JP2013192493A - Method for producing rna microarray, and rna microarray - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing an RNA microarray by which the RNA microarray can be produced rapidly and efficiently, and to provide the RNA microarray produced by the production method.SOLUTION: The method for producing an RNA microarray includes: a step for preparing first beads on which DNAs are immobilized; a step for preparing second beads on which nucleic acid linkers containing a sequence capable of hybridizing with an RNA obtained by transcripting the DNA are immobilized; a step for preparing a plurality of reaction vessels arranged in a substrate for arranging the beads; a step, after carrying out these steps, for arranging the second beads in the reaction vessels after arranging the first beads in the reaction vessels; and after the step (d1), a step for transcripting the DNA immobilized on the first beads by using a transcription system, and hybridizing the synthesized RNA with the nucleic acid linker immobilized on the second beads.

Description

  The present invention relates to a method for producing an RNA microarray, and an RNA microarray produced using the method.

  In recent years, functional RNAs such as ribozymes and RNA aptamers have been discovered, and RNA has attracted attention not only as a medium for expressing genetic information from DNA to protein but also as a molecule that can have a more active function.

Ribozymes are RNA molecules that have enzymatic activity and cleave or inactivate target RNAs. Examples of the target RNA include RNA derived from pathogenic viruses, RNA derived from oncogenes, RNA involved in cell growth / differentiation, and the like. Ribozymes targeting such RNA are expected as drug candidates.
As a method for searching for useful ribozymes, a method using an array in which ribozymes are immobilized on a solid support is proposed (for example, see Patent Document 1).

Since RNA aptamers have properties similar to those of antibodies, research and development of aptamers targeting substances that cause various diseases have been conducted, and they are expected as drug candidate substances, as with ribozymes.
As a method for searching for useful RNA aptamers, an in vitro artificial evolution method (SELEX) in which RNA molecules having high affinity with a target substance from a random RNA pool are concentrated is known. . A method for improving the SELEX method and efficiently obtaining RNA molecules that promote or inhibit the function of a target substance has been proposed (see, for example, Patent Document 2).

Special table 2003-503068 gazette Special table 2011-500076 gazette Japanese Patent No. 4318721

  The search for such useful functional RNA is extremely important in drug development, and a method capable of searching more rapidly and efficiently is demanded.

On the other hand, in obtaining a new functional protein, an evolutionary molecular engineering technique that repeats random molecular structure modification and wrinkling of the protein is expected.
The cDNA display method, which is one of the evolutionary molecular engineering methods, is a method of genotype-phenotype association. The nucleic acid linker is a protein (phenotype), mRNA encoding the same, reverse-transcribed cDNA. (Genotype). Since the mRNA / cDNA-protein conjugate structure is very stable, it is possible to perform screening under various environments by using the nucleic acid linker (see, for example, Patent Document 3).

  In the search for functional RNA, the present inventors have revealed that functional RNA can be searched for more rapidly and efficiently by applying the cDNA display method.

  The present invention has been made in view of the above circumstances, and an object of the present invention is to provide an RNA microarray production method capable of producing an RNA microarray quickly and efficiently, and an RNA microarray produced by the production method. To do.

As a result of intensive studies to solve the above problems, the present inventors have found that the problems can be solved by using two types of beads having different sizes for immobilizing nucleic acids. One embodiment of the present invention provides the following (1) to (5).
(1) The method for producing an RNA microarray according to one embodiment of the present invention is a method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is disposed,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C1) preparing the inside of a plurality of reaction vessels arranged on the substrate for arranging beads,
(D1) After the steps (a), (b), and (c1), after placing the first beads in the reaction vessel, placing the second beads in the reaction vessel; ,
(E1) After the step (d1), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Having a step of hybridizing;
The first bead is larger than the second bead;
The diameter or one side of the bottom surface of the reaction vessel is 1 to 2 times the diameter of the first bead.
(2) The method for producing an RNA microarray in one embodiment of the present invention is a method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is arranged,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C2) A step of preparing a plurality of reaction vessels arranged in a plurality of reaction vessels arranged on a bead arrangement substrate, which are divided by a partition having a communication hole and are composed of two kinds of micro reaction vessels having different bottom diameters or sides. When,
(D2) After the steps (a), (b), and (c2), after placing the large beads in the large micro reaction vessel among the first beads and the second beads, Placing in a small microreactor;
(E2) After the step (d2), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Hybridizing, and
The diameter or one side of the bottom of the large microreactor is 1-2 times the diameter of the large beads,
The diameter or one side of the bottom surface of the small micro reaction tank is 1 to 2 times the diameter of the small beads.
(3) The method for producing an RNA microarray according to an embodiment of the present invention is such that, in the step (a), an oil is contained so that an average of 1 molecule or less of DNA and an average of 1 or less of first beads are included per emulsion. Preparing a water-in-water emulsion;
It is preferable to perform a nucleic acid amplification reaction in the emulsion and immobilize the DNA to which the solid-phase binding site is added to the beads.
(4) In the method for producing an RNA microarray in one embodiment of the present invention, the first bead and the second bead are magnetic beads, and the bead arranging substrate is a magnetic bead arranging substrate. The steps (d1) and (d2) preferably include a step of arranging a magnet below the magnetic bead arranging substrate and guiding the magnetic beads to the reaction vessel.
(5) The RNA microarray in one embodiment of the present invention is manufactured using the method for manufacturing an RNA microarray.

