JP2013039066A - Identification of viral gene for obtaining resistance to rhabdovirus by rna interference - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for creating a plant having resistance to a virus belonging to the family Rhabdoviridae and a resistant breed which lead to practical use.SOLUTION: There is provided a composition including an expression inhibitor for at least one gene present in a viral genome of the family Rhabdoviridae for adding resistance to a viral disease of the family Rhabdoviridae. The method for producing a grass plant having resistance to a viral disease of the family Rhabdoviridae and capable of being infected with a virus of the family Rhabdoviridae includes the steps of: (A) providing an expression inhibitor of at least one gene present in a viral genome of the family Rhabdoviridae; (B) introducing the expression inhibitor into a cell of the plant; (C) selecting a cell of the plant into which the expression inhibitor is introduced; and (D) creating a transgenic plant by redifferentiating the selected cell.

Description

  The present invention relates to a method for producing a plant resistant to rhabdoviridae viruses. More specifically, for the Rhabdoviridae virus using nucleic acid molecules encoding genes such as the nucleoprotein (NP), phosphoprotein (P), transfer protein (P3) and P6 protein of the Rhabdoviridae virus. The present invention relates to a method for producing resistant plants.

  In general, the use of resistant varieties is one of the most effective methods for controlling plant viral diseases, but there are limited sources of resistant genes, and the virus strains that invade specific genes when used for a long time. The emergence of transgenes often leads to the loss of transgene effectiveness, resulting in disruption of its resistance.

  The Rhabdoviridae viruses include important viruses such as rice yellow leaf virus (RTYV), which are particularly damaging to the production of rice in Southeast Asia.

  As a breakthrough in this situation, a virus of the Rhabdoviridae family that frequently occurs and threatens the stable food supply by utilizing the genetic engineering technology that made it possible to apply and accumulate knowledge about the RNA interference ability inherent in the plant itself Therefore, the development of rice varieties that exhibit strong resistance to the development is desired.

  Patent Document 1 discloses virus resistance using RNA interference (RNAi) targeting rice dwarf virus (RDV).

  Patent Document 2 discloses virus resistance using RNAi targeting rice stripe blight virus (RSV).

  Non-Patent Document 1 discloses virus resistance using RNAi targeting nucleocapsid protein and transfer protein in plants.

International Publication No. 2009/020237 Pamphlet JP2011-67115A

Shimizu T, Nakazono-Nagaoka E, Uehara-Ichiki T, Sasaya T, Omura T. (2011) Targeting specific genes for RNA interference is crucial to the development of strong resistance to Rice stripe virus.Plant Biotechnol J. 2011 May; 9 ( 4): 503-12.

  As a result of intensive studies by the present inventors, a virus or rhabdo belonging to the rhabdoviridae family comprising an expression inhibitor of at least one gene present in the genome of a virus belonging to the rhabdoviridae family (for example, rice yellow leaf virus (RTYV)) Unexpectedly found that a composition for imparting resistance to diseases caused by viruses belonging to the family Viridae gives complete resistance. In contrast, we succeeded in producing resistant plants and obtaining resistant cultivars.

  In general, there is a common recognition that RNA interference (RNAi) cannot completely suppress gene expression (Q & A, Yodosha, 2006, pp. 4).

  RTYV differs from rice dwarf disease virus (RDV) and rice stripe blight virus (RSV), which are viruses that cause other rice lesions, in seven genes (NP) in the genome of one minus-strand RNA. , P, P3, M, G, P6, L), from which mRNA having CAP and poly (A) is transcribed. Further, there are regions called a leader sequence and a trailer sequence near both ends of the genome, from which RNA without CAP and poly (A) is transcribed.

  Therefore, it is not a method of comparing individual genes for all genes encoded by rice yellow virus with 20 bases that are usually used in research on imparting resistance to rhabdovirus, but each gene is about 500 bases long. When an attempt was made to suppress expression by RNA interference, it was found that resistance was imparted to rice when expression of NP, P, P3, P6 and the like was suppressed.

The present invention also provides the following items.
(1) To confer resistance of a nucleic acid sequence encoding a nucleoprotein (NP), phosphoprotein (P), transfer protein (P3) or P6 protein of a virus belonging to Rhabdoviridae to a virus belonging to Rhabdoviridae Use of.
(2) NP, P, P3 or P6 is a nucleotide sequence represented by SEQ ID NO: 1, 3, 5 or 11, respectively, or one or several substitutions, additions, insertions and / or deletions in the nucleotide sequence. Or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12, respectively. 2. Use according to item 1, encoding an amino acid sequence.
(3) The use according to item 1 or 2, wherein the virus is rice yellow leaf virus (RTYV).
(4) The use according to any one of items 1 to 3, wherein the resistance is imparted to a plant belonging to the genus Rice.
(5) Use in any one of the items 1-4 with which the said resistance is provided with respect to rice.
(6) Caused by a virus belonging to Rhabdoviridae or a virus belonging to Rhabdoviridae, which contains an expression inhibitor of at least one gene of NP, P, P3 or P6 present in the genome of a virus belonging to Rhabdoviridae A composition for imparting resistance to a lesion or disease.
(7) NP, P, P3, or P6 represents the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, or 11, respectively, or one or several substitutions, additions, insertions, and / or deletions in the nucleotide sequence. Or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12, respectively. Item 7. The composition according to Item 6, which encodes an amino acid sequence.
(8) The composition according to item 6 or 7, wherein the virus is rice yellow leaf virus (RTYV).
(9) The composition according to any one of items 6 to 8, wherein the resistance is imparted to a plant belonging to the genus Rice.
(10) The composition according to any one of items 6 to 9, wherein the resistance is imparted to rice.
(11) The composition according to any one of items 6 to 10, wherein the expression inhibitor is an RNAi, cosuppression, ribozyme, chimeric oligo, antisense suppressor of the gene, or an antibody against the gene product.
(12) The composition according to item 11, wherein the expression inhibitor is RNAi of the gene and has a length of 20 bases or more.
(12A) The composition according to item 11, wherein the expression inhibitor is RNAi of the gene and has a length of 30 bases or more.
(13) The composition according to item 12, wherein the RNAi has a length of about 500 bases.
(14) The RNAi has a nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 17, 18, 19, and 22, or one or several substitutions, additions, insertions, and / or deletions in the nucleotide sequence 14. The composition according to item 13, having a modified sequence.
(15) The expression inhibitor is RNAi of the gene (a) a ubiquitin promoter comprising the nucleic acid sequence represented by SEQ ID NO: 46;
(B) (i) a nucleic acid sequence shown in SEQ ID NO: 1, 3, 5 or 11 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12; or (ii) SEQ ID NO: 1, A variant having one or several substitutions, additions, insertions and / or deletions in the nucleic acid sequence shown in 3, 5 or 11 or the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12 ,
An antisense sequence complementary to
(C) a trimming sequence consisting of the nucleic acid sequence shown in SEQ ID NO: 45;
(D) (i) a nucleic acid sequence shown in SEQ ID NO: 1, 3, 5 or 11 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12; or (ii) SEQ ID NO: 1, A variant having one or several substitutions, additions, insertions and / or deletions in the nucleic acid sequence shown in 3, 5 or 11 or the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12 ,
A sense sequence consisting of; and (e) a terminator sequence,
The composition in any one of the items 6-14 containing this.
(16) NP, P, P3 or P6 present in the genome of a virus belonging to the Rhabdoviridae family for imparting resistance to a lesion or disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family An expression inhibitor of at least one of the genes.
(17) A vector comprising the expression inhibitor according to item 16.
(18) A plant cell comprising the vector according to item 17.
(19) A plant comprising the vector according to item 17.
(20) A seed comprising the vector according to item 17.
(21) The plant according to item 19, which exhibits resistance to viruses belonging to the Rhabdoviridae family.
(22) A method for producing a plant belonging to the genus Rice that can be infected with a virus belonging to the Rhabdoviridae family, to which resistance against a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family is provided,
A) providing a vector according to item 17;
B) introducing the vector into cells of the plant;
C) selecting a plant cell into which the vector has been introduced; and D) redifferentiating the selected cell to produce a transgenic plant;
Including the method.
(23) A method for producing seeds of a rice genus plant of a plant capable of being infected with a virus belonging to the Rhabdoviridae family, to which resistance against a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family is given There,
A) providing a vector according to item 17;
B) introducing the vector into cells of the plant;
C) selecting a plant cell into which the vector has been introduced;
D) redifferentiating the selected cells to produce a transgenic plant; and E) obtaining seeds from the transgenic plant;
Including the method.
(24) A method for reproducing a plant belonging to the genus Rhabdoviridae, which is infectious to a virus belonging to the Rhabdoviridae family, to which resistance against a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family is provided,
A) providing seeds comprising the vector of item 17;
B) growing the seed to obtain a mature plant;
C) obtaining seeds from the plant body;
Including the method.
(25) A plant or seed containing the expression inhibitor according to item 16, or a processed product thereof.

  As described above, according to the present invention, an expression inhibitor targeting a segmental genome encoding a nucleoprotein (NP), phosphoprotein (P), transfer protein (P3) or P6 protein gene of the Rhabdoviridae family. And preferably a fully resistant population (100% of the total number of rhabdoviridae virus-infected plants is resistant), at least partially resistant A method for producing a virus-resistant rice of the Rhabdoviridae family, which has a stable population and whose stable infection is imparted with a population having a reduced virus infection rate in the Rhabdoviridae family compared to a wild-type plant. Variety is provided.

  INDUSTRIAL APPLICABILITY According to the present invention, there are provided a method for producing a virus-resistant rice of the Rhabdoviridae family exhibiting resistance at a higher level of suppression of viral infection or disease-free symptoms, or imparting stable resistance, and a resistance-type cultivar.

FIG. 1 shows a genomic structure including the target gene region of rice yellow leaf virus (RTYV) (upper panel) and a schematic diagram of construction of an RNAi-inducing vector for suppressing the expression of each gene (lower panel). FIG. 2 is a diagram showing detection of transgene-derived siRNA in rice target RNAi rice of rice yellow leaf virus (RTYV). When RNAi is induced, RNA fragments of 24, 22 and 21 bases accumulate. C shows control (Nipponbare). FIG. 3 is a view showing the conferring of viral disease resistance in rice target RNAi rice of rice yellow leaf virus (RTYV). Infection using rice leaves about 60 days after RTYV inoculation was tested, and the infection rate was calculated with Japan sunny as 100.

  The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. Thus, it should be understood that singular articles or adjectives (eg, “a”, “an”, “the”, etc., in the English language) also include the plural concept unless otherwise stated. is there. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

(Definition of terms)
Listed below are definitions of terms particularly used in the present specification.

  In this specification, “rice yellow leaf virus” is also called RTYV and is a member of a virus belonging to the Rhabdoviridae family. The shape of the virus particle is a bullet-like particle having a width of 100 nm and a length of 180 to 210 nm. In addition, this virus uses a single minus-strand RNA as its genome (the genome sequence is shown in SEQ ID NO: 25), and seven proteins (NP, P, P3, M, G, P6 and L) are included in this minus strand. ). RTYV particles are said to consist of genomic RNA, NP, P, M, G, P6 and L. This virus is distributed in gramineous plants. In addition to the RTYV (Japanese strain) exemplified in the present invention and used in Example 1, the same type of virus strain isolated in China is named Riceylow stunt virus (RYSV) (GenBank accession No. NC_003746). (Hereinafter referred to as Chinese strain (RYSV)), similarly, it is expected that there are many lines and variant lines in RTYV. Thus, as used herein, the term “RTYV” will, of course, be readily apparent to one of ordinary skill in the art that the term is intended for various strains and variants of RTYV. is there. When the target sequence of the full-length RTYV Japanese strain was compared with the base sequence of the full-length Chinese strain (RYSV), a difference of 1.5% was observed. Even if there is this level of substitution, if a partial base sequence that causes minimal suppression of expression, that is, a partial base sequence that substantially matches more than 24 nucleotides exists between other strains or mutant strains, one strain The expression-suppressing agent of the present invention containing a segmental genome derived from can also exert its effect in another type of strain. On the other hand, regardless of the sequence derived from any strain of RTYV, those skilled in the art can understand that an expression inhibitor such as siRNA having an effect on other strains can be produced based on the description in this specification. Is done.

