JP2013046597A - Model animal and cell for nervous system disease and their use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a model animal and a cell for a hereditarily homogeneous nervous system disease which stably exhibit a condition of a nervous system disease, and a means for more efficiently developing a therapeutic/prophylactic agent using the model animal or cell.SOLUTION: A model animal for a nervous system disease is a nonhuman mammal with insufficiency of DBZ gene expression in which (a) the number of brain cortex cells is reduced, and/or (b) the growth of neurites is inhibited, and/or (c) cell migration during formation of brain cortex is delayed, and/or (d) differentiation of oligodendrocyte is inhibited, in comparison with corresponding wild type animals. In the mammal with insufficiency of DBZ gene expression, a cell keeps differentiation of oligodendrocyte inhibited. A method for screening a therapeutic/prophylactic agent for nervous system disease is based on the application of a substance to be inspected to the animal or cell to evaluate organic changes of brain, differentiation of oligodendrocyte, or improvement of behavioral disorder.

Description

  TECHNICAL FIELD The present invention relates to a nervous system disease model animal and cell, and uses thereof. More specifically, the present invention relates to a model animal and cell for a nervous system disease in which the expression of Disc1-binding zinc finger protein (DBZ) gene is deficient, and a screening for a substance having a therapeutic and / or preventive effect on the nervous system disease using them. Regarding the method.

  Disrupted-in-Schizophrenia 1 (DISC1) is a fragility factor identified from linkage analysis of a Scottish schizophrenic multiple family, and causes gene diseases such as schizophrenia. However, it has not been clarified why the gene abnormality of DISC1 expressed systemically causes a brain-specific lesion called a nervous system disease.

  In order to elucidate the molecular functions of DISC1 and intracellular signal transduction pathways, factors that interact with DISC1 have been searched, and DISC1-binding proteins such as Ndel1, PDE4B, and Girdin have been identified so far. As a result of screening DISC1 binding partners from an adult brain cDNA library using the yeast two-hybrid method, the present inventors have found that Disc1-binding zinc finger protein (DBZ), Fez1, and Kendrin are novel proteins that interact with DISC1. (Non-Patent Documents 1 and 2). The expression distribution of DBZ is extremely brain-specific, and the neurite appearance changes by artificially manipulating the expression level in nerve cells, so it is assumed that it plays an important role in the nervous system (Non-Patent Document 1). Furthermore, artificially disturbing the binding to DISC1 changes various functions of neurons (Non-patent Document 2), and it is speculated that the interaction with DSIC1 is important for its function expression. Yes.

  In patients with schizophrenia, the number of oligodendrocytes, which are the main constituent cells of the central nervous system, as well as nerve cells, have been reported to be decreased, misplaced, and abnormally shaped. Furthermore, it has been reported that single nucleotide polymorphisms of genes responsible for oligodendrocyte function are associated with schizophrenia, suggesting that oligodendrocytes are deeply involved in schizophrenia. However, the molecular mechanism behind the oligodendrocyte abnormality in these schizophrenia has not yet been elucidated.

  In addition, the main role of oligodendrocytes is the formation of nerve myelin sheath (myelin sheath), but as a typical disease that exhibits abnormalities in the process (regeneration after formation or injury), multiple sclerosis, Acute disseminated encephalomyelitis, inflammatory diffuse sclerosis, myelinopathy associated with infection (subacute sclerosis panencephalitis, progressive multifocal leukoencephalopathy), poisoning / metabolic myelinopathy (hypoxic encephalopathy, bridge) Central myelinopathy, vitamin B12 deficiency), peripheral anomalies such as Guillain-Barre syndrome, Fisher syndrome, chronic inflammatory demyelinating polyradiculoneuritis in addition to central nervous system diseases such as vascular myelinopathy (Binswanger disease) Nervous system diseases are known, but the detailed pathogenesis is unknown for all of them.

  In order to elucidate the onset mechanism of a nervous system disease, develop a therapeutic and / or preventive drug thereof, an appropriate model animal for the nervous system disease is desired. If there is an appropriate model animal, the initial screening of the drug can be easily performed by, for example, a general animal behavior test. However, at present, it is difficult to say that animal models for nervous system diseases have been established. For example, model animals in which disease states are induced by drugs such as narcotics are frequently used as model animals such as mania, depression, and schizophrenia, which are nervous system diseases. However, in such animals, accurate and homogeneous screening is performed, such as the interaction between the drug used for screening and the drug administered to induce the disease state becomes a problem, or the induction state of the disease state varies depending on the individual. It was difficult. In view of the above, it is desired to produce a genetically homogenous animal model of a nervous system disease that stably presents a disease state of the nervous system disease and can be used for screening of a therapeutic and / or preventive drug for the nervous system disease. Yes.

  With the development of genetic research, many candidate genes related to vulnerability to nervous system diseases have been reported, and the creation of neurological disease model animals based on more certain genetic factors is expected. Regarding DISC1, many mutant mice and RNAi knockdown mice using intrauterine electroporation have been reported so far. On the other hand, for DBZ, genetically modified animals have not been created so far, and the effect of DBZ on nervous system functions at the individual level remains unclear.

  On the other hand, at an early stage of disease treatment and / or prevention drug development, it is possible to evaluate multiple samples in a short amount in a short time in order to quickly predict the presence or absence of efficacy and optimize the structure efficiently Construction of an in vitro screening system is essential. However, model cells that well reflect oligodendrocyte abnormalities in schizophrenia and abnormal myelination in various neurological diseases have not been obtained.

Mol. Psychiatry., 12 (4): 398-407, 2007 Neurochem. Int., 51 (2-4): 165-72, 2007

  The object of the present invention is to (1) a genetically homogeneous animal model of a nervous system disease that stably exhibits a pathology of a nervous system disease, and (2) an oligodendrocyte abnormality in schizophrenia, and a medulla in various neurological diseases. By providing a model cell that well reflects anomalies of sheath formation and screening a candidate substance for a therapeutic and / or prophylactic agent for a nervous system disease using the model animal and cell, the treatment of the nervous system disease more efficiently • To provide a means to develop preventive drugs.

In order to solve the above-mentioned problems, the present inventors focused on DBZ as a candidate gene for a fragile factor for developing a nervous system disease, and created and analyzed a DBZ knockout animal. It has been found that changes similar to the structural changes in the brain occur.
The present inventors also examined the correlation between DBZ gene expression and oligodendrocyte differentiation using an in vitro cell culture system, and found that DBZ gene expression increased with oligodendrocyte differentiation, using siRNA. We found that oligodendrocyte differentiation is suppressed when DBZ gene expression is suppressed. Furthermore, in the above DBZ knockout animals, it was found that oligodendrocyte differentiation was suppressed, and DBZ was not only deeply involved in oligodendrocyte abnormalities in schizophrenia, but also in diseases exhibiting myelin abnormalities Clarified that they could be involved.
As a result of further studies based on these findings, the present inventors have completed the present invention.

That is, the present invention is as follows.
[1] A non-human mammal deficient in DBZ gene expression, compared to a corresponding wild-type animal,
(A) the number of cells in the cerebral cortex is decreased, and / or (b) the growth of neurites is suppressed, and / or (c) the cell migration during cerebral cortex formation is delayed, and / Or (d) An animal characterized in that oligodendrocyte differentiation is suppressed.
[2] The animal according to [1] above, wherein the non-human mammal is a mouse or a rat.
[3] The animal according to [1] above, wherein the non-human mammal is a mouse.
[4] The animal-derived brain tissue according to any one of [1] to [3] above.
[5] Use of the animal according to any one of [1] to [3] or the brain tissue according to [4] above as a nervous system disease model.
[6] The use according to [5] above, wherein the nervous system disease is a disease exhibiting schizophrenia, mood disorder or myelin sheath abnormality.
[7] The use according to [5] above, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin abnormality.
[8] The following steps:
(1) A step of applying a test substance to the animal according to any one of [1] to [3] or the brain tissue according to [4],
(2) examining the number of cells in the cerebral cortex of the animal, neurite growth in the central nervous tissue of the animal, cell migration in the brain tissue, or differentiation of oligodendrocytes in the brain of the animal; and (3) When the number of cells in the cerebral cortex is increased, neurite growth is promoted, cell migration is promoted, or oligodendrocyte differentiation is promoted, compared to the case where the test substance is not applied. A screening method for a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease.
[9] The following steps:
(1) A step of administering a test substance to the animal according to any one of [1] to [3] above,
(2) a step of examining behavioral abnormalities in the animal; and (3) treatment of a nervous system disease when the behavioral abnormalities are improved as compared to the case where the test substance is not applied. A method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting as a candidate for a substance having a preventive effect.
[10] The method of the above-mentioned [8] or [9], wherein the nervous system disease is a disease exhibiting schizophrenia, mood disorder or myelin sheath abnormality.
[11] The method according to [8] or [9] above, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin abnormality.
[12] The following steps:
(1) A step of bringing a test substance into contact with a mammalian cell deficient in DBZ gene expression,
(2) a step of inducing differentiation of the cells into oligodendrocytes,
(3) The step of examining the degree of oligodendrocyte differentiation in the cell population obtained by (2) above, and (4) oligodendrocyte differentiation is promoted compared to the case where the test substance is not contacted. A method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease.
[13] The method according to [12] above, wherein the nervous system disease is a disease exhibiting schizophrenia, mood disorder or myelin sheath abnormality.
[14] The method described in [12] above, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin abnormality.

  Since the DBZ gene expression-deficient animals and cells of the present invention well reflect the pathology of human nervous system diseases, particularly diseases with schizophrenia and myelin abnormalities, they can be used as model animals and model cells for the diseases. In particular, by administering a new drug candidate substance to the animal and subjecting it to a behavioral test or the like, it is possible to efficiently predict the therapeutic and / or prophylactic efficacy of the substance in human nervous system diseases.