  According to the present invention, an RNA microarray can be obtained quickly and efficiently.

It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is the figure which showed the one aspect | mode of the nucleic acid linker used for this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is a schematic diagram of the manufacturing method of the RNA microarray in this embodiment. It is the result of the electrophoresis in an Example. In an Example, it is the schematic of what bound GFP mRNA and the nucleic acid linker covalently. It is the result of the electrophoresis in an Example. It is the result of the electrophoresis in an Example. It is the result of the electrophoresis in an Example.

≪Method for producing RNA microarray≫
[First Embodiment]
The method for producing an RNA microarray of the present embodiment is a method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is arranged,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C1) preparing the inside of a plurality of reaction vessels arranged on the substrate for arranging beads,
(D1) After the steps (a), (b), and (c1), after placing the first beads in the reaction vessel, placing the second beads in the reaction vessel; ,
(E1) After the step (d1), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Having a step of hybridizing;
The first bead is larger than the second bead;
The diameter or one side of the bottom surface of the reaction vessel is 1 to 2 times the diameter of the first bead.
Hereafter, each process is demonstrated, referring FIG. 1A-FIG. 1E.

Step (a) is a step of preparing first beads 14 on which DNA 13 is immobilized (see FIG. 1A).
For immobilization, in addition to a method utilizing an avidin-biotin bond, DNA 13 is modified with a functional group such as amino group, formyl group, SH group, etc., and the solid phase is a silane having an amino group, formyl group, epoxy group, etc. A method using a surface treatment with a coupling agent can be used, and a method using an avidin-biotin bond is particularly preferable.

  In step (a), the solid phase is the first bead 14. Since the beads can later easily collect the DNA 13 and are spherical, the beads have a larger surface area than the substrate, and can be used to immobilize DNA having a higher molecular weight than when the DNA 13 is immobilized on the substrate. Are better. Furthermore, the first beads 14 are preferably magnetic beads from the viewpoint that they can be arranged in each reaction tank 12 in the bead arrangement substrate 11 described later in a short time.

The DNA 13 may be cDNA or genomic DNA, and preferably has a random mutation introduced from the viewpoint of evolutionary molecular engineering.
When a DNA microarray composed of DNA 13 into which random mutations are introduced is produced, one kind of DNA molecule is fixed to one spot on the DNA microarray using a mutant DNA library having an enormous number of molecules.
As a means for facilitating such immobilization, it is preferable to use a single molecule emulsion PCR method.
In single molecule emulsion PCR method, water is stirred in oil mixed with emulsifier to form reverse micelle colloid (water-in-oil (W / O) emulsion). This is a method that makes it possible to easily isolate single-molecule mutant DNA.
If a nucleic acid amplification reaction is carried out in an emulsion in which one molecule of DNA 13 is encapsulated, only one kind of amplified DNA 13 exists in one emulsion.

  From the viewpoint of the necessity of analyzing each mutant DNA, it is not appropriate that a plurality of mutant DNAs are mixed in one emulsion. Therefore, in this embodiment, an average of one molecule or less of DNA per emulsion is present. It is preferred to have a step of preparing a water-in-oil emulsion to be included.

  Therefore, the step (a) preferably includes a step of preparing a water-in-oil emulsion so that an average of one molecule or less of DNA 13 and an average of one or less first beads 14 are included per emulsion.

In the step (a), a water-in-oil emulsion is prepared by mixing oil and an emulsifier with an aqueous component in which a mutant DNA used as a template (hereinafter referred to as template DNA), a reagent necessary for nucleic acid amplification, and the like are prepared. It is preferable to do. Thereby, a plurality of template DNAs are partitioned by a plurality of emulsions (reverse micelles). That is, a plurality of emulsions (reverse micelles) enclosing the template DNA are obtained.
For the preparation of the emulsion, stirring treatment (use of magnetic stirrer, propeller type, etc.), homogenization (use of homogenizer, mortar, etc.), ultrasonic treatment (use of sonicator, etc.) can be used.
The size of the emulsion is not particularly limited, but the volume of one emulsion can be calculated based on the average particle size of the emulsion. The average particle size of the emulsion is preferably 1 μm to 100 μm, more preferably 5 μm to 50 μm, and particularly preferably 10 μm to 30 μm.
The number of emulsion particles is calculated by dividing the volume of one emulsion from the volume of the aqueous component. Therefore, in order to prepare a water-in-oil emulsion so that an average of one molecule or less of DNA per emulsion is contained, DNA having a number of molecules equal to or less than the number of emulsions in the whole may be prepared.

