489B-1F: 5'-gtgagactccgaaccgacatgaacatctac-3 '
489B-1R: 5'-cccggtcctcgtaggggacgccgagcagtt -3 '

Using these primers, the same operation as in Example 2 was performed to obtain a 1245 bp DNA fragment shown in SEQ ID NO: 16 containing the P450 gene sfaA (base 1 to base 1242 of SEQ ID NO: 86), and its sequence information Got. The amino acid sequence of protein sfaA is shown in SEQ ID NO: 87, respectively. Furthermore, referring to the nucleotide sequence of SEQ ID NO: 86, a primer sfaA-NdeF (see SEQ ID NO: 90) with an NdeI site added to the 5 'end and a primer sfaA-SpeR (see SEQ ID NO: 91) with a SpeI site added to the 5' end Designed and created.
sfaA-NdeF: 5'- agggcatatgagtcagacgaatcagatgaa-3 '
sfaA-SpeR: 5'-ccactagtctactgggccgtttgcgtcca-3 '

  Using these primers, the same operation as in Example 2 was performed to prepare plasmid pSC-sfaA incorporating sfaA from the DNA fragment of SEQ ID NO: 86, and using this plasmid, E. coli BL21 (DE3) competent cell (Novagen) ) Was transformed, and transformed E. coli BL21 (DE3) / pSC-sfaA strain was obtained.

Reference Example 1: Preparation of a transformant having the P450 gene P450SU-1 derived from Streptomyces griseolus ATCC11796 strain
Based on the information in J. Bacteriol. 172 (6), 3335-3345 (1990), the cytochrome P450 gene P450SU-1 (CYP105A1) derived from the actinomycete Streptomyces griseolus ATCC 11796 was incorporated into the plasmid pT7NS-CamAB. The cloned and transformed E. coli BL21 (DE3) / pSC-SU-1 strain was obtained.

Example 13: P450 gene conversion into vitamin D ₃ of 25-hydroxyvitamin D ₃ by E. coli transformants with and 25-hydroxyvitamin D ₃ of l [alpha], 25-converts the examples and reference to the dihydroxyvitamin D ₃ Transformed Escherichia coli BL21 (DE3) / pSC-dvaA strain, BL21 (DE3) / pSC-dvbAB strain, BL21 (DE3) / pSC-dvcA strain, BL21 (DE3) / pSC-ncaA strain, BL21 (DE3) ) / pSC-ncbAB, BL21 (DE3) / pSC-paaA, BL21 (DE3) / pSC-pabAB, BL21 (DE3) / pSC-sraA, BL21 (DE3) / pSC-scaA, BL21 (DE3 ) / pSC-pazAB, BL21 (DE3) / pSC-sxaAB, BL21 (DE3) / pSC-sfaA, BL21 (DE3) / pSC-SU-1 and BL21 (DE3) / pT7NS-CamAB M9mix medium (3.39% Na ₂ HPO ₄ , 1.5% KH ₂ PO, 0.25% NaCl, 0.5% NH ₄ Cl, 1% casamino acid, 0.002% containing carbenicillin 50 μg / mL and Overnight Express Autoinduction System (Novagen) _{thymine, 0.1mM CaCl 2, 0.1mM FeSO 4} ) was inoculated into flasks containing the a 250mL of 25mL shake for 24 hours at 25 ° C. Cormorants were cultured. Dispense 5 mL of this culture into a 15 mL test tube, and then centrifuge at 3500 rpm for 10 minutes.The resulting cells are mixed with CV2 buffer (50 mM potassium phosphate buffer, 2% glycerin, 50 μg / mL carbenicillin, 0.1 mL IPTG) 1 mL and 1% vitamin D ₃ or 10 μL of 25-hydroxyvitamin D ₃ were added. The conversion reaction solution thus obtained was reacted at 28 ° C. for 24 hours. The conversion reaction solution was extracted with an equal amount of ethyl acetate and then analyzed by high performance liquid chromatography (HPLC) to determine the amount of the hydroxylated derivative. Vitamin D ₃ the measurement results when the substrate are shown in Table 1 and the 25-hydroxyvitamin D ₃ measurement results when the substrate shown in Table 2. The analysis conditions of high performance liquid chromatography (HPLC) are as shown below.

Analyzer: Agilent 1100
Column: Zorbax XDB C18 ID4.6 × 50mm 1.8μm (manufactured by Agilent)
Mobile phase: Gradient: 0 min to 1 min (water to 40% acetonitrile), 1 to 4 min (40% acetonitrile to 90% acetonitrile), 4 to 11 min (90% acetonitrile to 100% acetonitrile), 11 to 11.5 min (100% acetonitrile) -40% acetonitrile), 11.5-13 min (40% acetonitrile-water), 13 min (stop)

Flow rate: 1mL / min
Detection: PDA (265nm)
Injection capacity: 5μL
Column temperature: 50 ° C
Analysis time: 13min
Retention time: Vitamin D ₃ 7.5 minutes
25-Hydroxyvitamin D ₃ 4.6 minutes
1α, 25-Dihydroxyvitamin D ₃ 3.9 min

As expected, the BL21 (DE3) / pT7NS-CamAB strain into which the P450 gene was not introduced did not show hydroxylation activity. However, conversion to 25-hydroxy vitamin D ₃ vitamin D ₃ in the purified enzyme, or 25-hydroxyvitamin D ₃ of l [alpha], 25-dihydroxyvitamin D ₃ actinomycete Streptomyces Guriseorasu conversion has been reported to ATCC11796 In the BL21 (DE3) / pSC-SU-1 strain into which the cytochrome P450 gene P450SU-1 (CYP105A1) derived from the strain was introduced, their hydroxylation activity could not be confirmed at all.