It is a physical map of the targeting vector used for DBZ knockout mouse production, and the mutant allele resulting from homologous recombination. It is a figure which shows the result of the genomic PCR, RT-PCR, and Western blot which show the homologous recombination to the DBZ locus in DBZ knockout mouse | mouth (A and B) and inactivation of DBZ gene expression (C and D). In quantitative RT-PCR, GAPDH was used as an internal standard. The vertical axis in FIG. 2C represents the relative expression level (%) when the DBZ gene expression level after correction with GAPDH is set to 100% in wild-type mice. It is a figure which shows the whole structure of the brain of a DBZ knockout mouse. The upper panel shows the result of KB staining, and the lower panel shows the result of Nissl staining. Wt: wild type mouse, Ht: heterozygous DBZ knockout mouse, Ho: homozygous DBZ knockout mouse. It is a figure which shows the reduction | decrease of the cell number in the cerebral cortex (sensory motor area) of an adult DBZ knockout mouse. Wt: wild type mouse, KO: DBZ knockout mouse. FIG. 3 is a diagram showing a decrease in the number of cells in the cerebral cortex of adult DBZ knockout mice. The upper panel of the upper figure shows a nissel-stained photograph of a cerebral cortex section of a wild-type mouse and the lower panel of a homozygous DBZ knockout mouse. The following figure is a graph showing the relative number of cells relative to wild-type mice in each layer of the cerebral cortex. WT: wild type mouse, Ho: homozygous DBZ knockout mouse. *: P <0.05 It is a figure which shows the reduction | decrease of the cell number in the cerebral cortex of a young DBZ knockout mouse (P3). The left panel of the upper figure shows a nistle-stained image of the whole section, and the right panel shows a stained image of each layer. The following figure is a graph showing the relative number of cells relative to wild-type mice in each layer of the cerebral cortex. WT: wild type mouse, Ho: homozygous DBZ knockout mouse. *: P <0.05 It is a figure which shows the reduction | decrease of the cell number in a cortex board (cerebral cortex) of embryonic (E17.5) and a young (P3) DBZ knockout mouse | mouth. The left figure shows a Nissle-stained photograph of a brain tissue section of a fetal mouse and the right figure of a young mouse. Wt: wild type mouse, KO: DBZ knockout mouse. MZ: marginal zone, CP: cortical plate, IZ: intermediate zone, SVZ / VZ: subventricular zone / ventricular zone. It is a figure which shows that neurite growth is suppressed in the young DBZ knockout mouse (P3) brain. The photograph shows the result of Golgi staining of pyramidal cells, and it can be seen that the dendrites of DBZ knockout mice (KO) are finer and less branched than wild-type mice (WT). It is a figure which shows that the nerve cell movement at the time of cerebral cortex formation is delayed in embryonic DBZ knockout mouse (E17.5). The left figure is a stained image of BrdU uptake cells in the whole fetal brain section, and the right figure is an enlarged view of the part surrounded by the square in the left figure. Wt: wild type mouse, KO: DBZ knockout mouse. CP: cortical plate, IZ: intermediate zone, VZ / SVZ: ventricular zone / subventricular zone. It is a figure which shows the expression of DBZ gene in the primary culture of an oligodendrocyte (OL), an oligodendrocyte progenitor cell (OPC), a neuron (Neu), and an astrocyte (Ast) (left figure). It is a figure which shows the relationship between the differentiation induction of an oligodendrocyte, and DBZ gene expression (right figure). The horizontal axis shows the time after PDGF removal. It is a figure which shows the result of quantitative RT-PCR which shows that differentiation of an oligodendrocyte is suppressed by suppression of DBZ expression by siRNA. DBZ (upper left), MAG (upper right), MBP (lower left), CNPase (lower right). It is the result (upper figure) and immuno-staining image (lower figure) of the western blotting which show that differentiation of oligodendrocyte is suppressed by DBZ expression suppression by siRNA. It is an immuno-staining image which shows the reduction | decrease of myelin formation in 10 days old DBZ knockout mouse | mouth. WT: wild type mouse, KO: DBZ knockout mouse. MAG (left panel), MBP (right panel). Cx: cerebral cortex, CC: corpus callosum

  The present invention provides a non-human mammal deficient in DBZ gene expression. A DBZ gene-deficient non-human mammal means a non-human mammal in which the expression of endogenous DBZ is inactivated, and other DBZ KO animals produced from ES cells in which the DBZ gene is knocked out (KO) Also included are knockdown (KD) animals in which DBZ gene expression is inactivated by antisense or RNAi technology. Here, “knockout (KO)” means that complete mRNA cannot be produced by destroying or removing the endogenous gene, while “knockdown (KD)” By inhibiting the translation from mRNA to protein, it means inactivating the expression of the endogenous gene as a result. Hereinafter, the DBZ gene KO / KD animal of the present invention may be simply referred to as “KO / KD animal of the present invention”.

The “non-human mammal” that can be the subject of the present invention is not particularly limited as long as it is a mammal other than a human in which a transgenic system has been established. For example, a mouse, rat, cow, monkey, pig, sheep, goat, Examples include rabbits, dogs, cats, guinea pigs, hamsters, rats, and mice. Preferably, mice, rats, rabbits, dogs, cats, guinea pigs, hamsters, etc., among which rodents with relatively short ontogeny and biological cycle and easy breeding are more preferable from the viewpoint of disease model animal production, In particular, mice (eg C57BL / 6 strain, BALB / c strain, DBA2 strain, etc. as pure strains, B6C3F ₁ strain, BDF ₁ strain, B6D2F ₁ strain, ICR strain, etc.) as hybrids and rats (eg, Wistar, SD, etc.) Is preferred.
In addition to mammals, birds such as chickens can be used for the same purpose as the “non-human mammal” targeted in the present invention.

  As a specific means for knocking out the DBZ gene, a DBZ gene (genomic DNA) derived from the target non-human mammal is isolated according to a conventional method, for example, (1) other DNA fragments (for example, in the exon part or the promoter region) , Destroying the function of exon or promoter by inserting a drug resistance gene or reporter gene), or (2) excising all or part of DBZ gene using Cre-loxP system or Flp-frt system Deleting the gene, (3) inserting a stop codon into the protein coding region to disable complete protein translation, or (4) a DNA sequence that terminates gene transcription into the transcription region (eg, Insert a polyA addition signal, etc.) to disable complete mRNA synthesis, resulting in a DNA strand with a DNA sequence constructed to inactivate the gene (hereinafter targeted) The abbreviated as vector), a scheme of incorporated DBZ locus of the subject non-human mammal may be used preferably by homologous recombination.

The homologous recombinant can be obtained, for example, by introducing the above targeting vector into embryonic stem cells (ES cells).
ES cells are cells derived from the inner cell mass (ICM) of fertilized eggs at the blastocyst stage, and can be cultured and maintained in an undifferentiated state in vitro. ICM cells are the cells that will form the embryo body in the future, and are the stem cells that form the basis of all tissues including germ cells. ES cells may be established cell lines, or may be newly established according to the method of Evans and Kaufman (Nature 292, 154, 1981). For example, in the case of mouse ES cells, ES cells derived from 129 mice are generally used, but since the immunological background is unclear, a purely alternative and immunologically genetic For the purpose of obtaining ES cells with clear background, for example, B57 ₁ mice (C57BL / 6 and DBA / ES cells established from F ₁ ) and 2 can also be used favorably. BDF ₁ mouse has C57BL / 6 mouse in the background in addition to the advantage that the number of eggs collected is large and the egg is strong, so the ES cell derived from this is C57BL / 6 mouse. Can be advantageously used in that it can be backcrossed to replace its genetic background with C57BL / 6 mice.

ES cells can be prepared, for example, as follows. Female after mating non-human mammals [e.g., a mouse (preferably C57BL / 6J (B6) inbred mouse such as, F, etc. ₁ of B6 and another inbred strain) When used, approximately 2 months of age or more A blastocyst-stage embryo is collected from the uterus of a female mouse (approximately 3.5 days of gestation) of about 8 to about 10 weeks of age mated with a male mouse (or early stage before the morula stage) After the embryo is collected from the fallopian tube, it may be cultured to the blastocyst stage in the same manner as described above in an embryo culture medium, and appropriate feeder cells (for example, in the case of mice, primary fibers prepared from mouse embryos) When cultured on a layer such as a blast cell or a known STO fibroblast cell line, some cells of the blastocyst gather to form an ICM that differentiates into an embryo in the future. This inner cell mass is treated with trypsin to dissociate single cells, while maintaining an appropriate cell density and repeating the dissociation and passage while changing the medium, ES cells can be obtained.

Both male and female ES cells may be used, but male ES cells are usually more convenient for producing germline chimeras. In addition, it is desirable to discriminate between males and females as soon as possible in order to reduce troublesome culture work. An example of a method for determining sex of male and female ES cells is a method of amplifying and detecting a gene in the sex determining region on the Y chromosome by PCR. If this method is used, the number of ES cells (about 50) is about 1 colony, while the number of cells required for karyotyping analysis is about 10 ⁶ cells. It is possible to perform primary selection of ES cells in the early stage by discriminating between males and females, and the selection of male cells at an early stage makes it possible to greatly reduce the labor of the initial culture.
The secondary selection can be performed by, for example, confirmation of the number of chromosomes by G-banding method. The number of chromosomes of the obtained ES cells is preferably 100% of the normal number.

  The ES cell line thus obtained needs to be subcultured carefully in order to maintain the properties of undifferentiated stem cells. For example, on a suitable feeder cell such as STO fibroblast, in a carbon dioxide incubator (preferably 5% carbon dioxide / 95%) in the presence of LIF (1 to 10,000 U / ml) known as a differentiation inhibitor. For example, trypsin / EDTA solution (usually 0.001 to 0.5% trypsin / 0.1 to 5 mM) at the time of passage, for example, by culturing at about 37 ° C. in air or 5% oxygen / 5% carbon dioxide / 90% air) EDTA, preferably about 0.1% trypsin / 1 mM EDTA) is used to form single cells and seed them on newly prepared feeder cells. Such passaging is usually carried out every 1 to 3 days. At this time, cells are observed, and if morphologically abnormal cells are found, the cultured cells are desirably discarded.

  ES cells can be differentiated into various types of cells such as parietal muscle, visceral muscle, and myocardium by monolayer culture to high density or suspension culture until a cell conglomerate is formed under appropriate conditions. [MJ Evans and MH Kaufman, Nature 292, 154, 1981; GR Martin, Proceedings of National Academy of Sciences USA (Proc. Natl Acad. Sci. USA) 78, 7634, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, 87, 27, 1985], of the present invention. DBZ gene expression deficient non-human mammalian cells obtained by differentiating ES cells into which a targeting vector has been introduced are useful for in vitro cell biology of DBZ.

  For example, when the targeting vector is designed to destroy the function of the exon or promoter by inserting another DNA fragment into the exon part or promoter region of the DBZ gene, the vector is, for example, The following configuration can be taken.

  First, since another DNA fragment is inserted into the exon or promoter portion of the DBZ gene by homologous recombination, the targeting vector is homologous to the target site 5 'upstream and 3' downstream of the other DNA fragment, respectively. Specific sequences (5 'and 3' arms) must be included. For example, in the examples described later, the targeting vector contains a sequence homologous to the intron 1 region of the DBZ gene at the 5 ′ upstream side of the other DNA fragment to be inserted so as to destroy exon 2, and the 3 ′ downstream side. Contains a sequence homologous to a region spanning part of intron 2 to exon 3.

  Other DNA fragments to be inserted are not particularly limited, but when a drug resistance gene or a reporter gene is used, ES cells in which a targeting vector is integrated into a chromosome can be selected using drug resistance or reporter activity as an index. Examples of drug resistance genes include neomycin phosphotransferase II (nptII) gene and hygromycin phosphotransferase (hpt) gene, and reporter genes include, for example, β-galactosidase (lacZ) gene, chloramphenicol acetyl. Examples thereof include, but are not limited to, transferase (cat) genes.