As the emulsion, those having excellent thermal stability are preferred. If an emulsion having excellent thermal stability is used, the emulsion can be maintained during a nucleic acid amplification reaction involving high-temperature treatment such as PCR. Therefore, contamination can be prevented from occurring between each micelle, and nucleic acid amplification is performed efficiently. Thus, if the conditions are set so that one molecule of template DNA is contained in each micelle, it is possible to obtain a large number of nucleic acid molecules derived from one template molecule in each micelle.
Therefore, a DNA microarray with a high density can be produced by performing a nucleic acid amplification reaction using an emulsion. Furthermore, RNA microarrays manufactured using such DNA microarrays can also have a high density in which multimolecular RNA is immobilized at each spot, and the detection sensitivity when selecting RNA having a specific activity is high. improves.
Examples of the emulsifier used in the emulsion include ABIL (registered trademark) WE09, ABIL (registered trademark) WS08, ABIL (registered trademark) EM90 manufactured by Goldschmidt.

In the step (a), it is preferable to prepare such that an average of one or less first beads 14 are contained in the water-in-oil emulsion.
The number of emulsions is calculated by the above calculation, and the number of first beads 14 equal to or less than the total number of emulsions may be prepared. When the number of the first beads 14 included in each emulsion is 2 or more, the number of molecules of the DNA 13 immobilized per one first bead 14 after the nucleic acid amplification reaction is decreased. This is not appropriate from the viewpoint of producing a high-density DNA microarray. In addition, since there is a high probability that there are a plurality of beads having the same type of DNA immobilized thereon, it is not appropriate from the viewpoint of screening efficiency.

  As described above, when the first beads 14 are used as the solid phase carrier of the DNA 13, it is possible to fix the DNA 13 having a larger number of molecules than when the DNA 13 is directly fixed on the substrate.

In the step (a), it is preferable to prepare a mutant DNA having an enormous number of molecules. Therefore, the template DNA is preferably a DNA derived from a mutant DNA library.
As a mutant DNA library, a library using Error-prone PCR (error-prone PCR), a library using Gene assembly mutation, a library using Random insertion and deletion mutation, a library using DNA shuffling, Library using Family shuffling, Library using Staged Extension Process in vitro recombination, ITCHY Hybrid protein libraries, SCRATCHY Hybrid Proteins Library endent Protein Recombination library and the like using, and the like.

The error-prone PCR method is a method for artificially generating random errors during a PCR reaction. In the error-prone PCR method, Taq DNA polymerase having no proofreading function is preferably used. It utilizes the inherent properties of the Taq DNA polymerase, which is an error-prone. Furthermore, it is more preferable to add Mn ²⁺ to the reaction solution or to make the dNTP concentration unbalanced so that one mutation occurs at a useful frequency, and this treatment causes an error in Taq DNA polymerase. Incidence increases.

  As the nucleic acid amplification reaction of the template DNA in the emulsion in the step (a), PCR (Polymerase Chain Reaction), LAMP (Loop-Mediated Isometric Amplification), NASBA (Nucleic Acid Amplification Basic) -Initiated Amplification of Nucleic Acids), TRC (Transplication Reverse-Transcribion Concerned), SDA (Strand Displacement Amplification), TMA (Trans ription Mediated Amplification), SMAP (SMart Amplification Process), RPA (Recombines polymerase amplification), etc. HDA (Helicase-dependent amplification) and the like, it is preferable to utilize an amplification reaction by the PCR method.

  As the reagent used for the nucleic acid amplification reaction of the template DNA in the emulsion, it is preferable to use an appropriate reagent for nucleic acid amplification reaction in accordance with the employed nucleic acid amplification reaction. For example, when PCR is employed as the nucleic acid amplification reaction, reagents necessary for each reaction constituting the PCR, that is, dNTP and DNA polymerase are used. As the DNA polymerase, it is preferable to use a thermostable DNA polymerase such as Taq DNA polymerase, Tth DNA polymerase, Vent DNA polymerase or the like. DNA polymerase having a hot start function or proofreading (proofreading) to prevent elongation before starting the test. It is more preferable to use a DNA polymerase having a function. These reagents are commercially available and are readily available.

  An aqueous component containing a template DNA and a reagent necessary for nucleic acid amplification is prepared as a solution suitable for the nucleic acid amplification reaction. For example, the solution is adjusted to a pH of about 7.0 to pH 9.0 using a buffer such as Tris-hydrochloric acid so that the PCR reaction proceeds well.

In addition, the step (a) preferably includes a step of performing a nucleic acid amplification reaction in the emulsion and immobilizing the DNA to which the solid phase binding site has been added to the beads.
In this embodiment, it is preferable to use a pair of primer sets (hereinafter referred to as “first primer and second primer” for convenience) that can amplify a specific region of the template DNA by PCR reaction. In this embodiment, if one primer (second primer) is solid-phased, an amplification product can be obtained in a state of being bound to the solid-phase carrier (first bead 14) via the second primer.

  As described above, as the binding between the second primer and the first bead 14, in addition to the method using an avidin-biotin bond, the second primer may be functionalized such as an amino group, an aldehyde group, or an SH group. Can be used such as a method in which a solid phase is surface-treated with a silane coupling agent having an amino group, an aldehyde group, an epoxy group, etc., and in particular, a method using an avidin-biotin bond Is preferred.