  Although virus "strains" and "strains" can be used herein to refer to variations within the same virus species, it is understood that these terms can be used interchangeably.

  Regarding RTYV, in this specification, “NP” refers to (1) a nucleic acid sequence represented by SEQ ID NO: 1 or a nucleic acid sequence encoding an amino acid sequence represented by SEQ ID NO: 2; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) NPs derived from other strains or variants of RTYV Represented by a nucleic acid sequence encoding, present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by NP binds to genomic RNA and creates a nucleocapsid structure (nucleoprotein). The protein encoded by NP also interacts with and plays a role in replicative enzymes in RNA synthesis.

  Regarding RTYV, in this specification, “P” means (1) a nucleic acid sequence represented by SEQ ID NO: 3 or a nucleic acid sequence encoding the amino acid sequence represented by SEQ ID NO: 4; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) P derived from other strains or variants of RTYV Represented by nucleic acid encoding sequence is present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by P functions as a structural protein (phosphoprotein). Also, the protein encoded by P interacts with and plays a role in replicative enzymes in RNA synthesis.

  Regarding RTYV, in this specification, “P3” refers to (1) the nucleic acid sequence shown in SEQ ID NO: 5 or the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 6; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) P3 derived from another strain or variant of RTYV Represented by a nucleic acid sequence encoding, present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by P3 functions as a translocation protein and plays its role in translocation to cells adjacent to RTYV infected cells.

  Regarding RTYV, in this specification, “M” means (1) a nucleic acid sequence represented by SEQ ID NO: 7 or a nucleic acid sequence encoding the amino acid sequence represented by SEQ ID NO: 8; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) M derived from other strains or variants of RTYV Represented by nucleic acid encoding sequence is present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by M functions as a structural protein and plays its role in the process of forming particle shapes.

  Regarding RTYV, in this specification, “G” means (1) a nucleic acid sequence shown in SEQ ID NO: 9 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 10; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) G derived from another strain or variant of RTYV Represented by the nucleic acid sequence over de, present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by G functions as a structural protein. The protein encoded by G also plays a role in particle formation and viral entry into the host cell.

  Regarding RTYV, in this specification, “P6” means (1) a nucleic acid sequence shown in SEQ ID NO: 11 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 12; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) derived from another strain or variant of RTYV 6 indicated by the nucleic acid sequence encoding a present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by P6 functions as a structural protein, but its role is unknown.

  Regarding RTYV, in this specification, “L” means (1) a nucleic acid sequence shown in SEQ ID NO: 13 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 14; A sequence complementary to a nucleic acid sequence that hybridizes under moderate or any stringent conditions; (3) having one or several nucleotide substitutions, additions, insertions and / or deletions in the nucleic acid sequence; A variant or a variant having a substitution, addition, insertion and / or deletion of one or several amino acids in the amino acid sequence; (4) a variant having at least 90% identity with the nucleic acid sequence; (5) A variant having at least 80% homology to the nucleic acid sequence; (6) L derived from another strain or variant of RTYV Represented by a nucleic acid sequence encoding, present on RTYV genome of minus strand. The above identity or homology is calculated using BLAST (for example, BLAST 2.2.9 (issued May 12, 2004)), a sequence analysis tool, using default parameters. Stringent conditions vary depending on the sequence, and determination of such conditions is within the skill of those in the art. The protein encoded by L is the protein associated with RTYV particles. The protein encoded by L functions as an RNA replication enzyme and plays a major role in RTYV RNA synthesis.

  In this specification, “resistance” or “resistance” to viruses (for example, Rhabdoviridae viruses such as RTYV) and the like means that a host organism (in this specification, a plant) to which a virus or the like intends to enter, It means having resistance to invasion of viruses. In the present specification, the resistance refers to a property that allows normal survival / proliferation of the host organism to be maintained. The evaluation method is defined below in this specification, and whether or not it is resistant is determined by this evaluation method unless otherwise specified in this specification.

  In the present specification, “tolerance” or “resistance” to a disease (for example, rice yellow leaf disease (rice transition yellowing disease) as a viral disease of the Rhabdoviridae family) refers to a host organism (this book) against the disease. In the specification, it means that a plant) has resistance. Therefore, it can be said that the plant is resistant to diseases as long as no changes are observed in the growth of the plant body and the yield of the target substance regardless of the invasion of the virus. The evaluation method for diseases is also defined below in this specification. Unless otherwise specified in this specification, whether or not the disease is resistant is determined by this evaluation method.

  In the present specification, “resistance” to a disease means that, when given an opportunity to infect a causative factor (for example, RTYV) that causes the disease, infection or proliferation of the causative factor is not observed. Compared with non-infected plants (non-infected plants), the growth of the plant (eg, splitting, elongation) and the yield of the target substance are tested and no change is observed with non-infected organisms. It can be determined by observing. Furthermore, “susceptibility” can be determined by testing and observing that no difference from a wild-type infected plant is observed when the target plant is infected with the pathogen.

  “Complete resistance” to a disease refers to a case where all of the target plant population is “resistant” when an opportunity to infect the pathogen is given.

  In addition, “partial resistance” means that when an objective plant population is given an opportunity to be infected with the pathogen, a wild-type plant population is similarly given an opportunity to be infected with the pathogen. Compared to the case, the rate at which “sensitivity” appears is reduced. In this specification, in order to correctly assess resistance to pathogens by removing individuals who have failed infection (i.e., those that have been sucked by the leafhopper, they have not developed disease). When the rate at which “sensitivity” appears is 100, the rate at which “sensitivity” appears in the target plant population is calculated, and when this rate is X of 100 or less, the target plant population is X% It is said that it has a certain resistance.

  In this specification, “stable resistance” refers to resistance retained in a plurality of generations. Retained in a plurality of generations means preferably retained for 3 generations, more preferably 5 generations, even more preferably 7 generations, most preferably permanently.

  In this specification, when specifically mentioned, it is understood that resistance refers to the property of the virus and resistance refers to the property of the disease, but may be used interchangeably.

  In the present specification, the “plant” includes both monocotyledonous plants and dicotyledonous plants. Generally, as used herein, refers to a plant that is infected by RTYV. The preferred plant is a monocotyledonous plant belonging to the family Gramineae, and the most preferred plant for the present invention is rice. Unless otherwise indicated, a plant means any plant, plant organ, plant tissue, plant cell, and seed. Examples of plant organs include roots, leaves, stems and flowers. Examples of plant tissue include vascular tissue (including phloem tissue, xylem tissue, etc.), apical meristem tissue, mesophyll tissue, thick angle tissue, soft tissue and the like. Examples of plant cells include callus and suspension culture cells.

  As used herein, “wild type” plant refers to a naturally occurring plant that has not been genetically modified by human means such as transformation.

  In the present specification, an “organ” of a living organism refers to a structure in which a certain function of a living organism is localized and operated in a specific part of the individual, and that part is morphologically independent. Examples include stems, roots, leaves, flowers, seeds and the like, but are not limited thereto.

  In the present specification, the “tissue” of an organism refers to a group of cells having a certain similar action in the group. Thus, the tissue can be part of an organ. In an organ, there are many cells having the same function, but those having slightly different functions may be mixed. May be mixed.

  As used herein, “polynucleotide”, “oligonucleotide” and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. The term also includes “oligonucleotide derivatives” or “polynucleotide derivatives”. “Oligonucleotide derivatives” or “polynucleotide derivatives” refer to oligonucleotides or polynucleotides that include derivatives of nucleotides or that have unusual linkages between nucleotides, and are used interchangeably. Specific examples of such oligonucleotides include, for example, 2′-O-methyl-ribonucleotides, oligonucleotide derivatives in which phosphodiester bonds in oligonucleotides are converted to phosphorothioate bonds, and phosphodiester bonds in oligonucleotides. Derivative converted to N3′-P5 ′ phosphoramidate bond, oligonucleotide derivative in which ribose and phosphodiester bond in oligonucleotide are converted to peptide nucleic acid bond, uracil in oligonucleotide is C− Oligonucleotide derivatives substituted with 5-propynyluracil, oligonucleotide derivatives wherein uracil in oligonucleotide is substituted with C-5 thiazole uracil, cytosine in oligonucleotide is C-5 propynylcytosine Substituted oligonucleotide derivatives, oligonucleotide derivatives in which the cytosine in the oligonucleotide is replaced with phenoxazine-modified cytosine, oligonucleotide derivatives in which the ribose in the DNA is replaced with 2'-O-propylribose Examples thereof include oligonucleotide derivatives in which the ribose in the oligonucleotide is substituted with 2′-methoxyethoxyribose. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91- 98 (1994)).

  As used herein, “nucleic acid molecule” is also used interchangeably with nucleic acid, oligonucleotide and polynucleotide, and includes cDNA, mRNA, genomic DNA, siRNA, shRNA, RNA and DNA complex molecules, and the like. As used herein, nucleic acids and nucleic acid molecules can be included within the concept of the term “gene”.

  As used herein, “gene” refers to a factor that defines a genetic trait. Usually arranged in a certain order on the genome. Those that define the primary structure of a protein are called structural genes, and those that influence the expression are called regulatory genes (for example, promoters). In the present specification, genes include structural genes and regulatory genes unless otherwise specified. Therefore, the term “gene” usually includes both a structural gene of the gene of the present invention and a transcriptional and / or translational regulatory sequence such as its promoter. As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule”. In the present specification, “gene product” refers to proteins, polypeptides, etc. expressed by genes, as well as “polynucleotides”, “oligonucleotides”, “nucleic acids” and “nucleic acid molecules” expressed by genes. Include. A person skilled in the art can understand what a gene product is, depending on the situation.

  In the present specification, the “amino acid” may be natural or non-natural as long as it satisfies the object of the present invention.

  In the present specification, the “nucleotide” may be natural or non-natural. The nucleotide sequence is referred to herein as “nucleotide sequence” or “base sequence”.

  As used herein, “nucleotide derivative” or “nucleotide analog” refers to a substance that is different from a naturally occurring nucleotide but has a function similar to that of the original nucleotide. Such nucleotide derivatives and nucleotide analogs are well known in the art. Examples of such nucleotide derivatives and nucleotide analogs include, but are not limited to, phosphorothioate, phosphoramidate, methylphosphonate, chiral methylphosphonate, 2-O-methylribonucleotide, peptide-nucleic acid (PNA). . As used herein, it is understood that nucleotide derivatives and nucleotide analogs can be used as an alternative to nucleotides as long as they perform the same biological function as nucleotides, particularly RNAi functions.

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by a generally recognized one letter code.

  In this specification, the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using default parameters using BLAST, which is a sequence analysis tool. The identity search can be performed, for example, using NCBI's BLAST 2.2.9 (issued May 12, 2004). In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value.

  In the present specification, a “corresponding” nucleotide has or is expected to have the same action as a given nucleotide in a nucleic acid molecule or polynucleotide as a reference for comparison in a certain nucleic acid molecule or polynucleotide molecule. In RNAi, it refers to nucleotides that contribute in the same way in RNA interference. An antisense molecule can be a similar part in an ortholog corresponding to a particular part of the antisense molecule.