  The drug resistance or reporter gene is preferably under the control of any promoter capable of functioning in mammalian cells. For example, viral promoters such as SV40-derived early promoter, cytomegalovirus (CMV) long terminal repeat (LTR), Rous sarcoma virus (RSV) LTR, murine leukemia virus (MoMuLV) LTR, adenovirus (AdV) derived early promoter, and Examples thereof include promoters of mammalian constituent protein genes such as β-actin gene promoter, PGK gene promoter, and transferrin gene promoter. However, when the drug resistance or reporter gene is inserted into the DBZ gene so that it is under the control of the DBZ gene's endogenous promoter, a promoter that controls transcription of the gene in the targeting vector is not necessary.

  Further, the targeting vector preferably has a sequence (also called a polyadenylation (polyA) signal, terminator) that terminates transcription of mRNA from the drug resistance or reporter gene, for example, Terminator sequences derived from viral genes or from various mammalian or avian genes can be used. Preferably, a SV40-derived terminator, a PGK gene-derived terminator, and the like are used.

  Usually, gene recombination in mammals is largely non-homologous, and the introduced DNA is randomly inserted at any position on the chromosome. Therefore, depending on selection (positive selection) such as detection of drug resistance or reporter gene expression, only clones targeted to the endogenous DBZ gene targeted by homologous recombination cannot be selected efficiently. It is necessary to confirm the integration site by Southern hybridization or PCR for all clones. Therefore, if a herpes simplex virus-derived thymidine kinase (HSV-tk) gene that confers sensitivity to ganciclovir, for example, is linked outside the region homologous to the target sequence of the targeting vector, cells into which the vector is randomly inserted Can not grow on ganciclovir-containing medium because it has the HSV-tk gene, but cells targeted to the endogenous DBZ locus by homologous recombination do not have the HSV-tk gene and are selected to be resistant to ganciclovir (negative selection). ). Alternatively, if, for example, a diphtheria toxin gene is linked instead of the HSV-tk gene, cells into which the vector has been randomly inserted will be killed by the toxin produced by the vector, so that homologous recombinants can be removed in the absence of a drug. You can also choose.

For introduction of targeting vectors into ES cells, calcium phosphate coprecipitation method, electroporation method, lipofection method, retrovirus infection method, aggregation method, microinjection method, gene gun (particle gun) However, as described above, genetic recombination in mammals is mostly non-homologous and the frequency with which homologous recombinants are obtained is low. In general, the electroporation method is selected from the viewpoint that a large number of cells can be treated. For electroporation, the conditions used for gene transfer into normal animal cells may be used as they are. For example, after ES cells in the logarithmic growth phase are treated with trypsin and dispersed into single cells, 10 ⁶ It can be carried out by suspending in a medium so as to be ˜10 ⁸ cells / ml, transferring to a cuvette, adding 10 to 100 μg of the targeting vector, and applying an electric pulse of 200 to 600 V / cm.

  ES cells incorporating a targeting vector can be assayed by screening chromosomal DNA isolated and extracted from colonies obtained by culturing single cells on feeder cells by Southern hybridization or PCR, When drug resistance genes or reporter genes are used as other DNA fragments, transformants can be selected at the cell stage using their expression as an index. For example, when a vector containing the nptII gene is used as a positive selection marker gene, the ES cells after gene transfer treatment are cultured in a medium containing a neomycin antibiotic such as G418, and the resulting resistant colonies are transformed. Select as a candidate. When a vector containing the HSV-tk gene is used as a negative selection marker gene, the vector is cultured in a medium containing ganciclovir, and the resulting resistant colony is selected as a candidate for a homologous recombinant. Each of the obtained colonies is transferred to a culture plate, and after trypsin treatment and medium exchange are repeated, a part is left for culture, and the rest is subjected to PCR or Southern hybridization to confirm the presence of the introduced DNA.

  When the ES cell in which the integration of the introduced DNA is confirmed is returned into an embryo derived from a non-human mammal of the same species, it is incorporated into the ICM of the host embryo to form a chimeric embryo. A chimeric KO animal can be obtained by transplanting this to a temporary parent (female for embryo transfer) and further allowing development. If ES cells contributed to the formation of primordial germ cells that differentiate into eggs and sperm in the future in a chimeric animal, germline chimeras will be obtained, and this will be mated to genetically fix the DBZ gene deficiency. KO animals can be made.

  The chimera embryos are prepared by adhering the early embryos up to the morula stage (aggregate chimera method) and by microinjecting cells into the blastocyst division (injection chimera method) There is. In the production of chimeric embryos using ES cells, the latter has been widely used in the past. Recently, however, there is no need for a method of creating an aggregate chimera by injecting ES cells into the zona pellucida of an 8-cell embryo or a micromanipulator. As a method that is easy to operate, a method of producing an aggregate chimera by co-culturing and aggregating an ES cell mass and an 8-cell embryo from which the zona pellucida has been removed has also been performed.

In either case, the host embryo can be collected in the same manner from a non-human mammal that can be used as an egg-collecting female in gene transfer into a fertilized egg, which will be described later. It is preferable to collect a host embryo from a mouse having a different color from the strain from which the ES cells are derived so that the contribution rate of the ES cells can be determined by the coat color. For example, if ES cells are derived from 129 mice (hair color: Agouti), C57BL / 6 mice (hair color: black) and ICR mice (hair color: albino) are used as eggs for collection, and ES cells are C57BL / 6 or DBF. _{If it is} derived from ₁ mouse (hair color: black) or TT2 cells (derived from C57BL / 6 and CBA F ₁ (hair color: Agouti)), ICR mice and BALB / c mice (hair color: albino) as females for egg collection Can be used.

  In addition, since the germline chimera-forming ability largely depends on the combination of ES cells and host embryos, it is more preferable to select a combination having a high germline chimera-forming ability. For example, in the case of mice, it is preferable to use a host embryo derived from the C57BL / 6 strain for ES cells derived from the 129 strain, and a host embryo derived from the BALB / c strain for ES cells derived from the C57BL / 6 strain. Etc. are preferred.

  The female mouse for egg collection is preferably about 4 to about 6 weeks of age, and the male mouse for mating is preferably of the same strain of about 2 to about 8 months of age. The mating may be natural mating, but is preferably performed after gonad stimulating hormone (follicle stimulating hormone and then luteinizing hormone) is administered to induce superovulation.

  When using the blastoplasty method, blastocyst stage embryos (for example, in the case of mice, about 3.5 days after mating) are collected from the uterus of the female for egg collection (or early embryos before the morula stage are collected from the oviduct) Thereafter, the cells may be cultured to the blastocyst stage in an embryo culture medium (described later), and ES cells (about 10 to about 15) into which the targeting vector has been introduced into the dividing space of the blastocyst using a micromanipulator. Are injected into the uterus of a female non-human mammal for embryo transfer that is pseudopregnant. As the female non-human mammal for embryo transfer, a non-human mammal that can be used as a female for embryo transfer in gene transfer into a fertilized egg can be similarly used.

  In the case of the co-culture method, 8-cell embryos and morulas (for example, about 2.5 days after mating in the case of mice) are collected from the oviduct and uterus of the female egg collection (or early embryos before the 8-cell stage). After harvesting from the fallopian tube, the zona pellucida can be cultivated in an acidic Tyrode solution after being cultured in the embryo culture medium (described later) until the 8-cell stage or morula stage. Place the ES cell mass (about 10 to about 15 cells) into which the targeting vector has been introduced into the microdroplet of the culture medium, and then add the above 8-cell stage embryo or morula (preferably 2). Co-culture overnight. The obtained morula or blastocyst is transplanted into the uterus of a female non-human mammal for embryo reception in the same manner as described above.

  If the transplanted embryo is successfully implanted and the recipient female becomes pregnant, a chimeric non-human mammal can be obtained by natural delivery or caesarean section. It is only necessary to continue suckling for naturally delivered embryos, and if a baby is delivered by caesarean section, the offspring are fed by a separately prepared nursing female (a female non-human mammal that is normally mated and delivered). be able to.

For selection of germline chimeras, first, if the sexes of ES cells have been discriminated in advance, select chimeric mice of the same sex as the ES cells (usually male ES cells are used, so male chimeric mice are selected. Then, a chimeric mouse (for example, 50% or more) having a high ES cell contribution rate is selected from the phenotype such as hair color. For example, in the case of a chimeric mouse obtained from a chimeric embryo of D3 cells, which are male ES cells derived from 129 mice, and a host embryo derived from a C57BL / 6 mouse, it is preferable to select male mice with a high proportion of agouti's coat color. preferable. Check selected chimeric non-human mammal of whether germline chimeras can be performed based on the phenotype of the F ₁ animal obtained by crossing with the appropriate strains of the same animal species. For example, in the case of the above chimeric mouse, Agouti is dominant to Black, so when crossed with female C57BL / 6 mice, the hair color of F ₁ obtained is Agouti if the selected male mouse is a germline chimera. .

A germline chimeric non-human mammal (founder) into which the targeting vector obtained as described above is introduced is usually obtained as a heterozygote in which only one DBZ gene of a homologous chromosome is KOed. Phase to DBZ genes both homologous chromosomes obtain a homozygote is KO may be crossed siblings heterozygous out of the F ₁ animal obtained as described above. Selection of heterozygotes can be assayed by screening for example F ₁ animals separated extracted chromosomal DNA from the tail by Southern hybridization or PCR method. 1/4 of the F ₂ animals obtained are homozygotes.

  As another preferred embodiment when a virus is used as a targeting vector, a virus comprising a positive selection marker gene inserted between the 5 ′ and 3 ′ arms and a DNA containing a negative selection marker gene outside the arm And a method for infecting non-human mammal ES cells (for example, Proc. Natl. Acad. Sci. USA), Vol. 99, No. 4, pp. 2140-2145, 2002). For example, when using a retrovirus or lentivirus, seed the cells in a suitable incubator such as a dish, add a viral vector to the culture solution (may coexist with polybrene if desired), and culture for 1-2 days. As described above, the selective agent is added and the culture is continued to select cells into which the vector has been incorporated.

  As a specific means of knocking down the DBZ gene, DNA encoding DBZ antisense RNA or siRNA (including shRNA) is introduced using a known per se transgenic production technique, and the target non-human mammalian cell. And the like are expressed in the inside.

DNA containing a base sequence complementary to the target region of the target polynucleotide, that is, DNA capable of hybridizing with the target polynucleotide is "antisense" to the target polynucleotide. it can.
Antisense DNA having a base sequence complementary to or substantially complementary to the nucleotide sequence of a polynucleotide encoding DBZ or a part thereof is complementary or substantially complementary to the nucleotide sequence of a polynucleotide encoding DBZ. Any antisense DNA may be used as long as it contains a complementary base sequence or a part thereof and has an action capable of suppressing the expression of the polynucleotide.