  After performing the emulsion PCR, it is preferable to break the emulsion in order to remove the DNA-immobilized beads. Breaking the emulsion is possible by any means known in the art, for example by adding a surfactant such as Triton X100 or Nonidet P40.

Step (b) is a step of preparing a second bead 24 on which a nucleic acid linker 2 including a sequence 50 capable of hybridizing with RNA 23 obtained by transcription of DNA 13 is immobilized (see FIGS. 1B and 2).
Hereinafter, the structure of the nucleic acid linker 2 used in this embodiment will be described with reference to FIG.
As will be described later, the nucleic acid linker has only to have a structure including a sequence capable of hybridizing with RNA obtained by transferring the DNA and a group used for immobilization to beads, and the structure shown in FIG. It is not limited to.

(Nucleic acid linker)
The nucleic acid linker 2 used in step (b) is a linker for capturing RNA23.

  The nucleic acid linker 2 has a sequence 50 (hereinafter, sequence 50) capable of hybridizing with a sequence on the 3 'end side of RNA 23 to be screened in the 3' side region.

  The sequence 50 may be DNA or a nucleic acid derivative such as PNA (polynucleopeptide), and is preferably a modified DNA imparted with nuclease resistance. As the modified DNA, any modified DNA known in the art, such as DNA having an internucleoside bond such as phosphorothioate, DNA having a sugar modification such as 2′-fluoro, 2′-O-alkyl, etc. may be used. .

  When RNA to be screened needs to be reverse transcribed as described later, it is preferable to use the 3 'end of the sequence 50 as a primer.

  The 3 'end of the sequence 50 may be labeled with a labeling substance. However, the label of the sequence 50 is limited to the case where the RNA to be screened does not need to be reverse transcribed. The labeling substance is appropriately selected from fluorescent dyes, radioactive substances, and the like. By such modification, the RNA23-nucleic acid linker 2 complex can be easily detected.

The nucleic acid linker 2 used in this embodiment includes cleavage sites 2c1 and 2c2. Examples of the cleavage sites 2c1 and 2c2 include a photocleavable site or a single-stranded nucleic acid cleaving enzyme cleavage site.
Useful RNA 23 (or cDNA 43) can be recovered by the cleavage sites 2c1 and 2c2.
The photocleavable site refers to a group having a property of being cleaved when irradiated with light such as ultraviolet rays. For example, PC Linker Phosphoramidite (Glen research), a nucleic acid containing fullerene is used. And a composition for photocleavage (composition for photocleavage of nucleic acid: JP-A 2005-245223).
As the photocleavable site, any group that is commercially available or known in the art may be used. The single-stranded nucleic acid cleaving enzyme cleavage site refers to a nucleic acid group that can be cleaved by a single-stranded nucleic acid cleaving enzyme such as deoxyribonuclease and ribonuclease, and includes nucleotides and derivatives thereof.

In the present embodiment, the nucleic acid linker 2 has a solid phase binding site 2b for fixing to the second bead 24. The second bead 24 has a solid-phase binding site recognition site 24 a for binding to the nucleic acid linker 2.
In the immobilization of the nucleic acid linker 2, as in the case of immobilizing the DNA 13 in the step (a) to the first bead 14, in addition to a method using an avidin-biotin bond, the nucleic acid linker 2 may be an amino group, a formyl group. , SH groups, and the like, and a method in which the second beads 24 are surface-treated with a silane coupling agent having an amino group, a formyl group, an epoxy group, or the like can be used. A method using an avidin-biotin bond is preferred.
The second beads 24 are preferably magnetic beads from the viewpoint that they can be arranged in a reaction tank 12 in a bead arrangement substrate 11 described later in a short time.
Thus, in the step (b), the second bead 24 on which the nucleic acid linker 2 is immobilized is prepared (see FIG. 1B).

Step (c1) is a step of preparing a plurality of reaction vessels 12 arranged on the bead arrangement substrate 11 (see FIG. 1C).
The surface of the substrate 11 for arranging beads and the inner wall of the reaction vessel 12 are preferably coated with a blocking agent for preventing nonspecific adsorption of biomolecules such as DNA, for example, polyethylene glycol (PEG) or 2-methacryloyloxyethyl phosphorylcholine (MPC). Can do. By coating such a blocking agent, nonspecific adsorption of biomolecules to the surface of the bead-arranging substrate 11 and the inner wall of the reaction vessel 12 can be suppressed.

  The substrate material used for the substrate 11 for arranging beads is preferably a transparent glass or polymer material, and more preferably an elastomer material such as polydimethylsiloxane for the purpose of suppressing leakage. When an elastomer material is used as the substrate material used for the bead arranging substrate 11, the beads of the entire reaction vessel 12 generated when particles such as fine dust are sandwiched between the reaction vessel 12 and the bead arranging substrate 11. There is an advantage that an adverse effect on adhesion to the placement substrate 11 is avoided by local deformation of the elastomer.

In the present embodiment, when magnetic beads are used as the first beads 14 and the second beads 24, it is preferable that a magnetic plate is disposed under the substrate material used for the substrate 11 for arranging beads. .
By using the bead arrangement substrate 11 having such a structure, the first beads 14 and the second beads 24 can be easily and reliably arranged in the reaction tank 12.