In contrast, BL21 (DE3) / pSC-dvaA strain, BL21 (DE3) / pSC-dvbAB strain, BL21 (DE3) / pSC-dvcA strain, BL21 (DE3) / pSC-ncaA strain, BL21 (DE3) / pSC- ncbAB strain, BL21 (DE3) / pSC-paaA strain, BL21 (DE3) / pSC-pabAB strain, BL21 (DE3) / pSC-sraA strain, BL21 (DE3) / pSC-scaA strain, BL21 (DE3) / pSC- In the conversion test using the transformants of pazAB strain, BL21 (DE3) / pSC-sxaAB strain and BL21 (DE3) / pSC-sfaA strain, conversion of vitamin D ₃ to 25-hydroxyvitamin D and 25-hydroxy The activity of at least one of the conversion of vitamin D to 1α, 25-dihydroxyvitamin D was confirmed.

From this, the conversion of dvaA, dvbA, dvcA, ncaA, ncbA, paaA, pabA, sraA, scaA, pazA, cytochrome P450 encoding of each gene sxaA and sfaA are vitamin D ₃ 25-to-hydroxyvitamin D ₃ , or 25-l [alpha] hydroxy vitamin D _3, 25-understood to have at least either the superior activity of the conversion to dihydroxyvitamin D _3.

Particularly dvca, PaaA, cytochrome P450 which each gene scaA and pazA encoded has only conversion activity to the 25-hydroxyvitamin D ₃ vitamin D _3, 25-hydroxyvitamin D ₃ l [alpha], 25-dihydroxyvitamin D Since it does not have the activity of converting to ₃ , it is suitable for the production of 25-hydroxyvitamin D ₃ using vitamin D ₃ as a raw material. In contrast, dvaA, dvbA, ncaA, ncbA , pabA, sraA, cytochrome P450 encoding of each gene sxaA and sfaA are vitamin D ₃ 25-conversion activity and 25-hydroxyvitamin D ₃ to hydroxyvitamin D ₃ l [alpha], 25-because it has the activity of both the conversion activity to dihydroxyvitamin D _3, it is suitable l [alpha], for the manufacture of 25-dihydroxyvitamin D _3.

  The present invention is useful in the pharmaceutical industry related to the production of hydroxylated vitamin D derivatives.

Claims (10)

At least one selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D _{2 represented} by (a), (b) or (c) below: DNA encoding a protein having hydroxylase activity of vitamin Ds.
(a) DNA consisting of a continuous base sequence from base 1 to base 1197 of SEQ ID NO: 7.
(b) A modified version of the DNA shown in (a) above, which has 90% or more identity with the DNA shown in (a).
(c) DNA having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA shown in (a) above. A protein encoded by the DNA of claim 1. At least one selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ , which has an amino acid sequence of any one of the following (1) to (3) DNA encoding a protein having hydroxylase activity of vitamin Ds.
(1) the amino acid sequence set forth in SEQ ID NO: 20 in the Sequence Listing;
(2) an amino acid sequence having a deletion, substitution and / or addition of 1 to several amino acids in the amino acid sequence set forth in SEQ ID NO: 20 in the Sequence Listing;
(3) An amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 20 in the sequence listing. At least one selected from the group consisting of vitamin D ₃ , vitamin D ₂ , 25-hydroxyvitamin D ₃ and 25-hydroxyvitamin D ₂ , which has an amino acid sequence of any one of the following (1) to (3) A protein having hydroxylase activity of vitamin Ds.
(1) the amino acid sequence set forth in SEQ ID NO: 20 in the Sequence Listing;
(2) an amino acid sequence having a deletion, substitution and / or addition of 1 to several amino acids in the amino acid sequence set forth in SEQ ID NO: 20 in the Sequence Listing;
(3) An amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 20 in the sequence listing. A self-replicating or integrating replicating recombinant plasmid carrying the DNA according to claim 1 or 3. A transformant obtained by transforming a host with the recombinant plasmid according to claim 5. The DNA represented by the following (e), (f) or (g) and encoding a protein having a ferredoxin function [(e) a DNA comprising a continuous base sequence from base 1200 to base 1385 of SEQ ID NO: 7;
(f) a variant of the DNA shown in (e) above, which has 90% or more identity with the DNA shown in (e);
(g) DNA having a base sequence having a deletion, substitution and / or addition of one to several bases in the base sequence of the DNA shown in (e) above, or any of the following (4) to (6) A DNA encoding a protein having such an amino acid sequence and having a ferredoxin function [(4) the amino acid sequence set forth in SEQ ID NO: 21 in the Sequence Listing;
(5) an amino acid sequence having a deletion, substitution and / or addition of 1 to several amino acids in the amino acid sequence set forth in SEQ ID NO: 21 in the Sequence Listing;
(6) Amino acid sequence having 90% or more identity to the amino acid sequence set forth in SEQ ID NO: 21 in the Sequence Listing]
The autonomously replicating or integrative replicating recombinant plasmid according to claim 5, further comprising: A transformant obtained by transforming a host with the recombinant plasmid according to claim 7. The transformant according to claim 6 or 8, wherein the host is Escherichia coli containing an actinomycete-derived ferredoxin gene and a ferredoxin reductase gene in an expressible state. The transformant according to claim 6, 8 or 9 is cultured in a medium, and during or after the culture, the grown transformant and vitamin D are brought into contact with each other to be converted into a hydroxylated vitamin D derivative and thus converted. A method for producing a hydroxylated vitamin D derivative, which comprises collecting the obtained hydroxylated vitamin D derivative.