The nucleotide sequence substantially complementary to the polynucleotide encoding DBZ is, for example, about 70% or more, preferably about 80% or more, with respect to the region overlapping with the nucleotide sequence of the complementary strand of the polynucleotide. Preferably, the nucleotide sequence has a homology of about 90% or more, most preferably about 95% or more. The homology of the nucleotide sequences in the present specification can be determined by, for example, using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expected value = 10; allow gaps; filtering = ON ; Match score = 1; mismatch score = -3).
In particular, among the entire nucleotide sequences of the complementary strand of the polynucleotide encoding DBZ, (a) in the case of antisense DNA directed to translation inhibition, the nucleotide sequence of the portion encoding the N-terminal site of the DBZ protein (for example, the start) An antisense DNA having a homology of about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more with a complementary strand of a base sequence near a codon) (b ) In the case of antisense DNA directed to RNA degradation by RNaseH, it is about 70% or more, preferably about 80% or more, more preferably about 90% with the complementary strand of the entire nucleotide sequence of DBZ encoding intron. As described above, antisense DNA having homology of about 95% or more is most preferable.

  Specifically, when the target non-human mammal is a mouse, the base sequence is complementary or substantially complementary to the base sequence registered as GenBank accession No. NM_178679 (VERSION: NM_178679.2, GI: 68448535) Or an antisense DNA containing a part thereof, preferably an antisense DNA containing a base sequence complementary to the base sequence or a part thereof. In addition, when the target non-human mammal is a rat, a base sequence complementary to or substantially complementary to the base sequence represented by GenBank accession No. NM_001025145 (VERSION: NM_001025145.1, GI: 68341936), or one of them An antisense DNA containing a portion, preferably an antisense DNA containing a base sequence complementary to the base sequence or a part thereof, and the like.

  An antisense DNA having a base sequence complementary to or substantially complementary to the base sequence of a polynucleotide encoding DBZ or a part thereof (hereinafter also referred to as “antisense DNA of the present invention”) was cloned, Alternatively, it can be designed and synthesized based on the determined base sequence information of DNA encoding DBZ. Such antisense DNA can inhibit replication or expression of the DBZ gene. That is, the antisense DNA of the present invention can hybridize with RNA (mRNA or initial transcription product) transcribed from the DBZ gene, and inhibits mRNA synthesis (processing) or function (translation into protein). Can do.

The length of the target region of the antisense DNA of the present invention is not particularly limited as long as the antisense DNA hybridizes, and as a result, the translation into the DBZ protein is inhibited. The length of the target region encodes the protein. The entire sequence or partial sequence of mRNA may be used, and the short sequence is about 10 bases, and the long sequence is the entire sequence of mRNA or initial transcription product. Specifically, DBZ gene 5 'end hairpin loop, 5' end 6-base pair repeat, 5 'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3' end untranslated region A 3'-end palindromic region or a 3'-end hairpin loop or the like can be selected as a preferred target region of antisense DNA, but any region within the DBZ gene can be selected as a target. For example, the intron portion of the gene can be used as the target region.
Furthermore, the antisense DNA of the present invention not only hybridizes with DBZ mRNA or initial transcription product to inhibit translation into protein, but also binds to DBZ gene, which is a double-stranded DNA, to bind to a triplex (triplex). ) And can inhibit RNA transcription. Alternatively, a DNA: RNA hybrid may be formed to induce degradation by RNaseH.

In the present specification, double-stranded RNA consisting of an oligo RNA homologous to a partial sequence in the coding region of DBZ mRNA or the initial transcript (including an intron in the case of the initial transcript) and its complementary strand, so-called Short interfering RNA (siRNA) can also be used for production of the KD animals of the present invention. The so-called RNA interference (RNAi) phenomenon, in which siRNA is introduced into cells and the mRNA homologous to the RNA is degraded, has been known for a long time in nematodes, insects and plants. However, it has been widely used as an alternative technology for ribozymes since it was confirmed that it occurs widely [Nature, 411 (6836): 494-498 (2001)]. siRNA can be appropriately designed using commercially available software (eg, RNAi Designer; Invitrogen) based on the base sequence information of the target mRNA.
Alternatively, microRNA (miRNA) targeting DBZ mRNA can also be used for the production of KD animals of the present invention. Examples of such miRNA include mmu-miR-130b, mmu-miR-130a, mmu-miR-301a, mmu-miR-301b, mmu-miR-721 and the like.

  The antisense oligo DNA of the present invention determines the target sequence of mRNA or initial transcript based on the DBZ cDNA sequence or genomic DNA sequence, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.) ) To synthesize a sequence complementary thereto. The synthesized antisense oligo DNA can be inserted downstream of the promoter of the expression vector via an appropriate linker (adapter) sequence as necessary to prepare a DNA expression vector encoding the antisense oligo RNA. it can. Expression vectors that can be used here include plasmids derived from E. coli, plasmids derived from Bacillus subtilis, plasmids derived from yeast, bacteriophages such as λ phage, retroviruses such as Moloney leukemia virus, lentiviruses, adeno-associated viruses, and vaccinia viruses. Or animals such as baculoviruses or insect viruses are used. Of these, plasmids (preferably E. coli-derived, Bacillus subtilis-derived or yeast-derived, especially E. coli-derived plasmids) and animal viruses (preferably retroviruses, lentiviruses) are preferably exemplified. Examples of promoters include SV40-derived early promoter, cytomegalovirus (CMV) long terminal repeat (LTR), Rous sarcoma virus (RSV) LTR, murine leukemia virus (MoMuLV) LTR, adenovirus (AdV) -derived early promoter. And promoters of mammalian constituent protein genes such as β-actin gene promoter, PGK gene promoter, transferrin gene promoter, and the like.

  A DNA expression vector encoding a longer antisense RNA (for example, the full-length complementary strand of DBZ mRNA) can be obtained by using a DBZ cDNA cloned by a conventional method, if necessary, via an appropriate linker (adapter) sequence. It can be prepared by inserting in the reverse direction downstream of the promoter.

  On the other hand, DNA encoding siRNA can be prepared by separately synthesizing as sense strand or antisense strand DNA and inserting each into an appropriate expression vector. As an expression vector for siRNA, one having a Pol III promoter such as U6 or H1 can be used. In this case, siRNA is formed by transcription and annealing of the sense strand and the antisense strand in the animal cell introduced with the vector. shRNA is obtained by inserting a unit in which a base (for example, about 15 to 25 bases) of a length capable of forming an appropriate loop structure is inserted between a sense strand and an antisense strand into an appropriate expression vector. Can be prepared. As an shRNA expression vector, one having a Pol III promoter such as U6 or H1 can be used. In this case, the shRNA transcribed in the animal cell into which the expression vector has been introduced forms a loop by itself, and then is processed by an endogenous enzyme dicer or the like to form a mature siRNA. Alternatively, knockdown can be achieved by RNAi by expressing a microRNA (miRNA) containing a target siRNA sequence with a Pol II promoter. In this case, a tissue-specific knockdown is also possible by a promoter exhibiting tissue-specific expression.

  As a method for introducing an expression vector containing DNA encoding DBZ antisense RNA, siRNA, shRNA, or miRNA into a cell, a method known per se is appropriately used depending on the target cell. For example, a microinjection method is used for introduction into an early embryo such as a fertilized egg. For introduction into ES cells, calcium phosphate coprecipitation method, electroporation method, lipofection method, retrovirus infection method, aggregation method, microinjection method, particle gun method, DEAE-dextran method and the like can be used. Alternatively, when a retrovirus or lentivirus is used as a vector, the virus is added to an early embryo or ES cell, cultured for 1 to 2 days, and the cell is infected with the virus to facilitate gene transfer. May be achievable. Individual regeneration (establishment of a founder), passage (production of a homozygote), and the like from ES cells can be performed by the same method as described above in the KO animal of the present invention.

  In a preferred embodiment, an expression vector comprising DNA encoding antisense RNA, siRNA, shRNA, or miRNA of DBZ is introduced into an early embryo of a target non-human mammal by a microinjection method.

The early embryo of the target non-human mammal can be obtained by collecting in-vivo fertilized eggs obtained by mating male and female of the same non-human mammal, or by collecting eggs and sperm collected from male and female of the same non-human mammal respectively. It can be obtained by fertilization.
Non-human mammals age and breeding conditions are different from each other by the animal species used, for example, a mouse (preferably an inbred mouse such as C57BL / 6J (B6), etc. F ₁ of B6 and another inbred strain) Are preferably about 4 to about 6 weeks of age for females and about 2 to about 8 months of age for males, and about 12 hours light condition (for example, 7: 00-19: 00) Those raised for one week are preferred.

In vivo fertilization may be by natural mating, but in order to regulate the sexual cycle and to obtain a large number of early embryos from one individual, after inducing superovulation by injecting gonadotropin to a female non-human mammal, A method of mating with a non-human mammal is preferred. As a method for inducing ovulation in female non-human mammals, for example, follicle stimulating hormone (pregnant horse serum gonadotropin, generally abbreviated as PMSG) and luteinizing hormone (human chorionic gonadotropin, generally abbreviated as hCG) Is preferably administered by, for example, intraperitoneal injection, but the preferred dose and interval of administration of hormones differ depending on the type of non-human mammal. For example, in the case of the non-human mammal is a mouse (preferably an inbred mouse such as C57BL / 6J (B6), etc. F ₁ of B6 and another inbred strain), usually after follicle stimulating hormone administration, about 48 hours later, luteinizing hormone is administered, and a method of obtaining a fertilized egg by immediately mating with a male mouse is preferred, and the dosage of follicle stimulating hormone is about 20 to about 50 IU / individual, preferably about 30 IU / individual, luteinization The dosage of the hormone is about 0 to about 10 IU / individual, preferably about 5 IU / individual.

  After a certain period of time, open the abdominal cavity of a female non-human mammal whose mating has been confirmed by inspection of the vaginal plug, etc., remove the fertilized egg from the oviduct and culture medium for embryo culture (eg, M16 medium, modified Whitten medium, BWW medium, Wash in M2 medium, WM-HEPES medium, BWW-HEPES medium, etc.) to remove cumulus cells, and incubate to DNA microinjection in 5% carbon dioxide / 95% air by the microdrop culture method. If microinjection is not performed immediately, the collected fertilized eggs can be stored frozen by a slow method or an ultra-rapid method.