  In the present specification, the “corresponding” gene refers to a gene having, or expected to have, the same action as that of a predetermined gene in a species as a reference for comparison in a certain species. When there are a plurality of genes having the same, those having the same origin evolutionarily. Therefore, a gene corresponding to a certain gene (for example, NP, P, P3, P6, etc. of RTYV) can be an ortholog of that gene. Therefore, genes corresponding to viral genes can also be found in other viruses (such as other viruses of the Rhabdoviridae family). Such corresponding genes can be identified using techniques well known in the art. Thus, for example, a corresponding gene in a virus is found by searching a sequence database of that virus (eg, another virus in the Rhabdoviridae family) using the sequence of the gene that serves as a reference for the corresponding gene as a query sequence. be able to.

  As used herein, “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250 and more amino acids, and the length represented by an integer not specifically listed here (eg, 11 Etc.) may also be appropriate as a lower limit. In the case of polynucleotides, examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 200, 300, 400, 500 and more nucleotides. A length represented by an integer not specifically listed here (eg, 11 etc.) may also be appropriate as a lower limit. In the present specification, the lengths of polypeptides and polynucleotides can be represented by the number of amino acids or nucleic acids, respectively, as described above. Alternatively, the above-mentioned number as the lower limit is intended to include the upper and lower numbers (or, for example, up and down 10%) of the number. In order to express such intention, in this specification, “about” may be added before the number. However, it should be understood herein that the presence or absence of “about” does not affect the interpretation of the value. The length of a fragment useful herein can be determined by whether or not at least one of the functions of a full-length protein that serves as a reference for the fragment is retained.

  As used herein, “biological function” refers to a specific function that a gene, nucleic acid molecule or polypeptide may have in vivo when referring to a gene or a nucleic acid molecule or polypeptide related thereto. Examples of the antibody include, but are not limited to, generation of specific antibodies, enzyme activity, and imparting resistance. In the present invention, in addition to the functions of these proteins themselves, for example, involvement in the propagation of Rhabdoviridae virus in plants, involvement in resistance or susceptibility to Rhabdoviridae virus, Rhabdoviridae virus disease, Resistance, functions directly or indirectly related to these specific functions (for example, binding to viral proteins, etc.) can be mentioned, but are not limited thereto. As used herein, a biological function can be exerted by “biological activity”. As used herein, “biological activity” refers to the activity that a factor (eg, polynucleotide, protein, etc.) may have in vivo, and various functions (eg, binding to viral proteins, etc.) For example, an activity in which another molecule is activated or inactivated by interaction with one molecule is also included. When two factors interact, their biological activity depends on the binding between the two molecules and the resulting biological change, eg, when one molecule is precipitated with an antibody, the other When molecules also coprecipitate, the two molecules are considered bound. Therefore, seeing such coprecipitation is one method of judgment. For example, when a factor is an enzyme, the biological activity includes the enzyme activity. In another example, when an agent is a ligand, the ligand includes binding to the corresponding receptor. Such biological activity can be measured by techniques well known in the art.

  Thus, “activity” indicates or reveals binding (either direct or indirect); affects the response (ie, has a measurable effect in response to some exposure or stimulus); Refers to various measurable indicators, such as the affinity of a compound that binds directly to a polypeptide or polynucleotide, or the amount of an upstream or downstream protein after some stimulation or event or other similar function, for example A measure of

  In this specification, the term “interaction” refers to two substances. Force (for example, intermolecular force (van der Waals force), hydrogen bond, hydrophobic interaction between one substance and the other substance. Etc.). Usually, two interacting substances are in an associated or bound state.

  The term “binding” as used herein means a physical or chemical interaction between two proteins or compounds or related proteins or compounds, or a combination thereof. Bonds include ionic bonds, non-ionic bonds, hydrogen bonds, van der Waals bonds, hydrophobic interactions, and the like. A physical interaction (binding) can be direct or indirect, where indirect is through or due to the effect of another protein or compound. Direct binding refers to an interaction that does not occur through or due to the effects of another protein or compound and does not involve other substantial chemical intermediates.

  The term “modulate” or “modify” as used herein means an increase or decrease or maintenance in the amount, quality or effect of a particular activity, factor or protein.

  As used herein, “antisense (activity)” refers to an activity capable of specifically suppressing or reducing the expression of a target gene. Antisense activity is usually a nucleic acid having a length of at least 8 contiguous nucleotides that is complementary to all or part of the nucleic acid sequence of the gene of interest or a nucleic acid sequence having at least 90% identity to the above nucleic acid sequence. Accomplished by an array. Such nucleic acid sequences are preferably at least 9 contiguous nucleotides long, more preferably at least 10 contiguous nucleotides long, more preferably at least 11 contiguous nucleotides long, at least 12 contiguous nucleotides long. At least 13 contiguous nucleotide lengths, at least 14 contiguous nucleotide lengths, at least 15 contiguous nucleotide lengths, at least 20 contiguous nucleotide lengths, at least 25 contiguous nucleotide lengths, at least 30 contiguous sequences At least 40 contiguous nucleotides, at least 50 contiguous nucleotides, at least 100 contiguous nucleotides, at least 200 contiguous nucleotides, at least 30 Of contiguous nucleotides in length, the nucleotide long contiguous at least 400, at least 500 contiguous nucleotides in length, may be a nucleic acid sequence. Molecules having such nucleic acid sequences are referred to herein as “antisense molecules”, “antisense nucleic acid molecules” or “antisense nucleic acids” and are used interchangeably. Such nucleic acid sequences include nucleic acid sequences that are at least 70% homologous, more preferably at least 80% homologous, more preferably 90% homologous, most preferably 95% homologous to the sequences described above. included. Such antisense activity is preferably complementary to a sequence at the 5 'end of the nucleic acid sequence of the gene of interest. Such antisense nucleic acid sequences also include those having one, several or one or more nucleotide substitutions, additions, insertions and / or deletions relative to the sequences described above. Given the nucleic acid sequence disclosed herein (eg, SEQ ID NO: 1), the antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing or Hoogstein base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of the signaling factor mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of the mRNA. . For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of mRNA. Antisense oligonucleotides can be, for example, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 nucleotides in length. In one preferred embodiment, the antisense nucleic acid used in the expression-suppressing agent of the present invention is at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about at the lower end of its length. It can be 300 nucleotides, at least about 350 nucleotides, preferably at least about 400 nucleotides, more preferably at least about 450 nucleotides, and most preferably at least about 500 nucleotides in length, but is not limited to these lengths and is about 100 Any length between nucleotides and about 500 nucleotides may be used; the antisense nucleic acid may have, for example, up to about 1050 nucleotides up to about 1100 nucleotides at the upper end of its length. , Up to about 1200 nucleotides, up to about 1300 nucleotides, up to about 1400 nucleotides, up to about 1500 nucleotides, up to about 2000 nucleotides, or about 2500 nucleotides, or the total length of the nucleic acid of interest, although these lengths However, it may be any length between about 500 and the entire length. Although not wishing to be bound by theory, it is possible to induce gene expression suppression effects based on antisense phenomenon widely among virus strains by designing the target gene in the above range (for example, about 500 bases). It is possible. The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) are naturally occurring nucleotides, or two that are formed between an antisense nucleic acid and a sense nucleic acid that increase the biological stability of the molecule. It can be chemically synthesized (eg, phosphorothioate derivatives and acridine substituted nucleotides can be used) using various modified nucleotides designed to increase the physical stability of the strand. Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyl Hydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosyl queosine, inosine, N6-isopentenyladenine, 1-methylguanine 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5 -Metoki Cyaminomethyl-2-thiouracil, β-D-mannosylcuocin, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine ), Pseudouracil, cuocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), Examples include 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, 3- (3-amino-3-carboxypropyl) uracil, and 2,6-diaminopurine. But not limited to them.

  As used herein, “RNA interference” or “RNAi (RNA interference)” is used interchangeably, and a protein is obtained by degrading RNA in a sequence-specific manner by double stranded RNA (dsRNA). This refers to a phenomenon in which translation into is inhibited and gene expression is suppressed. For a review on RNAi in plants as a method for suppressing gene expression, see, for example, Miki et al., “Molecular Mechanisms of RNAi in Plants and Their Applications” (Experimental Medicine Vol. 22 No. 4 (March) 2004) (this specification) Among them, incorporated by reference). One advantage of RNAi is that various levels of expression suppression, from weak to strong, can be obtained by individual genes. Currently, RNAi is used as a simple and effective method for suppressing gene expression. In a preferred embodiment, “RNAi” suppresses synthesis of a gene product by specifically degrading homologous RNA by introducing an RNAi-causing factor such as double-stranded RNA (also referred to as dsRNA) into a cell. Phenomenon and the technology used for it. As used herein, the term “RNAi” can also be used synonymously with an agent that causes RNAi, depending on the context. When RNAi represents a factor, it is, for example, 20 bases or more, usually 25 bases or more, and preferably 30 bases or more.

  As used herein, “factor causing RNAi” refers to any factor capable of causing RNAi. In the present specification, the “factor causing RNAi” with respect to “gene” means that RNAi related to the gene is caused and an effect brought about by RNAi (for example, suppression of expression of the gene) is achieved. Factors that cause such RNAi include, for example, at least about 70%, at least about 80% of a portion of the nucleic acid sequence of the target gene or a nucleic acid sequence having at least 90% identity with the above nucleic acid sequence, An RNA comprising at least about 90%, at least about 95% homology, or a RNA or variant thereof comprising a double-stranded portion at least 10 nucleotides in length, comprising a sequence that hybridizes under stringent conditions However, it is not limited to that. Here, the factor preferably comprises a 3 'overhang, more preferably the 3' overhang can be 2 or more nucleotides long DNA (eg 2 to 4 nucleotides long DNA).

In the present specification, “trimming sequence” refers to a sequence corresponding to a sense sequence and an antisense sequence and a sequence located between these two sequences (referred to as spacer, hairpin, trimming, etc.). The following structure:
When a cell is transformed with a vector into which a nucleic acid molecule having a sense sequence-trimming sequence-antisense sequence; or antisense sequence-trimming sequence-sense sequence can be introduced, the sense sequence and the antisense sequence are double-stranded. The RNA is formed, and the portion located between the two strands is retained as a loop or hairpin portion, and a double-stranded RNA (shRNA) containing a single-stranded portion of the loop or hairpin structure is formed in a part thereof. The The length of the trimming sequence is any length as long as the single-stranded part of the trimming sequence takes a loop or hairpin structure when the sense sequence and the antisense sequence form a double-stranded RNA. It may be. The shRNA moves from the nucleus to the cytoplasm and is cleaved by Dicer in the introduced cell to become siRNA, causing RNA interference. As an example of the trimming array, for example, the one shown in SEQ ID NO: 45 can be cited.

  In one embodiment, the length of the sense or antisense sequence used in the agent that causes RNAi is at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about the lower limit. It can be 300 nucleotides, at least about 350 nucleotides, preferably at least about 400 nucleotides, more preferably at least about 450 nucleotides, and most preferably at least about 500 nucleotides in length, but is not limited to these lengths and is about 100 Any length between nucleotides and about 500 nucleotides can be used; the length of the sense or antisense sequence is at its upper limit, for example, up to about 1050, about 11 Up to 0 nucleotides, up to about 1200 nucleotides, up to about 1300 nucleotides, up to about 1400 nucleotides, up to about 1500 nucleotides, up to about 2000 nucleotides, or about 2500 nucleotides in length, or the full length of the nucleic acid of interest, However, the length may be any length between about 500 and the entire length. Although not wishing to be bound by theory, it is considered that RNAi can be widely induced between virus strains by designing the target gene in the above range (for example, about 500 bases).