In the step (d1), after the steps (a), (b), and (c1), the first beads 14 are arranged in the reaction vessel 12, and then the second beads 24 are arranged in the reaction vessel 12. (Refer to FIG. 1D).
In this embodiment, the first bead 14 is larger than the second bead 24, the bottom surface of the reaction vessel 12 is a square or a circle, and the diameter or one side of the bottom surface is 1 of the diameter of the first bead. ~ 2 times. Therefore, one first bead 14 is arranged in the reaction tank 12 by arranging the first bead 14 in the reaction tank 12 first.
Thereby, one kind of DNA-derived RNA is immobilized on the second bead 24 in the step (e1) described later.

As described above, the first beads 14 and the second beads 24 are preferably magnetic beads, and the bead placement substrate 11 is preferably a magnetic bead placement substrate. In such a case, it is preferable that the step (d1) includes a step of arranging a magnet below the magnetic bead arranging substrate and guiding the magnetic beads to the reaction vessel 12.
Specifically, first, a magnet is arranged below the bead arrangement substrate 11 (magnetic bead arrangement substrate), and the DNA 13 is immobilized on the bead arrangement substrate 11 (magnetic bead arrangement substrate). A dispersion liquid in which beads 14 (magnetic beads) are dispersed is dropped. The first beads 14 (magnetic beads) and the magnetic thin film act to attract the first beads 14 (magnetic beads) into the reaction vessel 12 due to the magnetic force of the first thin film 14 (magnetic beads) and the magnetic thin film. Furthermore, the first beads 14 (magnetic beads) are dispersed by appropriately moving the magnet in the direction parallel to the substrate, and the filling rate into the reaction vessel 12 is improved.
Next, after placing the first beads 14 with the DNA 13 immobilized in the reaction vessel 12, the second beads 24 with the nucleic acid linker 2 immobilized thereon are arranged.
A specific arrangement method is the same as the arrangement method of the first beads 14. The reaction vessel 12 is already filled with one first bead 14, and the remaining space in the reaction vessel 12 is filled with at least one second bead 24. By placing a large bead (first bead 14) in the reaction vessel 12 first and then placing a small bead (second bead 24), one reaction vessel 12 has one first bead. 14 and at least one second bead 24 are respectively arranged.

In order to obtain a desired effect, the strength of the magnetic field applied to the bead-arranging substrate by the magnet is preferably 100 to 10,000 gauss.
Further, since the magnetization of the magnetic plate remains even after the magnet is removed, the magnetic beads can continue to maintain a stable arrangement.

  As such a magnetic material, metals such as nickel, nickel alloy, iron and iron alloy can be suitably used. In the present embodiment, it is preferable to use a magnetic material having a large residual magnetization.

  The reaction vessel 12 is preferably hydrophilized, and the reaction vessel 12 is hydrophilized by oxygen plasma irradiation or the like, thereby facilitating filling of the reaction vessel 12 with dispersed magnetic beads, The filling rate is improved.

In step (e1), after the step (d1), the DNA 13 immobilized on the first bead 14 is transferred using a transcription system, and the synthesized RNA 23 is immobilized on the second bead 24. This is a step of hybridizing to the nucleic acid linker 2 (see FIG. 1E).
Conventionally, as a transfer of RNA between beads, RNA synthesized by transferring DNA immobilized on the first bead is used as a second bead on which a nucleic acid linker is immobilized using a pipette or the like. There was no choice but to transfer to the filled reaction tank, and there were problems in terms of speed of operation and RNA transfer efficiency.
In the present embodiment, since the DNA 13 immobilized on the first bead 14 and the nucleic acid linker 2 immobilized on the second bead 24 are arranged in the same reaction tank 12, the transcription system is In use, RNA 13 is transcribed by transcription of DNA 13, and at the same time, synthesized RNA 23 diffuses between beads (from first bead 14 to second bead 24) and hybridizes to nucleic acid linker 2. Therefore, according to this embodiment, the RNA23-nucleic acid linker 2 complex is formed on the second bead 24 quickly and efficiently.

Examples of the transcription system in the step (e1) include conventionally known transcription systems that are transcribed with RNA polymerase. Examples of the RNA polymerase include T7 RNA polymerase.
RNA23 is not limited to mRNA, For example, tRNA, rRNA, miRNA, siRNA etc. may be sufficient.

Alternatively, cDNA 43 may be synthesized by reverse transcription from the RNA23-nucleic acid linker 2 complex immobilized on the second bead 24 (see FIG. 2). As the reverse transcriptase used for reverse transcription, conventionally known ones are used, and examples include reverse transcriptase derived from Moloney Murine Leukemia Virus.
The reverse transcribed DNA forms a hybrid with the RNA of the RNA23-nucleic acid linker 2 complex. In order to analyze the base sequence of RNA found useful by screening, it is preferable to prepare this complex.
Further, in the step (e1), it is preferable to have a step of ligating the 3 ′ end of RNA 23 and the 5 ′ end of the nucleic acid linker 2. At the time of ligation, it is necessary to phosphorylate the 3 ′ end of RNA23 using an enzyme such as T4 polynucleotide kinase. As an enzyme used for ligation, RNA ligase is preferable, and for example, T4 RNA ligase can be mentioned.