  On the other hand, in the case of in vitro fertilization, ovulation was induced by administering follicle stimulating hormone and luteinizing hormone to female non-human mammals for egg collection (similar to those used in in vivo fertilization are preferably used) as described above. Thereafter, the ovum is collected and cultured in a fertilization medium (eg, TYH medium) in the atmosphere of 5% carbon dioxide / 95% by microdrop culture or the like until in vitro fertilization. On the other hand, the epididymis tail is taken out from the same kind of male non-human mammal (the same as in the case of in-vivo fertilization), and the sperm mass is collected and pre-cultured in a fertilization medium. Sperm after completion of pre-culture is added to the fertilization medium containing the egg and cultured in 5% carbon dioxide / 95% air by the microdrop culture method, etc., and then the fertilized egg having two pronuclei is observed under a microscope. Select. When DNA microinjection is not performed immediately, the obtained fertilized egg can be frozen and stored by a slow method or an ultra-rapid method.

  Microinjection of DNA into a fertilized egg can be performed according to a conventional method using a known apparatus such as a micromanipulator. Briefly, a fertilized egg placed in a microdrop of embryo culture medium is aspirated and fixed with a holding pipette and the DNA solution is directly injected into the male or female pronucleus, preferably into the male pronucleus, using an injection pipette. inject. The introduced DNA is preferably highly purified by CsCl density gradient ultracentrifugation or an anion exchange resin column. The introduced DNA is preferably linearized by cleaving the vector portion using a restriction enzyme.

  The fertilized egg after DNA introduction is cultured from the 1st cell stage to the blastocyst stage in 5% carbon dioxide gas / 95% air in the embryo culture medium by microdrop culture etc. Transplanted into the fallopian tube or uterus of a non-human mammal. The female non-human mammal for embryo transfer may be of the same kind as the animal from which the early embryo to be transplanted is derived. For example, when transplanting a mouse early embryo, an ICR female mouse (preferably about 8 to about 10 weeks old) is preferably used. Examples of a method for putting a female non-human mammal for embryo transfer into a pseudopregnant state include, for example, the same type of vasectomized (ligated) male non-human mammal (for example, in the case of a mouse, an ICR male mouse (preferably about 2 There is known a method of selecting those in which the presence of vaginal plugs has been confirmed by mating with those a month old or older)).

Embryonic females may be naturally ovulated, or administered luteinizing hormone-releasing hormone (generally abbreviated as LHRH) or its analog prior to mating with a vasectomized (ligated) male. Alternatively, fertility induced may be used. Examples of LHRH analogs include [3,5-DiI-Tyr ⁵ ] -LH-RH, [Gln ⁸ ] -LH-RH, [D-Ala ⁶ ] -LH-RH, [des-Gly ¹⁰ ]- Examples include LH-RH, [D-His (Bzl) ⁶ ] -LH-RH, and their ethylamide. The dose of LHRH or an analog thereof and the timing of mating with a male non-human mammal after the administration vary depending on the type of non-human mammal. For example, when the non-human mammal is a mouse (preferably an ICR mouse, etc.), it is usually preferable to cross with a male mouse about 4 days after administration of LHRH or an analog thereof. The dose of the analog is usually about 10-60 μg / individual, preferably about 40 μg / individual.

  Usually, when the early embryo to be transplanted is after the morula stage, the embryo is transplanted into the uterus of the female embryo for embryo transfer, and before that (for example, 1-cell to 8-cell embryo). As a female for embryo transfer, a female whose a certain number of days has passed since pseudopregnancy is appropriately used depending on the stage of development of the transplanted embryo. For example, in the case of mice, female mice about 0.5 days after pseudopregnancy are preferable for transplanting 2-cell stage embryos, and female mice about 2.5 days after pseudopregnancy are preferable for transplanting blastocyst stage embryos. After anesthetizing females for embryo transfer (preferably Avertin, Nembutal, etc. are used), incisions are drawn to draw out the ovaries, and early embryos (about 5 to about 10) suspended in embryo culture medium are pipetted for embryo transfer Inject into the fallopian tube or near the fallopian junction at the uterine horn.

  If the transplanted embryo is successfully implanted and the recipient female becomes pregnant, a non-human mammal can be obtained by natural delivery or caesarean section. It is only necessary to continue suckling to the naturally delivered embryos, and if the baby is delivered by caesarean section, the offspring is a separately provided female female (for example, in the case of a mouse, a female mouse normally mated and delivered) Can be fed into ICR female mice))).

Introduction of DNA encoding DBZ antisense RNA, siRNA, shRNA, or miRNA at the fertilized egg cell stage is ensured so that the introduced DNA is present in all germ line cells and somatic cells of the subject non-human mammal. Whether or not the introduced DNA is incorporated into the chromosomal DNA can be assayed, for example, by screening the chromosomal DNA separated and extracted from the tail of the offspring by Southern hybridization or PCR. The presence of a targeting vector in germline cells of non-human mammals (F ₀ ) obtained as described above means that all of the progeny (F ₁ ) animals have their germline cells and somatic cells in all. It means that a targeting vector exists.
Usually, F ₀ animals are obtained as heterozygotes having the introduced DNA only on one of the homologous chromosomes. Individual F ₀ individuals are randomly inserted on different chromosomes unless homologous recombination is used. To obtain homozygotes with targeting vectors on both homologous chromosomes, F ₀ animals and non-transgenic animals are crossed to create F ₁ animals, and heterozygotes with introduced DNA only on one of the homologous chromosomes You only have to cross your brothers and sisters. If only introduced DNA is integrated into a locus, 1/4 of the obtained F ₂ animals would be homozygotes.

  As another preferred embodiment when a virus is used as a vector, as in the case of the KO animal, a virus containing DNA encoding DBZ antisense RNA, siRNA, shRNA, or miRNA is used. Examples include a method of infecting an early embryo or ES cell. When using a fertilized egg as a cell, it is preferable to remove the zona pellucida prior to infection. After incubating with a viral vector for 1-2 days, if it is an early embryo, transplant it into the oviduct or uterus of a female non-human mammal for embryo transfer pseudopregnant as described above, and if it is an ES cell Then, the selective agent is added as described above, and the culture is continued to select cells into which the vector has been incorporated.

  Furthermore, as described in Proc. Natl. Acad. Sci. USA, 98, 13090-13095, 2001, a spermatogonia collected from a male non-human mammal can be used as a viral vector during co-culture with STO feeder cells. After infection, injected into the seminiferous tubules of male infertile non-human mammals and mated with female non-human mammals to efficiently heterologize DNA encoding antisense RNA, siRNA, shRNA, or miRNA of DBZ. Tg (+/-) offspring can be obtained.

The non-human mammal deficient in DBZ gene expression of the present invention has the following characteristics compared to the corresponding wild-type animal:
(A) the number of cells in the cerebral cortex is decreased, and / or (b) the growth of neurites is suppressed, and / or (c) the cell migration during cerebral cortex formation is delayed, and And / or (d) the oligodendrocyte differentiation is suppressed.
The cerebral cortex has a layer structure consisting of six layers of neurons, and each layer is regularly arranged with morphologically similar types of neurons, and at the same time forms a layer-specific neural network. The layer in which the decrease in the number of cells is observed is not particularly limited and is recognized as a whole, but may be particularly remarkable in the II / III to V layers. A decrease in the number of cells in the cerebral cortex is observed from embryonic to adult.
In cerebral cortex formation, neurons born in the vicinity of the ventricle (ventricular zone VZ / subventricular zone SVZ) move to the intermediate zone (IZ) and further to the cortical plate (CP), and are functionally different 6 layers Form a structure. When this process becomes abnormal, it causes various nervous system diseases, and nerve cell migration is an essential developmental stage for the brain to function normally. In the non-human mammal deficient in expression of the DBZ gene of the present invention, the migration of nerve cells during the formation of the cerebral cortex is delayed as compared with the wild type animal.

  In the present specification, the term “neurite” is used to mean both dendrites and axons. The term “growth” of neurites is used to include all of axon elongation, synapse formation, spine formation, dendritic branching, and increase in neurite thickness. In the non-human mammal deficient in DBZ gene expression of the present invention, the growth of neurites is suppressed as compared to wild-type animals. For example, as shown in Examples below, the dendritic shape of pyramidal cells in early childhood The protrusions are thinner than the wild-type animals and there are few branches.

As used herein, “differentiation of oligodendrocytes” refers to the degree of differentiation to oligodendrocytes that have formed myelin (myelin sheath). Therefore, “differentiation of oligodendrocytes is suppressed” in the present invention means (1) when the differentiation process from oligodendrocyte precursor cells to oligodendrocytes is suppressed, (2) oligodendrocyte precursors The term is used to encompass both cases where cell proliferation and survival are inhibited, resulting in a decrease in the number of oligodendrocyte cells, and a combination of both.
Specifically, oligodendrocyte differentiation is caused by changes in the expression level or cell morphology of oligodendrocyte marker proteins (genes) such as CNPase, MBP (myelin basic protein), MAG (myelin-binding glycoprotein), or The degree of differentiation can be evaluated by the number of living cells (proliferation / survival) of oligodendrocytes and their progenitor cells. The expression of these marker proteins (genes) is remarkably reduced in non-human mammals deficient in DBZ gene expression compared to the corresponding wild-type animals.

  The DBZ gene expression-deficient non-human mammal of the present invention causes the same or similar pathological condition as a disease involving regulation of DBZ activity in addition to the inactivated expression of the endogenous DBZ gene. May have one or more other genetic modifications. Examples of diseases that involve DBZ activity modulation include schizophrenia, mood disorders (such as mania, depression, manic depression), bipolar disorders and other neurological diseases and diseases that exhibit myelin abnormalities. Other gene modifications include naturally occurring disease model animals that have abnormalities in endogenous genes due to spontaneous mutations, Tg animals that have been introduced with other genes, and KO / that have inactivated endogenous genes other than the DBZ gene. KD animals (including Tg animals whose gene expression has been reduced to an undetectable or negligible level due to the introduction of antisense DNA or DNA encoding neutralizing antibodies in addition to gene disruption due to insertion mutations, etc.) Examples include dominant negative mutant Tg animals into which sex genes have been introduced.

  Examples of the “disease model having one or more other gene modifications that cause the same or similar pathological condition as a disease involving the regulation of DBZ activity” include, for example, the DISC1 gene modification model (PNAS, 2006; 103: 3693-3697; Neuron, 2007; 54: 387-402; PNAS, 2007; 104: 14501-14506; Mol Psychiatry, 2008; 13: 173-186; J Neurosci, 2008; 28: 10893-10904), New Reguline-1 gene hetero-modified mice (Am J Hum Genet, 2002; 71: 877-892; Neuroreport, 2005; 16: 271-275; Neuroreport, 2006; 17: 79-83), catechol-O-methyltransferase ( COMT) genetically modified mice (PNAS, 1998; 95: 9991-9996), proline dehydrogenase (PRODH) genetically modified mice (Nat Genet, 1999; 21: 434-439; Nat Neurosci, 2005; 8: 1586-1594), dopamine Transporter (DAT) deficient mice (Behav Pharmacol, 2000; 11: 279-290), NMDA receptor subunit gene modified mice (Cell, 1999; 98: 427-436; J Neurosci, 2002; 22: 6713-6723; J Neurosci, 2001; 21: 750-757), and the like.