  In this specification, the first substance or factor “specifically interacts” with the second substance or factor means that the first substance or factor is different from the second substance or factor with respect to the second substance or factor. Interacting with a higher affinity than a substance or factor other than a substance or factor (especially another substance or factor present in a sample containing a second substance or factor). Specific interactions for a substance or factor include, for example, when both nucleic acid and protein are involved, such as hybridization in nucleic acids, antigen-antibody reactions in proteins, ligand-receptor reactions, enzyme-substrate reactions, etc. Examples include, but are not limited to, protein-lipid interactions, nucleic acid-lipid interactions, and the like, such as reactions with transcription factor binding sites. Thus, when both a substance or factor is a nucleic acid, the first substance or factor “specifically interacts” with the second substance or factor means that the first substance or factor is the second substance. Or having at least a part of complementarity to the factor. In addition, for example, when both substances or factors are proteins, the fact that the first substance or factor “specifically interacts” with the second substance or factor includes, for example, interaction by antigen-antibody reaction, receptor- Examples include, but are not limited to, interaction by a ligand reaction and enzyme-substrate interaction. When the two substances or factors include proteins and nucleic acids, the first substance or factor “specifically interacts” with the second substance or factor means that the transcription factor and the transcription factor Interaction between the binding region of the nucleic acid molecule to be included. Therefore, in the present specification, a “factor that specifically interacts” with a biological agent such as a polynucleotide or a polypeptide means an affinity for the biological agent such as the polynucleotide or the polypeptide, The affinity for other unrelated (especially less than 30% identity) polynucleotides or polypeptides is typically equivalent or higher, preferably significantly (eg, statistically significant) ) Includes the expensive. Such affinity can be measured, for example, by hybridization assays, binding assays, and the like.

  As used herein, the term “expression inhibitor” broadly refers to any factor that can suppress gene expression in cells, that is, genome replication, transcription, and translation.

  As used herein, an “agent” is any substance or other element (eg, energy such as light, radioactivity, heat, electricity, etc.) that can achieve the intended purpose. Good. Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA or genomic RNA) ), Polysaccharides, oligosaccharides, lipids, small organic molecules (for example, hormones, ligands, signaling substances, small organic molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.) ), And the like, typically having a molecular weight of about 10,000 or less (for example, but not limited to those having a molecular weight of about 1,000 or less), and these complex molecules, but are not limited thereto . As a factor specific for a polynucleotide, typically, a polynucleotide having a certain sequence homology to the sequence of the polynucleotide (for example, 70% or more sequence identity) and complementarity, Examples include, but are not limited to, a polypeptide such as a transcription factor that binds to the promoter region. Factors specific for a polypeptide typically include an antibody specifically directed against the polypeptide or a derivative or analog thereof (eg, a single chain antibody), and the polypeptide is a receptor. Alternatively, specific ligands or receptors in the case of ligands, and substrates thereof when the polypeptide is an enzyme include, but are not limited to.

  As used herein, “complex molecule” refers to a molecule formed by linking a plurality of molecules such as polypeptides, polynucleotides, lipids, sugars, and small molecules. Examples of such complex molecules include, but are not limited to, RNA and DNA complex molecules, glycolipids, glycopeptides, and the like. In the present specification, a polypeptide having the amino acid of SEQ ID NO: 2, or a variant or fragment thereof, as long as it has biological activity involved in the growth of Rhabdoviridae virus, each variant or fragment, etc. Nucleic acid molecules encoding can also be used. A complex molecule containing such a nucleic acid molecule can also be used.

  As used herein, an “isolated” biological agent (eg, a cell, nucleic acid, protein, etc.) is any other biological agent (such as a cell, nucleic acid or protein) within the cell of the organism in which it naturally occurs ( For example, in the case of a nucleic acid, a nucleic acid containing a non-nucleic acid factor and a nucleic acid sequence other than the target nucleic acid; Means isolated or purified. “Isolated” nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. Thus, isolated nucleic acids and proteins include chemically synthesized nucleic acids and proteins.

  As used herein, a “purified” biological factor (eg, a cell, nucleic acid, protein, etc.) refers to a product from which at least a portion of the factor that naturally accompanies the biological factor has been removed. Thus, typically the purity of the biological agent in a purified biological agent is higher (ie, enriched) than the state in which the biological agent is normally present.

  The terms “purified” and “isolated” as used herein are preferably at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably Means that at least 98% by weight of the same type of biological agent is present and is used to distinguish the object from the natural product.

  As used herein, “gene transfer” refers to a natural, synthetic or recombinant desired gene or gene fragment in a target cell in vivo or in vitro, and the introduced gene has its function. Introducing to maintain. The gene or gene fragment introduced in the present invention includes a nucleic acid which is DNA, RNA or a synthetic analog thereof having a specific sequence. Also, as used herein, gene transfer, transformation, transfection, and transfection are used interchangeably.

  As used herein, “gene transfer vector” and “gene vector” are used interchangeably. “Gene transfer vector” and “gene vector” refer to a vector capable of transferring a target polynucleotide sequence into a target cell. “Gene transfer vector” and “gene vector” include, but are not limited to, plasmid vectors and the like.

  As used herein, “gene transfer activity” refers to the activity of “gene transfer” by a vector, and functions of the introduced gene (for example, in the case of an expression vector, expression of the encoded protein and / or Alternatively, the activity of the protein can be detected as an index.

  As used herein, a “foreign” nucleic acid molecule refers to a nucleic acid molecule of a source other than the target nucleic acid molecule contained in a target nucleic acid molecule. This exogenous nucleic acid molecule contains the appropriate regulatory sequences for the expression of the gene introduced by the gene transfer vector (eg, promoter, enhancer, terminator, and poly A addition signal required for transcription, and ribosome binding required for translation). Site, start codon, stop codon, etc.). In another aspect of the invention, the foreign gene does not contain regulatory sequences for expression of the foreign gene.

  The foreign nucleic acid molecule contained in the gene transfer vector is typically a DNA or RNA nucleic acid molecule, but the nucleic acid molecule to be introduced may include a nucleic acid analog molecule that serves the purpose (eg, RNA interference). . The molecular species contained in the gene transfer vector may be a single gene molecular species or a plurality of different gene molecular species.

  Therefore, in the present specification, “reduction” or “suppression” of “expression” of a gene, polynucleotide, polypeptide or the like is used interchangeably, and when a certain factor (that is, an expression inhibitor) is acted on. This means that the amount of expression is significantly reduced compared to when no action is taken. Preferably, the decrease in expression includes a decrease in the expression level of the polypeptide.

  In this specification, “increase” in “expression” of a gene, polynucleotide, polypeptide, etc. means that the amount of expression increases significantly when the factor of the present invention is applied, rather than when it is not. Say. Preferably, the increase in expression includes an increase in the expression level of the polypeptide. As used herein, “induction” of “expression” refers to increasing the expression level of a gene by causing a certain factor to act on a certain cell. Therefore, induction of expression means that the gene is expressed when no expression of the gene is seen, and the expression of the gene is increased when the expression of the gene is already seen. Is included.

  In the present specification, a gene is “specifically expressed” means that the gene is expressed at a level (preferably high) different from other sites or times in a specific site or time of an organism such as a plant. That means. With specific expression, it may be expressed only at a certain site (specific site) or may be expressed at other sites. The expression specifically preferably means that it is expressed only at a certain site.

  As used herein, “gene silencing” refers to the phenomenon of suppression of gene expression. The phenomenon called “gene silencing” includes genome imprinting, X chromosome inactivation, PEV (position effect variegation), maize paramutation, and the like. One of the inactivation of transgenes (transgenes) in plants is homology-dependent gene silencing (HDGS), and the HDGS-like phenomenon is a plant endogenous gene, other than plants. It is also seen in some transgenics, and is considered to be some kind of gene regulation mechanism of organisms.

  As used herein, “homology-dependent gene silencing” or “HDGS” is a gene expression that occurs when multiple genes occur depending on their base sequence homology or sequence similarity. Refers to the suppression phenomenon. In particular, when a specific introduced gene (transgene) is overexpressed, it refers to a phenomenon in which the same or homologous gene originally present in the genome together with the transgene (ie, endogenous) is suppressed. “HDGS” includes, for example, “PTGS”.

  As used herein, “post-transcriptional gene silencing” or “PTGS” refers to the phenomenon of suppression of gene expression that occurs after transcription. RNAi is also a kind of PTGS.

  As used herein, “co-suppression”, “co-suppression” and “co-suppression” can be used as synonyms. "Cosuppression" is an endogenous gene having a sequence homologous to the transgene in the plant containing the transgene (in the plant, the same transgene that was present on the genome of the plant) Or a gene that is homologous). This phenomenon was discovered in the process of studying the expression mechanism of genes involved in pigment synthesis in petunia flowers (Napoli, C., Lemieux, C. & Joergensen, R .: Plant Cell 2, 291-299 (1990). ); And van der Krol, R et al: Plant Cell 2, 291-299 (1990)). Since then, similar phenomena have been discovered not only in plants but also in red mold, Drosophila, nematodes, mammalian cells and the like. An example of using such “co-suppression” for breeding purposes is SCIENCE Vol. 309 29 July 2005 p. 741-745.

  Without being bound by theory, one of the possible mechanisms for RNAi to work is that when a molecule that causes RNAi, such as dsRNA, is introduced into a cell, a relatively long (eg, 40 base pairs or more) RNA, helicase In the presence of ATP, an RNaseIII-like nuclease called Dicer having a domain excises the molecule from the 3 ′ end by about 20 base pairs to produce a short dsRNA (also called siRNA). As used herein, “siRNA” is an abbreviation for short interfering RNA, which is artificially chemically synthesized, biochemically synthesized, synthesized in an organism, or about 40 This refers to short double-stranded RNA of 10 base pairs or more formed by decomposing double-stranded RNA of bases or more in the body, and usually has a 5′-phosphate, 3′-OH structure. 'The end protrudes about 2 bases. A protein specific to the siRNA binds to form an RNA-induced-silencing-complex (RISC). This complex recognizes and binds to mRNA having the same sequence as siRNA, and cleaves mRNA at the center of siRNA by RNaseIII-like enzyme activity. The relationship between the siRNA sequence and the mRNA sequence cleaved as a target is preferably 100% identical. However, with respect to the base mutation at a position off the center of siRNA, the cleavage activity by RNAi is not completely lost, but a partial activity remains. On the other hand, the mutation of the base at the center of siRNA has a large effect, and the cleavage activity of mRNA by RNAi is extremely reduced. Utilizing such properties, for mRNA having a mutation, only siRNA having the mutation can be specifically decomposed by synthesizing siRNA having the mutation in the center and introducing it into the cell. Therefore, in the present invention, siRNA itself can be used as a factor that causes RNAi, and a factor that generates siRNA (for example, a dsRNA typically having about 40 bases or more) can be used as such a factor. .

  Moreover, although not wishing to be bound by theory, siRNA is synthesized separately from the above pathway, and the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RdRP). It is also contemplated that this dsRNA becomes Dicer's substrate again, generating new siRNA and amplifying the action. Thus, in the present invention, siRNA itself and factors that produce siRNA are also useful. In fact, in insects and the like, for example, 35 dsRNA molecules almost completely degrade the mRNA in a cell having 1,000 copies or more, so it is understood that siRNA itself and factors that generate siRNA are useful. Is done.

  In the present invention, double-stranded RNA having a length of about 20 bases (for example, typically about 21 to 23 bases in length) or less than that called siRNA can be used. Such siRNA can be used for treatment, prevention, prognosis, etc. of a disease because it suppresses gene expression by expressing in a cell and suppresses expression of a pathogenic gene targeted by the siRNA.

  The siRNA used in the present invention may take any form as long as it can cause RNAi.