In the evolutionary molecular engineering technique, useful RNA can be obtained as the number of screenings increases. Therefore, the greater the number of cycles, the better. On the other hand, from the viewpoint of screening accuracy, the number of steps in one cycle should be as small as possible.
According to the method for producing an RNA microarray of this embodiment, RNA can be transferred between beads automatically and efficiently, so that the number of steps can be reduced and the operation can be speeded up.
In addition, according to the method for producing an RNA microarray of this embodiment, an RNA microarray that is accurately transferred from a DNA microarray can be obtained.
Furthermore, since the RNA microarray manufacturing method of this embodiment is a method in which RNA is immobilized on beads from DNA immobilized on the beads via a nucleic acid linker immobilized on the beads, a high-density RNA microarray is obtained. Can do.

[Second Embodiment]
The method for producing an RNA microarray of the present embodiment is a method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is arranged,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C2) A step of preparing a plurality of reaction vessels arranged in a plurality of reaction vessels arranged on a bead arrangement substrate, which are divided by a partition having a communication hole and are composed of two kinds of micro reaction vessels having different bottom diameters or sides. When,
(D2) After the steps (a), (b), and (c2), after placing the large beads in the large micro reaction vessel among the first beads and the second beads, Placing in a small microreactor;
(E2) After the step (d2), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Hybridizing, and
The diameter or one side of the bottom of the large microreactor is 1-2 times the diameter of the large beads,
The diameter or one side of the bottom surface of the small micro reaction tank is 1 to 2 times the diameter of the small beads.
In this embodiment, the description of the same steps as those in the first embodiment is omitted, and the same components as those shown in the schematic diagrams of the method for producing the RNA microarray in FIGS. The reference numerals are attached and the description is omitted.

Step (c2) is a plurality of reaction vessels 12 arranged on the bead arrangement substrate 11, which is partitioned by a partition 12 a having a communication hole, and is composed of two types of micro reaction vessels having different diameters. It is a process (see FIG. 3A).
The plurality of reaction tanks 12 are partitioned by a partition 12a having a communication hole, and include a large micro reaction tank 12b and a small micro reaction tank 12c. The size of the communication hole of the partition 12a is not particularly limited as long as the size allows the RNA 23 to pass therethrough and does not allow the small beads to pass. Further, the number of communication holes provided in the partition 12a is not particularly limited.

In the step (d2), after the steps (a), (b), and (c2), the large beads out of the first beads 14 and the second beads 24 are disposed in the large microreaction tank 12b. This is a step of placing small beads in a small microreaction tank 12c (see FIG. 3B).
Either the first bead 14 or the second bead 24 may be larger, but in the present embodiment, the first bead 14 is made larger for convenience.
In the bead arrangement substrate 11, the diameter or one side of the bottom surface of the large microreaction tank 12b is 1 to 2 times the diameter of the large bead, and the diameter or one side of the bottom surface of the small microreaction tank 12c is the diameter of the small bead. 1 to 2 times.
As a specific method for arranging the beads in the present embodiment, first, the first beads 14 which are large beads are arranged in a large micro reaction tank 12b.
Next, the second bead 24, which is a small bead, is placed in the small microreaction vessel 12c. The large micro reaction tank 12b is already filled with one first bead 14, so there is no room for the second bead 24 to be filled, and the second bead 24 is placed in the small micro reaction tank 12c. One is filled.

In the step (e2), after the step (d2), the DNA 13 immobilized on the first bead 14 is transferred using a transcription system, and the synthesized RNA 23 is immobilized on the second bead 24. In this step, the nucleic acid linker 2 is hybridized.
In the present embodiment, the DNA 13 immobilized on one first bead 14 and the nucleic acid linker 2 immobilized on one second bead 24 are placed in adjacent micro reaction vessels 12b and 12c. It arrange | positions through the partition 12a. Therefore, using the transcription system, DNA 13 is transcribed to synthesize RNA 23, and at the same time, synthesized RNA 23 diffuses between the beads (from the first bead 14 to the second bead 24) through the communication hole, Hybridizes to the nucleic acid linker 2.
Therefore, according to the present embodiment, beads of a predetermined size can be arranged one by one in a predetermined microreaction tank, so that a larger number of RNAs 23 can be formed on one second bead 24. A nucleic acid linker 2 complex is formed.

Examples of the transfer system in step (e2) include the same transfer system as in step (e1).
Moreover, in the step (e2), it is preferable to have a step of ligating the 3 ′ end of RNA 23 and the 5 ′ end of nucleic acid linker 2. Similar to step (e1), at the time of ligation, it is necessary to phosphorylate the 3 ′ end of RNA23 using an enzyme such as T4 polynucleotide kinase. As an enzyme used for ligation, RNA ligase is preferable, and for example, T4 RNA ligase can be mentioned.