  There is no particular limitation on the method for introducing one or more other genetic modifications that cause the same or similar pathological condition to a disease involving regulation of the activity of DBZ into the expression-deficient animal of the present invention.For example, (1) A method of crossing an animal with an expression deficiency with a non-human mammal of the same species having one or more other gene modifications that cause the same or similar pathological condition as a disease involving regulation of DBZ activity; (2) regulation of DBZ activity Treating early embryos and ES cells of non-human mammals with one or more other genetic modifications that cause the same or similar pathology to the disease involved in the treatment as described above to inactivate endogenous DBZ gene expression A method for obtaining a KO / KD animal; (3) a non-human mammal early embryo or ES cell in which an endogenous DBZ gene is inactivated, by the method described above, the same as a disease involving the regulation of DBZ activity or One or more other genes that cause similar pathologies And a method of introducing the change. In addition, when one or more other genetic modifications that cause the same or similar pathology as a disease involving the regulation of DBZ activity are due to the introduction of a foreign gene or a dominant mutant gene, the early embryo or ES of a wild-type non-human mammal A KO / KD animal may be obtained by introducing the foreign gene or the like and a targeting vector / antisense RNA or DNA encoding siRNA simultaneously or sequentially into a cell.

  The expression-deficient animal of the present invention may have been subjected to one or more non-genetic treatments that cause the same or similar pathology as a disease involving regulation of DBZ activity. “Non-genetic treatment” means treatment that does not cause genetic modification in the subject non-human mammal. Examples of such treatment include stimulant administration, phencyclidine (PCP) acute or continuous administration, neonatal ventral hippocampal damage, perinatal virus infection or synthetic double-stranded RNA administration, neonatal PCP administration, etc. However, it is not limited to these.

The above characteristics (a) to (d) of the KO / KD animal of the present invention well reflect the brain organic changes observed in human nervous system diseases, particularly schizophrenia. Although the previous results of applying a dominant negative form of DBZ to nerve cells suggest an effect on DBZ neurite outgrowth, in nervous system diseases, a gene that inactivates a single candidate gene. It is an established theory in the art that it is extremely difficult to faithfully reflect the disease state in the modified animal, and that an animal deficient in DBZ gene expression thus exhibits a phenotype that closely mimics human nervous system diseases. This is an unexpected result.
In addition, the characteristic of (d) is that various diseases exhibiting abnormality in the process of myelination (reformation after formation or injury) such as multiple sclerosis, acute disseminated encephalomyelitis, inflammation Diffuse sclerosis, myelin abnormalities associated with infection (subacute sclerosing panencephalitis, progressive multifocal leukoencephalopathy), poisoning / metabolic myelin abnormalities (hypoxic encephalopathy, central pontine myelopathy, vitamin B12 Deficiency), central nervous system diseases such as vascular myelinopathy (Binswanger's disease), peripheral nervous system diseases such as Guillain-Barre syndrome, Fisher syndrome, chronic inflammatory demyelinating polyradiculoneuritis, etc. ing.
As described above, since the KO / KD animal of the present invention closely mimics the organic changes in the brain in human nervous system diseases and myelin abnormalities in various nervous system diseases, it is used as a model animal for human nervous system diseases. be able to. Examples of the nervous system diseases include schizophrenia, mood disorders (manic, depression, manic depression, etc.), bipolar disorder, attention deficit / hyperactivity disorder, autism, and the above myelin abnormalities The KO / KD animal of the present invention is preferably used as a model animal of a disease exhibiting schizophrenia, mood disorder or myelin abnormality, more preferably a disease exhibiting schizophrenia or myelin abnormality. be able to.

For example, the KO / KD animal of the present invention can be used to screen for therapeutic and / or preventive drugs for nervous system diseases.
That is, in one aspect of the present invention, the following steps:
(1) A step of applying a test substance to any of the above DBZ gene expression deficient animals or brain tissue derived from the animals,
(2) examining the number of cells in the cerebral cortex of the animal, neurite growth in the central nervous tissue of the animal, cell migration in the brain tissue, or differentiation of oligodendrocytes in the brain of the animal; and (3) When the number of cells in the cerebral cortex increases, neurite growth is promoted, cell migration is promoted, or oligodendrocyte differentiation is promoted, compared to the case where the test substance is not applied. There is provided a screening method for a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease.
In the step (1), when an animal individual deficient in DBZ gene expression is used, the test substance is applied by administering the test substance to the animal individual. As the test substance, in addition to known synthetic compounds, peptides, proteins, DNA libraries, etc., for example, mammalian tissue extracts (eg, mice, rats, pigs, cows, sheep, monkeys, humans, etc.), cells A culture supernatant or the like is used. The administration method of the test substance is not particularly limited. For example, the test substance is administered orally or parenterally (eg, intravenous, intramuscular, intraperitoneal, intraarterial, subcutaneous, intradermal, intratracheal, etc.) in the form of solid, semi-solid, liquid, aerosol, etc. can do. The dosage of the test substance varies depending on the type of compound, animal species, body weight, dosage form, etc., and can be appropriately selected from the range of 0.01 to 1000 mg / kg / day, for example, and the amount is once a day. Or it can be administered in several divided doses. The administration period is not particularly limited, but can be administered every day for 1 to 14 days or every 2 to 4 days, for example.
On the other hand, in the step (1), when a brain tissue collected from a DBZ gene expression deficient animal is used, the test substance can be applied by adding the test substance to the culture solution of the brain tissue. The addition concentration of the test substance can be appropriately selected from the range of 0.1 to 1000 μmol / L, for example. The brain tissue is cultured for 1 to 72 hours in the presence of the test substance, and then subjected to step (2). Examples of the brain tissue include, but are not limited to, a slice tissue prepared using a vibratome from a fetal brain preferably about 14 to 17 days old in the case of a mouse. Prior to brain tissue preparation, a reporter gene such as GFP and DsRed with a nuclear translocation signal is introduced into the cerebral cortex of mouse embryos around 12 to 15 days of gestation to visualize nerve cells. It is desirable to keep it.

  In step (2), a disease state like a nervous system disease in the DBZ gene expression-deficient animal or brain tissue thereof, that is, an organic change in the brain is examined. When using an animal individual, the brain is removed from the individual and a frozen section of the cerebral cortex is prepared, or a block of a central nervous tissue (eg, cerebral neocortex, etc.) is prepared. Nerve cells in frozen sections of cerebral cortex are stained using Nissl staining or the like, and the number of cells per layer is counted. The central nervous system block stains neurites (axons and / or dendrites) by Golgi staining and observes the degree of growth (axon elongation, thickness, dendritic branching, thickness, etc.) To do. When using brain tissue (eg, mouse embryonic cerebral cortex), a tissue section of the fetal brain taken at a time when migrating neurons convert to locomotion cells is cultured in the presence of the test substance under a time-lapse microscope. Measure the speed of nuclear movement of locomotion cells.

  In step (3), the degree of organic change in the brain examined in step (2) is compared with the degree of change in the animal to which the test substance was not applied or in its brain tissue. As a result, when the test substance is not applied, the number of cells in the cerebral cortex increases, the growth of neurites is promoted, or the cell migration is promoted. It selects as a candidate of the substance which has the treatment and / or prevention effect of a disease. On the other hand, when the test substance is not applied, when the number of cells in the cerebral cortex decreases, neurite growth is suppressed, or cell migration is suppressed, for example, the test substance is a pharmaceutical. In the case of a compound or a component contained in food, the test substance can be identified as an exacerbation factor for nervous system diseases.

  In another embodiment, in the step (2), a DBZ gene-deficient animal or its brain tissue is examined for a disease state like a nervous system disease, that is, an oligodendrocyte differentiation abnormality. The degree of oligodendrocyte differentiation is determined by immunological techniques using antibodies that specifically react with the markers of myelin-formed oligodendrocyte differentiation marker proteins such as CNPase, MBP, and MAG. Detection or quantification can be performed by (immunostaining, Western blotting, etc.), or gene expression of the marker can be evaluated by detection / quantification by quantitative RT-PCR, Northern blotting, or the like. Alternatively, it can be evaluated by microscopic observation of changes in actual cell morphology. Furthermore, as described above, the suppression of oligodendrocyte differentiation can occur not only by suppressing the differentiation process from oligodendrocyte precursor cells to oligodendrocytes, but also by inhibiting the proliferation or survival of the progenitor cells. The degree of site differentiation can also be assessed by measuring the number of living oligodendrocytes and their progenitor cells.

  In step (3), the degree of oligodendrocyte differentiation examined in step (2) is compared with the degree of change in the animal to which the test substance was not applied or in its brain tissue. As a result, when the oligodendrocyte differentiation (myelin formation or cell proliferation / survival) is promoted compared to the case where the test substance is not applied, the test substance is treated with abnormal oligodendrocytes or myelin sheath. It selects as a candidate of the substance which has the therapeutic and / or preventive effect of the nervous system disease which exhibits abnormality. On the other hand, when oligodendrocyte differentiation (myelin formation or cell proliferation / survival) is further suppressed as compared to the case where the test substance is not applied, for example, the test substance is a pharmaceutical compound. In the case of a component contained in food, the test substance can be identified as an exacerbation factor of the above-mentioned nervous system disease.

Since the KO / KD animal of the present invention closely mimics the brain's organic changes in human nervous system diseases, positive symptoms, negative symptoms, behavioral disorders, which are seen in nervous system diseases such as schizophrenia and mood disorders, It may exhibit a phenotype such as cognitive impairment. Thus, in another aspect of the invention, the following steps:
(1) a step of administering a test substance to any of the above-mentioned DBZ gene-deficient animals,
(2) a step of examining behavioral abnormalities in the animal; and (3) treatment of a nervous system disease when the behavioral abnormalities are improved as compared to the case where the test substance is not applied. A method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting as a candidate for a substance having a preventive effect is provided.
The administration of the test substance in the step (1) can be carried out in the same manner as in the case of the above screening method using the brain organic change as an index.
As an evaluation method for behavioral abnormalities in the step (2), for example, as an evaluation method for positive symptoms (such as hallucinations, delusions, and tension disease symptoms), an open field test, a drug-induced motor activity enhancement test, a spontaneous motor activity measurement test, etc. Motivation by exercise measurement, behavioral evaluation using social behavioral disorder as an index, forced swimming test, tail suspension test, etc. as an evaluation method of momentum measurement, negative symptoms (feeling dull, motivation decline, communicative disorder, etc.) Behavioral evaluation based on decline, behavioral evaluation based on anxiety emotions such as elevated cross-maze test, behavioral evaluation based on information processing disorder due to prepulse inhibition as an evaluation method for cognitive impairment, T-shaped maze Behavioral evaluation using work memory as an index for tasks and 8-way radial maze tasks, and working memory and attention through set-shifting tests Examples include behavioral evaluations based on targets, behavioral evaluations based on latent learning (attention) through water exploration tests, and behavioral evaluations based on object recognition memory using novel object recognition tests, but are not limited to these. Any behavioral test routine in the field of behavioral pharmacology can be used.
In step (3), the degree of behavioral abnormality investigated in step (2) is compared with the degree of behavioral abnormality in animals to which the test substance was not applied. As a result, when the behavioral abnormality is improved as compared with the case where the test substance is not applied, the test substance is selected as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease. On the other hand, when the behavioral abnormality is worse than when the test substance is not applied, for example, when the test substance is a pharmaceutical compound or a component contained in food, the test substance is not used. The test substance can be identified as an exacerbation factor of nervous system diseases.