  In another embodiment, the agent that causes RNAi of the present invention may be a short hairpin RNA (shRNA) having an overhang at the 3 'end. As used herein, “shRNA” is a single-stranded RNA that includes a partially palindromic base sequence, and thus has a double-stranded structure within the molecule, resulting in a hairpin-like structure. The above molecules. Such shRNA is artificially chemically synthesized. Alternatively, such shRNA can be generated by synthesizing RNA in vitro using T7 RNA polymerase with hairpin structure DNA in which the DNA sequences of the sense strand and antisense strand are ligated in the opposite direction. Although not wishing to be bound by theory, such shRNAs are approximately 20 bases in length (typically 21 bases, 22 bases, 23 bases, etc.) in length after being introduced into the cell. It should be understood that it is degraded to cause RNAi as well as siRNA and has the therapeutic effect of the present invention. It should be understood that such effects are exerted in a wide range of organisms such as insects, plants, animals (including mammals). Thus, since shRNA causes RNAi similarly to siRNA, it can be used as an active ingredient of the present invention. The shRNA can also preferably have a 3 'overhang. The length of the double-stranded part is not particularly limited, but may preferably be about 10 nucleotides or more, more preferably about 20 nucleotides or more. Here, the 3 'protruding end may be preferably DNA, more preferably DNA having a length of at least 2 nucleotides, and further preferably DNA having a length of 2 to 4 nucleotides.

  The factor causing RNAi used in the present invention can be either artificially synthesized (for example, chemical or biochemical) or naturally occurring, and the effect of the present invention can be achieved between the two. There is no essential difference. Those chemically synthesized are preferably purified by liquid chromatography or the like.

  The factor that causes RNAi used in the present invention can also be synthesized in vitro. In this synthesis system, antisense and sense RNAs are synthesized from template DNA using T7 RNA polymerase and T7 promoter. When these are annealed in vitro and then introduced into cells, RNAi is caused through the mechanism described above, and the effects of the present invention are achieved. Here, for example, such RNA can be introduced into cells by the calcium phosphate method.

  Factors causing RNAi of the present invention also include factors such as single strands that can hybridize to mRNA, or all similar nucleic acid analogs thereof. Such factors are also useful in the methods and compositions of the invention.

  In this specification, for RTYV, SEQ ID NO: 2 (NP), SEQ ID NO: 4 (P), SEQ ID NO: 6 (P3), SEQ ID NO: 12 (P6), etc., preferably SEQ ID NO: 4 (P), SEQ ID NO: 6 ( Natural nucleic acid encoding a protein such as a polypeptide having the amino acid sequence of P3) or SEQ ID NO: 12 (P6) or a variant or fragment thereof is, for example, SEQ ID NO: 1 (NP coding region), SEQ ID NO: 3 (P code). Region), SEQ ID NO: 5 (P3 coding region) or SEQ ID NO: 11 (P6 coding region), preferably SEQ ID NO: 3 (P coding region), SEQ ID NO: 5 (P3 coding region) or SEQ ID NO: 11 (P6 coding region) A cDNA library having a PCR primer and a hybridization probe containing a part of the nucleic acid sequence shown in FIG. It is easily separated from the chromatography.

As used herein, “stringent conditions” for hybridization means that the complementary strand of a nucleotide strand having similarity or homology to the target sequence preferentially hybridizes to the target sequence, and the similarity Alternatively, it means a condition in which a complementary strand of a nucleotide strand having no homology does not substantially hybridize. The “complementary strand” of a certain nucleic acid sequence refers to a nucleic acid sequence (for example, T for A and C for G) that pair based on hydrogen bonding between the bases of the nucleic acid. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5 ° C. lower than the thermal melting temperature (Tm) for the specific sequence at a defined ionic strength and pH. T _m is the temperature at which 50% of the nucleotides complementary to the target sequence hybridize to the target sequence in equilibrium under a defined ionic strength, pH, and nucleic acid concentration. “Stringent conditions” are sequence-dependent and depend on various environmental parameters. General guidelines for nucleic acid hybridization are described in Tijssen (Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe”. assay ", Elsevier, New York).

Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na ^+, typically, Na ⁺ concentration of approximately 0.01~1.0M in PH7.0～8.3 ( Or other salts) and the temperature is at least about 30 ° C. for short nucleotides (eg, 10-50 nucleotides) and at least about 60 ° C. for long nucleotides (eg, longer than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Stringent conditions herein include hybridization in a buffer solution of 50% formamide, 1M NaCl, 1% SDS (37 ° C.), and washing at 60 ° C. with 0.1 × SSC. It is done.

  In the present specification, “polynucleotide hybridizing under stringent conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, hybridization was performed at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which DNA derived from colonies or plaques was immobilized, and then 0.1 to 2 times the concentration. Means a polynucleotide that can be identified by washing the filter under conditions of 65 ° C. using an SSC (saline-sodium citrate) solution (composition of 1-fold concentration of SSC solution is 150 mM sodium chloride and 15 mM sodium citrate). To do. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplements 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995) and the like. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% Examples thereof include a polynucleotide having the above homology, a polynucleotide having a homology of 90% or more, and more preferably a polynucleotide having a homology of 95% or more.

As used herein, “highly stringent conditions” are designed to allow hybridization of DNA strands having a high degree of complementarity in nucleic acid sequences and to exclude hybridization of DNA having significant mismatches. Say conditions. Hybridization stringency is primarily determined by temperature, ionic strength, and the conditions of denaturing agents such as formamide. Examples of “highly stringent conditions” for such hybridization and washing are 0.0015 M sodium chloride, 0.0015 M sodium citrate, 65-68 ° C., or 0.015 M sodium chloride, 0.0015 M citric acid. Sodium, and 50% formamide, 42 ° C. For such highly stringent conditions, see Sambrook et al. , Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory (Cold Spring Harbor, N, Y. 1989); and Anderson et al. Nucleic Acid Hybridization: a Practical approach, IV, IRL Press Limited (Oxford, England). See Limited, Oxford, England. If necessary, more stringent conditions (eg, higher temperature, lower ionic strength, higher formamide, or other denaturing agents) may be used. Other agents can be included in the hybridization and wash buffers for the purpose of reducing non-specific hybridization and / or background hybridization. Examples of such other agents include 0.1% bovine serum albumin, 0.1% polyvinyl pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO ₄ or SDS), Ficoll, Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA) and dextran sulfate, but other suitable agents can also be used. The concentration and type of these additives can be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually performed at pH 6.8-7.4; however, at typical ionic strength conditions, the rate of hybridization is almost pH independent. Anderson et al. , Nucleic Acid Hybridization: a Practical Approach, Chapter 4, IRL Press Limited (Oxford, England).

Factors that affect the stability of the DNA duplex include base composition, length, and degree of base pair mismatch. Hybridization conditions can be adjusted by one of ordinary skill in the art to apply these variables and to allow different sequence related DNAs to form hybrids. The melting temperature of a perfectly matched DNA duplex can be estimated by the following equation:
T _m (° C.) = 81.5 + 16.6 (log [Na ⁺ ]) + 0.41 (% G + C) −600 / N-0.72 (% formamide)
Where N is the length of the duplex formed, [Na ⁺ ] is the molar concentration of sodium ions in the hybridization or wash solution, and% G + C is the (guanine + Cytosine) base percentage. For imperfectly matched hybrids, the melting temperature decreases by about 1 ° C. for each 1% mismatch.

  As used herein, “moderately stringent conditions” refers to conditions under which a DNA duplex having a higher degree of base pair mismatch than can be generated under “highly stringent conditions”. . Examples of representative “moderately stringent conditions” are 0.015 M sodium chloride, 0.0015 M sodium citrate, 50-65 ° C., or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 20 % Formamide, 37-50 ° C. By way of example, “moderately stringent” conditions at 50 ° C. in 0.015 M sodium ion tolerate a mismatch of about 21%.

  It will be appreciated by those skilled in the art that there may not be a complete distinction between “highly” stringent conditions and “moderate” stringent conditions herein. For example, at 0.015M sodium ion (no formamide), the melting temperature of perfectly matched long DNA is about 71 ° C. In washing at 65 ° C. (same ionic strength), this allows about 6% mismatch. In order to capture more distant related sequences, one of ordinary skill in the art can simply decrease the temperature or increase the ionic strength.

For oligonucleotide probes up to about 20 nucleotides, a reasonable estimate of the melting temperature in 1M NaCl is
Tm = (2 ° C. for one AT base) + (4 ° C. for one GC base pair)
Provided by. The sodium ion concentration in 6 × sodium citrate (SSC) is 1M (see Suggs et al., Developmental Biology Using Purified Genes, page 683, Brown and Fox (ed.) (1981)).

SEQ ID NO: 2 (NP), SEQ ID NO: 4 (P), SEQ ID NO: 6 (P3) or SEQ ID NO: 12 (P6), etc., preferably SEQ ID NO: 4 (P), SEQ ID NO: 6 (P3) or SEQ ID NO: 12 ( A nucleic acid encoding a polypeptide having the amino acid sequence of P6) or a variant or fragment thereof is essentially 1% bovine serum albumin (BSA); 500 mM sodium phosphate (NaPO ₄ ); 1 mM EDTA; temperature of 42 ° C. Low stringency conditions defined by a hybridization buffer containing 7% SDS at 5% and essentially 2 × SSC (600 mM NaCl; 60 mM sodium citrate); wash buffer containing 0.1% SDS at 50 ° C. More preferably essentially 1% bovine serum albumin (BSA) at a temperature of 50 ° C .; 500 mM phosphorus Sodium acetate (NaPO ₄ ); 15% formamide; 1 mM EDTA; hybridization buffer containing 7% SDS and essentially 1 × SSC at 50 ° C. (300 mM NaCl; 30 mM sodium citrate); wash containing 1% SDS 1% bovine serum albumin (BSA) under low stringent conditions as defined by buffer, most preferably at a temperature of essentially 50 ° C .; 200 mM sodium phosphate (NaPO ₄ ); 15% formamide; 1 mM EDTA; 7 Low stringency conditions defined by hybridization buffer containing% SDS and essentially 0.5 × SSC (150 mM NaCl; 15 mM sodium citrate) at 65 ° C .; wash buffer containing 0.1% SDS SEQ ID NO: 1 (NP), SEQ ID NO: 3 ( ), SEQ ID NO: 5 (P3) or SEQ ID NO: 11 (P6), etc., preferably one of the nucleic acid sequences shown in SEQ ID NO: 3 (P), SEQ ID NO: 5 (P3) or SEQ ID NO: 11 (P6) or one of them It can hybridize with the part.

  As used herein, “homology” indicates that, in a comparison of two or more sequences, those sequences evolutionarily share ancestry. Whether two genes have homology can be determined by performing a determination based on similarity by direct comparison of sequences or by a hybridization method under stringent conditions. When judging based on similarity by direct comparison of sequences, the simplest interpretation in the alignment of the similarity measurement process is juxtaposed with the same (or equivalent) character string (base, amino acid residue, etc.) Strings indicate that these regions were ancestral sequences that did not change, and non-identical (or not equivalent) strings were mutations in one sequence It is possible to consider. Gaps (indels) in the alignment are considered to be those in which insertions or deletions have occurred on one side of the sequence. That is, it is understood that the high identity or similarity of these sequences strongly suggests homology in those sequences. Homology is referenced in the design of expression inhibitors.

  In the present specification, the “primer” refers to a substance necessary for initiation of a reaction of a polymer compound to be synthesized in a polymer synthase reaction. In the synthesis reaction of a nucleic acid molecule, a nucleic acid molecule (for example, DNA or RNA) complementary to a partial sequence of a polymer compound to be synthesized can be used.