  According to the method for producing an RNA microarray of the present embodiment, beads of a predetermined size can be arranged one by one in a predetermined microreaction tank, so that the number of polymolecules on one second bead 24 is increased. RNA23-nucleic acid linker 2 complex is formed. Therefore, in addition to the effects of the first embodiment, a higher density RNA microarray can be obtained.

  EXAMPLES Hereinafter, although an Example demonstrates this invention, this invention is not limited to a following example.

(Preparation of biotin-modified double-stranded DNA)
T7, Cap, Omega sequence, 5 ′ end, Kozak sequence, 3 ′ end complementary sequence to the DNA portion of the linker, and GFP gene (SEQ ID NO: 1 889 bp) with the stop codon removed as a template and biotin modified Biotin-modified double-stranded DNA was prepared by PCR using the prepared primers. A reaction solution was prepared so as to have the composition shown in Table 1 and maintained at 98 ° C. for 2 minutes, followed by 20 cycles of 98 ° C. for 10 seconds, 68 ° C. for 10 seconds, and 72 ° C. for 20 seconds. It was cooled with.
The primer sequences used are shown below.
(1) Biotin-New Left (22mer)
[Sequence: 5 ′-(B) -X-3 ′]
Here, X represents the following sequence.
GATCCCGCCGAAATTAATACGACTCACTATAGG (SEQ ID NO: 2: 33mer)
(2) New Ytag to HGGS-R (33mer)
[Sequence: 5′-TTTCCCCCGCCCCCCCCCTCCCTGCTTCGCCGGTGATGAT-3 ′] (SEQ ID NO: 39mer)

The PCR product was subjected to PAGE analysis (4% non-denaturing PAGE, SybrGold staining) to confirm the amplification of the target product of 889 bp. The result is shown in FIG. The PCR product was purified by QIAquick PCR purification column (Qiagen) to obtain a biotin-modified double-stranded DNA having a concentration of 2.9 × 10 ⁻⁸ M.

(Pretreatment of magnetic beads)
100 μl of Dynabeads MyOne streptavidin C1 (10 mg / ml, invitrogen) was washed twice with 100 μl of Solution A (0.1 M NaOH, 0.05 M NaCl) and 1 μl with 100 μl of Solution B (0.1 M NaCl). And suspended in 100 μl of 1 × Binding buffer (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.1% Triton X-100). 10 μl of the suspension was dispensed into three Eppendorf tubes, and 20 μl was dispensed into three Eppendorf tubes.

(Immobilization of biotin-modified double-stranded DNA)
The supernatant of the suspension dispensed by 10 μl was removed, suspended in a solution having the composition described in Table 2, and stirred at room temperature for 30 minutes. The magnetic beads in the suspension were washed 3 times with 100 μl of 1 × Binding buffer and then suspended in 20 μl of 1 × T7 transcription buffer (promega).

(Immobilization of nucleic acid linker)
The supernatant of the 20 μl aliquot was removed, suspended in a solution having the composition described in Table 3, and stirred at room temperature for 30 minutes. The magnetic beads in the suspension were washed 3 times with 100 μl of 1 × Binding buffer and then suspended in 20 μl of 1 × T7 transcription buffer (promega).

In Table 3, SBP (I) represents a nucleic acid linker. FIG. 5 shows a schematic diagram of a GFP mRNA and a nucleic acid linker (SBP (I)) covalently bound to each other. In FIG. 5, P is puromycin, F is FITC, EMCS is a divalent crosslinking agent, and B is biotin. (Spc18) represents (18-O-Dimethyltriethylethyleneglycol, 1-[(2-cyanethyl)-(N, N-diisopropyl)]-phosphoramidite).
The part indicated by capital letters indicates the DNA part, and the part indicated by small letters indicates the mRNA. I indicates deoxyinosine, and the arrow indicates the cleavage site by Endonuclease V.

(Transcription reaction)
After mixing 40 μl of biotin-modified double-stranded DNA-immobilized magnetic beads and 80 μl of nucleic acid linker-immobilized magnetic beads, the supernatant was removed and suspended in a transcription reaction solution having the composition described in Table 4 at 37 ° C. The reaction was stirred for an hour. In addition, Ribomax large scale RNA production System (T7) (Promega) was used as the In vitro transcription kit.
A part of the supernatant after the reaction was subjected to PAGE analysis (8 M Urea 4% PAGE, SybrGold staining). The results are shown in FIG. Lanes A, B, and C show triplicate results.
As shown in FIG. 6, it was confirmed that mRNA was generated by a transcription reaction using a biotin-modified double-stranded DNA immobilized on magnetic beads as a template.

(Reverse transcription reaction / Endonuclease V treatment)
The magnetic beads in the suspension were washed three times with 100 μl of 1 × binding buffer and once with 20 μl of 1 × RT buffer (Toyobo), and then suspended in a solution having the composition described in Table 5 at 42 ° C. For 30 minutes.

(Endonclease V processing)
The supernatant of the suspension was removed, suspended in a solution having the composition described in Table 6, and stirred at 37 ° C. for 1 hour. The supernatant after the Endonuclease V treatment reaction was recovered, and PAGE analysis (4% non-denaturing PAGE, SybrGold staining, and FITC fluorescence detection) was performed on 3 μl of the recovered supernatant. The results are shown in FIG. Lanes A, B, and C show triplicate results.