The present invention also provides a method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease using a mammalian cell deficient in DBZ gene expression. That is, the method comprises the following steps:
(1) A step of bringing a test substance into contact with a mammalian cell deficient in DBZ gene expression,
(2) a step of inducing differentiation of the cells into oligodendrocytes,
(3) The step of examining the degree of oligodendrocyte differentiation in the cell population obtained by (2) above, and (4) oligodendrocyte differentiation is promoted compared to the case where the test substance is not contacted. A step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease.

  The DBZ gene-deficient mammalian cell used in the step (1) is a cell prepared from the above-mentioned DBZ gene-deficient non-human mammal and capable of differentiating into oligodendrocytes (for example, oligodendrocyte precursor cells and It may be a more undifferentiated cell (neural stem cell or the like), or a cell having the ability to differentiate into oligodendrocytes prepared from a brain tissue derived from a mammal by a conventional method. It may be produced by applying the same knockout / knockdown technique as used in the production of mammals. In the latter case, it is also possible to obtain human-derived DBZ gene expression deficient mammalian cells. However, since gene targeting to human ES cells is low in efficiency, it is more efficient to knock down DBZ transiently with siRNA etc. in well-differentiated human cells such as oligodendrocyte precursor cells. Since it is difficult to obtain human oligodendrocyte progenitor cells, in one embodiment, iPS cells were established from any human somatic cells, and the iPS cells were induced to differentiate into oligodendrocyte progenitor cells. Later, a technique of transiently knocking down the expression of DBZ in the cells with siRNA or the like can be used.

  The contact of the test substance in the step (1) can be performed by adding the test substance to the culture solution of the brain tissue. The addition concentration of the test substance can be appropriately selected from the range of 0.1 to 1000 μmol / L, for example.

Methods for preparing cells having the ability to differentiate into oligodendrocytes from mammalian brain tissue are well known (see, for example, Nature Protocols, 2007, Vol. 2, p1044). This can be carried out according to the method described in Example 5. A reagent kit for inducing differentiation of oligodendrocytes from ES cells or iPS cells is commercially available. Shh, PDGF, triiodothyronine (T3), insulin-like growth factor-I (IGF-I) and the like are known as factors that promote differentiation induction from neural stem cells to oligodendrocytes. As defined "differentiation of oligodendrocytes", differentiation into myelinating oligodendrocytes is induced by removing PDGF from the medium. Therefore, as a DBZ knockdown timing in oligodendrocyte progenitor cells, a preferred embodiment includes simultaneous with medium exchange to a PDGF-free medium.
Depending on the case, step (1) and step (2) may be performed earlier or simultaneously.

  Step (3) can be performed by the same method as described in the screening method using the non-human mammal deficient in DBZ gene expression.

  In step (4), the degree of oligodendrocyte differentiation examined in step (4) is compared with the degree of change in cells to which the test substance was not applied. As a result, when the oligodendrocyte differentiation (myelin formation or cell proliferation / survival) is promoted compared to the case where the test substance is not applied, the test substance is treated with abnormal oligodendrocytes or myelin sheath. It selects as a candidate of the substance which has the therapeutic and / or preventive effect of the nervous system disease which exhibits abnormality. On the other hand, when oligodendrocyte differentiation (myelin formation or cell proliferation / survival) is further suppressed as compared to the case where the test substance is not applied, for example, the test substance is a pharmaceutical compound. In the case of a component contained in food, the test substance can be identified as an exacerbation factor of the above-mentioned nervous system disease.

  Substances having therapeutic and / or prophylactic effects for neurological diseases selected by the above screening method may be used alone or mixed with pharmacologically acceptable carriers, excipients, diluents, etc. It can be administered orally or parenterally as a pharmaceutical composition in dosage form.

  Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like. On the other hand, as a composition for parenteral administration, for example, injections, suppositories and the like are used, and injections include intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. Dosage forms may be included. These formulations include excipients (eg sugar derivatives such as lactose, sucrose, sucrose, mannitol, sorbitol; starch derivatives such as corn starch, potato starch, alpha starch, dextrin; cellulose derivatives such as crystalline cellulose; Gum arabic; dextran; organic excipients such as pullulan; and silicate derivatives such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate and magnesium metasilicate aluminate; phosphates such as calcium hydrogen phosphate; Carbonates such as calcium; inorganic excipients such as sulfates such as calcium sulfate), lubricants (eg, stearic acid metal salts such as stearic acid, calcium stearate, magnesium stearate; talc; Colloidal silica; wax like beeswax and gay wax Borax; adipic acid; sulfate such as sodium sulfate; glycol; fumaric acid; sodium benzoate; DL leucine; lauryl sulfate such as sodium lauryl sulfate and magnesium lauryl sulfate; anhydrous silicic acid, silicic acid hydrate Such as silicic acids; and the above-mentioned starch derivatives), binders (for example, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, and compounds similar to the excipients), disintegrants ( For example, cellulose derivatives such as low substituted hydroxypropyl cellulose, carboxymethyl cellulose, carboxymethyl cellulose calcium, internally crosslinked sodium carboxymethyl cellulose; carboxymethyl starch, carboxymethyl starch sodium, crosslinked poly Chemically modified starches and celluloses such as livinylpyrrolidone), emulsifiers (for example, colloidal clays such as bentonite and bee gum; metal hydroxides such as magnesium hydroxide and aluminum hydroxide; sodium lauryl sulfate Anionic surfactants such as calcium stearate; cationic surfactants such as benzalkonium chloride; and nonionic interfaces such as polyoxyethylene alkyl ethers, polyoxyethylene sorbitan fatty acid esters, sucrose fatty acid esters Activators), stabilizers (paraoxybenzoates such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol and phenylethyl alcohol; benzalkonium chloride; phenol, cresol Such phenols; thimerosal; dehydroacetic acid; and sorbic acid), flavoring agents (for example, commonly used sweeteners, acidulants, fragrances, etc.), well-known additives using diluents, etc. It is manufactured by the method.

  The dose of the active ingredient of the agent for preventing and treating nervous system diseases in the present invention can vary depending on various conditions such as the patient's symptom, age, weight, etc., but in the case of oral administration, the lower limit is 0.1 mg per dose ( Preferably 0.5 mg), upper limit 1000 mg (preferably 500 mg), in the case of parenteral administration, lower limit 0.01 mg (preferably 0.05 mg), upper limit 100 mg (preferably 50 mg) per dose, It can be administered 1 to 6 times per day for adults. The dose may be increased or decreased depending on the symptoms.

  Furthermore, the agents for preventing and treating nervous system diseases of the present invention include other drugs such as chlorpromazine, haloperidol, thiothixene, clozapine, risperidone, olanzapine and quetiapine, antipsychotic drugs such as clonazepam and diazepam, lithium, You may use together with mood stabilizers, such as carbamazepine and valproic acid. The agent for preventing / treating nervous system diseases of the present invention and these other agents can be administered simultaneously, sequentially or separately.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited at all by these Examples.

Example 1 Production of DBZ Knockout Mice Procedures related to the production of knockout mice were approved by the Animal Ethics Committee of Osaka University.
The DBZ locus was amplified by PCR from the genome of E14 (day 14 embryo) mouse ES cells using LA-Taq polymerase (TaKaRa, Kyoto, Japan). A targeting vector was constructed by replacing a 1.3 kb genomic DNA fragment containing the second exon of DBZ with a PGK-neo-poly (A) cassette (FIG. 1). Thus, the vector contains 1.1 kb and 6.9 kb homologous regions 5 'and 3' to the neomycin resistance gene (neo), respectively. A PGK-tk-poly (A) cassette was ligated to the 3 ′ end of the targeting construct. Maintenance, transfection and selection of mouse ES cells were performed as described in Nakayama K et al., Cell, 85: 707-720 (1996). The occurrence of recombination was confirmed by PCR analysis of a 9.1 kb genomic DNA fragment adjacent to the 5 ′ homology region (FIG. 2A). Mutant ES cells were microinjected into C57BL / 6 blastocysts and the resulting chimeric males were mated with C57BL / 6 female mice. Homozygous mutant animals were produced by crossing heterozygous offspring. In order to determine the genotype of the mouse, genomic DNA was extracted from the tail, D5 (5'-AGTGCTGGGGAAGAGAACCTGTAG-3 '; SEQ ID NO: 1) as a forward primer, and W1 (5'-ACCTCCTGCTCTTGACTATACAATCTAC-3'; sequence as a reverse primer No. 2) and N199 (5′-AACTTCCTGACTAGGGGAGGAGTAGAAGGT-3 ′; SEQ ID NO: 3) (FIG. 1) were analyzed by PCR (FIG. 2B). In addition, RNA was extracted from the brain tissue of homozygous knockout mice, heterozygous knockout mice and wild type mice, and the expression of DBZ gene was examined by quantitative RT-PCR or Western blotting using anti-DBZ antibody. It was confirmed that expression was inactivated (FIGS. 2C and D).

Example 2 Histological Analysis of Adult DBZ Knockout Mice Brains were removed from heterozygous DBZ knockout mice, homozygous DBZ knockout mice and wild type mice (20 weeks old, female or male) prepared in Example 1, and 4% After fixing paraformaldehyde, it was embedded in paraffin to prepare a cortical slice. The sections were subjected to KB staining and Nissl staining for comparison, and an abnormality in brain structure was analyzed by microscopic observation. The brains of DBZ knockout mice did not show gross morphological abnormalities (FIG. 3).

  The number of cells in the cerebral cortex was observed with a microscope using a section of the brain of an adult mouse subjected to Nissl staining (FIG. 4). As a result of counting the number of cells in each layer of the cerebral cortex, the brain of the adult DBZ knockout mouse was compared with the brain of the wild type mouse in each of the layers II / III, IV and V. A significant decrease was seen (Figure 5).