  Examples of nucleic acid molecules that are usually used as primers include those having a nucleic acid sequence of at least 8 consecutive nucleotides that is complementary to the nucleic acid sequence of the target gene. Such a nucleic acid sequence is preferably at least 12 contiguous nucleotides long, at least 9 contiguous nucleotides, more preferably at least 10 contiguous nucleotides, and even more preferably at least 11 contiguous nucleotides. At least 13 contiguous nucleotides, at least 14 contiguous nucleotides, at least 15 contiguous nucleotides, at least 16 contiguous nucleotides, at least 17 contiguous nucleotides, at least 18 At least 19 contiguous nucleotides, at least 19 contiguous nucleotides, at least 20 contiguous nucleotides, at least 25 contiguous nucleotides, at least 30 contiguous nucleotides, at least 40 Nucleotides long that connection, at least 50 contiguous nucleotides in length, may be a nucleic acid sequence. Nucleic acid sequences used as probes are nucleic acid sequences that are at least 70% homologous, more preferably at least 80% homologous, more preferably at least 90% homologous, at least 95% homologous to the sequences described above. Is included. A sequence suitable as a primer may vary depending on the nature of the sequence intended for synthesis (amplification), but those skilled in the art can appropriately design a primer according to the intended sequence. Such primer design is well known in the art, and may be performed manually or using a computer program (eg, LASERGENE, PrimerSelect, DNAStar).

  In the present specification, the “variant” refers to a substance in which a part of the original substance such as a polypeptide or polynucleotide is changed. Such variants include substitutional variants, addition variants, insertion variants, deletion variants, truncated variants, allelic variants, and the like. Such variants include one or several substitutions, additions, insertions and / or deletions, or one or more substitutions, additions, insertions and / or deletions from a reference nucleic acid molecule or polypeptide. Examples include, but are not limited to, loss. “Ortholog” is also referred to as an orthologous gene, which is a gene derived from speciation from a common ancestor with two genes. Since orthologs can usually perform the same function as the original virus strain in another virus strain, the orthologs of the present invention can also be useful in the present invention.

  As used herein, “conservative (modified) variants” applies to both amino acid and nucleic acid sequences. Conservatively modified variants with respect to a particular nucleic acid sequence refer to nucleic acids that encode the same or essentially the same amino acid sequence, and are essentially identical if the nucleic acid does not encode an amino acid sequence. An array. Such base sequence modification methods include restriction enzyme digestion, DNA polymerase, Klenow fragment, DNA ligase treatment and other ligation treatments, site-specific base substitution methods using synthetic oligonucleotides (specification) Site-directed mutagenesis; Mark Zoller and Michael Smith, Methods in Enzymology, 100, 468-500 (1983)), but can also be modified by methods usually used in the field of molecular biology it can.

  As long as the nucleic acid molecule used in the present specification suppresses the expression of the target gene, a part of the sequence of the nucleic acid may be deleted or replaced with another base as described above, or other A part of the nucleic acid sequence may be inserted. Alternatively, another nucleic acid may be bound to the 5 'end and / or the 3' end. Alternatively, it may be a nucleic acid molecule that hybridizes under stringent conditions with a gene encoding a polypeptide and encodes a polypeptide having substantially the same function as the polypeptide. Such genes are known in the art and can be used in the present invention.

  Such a nucleic acid can be obtained by a well-known PCR method, and can also be chemically synthesized. These methods may be combined with, for example, a site-specific displacement induction method or a hybridization method.

  In the present specification, “substitution, addition, insertion and / or deletion” of a polypeptide or polynucleotide refers to an amino acid or a substitute thereof, or a nucleotide or a substitute thereof, respectively, relative to the original polypeptide or polynucleotide. An object is replaced, added, inserted, or removed. Such substitution, addition, insertion and / or deletion techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. Can these changes in the reference nucleic acid molecule or polypeptide occur at the 5 'or 3' end of the nucleic acid molecule or can occur at the amino-terminal or carboxy-terminal site of the amino acid sequence representing the polypeptide , Or anywhere between their terminal sites, interspersed individually between residues in the reference sequence. The number of substitutions, additions or deletions may be any number as long as it is one or more, and such number is a function (for example, information on hormones, cytokines) in a variant having the substitution, addition or deletion. As long as the transmission function is maintained, it can be increased. For example, such a number can be one or several, and preferably within 20%, within 15%, within 10%, within 5%, or less than 150, less than 100, less than 100, It can be 50 or less, 25 or less, and the like.

(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in the present specification are well known and commonly used in the art. For example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F.A. M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F.M. M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, a separate volume of experimental medicine “Gene Transfer & Expression Analysis Experimental Method”, Yodosha, 1997, etc., and these are relevant parts (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPress; Gait, M. J. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: A Practical Approac, IRL Press; Adams, R. L. et al. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G. M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G. T. (I996). Bioconjugate Techniques, Academic Press, etc., which are incorporated herein by reference in the relevant part.

(Genetic engineering)
SEQ ID NO: 2 (NP), SEQ ID NO: 4 (P), SEQ ID NO: 6 (P3), SEQ ID NO: 12 (P6) or the like used in the present invention, preferably SEQ ID NO: 4 (P), SEQ ID NO: 6 (P3) Alternatively, a polypeptide having the amino acid sequence of SEQ ID NO: 12 (P6) and fragments and variants thereof can be produced using genetic engineering techniques.

  In the present specification, when referring to a gene, “vector” or “recombinant vector” refers to a vector capable of transferring a target polynucleotide sequence to a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, animal cells, plant cells, insect cells, individual animals and individual plants, or can be integrated into chromosomes. Examples include those containing a promoter at a position suitable for nucleotide transcription. Among vectors, a vector suitable for cloning is called “cloning vector”. Such cloning vectors usually contain multiple cloning sites that contain multiple restriction enzyme sites. Such restriction enzyme sites and multiple cloning sites are well known in the art, and those skilled in the art can appropriately select and use them according to the purpose. Such techniques are described in the literature described herein (eg, Sambrook et al., Supra). Preferred vectors include, but are not limited to, plasmids, phages, cosmids, episomes, viral particles or viruses and integratable DNA fragments (ie, fragments that can be integrated into the host genome by homologous recombination).

  One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) can replicate autonomously in the host cell into which they are introduced. Other vectors (eg, non-episomal mammalian vectors) are integrated into the host cell's genome upon introduction into the host cell, and are thereby replicated along with the host genome. Furthermore, certain vectors may direct the expression of genes to which they are operably linked. Such vectors are referred to herein as “expression vectors”.

  Therefore, in the present specification, an “expression vector” or “expression plasmid” refers to a nucleic acid in which various regulatory elements are linked in a state capable of operating in a host cell in addition to a structural gene and a promoter that regulates its expression. An array. Regulatory elements can preferably include terminators, selectable markers such as drug resistance genes, and enhancers. It is well known to those skilled in the art that the type of organism (eg, plant) expression vector and the type of regulatory elements used can vary depending on the host cell.

As a “recombinant vector” for prokaryotic cells that can be used in the present invention, pcDNA3 (+), pBluescript-SK (+/−), pGEM-T, pEF-BOS, pEGFP, pHAT, pUC18, pFT-DEST ^™ 42GATEWAY And pENTR ^™ / D-TOPO (Invitrogen). Prokaryotic cells can be used for gene amplification and modification.

  As a “recombinant vector” for plant cells that can be used in this specification, pANDA (sold by Prof. Shimamoto, Nara Institute of Science, Miki D, Itoh R, and Shimamoto K (2005) RNA Silencing of Single and Multiple Members in a GeneFamily 138: 1903-1913), pBE7133-GUS-Hygro (pE7ΩIGUS-Hygro), and pPZP2H-lac, but are not limited thereto.

  As used herein, “terminator” is a sequence that is located downstream of a region encoding a protein of a gene and is involved in termination of transcription when DNA is transcribed into mRNA, and addition of a poly A sequence. Terminators are known to contribute to mRNA stability and affect gene expression levels. Examples of terminators include, but are not limited to, CaMV35S terminator and terminator (Tnos) of nopaline synthase gene.

  As used herein, the term “promoter” refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency, and is a base sequence that initiates transcription upon binding of RNA polymerase. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene.

  The promoter may be inducible, constitutive, site specific, or time specific, but is preferably a constitutive promoter or an inducible promoter. Any promoter can be used as long as it can be expressed in host cells such as mammalian cells, E. coli, and yeast.

  In this specification, when used for expression of a gene, “site specificity” generally refers to the specificity of expression of the gene in a plant site. “Time specificity” refers to the specificity of expression of the gene depending on the stage of plant development. Such specificity can be introduced into a desired organism by selecting an appropriate promoter. By expressing nucleic acids using site-specific regulatory elements, recombinant plant expression vectors can preferentially direct the expression of nucleic acids in specific cell types. Site-specific regulatory elements are known in the art.

  As used herein, “site-specific expression promoter” refers to organs (eg, roots, stems, leaves, fruits, seeds, and combinations thereof), tissues (eg, epidermis, sieve, soft tissue, xylem, Vascular bundles, as well as combinations thereof), developmental stages (eg, germination, growth, flowering, climbing and combinations thereof) and the like. In principle, it can be obtained by isolating a gene specifically expressed in an individual and isolating its promoter and expression control cis region.

  In the present specification, the expression of a promoter is “constitutive” refers to the property that it is expressed in an almost constant amount in all tissues of an organism, regardless of whether the organism is growing or proliferating. Specifically, when Northern blot analysis is performed, for example, at any time point (for example, 2 points or more (for example, 5th day and 15th day)), the same or corresponding sites have almost the same level. When the expression level is observed, the expression is constitutive by definition of the present invention. Constitutive promoters are thought to play a role in maintaining homeostasis of organisms in normal growth environments. The expression “responsiveness” of the promoter of the present invention refers to the property that the expression level changes when at least one factor is given to an organism. In particular, the property of increasing the expression level is called “inducibility” with respect to the factor, and the property of decreasing the expression level is called “decreasing” with respect to the factor. The expression of “decreasing” is a concept that overlaps with “constitutive” expression because it is assumed that expression is observed in the normal state. These properties can be determined by extracting RNA from any part of the organism and analyzing the expression level by Northern blot analysis or quantifying the expressed protein by Western blot. Mammalian cells or mammals (including specific tissues etc.) transformed with a vector incorporating a promoter inducible to the factor together with a nucleic acid encoding the site-specific recombination inducing factor of the present invention, the promoter By using a stimulating factor having an inducing activity, site-specific recombination of site-specific recombination sequences can be performed under certain conditions.

  The polynucleotide of the present invention can be used as it is or modified, linked to an appropriate plant expression vector using methods well known to those skilled in the art, and introduced into plant cells by a known gene recombination technique. The introduced gene is incorporated into DNA in the plant cell. The DNA in plant cells includes not only chromosomes but also DNAs contained in various organelles (for example, mitochondria and chloroplasts) contained in plant cells.

  As used herein, “plant expression vector” refers to a nucleic acid sequence to which various regulatory elements such as a promoter that regulates the expression of the gene of the present invention are operably linked in a host plant cell. As used herein, the term “regulatory sequence” refers to a DNA sequence having a functional promoter and any associated transcription elements (eg, enhancer, CCAAT box, TATA box, SPI site, etc.). As used herein, the term “operably linked” refers to the operation of a polynucleotide associated therewith and various regulatory elements such as promoters, enhancers and the like that regulate its expression in a host cell so that the gene can be expressed. It is said that it is connected in the obtained state. The plant expression vector can suitably comprise a plant gene, promoter, terminator, drug resistance gene and enhancer. It is well known to those skilled in the art that the type of expression vector and the type of regulatory elements used can vary depending on the host cell. The plant expression vector used in the present invention may further have a T-DNA region. The T-DNA region increases the efficiency of gene introduction, particularly when a plant is transformed with Agrobacterium.