In FIG. 7, in both lanes of the supernatant after the reverse transcription reaction before the Endonuclease V treatment reaction (reverse transcription reaction supernatant) and the supernatant after the reverse transcription reaction after the Endonuclease V treatment reaction (supernatant after the Endonuclease V treatment), SybrGold Since the band was detected by staining, it was confirmed that cDNA was generated by the reverse transcription reaction.
Furthermore, since the FITC fluorescence labeled with the nucleic acid linker was detected only in the supernatant lane after Endonuclease V treatment, an mRNA / cDNA-nucleic acid linker complex was formed, and Endoclease V treatment was performed at the cleavage site of the nucleic acid linker. It was confirmed that the mRNA / cDNA-nucleic acid linker complex was cleaved.

Furthermore, PAGE (8M Urea 5% PAGE, SybrGold staining, and FITC fluorescence detection) analysis of the supernatant after Endonuclease V treatment was performed. The results are shown in FIG. The left side of FIG. 8 shows the analysis result by SybrGold staining, and the right side of FIG. 8 shows the analysis result by FITC fluorescence detection.
In FIG. 8 left, since there is no unreacted mRNA after reverse transcription treatment, it was confirmed that all the mRNA hybridized to the nucleic acid linker (SBP (I)) was reverse transcribed. From the FITC fluorescence detection image, the reverse transcription efficiency (ie, hybridization efficiency) was 15-40%.

From the above results, according to the method for producing an RNA microarray of the present embodiment, RNA can be transferred between beads automatically and efficiently, so that an RNA microarray can be produced quickly and efficiently. In addition, according to the method for producing an RNA microarray of this embodiment, an RNA microarray that is accurately transferred from a DNA microarray can be obtained.
Furthermore, since the RNA microarray manufacturing method of this embodiment is a method in which RNA is immobilized on beads via DNA immobilized on the beads via a nucleic acid linker immobilized on the beads, the DNA directly immobilized on the substrate. From the above, it is clear that an RNA microarray having a higher density can be obtained through a transcription reaction than when RNA is directly immobilized on a substrate.

  2 ... Nucleic acid linker, 2b ... Solid phase binding site, 2c1, 2c2 ... Cleavage site, 11 ... Substrate for placing beads, 12 ... Reaction vessel, 12a ... Partition, 12b, 12c ... Micro reaction vessel, 13 ... DNA, 14 ... First One bead, 23 ... RNA, 24 ... second bead, 24a ... solid phase binding site recognition site, 43 ... cDNA, 50 ... sequence

Claims (5)

A method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is disposed,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C1) preparing the inside of a plurality of reaction vessels arranged on the substrate for arranging beads,
(D1) After the steps (a), (b), and (c1), after placing the first beads in the reaction vessel, placing the second beads in the reaction vessel; ,
(E1) After the step (d1), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Having a step of hybridizing;
The first bead is larger than the second bead;
A method for producing an RNA microarray, wherein the diameter or one side of the bottom surface of the reaction vessel is 1 to 2 times the diameter of the first bead. A method for producing an RNA microarray comprising a plurality of reaction vessels in which RNA is disposed,
(A) preparing a first bead having DNA immobilized thereon;
(B) preparing a second bead on which a nucleic acid linker containing a sequence capable of hybridizing with RNA obtained by transferring the DNA is immobilized;
(C2) A step of preparing a plurality of reaction vessels arranged in a plurality of reaction vessels arranged on a bead arrangement substrate, which are divided by a partition having a communication hole and are composed of two kinds of micro reaction vessels having different bottom diameters or sides. When,
(D2) After the steps (a), (b), and (c2), after placing the large beads in the large micro reaction vessel among the first beads and the second beads, Placing in a small microreactor;
(E2) After the step (d2), using a transcription system, the DNA immobilized on the first bead is transcribed, and the synthesized RNA is transferred to the nucleic acid linker immobilized on the second bead. Hybridizing, and
The diameter or one side of the bottom of the large microreactor is 1-2 times the diameter of the large beads,
A method for producing an RNA microarray, wherein the diameter or one side of the bottom surface of the small microreaction tank is 1 to 2 times the diameter of the small beads. Preparing a water-in-oil emulsion so that, in step (a), an average of 1 molecule or less of DNA per emulsion and an average of 1 or less first beads are included;
The method for producing an RNA microarray according to claim 1, further comprising a step of performing a nucleic acid amplification reaction in the emulsion and immobilizing DNA to which a solid phase binding site is added to the beads.   The first bead and the second bead are magnetic beads, the bead arranging substrate is a magnetic bead arranging substrate, and the steps (d1) and (d2) are the magnetic bead arranging substrates. The method for producing an RNA microarray according to any one of claims 1 to 3, further comprising a step of disposing a magnet at a lower portion of the substrate and guiding the magnetic beads to the reaction vessel.   An RNA microarray produced using the method for producing an RNA microarray according to any one of claims 1 to 4.