Example 3 Histological analysis of juvenile and embryonic DBZ knockout mice Brains were removed from juvenile homozygous DBZ knockout mice on day 3 of birth and embryonic mice on day of embryonic day 17.5, and cerebral cortex sections were prepared in the same manner as in Example 2. Nissle staining was performed, and the number of cells was observed under a microscope, and compared with the brains of wild-type mice (FIGS. 6 and 7). As a result of counting the number of cells in each cerebral cortex layer of young mice, the DBZ knockout mouse brain was compared with the wild-type mouse brain in each of the II / III layer (II / III / IV layer) and V layer. Thus, a significant decrease in the number of cells was observed (FIG. 6). On the other hand, in embryonic mice, the number of cells was reduced in the cortical plate (CP) compared to the brain of wild-type mice (FIG. 7).

  Next, Golgi staining was performed using a brain tissue section of a young mouse on the third day of birth to stain neurons. The neocortical pyramidal dendrites of young DBZ knockout mice were thinner and less branched than wild-type mice (FIG. 8).

Example 4 Cerebral cortex formation in DBZ knockout mice BrdU (50 mg / kg) was administered once every 24 hours to homozygous DBZ knockout mice and wild type mice at 14.5 days of gestation, and then embryonic mice (E17.5) The brain was removed, fixed with 4% paraformaldehyde, and then embedded in paraffin to prepare a brain section. The sections were immunostained using an anti-BrdU antibody, and the cells incorporating BrdU were observed. As a result, in DBZ knockout mice, neuronal cell migration during cerebral cortex formation was delayed compared to wild-type mice (FIG. 9).

Example 5 DBZ expression in primary oligodendrocytes and oligodendrocyte progenitor cells
With reference to the method described in Chen et al. (Nature Protocols, 2007, Vol. 2, p1044), oligodendrocyte primary culture was performed as follows.
The cerebrum was removed from a 1-day-old rat, and the olfactory bulb, hippocampus, and buffy coat were removed under a stereomicroscope. After chopping finely in Eagle MEM medium using a micro scissors, dispase I was added. The tissue was loosened by gently pipetting with a P1000 pipetteman, and then incubated at 37 ° C. for 5 minutes. DNaseI was added and lightly pipetted with a P1000 pipetteman, then incubated at 37 ° C. for 10 minutes. After lightly pipetting with a P1000 pipetman, Eagle MEM medium (MEM (+)) containing 10% serum was added. A cell suspension obtained by pipetting 20 times by attaching a 200 μl tip to a 10 ml measuring pipette was passed through a 70 μm filter to remove residues. Cell sediment was collected by centrifugation at 1000 rpm for 5 minutes, and suspended in 5 ml MEM (+) / 1 cerebrum. This was seeded in a culture bottle previously coated with poly-L-lysine (cerebrum for ^two per 75 cm ^{2 of} bottom area) and cultured in a 10 ° C. carbon dioxide incubator at 37 ° C. Thereafter, the culture was continued for 10 to 14 days while exchanging the medium with fresh MEM (+) once every 3 days.

  The medium was changed in the morning of the 10th to 14th days, and the culture bottle was shaken at 200 rpm for about 20 hours from that night. The culture supernatant containing the detached cells was collected and passed through a 70 μm filter to remove the residue. This was seeded in a culture dish and left at 37 ° C. for 1 hour. The supernatant is collected and seeded in a culture bottle pre-coated with poly-L-lysine. After 4 to 5 hours, it is confirmed that the cells have adhered to the bottom of the culture bottle, then insulin, neurotrophin 3, and platelet-derived growth factor The medium was replaced with Neurobasal medium containing L-glutamine and B27 culture additives. Thereafter, differentiation into oligodendrocytes was induced by exchanging the medium with a Neurobasal medium containing insulin, neurotrophin 3, L-glutamine, and B27 culture additives.

  The expression of DBZ gene in the obtained oligodendrocytes and oligodendrocyte progenitor cells before PDGF removal was examined by quantitative RT-PCR in the same manner as in Example 1 and compared with each other and with neurons and astrocytes. The time course of DBZ expression after PDGF removal was also examined. The results are shown in FIG. DBZ was highly expressed in oligodendrocytes. DBZ expression increased with oligodendrocyte differentiation.

Example 6 Suppression of oligodendrocyte differentiation by inhibiting DBZ expression In the primary culture system of oligodendrocyte of Example 5, Neurobasal medium containing insulin, neurotrophin 3, platelet-derived growth factor, L-glutamine, and B27 culture additive 1-3 days after the medium change, the following siRNA was introduced into the cells by referring to the method described in the method of John et al. (Current Protocols in Molecular Biology (2003) 26.2.1-26.2.14) did.
DBZ expression-suppressed siRNA (DBZ-1i): ACGAACCCUCCUGACAAAAUG (SEQ ID NO: 4)
DBZ expression suppression siRNA (DBZ-2i): AGCAGUUGGAGUACUAUCAAA (SEQ ID NO: 5)
Control siRNA: GGCGCGCUUUGUAGGAUUCGA (SEQ ID NO: 6)

  The next day, differentiation into oligodendrocytes was induced by replacing the medium with a Neurobasal medium containing insulin, neurotrophin 3, L-glutamine, and B27 culture additives.

Quantitative RT-PCR was performed using the following primer set with reference to the method described in Arany's method (Current Protocols in Human Genetics 11.10.1-11.10.11, 2008).
GAPDH: forward primer GCCTTCTCTTGTGACAAAGTGG (SEQ ID NO: 7)
reverse primer ATTCTCAGCCTTGACTGTGCC (SEQ ID NO: 8)
CNP: forward primer CAACAGGATGTGGTGAGGA (SEQ ID NO: 9)
reverse primer CTGTCTTGGGTGTCACAAAG (SEQ ID NO: 10)
MBP: forward primer CACACACAAGAACTACCCA (SEQ ID NO: 11)
reverse primer GGTGTACGAGGTGTCACAA (SEQ ID NO: 12)
MAG: forward primer CTGCCTCTGTTTTGGATAAT (SEQ ID NO: 13)
reverse primer TCTTGGGGTAGGGACTGTTG (SEQ ID NO: 14)

  The results are shown in FIG. In control cells to which siRNA was not added, the expression of oligodendrocyte marker genes increased, but when DBZ expression was suppressed by siRNA, the expression of these marker genes was not increased and differentiation into oligodendrocytes was not observed. It became clear that it was suppressed.

Next, the protein is extracted from the cells into which siRNA has been introduced, referring to the method described in the method of Alegria-Schaffer et al. (Methods in Enzymology, 2009, Vol.463, p573), and using the following primary antibody: Western blotting was performed.
Anti-MAG antibody (Millipore: MAB1567)
Anti-MBP antibody (Abcam: ab62631)
Anti-CNPase antibody (Sigma: C-5922)
Furthermore, using the same anti-MBP primary antibody, immunohistochemical staining of oligodendrocytes was performed with reference to the method described in the method of Goldstein et al. (Current Protocols in Molecular Biology 14.6.1-14.6.23, 2008). It was.

  The results are shown in FIG. As a result of Western blotting, when DBZ expression was suppressed, the expression of oligodendrocyte differentiation marker protein decreased. Moreover, as a result of immunohistochemical staining, when DBZ expression was suppressed, cells showing oligodendrocyte-like morphology decreased.

Example 7 Reduction of Myelin Formation in DBZ Knockout Mice In mice, about 3 weeks after birth is an active period of myelin formation. Thus, brain sections of 10-day-old DBZ knockout mice were prepared, and immunohistochemical staining was performed using the same anti-MAG and anti-MBP antibodies used in Example 6 as primary antibodies.

  The results are shown in FIG. In the DBZ knockout mouse brain, myelin formation was significantly reduced compared to wild-type mice.

  By subjecting a DBZ knockout animal administered with a new drug candidate substance to a behavioral test or the like, the therapeutic efficacy of the substance in human nervous system diseases, especially the therapeutic efficacy for schizophrenia, mood disorders, diseases with myelin abnormalities, etc. It is expected to be able to judge. Similarly, by adding a new drug candidate substance to an experimental system that induces differentiation in vitro of oligodendrocytes knocked out or knocked down the DBZ gene, and evaluating whether the delay in differentiation induction is recovered, It is expected to be able to judge the therapeutic efficacy in systemic diseases. In this way, the use of this animal or cell as an in vivo or in vitro screening system is expected to speed up research and development of new drugs and reduce the failure rate. As a result, new drugs can be offered at a lower price. It is expected.

Claims (14)

DBZ gene expression deficient non-human mammal, compared to the corresponding wild type animal,
(A) the number of cells in the cerebral cortex is decreased, and / or (b) the growth of neurites is suppressed, and / or (c) the cell migration during cerebral cortex formation is delayed, and / Or (d) An animal characterized in that oligodendrocyte differentiation is suppressed.   The animal according to claim 1, wherein the non-human mammal is a mouse or a rat.   The animal according to claim 1, wherein the non-human mammal is a mouse.   The animal-derived brain tissue according to any one of claims 1 to 3.   Use of the animal according to any one of claims 1 to 3 or the brain tissue according to claim 4 as a nervous system disease model.   The use according to claim 5, wherein the nervous system disease is a disease exhibiting schizophrenia, mood disorder or myelin sheath abnormality.   The use according to claim 5, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin abnormality. The following steps:
(1) A step of applying a test substance to the animal according to any one of claims 1 to 3 or the brain tissue according to claim 4,
(2) examining the number of cells in the cerebral cortex of the animal, neurite growth in the central nervous tissue of the animal, cell migration in the brain tissue, or differentiation of oligodendrocytes in the brain of the animal; and (3) When the number of cells in the cerebral cortex is increased, neurite growth is promoted, cell migration is promoted, or oligodendrocyte differentiation is promoted, compared to the case where the test substance is not applied. A screening method for a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease. The following steps:
(1) A step of administering a test substance to the animal according to any one of claims 1 to 3,
(2) a step of examining behavioral abnormalities in the animal; and (3) treatment of a nervous system disease when the behavioral abnormalities are improved as compared to the case where the test substance is not applied. A method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting as a candidate for a substance having a preventive effect.   The method according to claim 8 or 9, wherein the nervous system disease is a disease exhibiting schizophrenia, mood disorder, or myelin sheath abnormality.   The method according to claim 8 or 9, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin sheath abnormality. The following steps:
(1) A step of bringing a test substance into contact with a mammalian cell deficient in DBZ gene expression,
(2) a step of inducing differentiation of the cells into oligodendrocytes,
(3) The step of examining the degree of oligodendrocyte differentiation in the cell population obtained by (2) above, and (4) oligodendrocyte differentiation is promoted compared to the case where the test substance is not contacted. A method for screening a substance having a therapeutic and / or preventive effect on a nervous system disease, comprising a step of selecting the test substance as a candidate for a substance having a therapeutic and / or preventive effect on a nervous system disease.   The method according to claim 12, wherein the nervous system disease is a disease presenting with schizophrenia, mood disorder, or myelin sheath abnormality.   The method according to claim 12, wherein the nervous system disease is a disease exhibiting schizophrenia or myelin abnormality.