  As used herein, “plant gene promoter” means a promoter expressed in a plant. Plant promoter fragments that direct expression of the polynucleotides of the invention can be employed in all tissues of regenerated plants. Examples of promoters for constitutive expression include, for example, a promoter of nopaline synthase gene (Langridge, 1985, Plant Cell Rep. 4, 355), a promoter that generates cauliflower mosaic virus 19S-RNA (Guilley, 1982, Cell 30, 763), a promoter that generates cauliflower mosaic virus 35S-RNA (Odell, 1985, Nature 313, 810), actin promoter of rice (Zhang, 1991, Plant Cell 3, 1155), maize ubiquitin promoter (Cornejo 1993, Plant Mol. Biol 23, 567), REXφ promoter (Mitsuhara, 1996, Plant Cell Physiol. 37, 49), etc. can be used.

  Alternatively, a plant promoter can direct the expression of the polynucleotide of the invention in a particular tissue, or can be under more specific environmental or developmental control. Such promoters are referred to herein as “inducible” promoters. Examples of inducible promoters include promoters that are known to be expressed by external factors such as light, low temperature, high temperature, drying, ultraviolet irradiation, and application of specific compounds. Examples of such a promoter include a promoter of a gene encoding a ribulose-1,5-2 phosphate carboxylase small subunit expressed by light irradiation (Fluhr, 1986, Pro. Natl. Acad. Sci. USA 83, 2358). ), The rice lip19 gene promoter induced by low temperature (Aguan, 1993, Mol. Gene. Genet. 240, 1), the rice hsp72, hsp80 gene promoter induced by high temperature (Van Breusegem, 1994, Planta 193) 57), Arabidopsis thaliana rab16 gene promoter (Nundy, 1990, Proc. Natl. Acad. Sci. USA 87, 1406) induced by drought, and maize alcohol dehydrogenase gene promoter induced by UV irradiation (Schulze). -Lefert, 1989, EMBO J. 8, 651). The promoter of the lab16 gene is also induced by spraying the plant hormone abscisic acid.

  In the present specification, the “drug resistance gene” is desirably one that facilitates selection of transformed plants. A neomycin phosphotransferase II (NPTII) gene for conferring kanamycin resistance, a hygromycin phosphotransferase gene for conferring hygromycin resistance, and the like can be preferably used, but are not limited thereto. These drug resistance genes are used in screening techniques and the like in the present invention.

  Plant expression vectors such as those described above can be produced using genetic recombination techniques well known to those skilled in the art. For the construction of a plant expression vector, for example, a pBI-type vector or a pUC-type vector is preferably used, but is not limited thereto.

  As a plant material for DNA introduction, an appropriate material can be selected from leaves, stems, roots, tubers, protoplasts, callus, pollen, seed embryos, shoot primordia, etc., depending on the introduction method. A “plant cell” may be any plant cell. Examples of “plant cells” include cells of plant organs such as leaves and roots, callus and suspension culture cells. The plant cell may be in any form of a cultured cell, a cultured tissue, a cultured organ, or a plant body. Preferred are cultured cells, cultured tissues, or cultured organs, and more preferred are cultured cells.

  In general, when introducing DNA into plant cultured cells, protoplasts are used as a material, and DNA is introduced by physical / chemical methods such as electroporation and polyethylene glycol methods, whereas it is introduced into plant tissues. When introducing DNA, leaves, stems, roots, tubers, callus, pollen, seed embryos, shoot primordia, etc., preferably leaves, stems, callus, etc., biology using viruses or Agrobacterium DNA is introduced by a physical method or a physical / chemical method such as a particle gun method. As a method using Agrobacterium, for example, the method of Nagel et al. (Microbiol. Lett., 67, 325 (1990)) can be used. In this method, Agrobacterium is first transformed with a plant expression vector (for example, by electroporation), and then the transformed Agrobacterium is introduced into plant tissue by a well-known method such as a leaf disk method. Is the method. These methods are well known in the art, and a method suitable for the plant to be transformed can be appropriately selected by those skilled in the art.

  A cell into which a plant expression vector has been introduced is selected based on drug resistance such as kanamycin resistance. The selected cells can be regenerated into a plant body by a conventional method.

  In order to regenerate a plant from a plant cell into which the polynucleotide of the present invention has been introduced, such a plant cell may be cultured in a regeneration medium, a hormone-free MS medium, or the like. The rooted young plant body can be made into a plant body by transplanting and cultivating it in soil. The method of regeneration (redifferentiation) varies depending on the type of plant cell. Various documents include rice (Fujimura, 1995, Plant Tissue Culture Lett. 2, 74), corn (Shillito, 1989, Bio / Technol. 7, 581, Gorden-Kamm, 1990, Plant Cell 2, 603), potato (Visser, 1989, Theor. Appl. Genet. 78, 594) and tobacco (Nagata, 1971, Planta 99, 12) and other methods for redifferentiation are described.

  In the regenerated plant body, the expression of the introduced gene of the present invention can be confirmed using techniques well known to those skilled in the art. This confirmation can be performed, for example, using Northern blot analysis. Specifically, total RNA is extracted from plant leaves, electrophoresed with denatured agarose, and then blotted onto an appropriate membrane. By hybridizing a labeled RNA probe complementary to a part of the transgene to this blot, the mRNA of the gene of the present invention can be detected.

  The plant that can be transformed with the polynucleotide of the present invention includes any plant capable of gene transfer.

  When using Escherichia coli as a host cell, promoters derived from Escherichia coli and phage, such as trp promoter (Ptrp), lac promoter (Plac), PL promoter, PR promoter, PSE promoter, etc., SPO1 promoter, SPO2 promoter, penP promoter, etc. Can be mentioned. An artificially designed and modified promoter such as a promoter in which two Ptrps are connected in series (Ptrp x2), a tac promoter, a lacT7 promoter, and a let I promoter can also be used.

  As used herein, “replication origin” refers to a specific region on a chromosome where DNA replication begins. The origin of replication can either be provided by constructing the vector to include an endogenous origin, or it can be provided by the host cell's chromosomal replication machinery. The latter may be sufficient if the vector is integrated into the host cell chromosome. Alternatively, rather than using a vector containing a viral origin of replication, one of skill in the art can transform mammalian cells by a method that co-transforms a selectable marker and the DNA of the present invention. Examples of suitable selectable markers are dihydrofolate reductase (DHFR) or thymidine kinase (see US Pat. No. 4,399,216).

  As used herein, “enhancer” refers to a sequence used to increase the expression efficiency of a target gene. Such enhancers are well known in the art. For example, an enhancer region including an upstream sequence in the CaMV35S promoter is used as an enhancer, but is not limited thereto. A plurality of enhancers may be used, but one may be used or may not be used.

  In the present invention, an “enhancer” can be used to increase the expression efficiency of a target gene. As the enhancer, an enhancer region containing an upstream sequence in the CaMV35S promoter is preferable. A plurality of enhancers can be used per plant expression vector.

  As used herein, “operably linked” refers to a transcriptional translational regulatory sequence (eg, promoter, enhancer, etc.) or a translational regulatory sequence that has the expression (operation) of a desired sequence. That means. In order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

  In this specification, any technique may be used for introducing a nucleic acid molecule into a cell, and examples thereof include transformation, transduction, and transfection. Such a technique for introducing a nucleic acid molecule is well known in the art and commonly used. For example, Ausubel F. et al. A. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY; Sambrook J et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. And its third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, a separate volume of experimental medicine "Gene Transfer & Expression Analysis Experimental Method" Yodosha, 1997, and the like. Gene transfer can be confirmed using the methods described herein, such as Northern blot, Western blot analysis, or other well-known conventional techniques.

  Moreover, as a method for introducing a vector, any of the above-described methods for introducing DNA into cells can be used. For example, transfection, transduction, transformation, etc. (for example, calcium phosphate method, liposome method, DEAE dextran method, electroporation method, method using particle gun (gene gun), etc.).

  As used herein, “transformant” refers to all or part of a living organism such as a cell produced by transformation. Examples of the transformant include prokaryotic cells, yeast, animal cells, plant cells, insect cells and the like. A transformant is also referred to as a transformed cell, transformed tissue, transformed host, etc., depending on the subject. The cell used in the present invention may be a transformant.

  When prokaryotic cells are used in genetic manipulation or the like in the present invention, prokaryotic cells include, for example, prokaryotic cells belonging to the genus Escherichia, Serratia, Bacillus, Brevibacterium, Corynebacterium, Microbacterium, Pseudomonas, etc. And Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, and Escherichia coli DH1.

  As used herein, any method for introducing a DNA can be used as a method for introducing a recombinant vector. For example, a calcium chloride method, an electroporation method [Methods. Enzymol. , 194, 182 (1990)], lipofection method, spheroplast method [Proc. Natl. Acad. Sci. USA, 84, 1929 (1978)], lithium acetate method and the like.

  As used herein, “detection” or “quantification” of gene expression (eg, mRNA expression, polypeptide expression) can be accomplished using appropriate methods, including, for example, mRNA measurement and immunoassay methods. Examples of molecular biological measurement methods include Northern blotting, dot blotting, and PCR. Examples of the immunological measurement method include an ELISA method using a microtiter plate, an RIA method, a fluorescent antibody method, a Western blot method, and an immunohistochemical staining method. Examples of the quantitative method include an ELISA method and an RIA method. It can also be performed by a gene analysis method using an array (eg, DNA array, protein array). The DNA array is widely outlined in (edited by Shujunsha, separate volume of cell engineering "DNA microarray and latest PCR method"). For protein arrays, see Nat Genet. 2002 Dec; 32 Suppl: 526-32. Examples of gene expression analysis methods include, but are not limited to, RT-PCR, RACE method, SSCP method, immunoprecipitation method, two-hybrid system, in vitro translation and the like. Such further analysis methods are described in, for example, Genome Analysis Experimental Method / Yusuke Nakamura Lab Manual, Editing / Yusuke Nakamura Yodosha (2002), etc., all of which are incorporated herein by reference. Is done.

(Evaluation of resistance)
Whether or not the genetically modified plant produced by the method of the present invention has resistance to a pathogen can be confirmed by observing disease symptoms and testing for the possibility of pathogen infection. For example, in the case of a viral disease of the Rhabdoviridae family, when an RTYV-mediated insect such as leafhopper is released in a greenhouse and infected with a virus in a specific rice cultivar, the formation of lesions, rice height, etc. It is possible to compare the cultivar or wild type with the recombinant, and to test the possibility of viral infection by ELISA, but is not limited thereto.

  In the present specification, the “expression level” refers to an amount at which a polypeptide or mRNA is expressed in a target cell or the like. Such expression level is evaluated by any appropriate method including immunoassay methods such as ELISA method, RIA method, fluorescent antibody method, Western blot method, and immunohistochemical staining method using the antibody of the present invention. The polypeptide of the present invention evaluated by any appropriate method including the expression level of the polypeptide of the present invention at the protein level, or a molecular biological measurement method such as Northern blotting, dot blotting, RT-PCR, etc. Expression level at the mRNA level. “Change in expression level” means an increase in the expression level at the protein level or mRNA level of the polypeptide of the present invention evaluated by any appropriate method including the above immunological measurement method or molecular biological measurement method. Or it means to decrease.

  As used herein, the term “upstream” refers to a position from a particular reference point toward the 5 ′ end of a polynucleotide.

  As used herein, the term “downstream” refers to a position from a particular reference point toward the 3 ′ end of a polynucleotide.

  As used herein, the terms “complementary” or “complement” are used herein to refer to a sequence of a polynucleotide that allows the entire complementary region to directly form a Watson & Crick base pair with another specific polynucleotide. Show. For purposes of the present invention, a first polynucleotide is considered complementary to a second polynucleotide when each base of the first polynucleotide is paired with its complementary base. Complementary bases are generally A and T (or A and U) or C and G. In the present specification, the term “complement” is used as a synonym for “complementary polynucleotide”, “complementary nucleic acid” and “complementary nucleotide sequence”. These terms apply to a pair of polynucleotides based solely on their sequence, and do not apply to the particular set in which the two polynucleotides are effectively in a combined state.

(Description of Preferred Embodiment)
The description of the preferred embodiment is described below, but it should be understood that this embodiment is an illustration of the present invention and that the scope of the present invention is not limited to such a preferred embodiment. It should be understood that those skilled in the art can easily make modifications, changes and the like within the scope of the present invention with reference to the following preferred embodiments.

  Since almost no analysis has been made on the behavior of each protein encoded by RTYV in infected cells, an expression inhibitor was prepared by setting individual target genes, and an attempt was made to produce RTYV resistant rice. In the present invention, the above-described resistant rice was tried for the purpose of constructing a long sequence of about 500 bases instead of the conventional 20 bases.

  In one aspect, the present invention provides a composition for imparting resistance to a rhabdoviridae viral disease, comprising an expression inhibitor of at least one gene present in the rhabdoviridae viral genome.

  In one embodiment of the present invention, the nucleic acid sequence encoding the at least one gene is a group consisting of SEQ ID NO: 1 (NP), SEQ ID NO: 3 (P), SEQ ID NO: 5 (P3), or SEQ ID NO: 11 (P6). More can be selected.

  In one embodiment, preferred antisense sequences are SEQ ID NO: 16 (Trigger leader + NP), SEQ ID NO: 17 (Trigger NP), SEQ ID NO: 18 (Trigger P), SEQ ID NO: 19 (Trigger P3), SEQ ID NO: 20 (Trigger M). , SEQ ID NO: 22 (Trigger P6) or SEQ ID NO: 24 (Trigger trailer + L). More preferred antisense sequences are complementary to SEQ ID NO: 16 (Trigger leader + NP), SEQ ID NO: 17 (Trigger NP), SEQ ID NO: 18 (Trigger P), SEQ ID NO: 19 (Trigger P3) or SEQ ID NO: 22 (Trigger P6). It can be an array. Even more preferred antisense sequences can be sequences complementary to SEQ ID NO: 18 (Trigger P), SEQ ID NO: 19 (Trigger P3) or SEQ ID NO: 22 (Trigger P6).

  In one embodiment, the trimming sequence can have a sequence of 5 to 32 or more nucleotides. Preferred trimming sequences include, but are not limited to, GUS sequences, pyruvate orthophosphate dikinase introns, dof affecting germination (DAG1) introns, and the like.

  The promoter of the present invention may be inducible, constitutive, site-specific, or time-specific. Preferred promoters include constitutive promoters or inducible promoters. Is mentioned. As the inducible promoter, a stress inducible promoter (for example, an infection inducible promoter) is preferable. The constitutive promoter includes, but is not limited to, a ubiquitin promoter (for example, the ubiquitin promoter sequence of SEQ ID NO: 46 (derived from Genbank accession number AY452736)) and an actin promoter. Examples of infection-inducible promoters include, but are not limited to, WRKY transcription factor promoter, PR1 promoter, PBZ1 gene promoter, peroxidase promoter, mitogen-activated promoter, and the like.

  In one aspect, the present invention includes an antisense sequence complementary to a nucleic acid sequence encoding at least one gene present in the viral genome of the Rhabdoviridae family, a trimming sequence, and a sense sequence complementary to the antisense sequence. An expression cassette is provided.

  In another preferred embodiment, the antisense sequence used is, for example, rnai_designer (http://www.invitrogen.co.jp/rnai/rnai_designer.shtml/) available on the Invitrogen website, Promega web SiRNADesigner available on the site (http: //www.promega.com.siRNADesigner/), siRNA Target Finder on Ambion's website, siDESIGN Center on Dharmacon, siRNA Target Finder on GenScript, and Gene specific siRNA selector (these methods) It is possible to design easily by using (but not limited to).

  In one aspect, the present invention provides a vector containing the expression cassette. It is understood that any vector may be used as long as the vector used in the present invention achieves a desired purpose (expression, delivery, insertion, introduction, etc.).

  The vector of the present invention may contain a drug resistance gene in order to confirm whether or not it has been introduced into the target cell. As the drug resistance gene, a neomycin phosphotransferase II (NPTII) gene for conferring kanamycin resistance, a hygromycin phosphotransferase gene for conferring hygromycin resistance, and the like can be preferably used. Not.

  In one aspect, the present invention provides a plant cell, a plant body, and a seed containing the vector.

  Such a plant may be any type, but is preferably a plant affected by a rhabdoviridae virus such as rice yellow leaf virus (RTYV), more preferably a grass family (wheat, barley, Corn, sorghum, etc.), even more preferably a rice plant, even more preferably rice (eg, Japonica or Indica).

  In one embodiment, the plant of the present invention exhibits complete resistance to Rhabdoviridae viruses.

(Creation of resistant and resistant plants)
In one aspect, the present invention provides a method for producing a Gramineae plant capable of infecting a Rhabdoviridae virus, which is imparted with resistance to Rhabdoviridae virus disease; Providing a method for producing seeds of a plant capable of infecting a Rhabdoviridae virus; and a method for regenerating a plant capable of infecting a Rhabdoviridae virus that has been rendered resistant to Rhabdoviridae virus disease .

  The method shown above includes the step of introducing the expression inhibitor of the present invention into cells of a grass family plant. In general, the vectors of the present invention can be introduced into the genome of a desired plant host (eg, a grass cell) using a variety of conventional techniques. Preferred introduction methods include, but are not limited to, the Agrobacterium method, the polyethylene glycol method, the electroporation method, and the particle gun method. The method further includes selecting a plant that is resistant to rhabdoviridae viruses. Such selection may be performed by any method as long as a transgenic plant having resistance can be selected, and may be selected at the cell level or at the plant body level.

  In order to confirm whether or not the vector of the present invention has been introduced, in the case of a vector containing a drug resistance gene (for example, a hygromycin phosphotransferase gene), the cells obtained after the introduction step described above are the drug resistance gene. Can be selected by growing in a selective medium containing an agent (eg, hygromycin) to detect whether or not is expressed in the cell. Of course, the drug contained in such a selective medium can be altered depending on the drug resistance gene contained in the vector.

  The cells selected as described above are re-differentiated by culturing them in a regeneration medium generally used in the art until, for example, roots and shoots can be confirmed. Such regeneration media include, but are not limited to, media known in the art such as regeneration media (MSRE) as described in the examples below.

  Roots and shoots obtained by redifferentiation as described above are potted and allowed to grow to a suitable time for testing (for example, the 9th leaf stage) or to a mature stage, thereby allowing transgenic plants ( T0) is created.

  Further, whether or not the vector of the present invention is contained in the thus obtained transgenic plant is obtained by collecting cells from the plant to obtain total cellular DNA and incorporating the drug resistance gene incorporated into the genome. Whether the vector of the present invention is actually contained in the obtained transgenic plant can be confirmed by Southern blotting or the like. Moreover, it can also be confirmed that RNAi can actually be induced in a transgenic plant by obtaining low molecular weight RNA and performing Northern blotting using the Trigger region as a probe. Furthermore, the obtained transgenic plant is actually infected with RTYV to detect whether the vector of the present invention is contained by comparing the infected transgenic plant with a control wild type plant. You can also.

  Furthermore, the transgenic plant of the present invention can also be obtained from seeds obtained from T0 plants, as well as from progeny T1 plants, T2 plants, T3 plants and the like.

(use)
In another aspect, the present invention provides an agrochemical for imparting resistance to, or imparting, resistance to rhabdoviridae virus resistance of the expression inhibitor of the present invention. Provide use for manufacturing. It will be understood that the nucleic acid molecules and factors used herein can be any nucleic acid molecule as described herein above.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in the present specification, but is limited only by the scope of the claims.

(Materials and methods)
In the examples described below, unless otherwise specified, experiments were generally conducted using the materials and methods described below.

1. Rice Growth Rice (Oryza sativa cv. Nipponbare) was used as an experimental strain. Rice plants were cultivated in a greenhouse (20 ° C. to 32 ° C.) and grown to the 9th leaf stage before being used for the following experiments. In the RTYV inoculation test for rice, each of the transformant lines and the control wild-type rice were used after being grown to the 2-3 leaf stage. This is because RTYV symptom is observed in newly developed leaves, that is, 2-3 rice stages are considered to be most sensitive to RTYV in the rice growing season.

2. Medium and Reagent (0) N6-vitamin 1.2L
Glycine 2g
Nicotinic acid 0.5g
Pyridoxine HCl 0.5g
Thiamine HCl 1g
Myoinositol 100g
Bring to 1.2 L with distilled water.

Dispense 1.2 ml each and store at -20 ° C until use.

(1) MS-vitamin 1.2L
Nicotinic acid 0.5g
Pyridoxine HCl 0.5g
Thiamine HCl 0.1g
Myoinositol 100g
Bring to 1.2 L with distilled water.

Dispense 1.2 ml each and store at -20 ° C until use.

(2) Callus induction medium (N6D) 1L
30g sucrose
Casamino acid 0.3g
Chu (N6) Basal Salt Mixture Powder (purchased from Sigma)
3.981 g
Proline 2.9g
N6-vitamin 1.2ml
2,4-D (1 mg / ml in 0.1 M KOH) 2 ml
Adjust to pH 5.8 with 1N KOH and make up to 1 L with distilled water.

Add 4g of gellite and autoclave.

(3) Co-culture medium (N6CO) 1L
30g sucrose
Glucose 10g
Casamino acid 0.3g
Chu (N6) Basal Salt Mixture Powder (purchased from Sigma)
3.981 g
N6-vitamin 1.2ml
2,4-D (1 mg / ml in 0.1 M KOH) 2 ml
Adjust to pH 5.2 with 1N KOH and make up to 1 L with distilled water.

Add 4g of gellite and autoclave.
Wait until the temperature drops below 50 ° C., then add 400 μl of acetosyringone (50 mg / ml).

(4) Selection medium (N6SE) 1L
30g sucrose
Casamino acid 0.3g
Chu (N6) Basal Salt Mixture Powder (purchased from Sigma)
3.981 g
Proline 2.9g
N6-vitamin 1.2ml
2,4-D (1 mg / ml in 0.1 M KOH) 2 ml
Adjust to pH 5.8 with 1N KOH and make up to 1 L with distilled water.

Add 4g of gellite and autoclave. Wait until the temperature drops below 50 ° C., then add 2 ml carbenicillin (250 mg / ml) and 0.5 ml hygromycin (50 mg / ml).

(5) Regeneration medium (MSRE) 1L
30g sucrose
D-sorbitol 30g
2g casamino acid
Mixed salt for Murashige / Skoog plant medium (purchased from Wako Pure Chemical Industries) 4.4g
MS-vitamin 1.2ml
Kinetin (10mg / ml in DMSO) 0.2ml
α-Naphthalene acetic acid (NAA)
(1 mg / ml in DMSO) 0.2 ml
Adjust to pH 5.8 with 1N KOH and make up to 1 L with distilled water.

Add 4g of gellite and autoclave.
Wait until the temperature drops below 50 ° C., then add 1 ml carbenicillin (250 mg / ml) and 0.5 ml hygromycin (50 mg / ml).

(6) Hormone free (HF) medium 1L
30g sucrose
Mixed salt for Murashige / Skoog plant medium (purchased from Wako Pure Chemical Industries) 4.4g
MS-vitamin 1.2ml
Adjust to pH 5.8 with 1N KOH and make up to 1 L with distilled water.

Add 4g of gellite and autoclave.
Wait until the temperature drops below 50 ° C., then add 0.5 ml of hygromycin (50 mg / ml).

Example 1: Construction of RNAi-inducing vector using RTYV leader sequence, leader sequence + NP gene, NP gene, P gene, P3 gene, M gene, G gene, P6 gene, L gene and L gene + trailer sequence (1) The RTYV leader sequence, leader sequence + NP gene, NP gene, P gene, P3 gene, M gene, G gene, P6 gene, L gene and L gene + trailer sequence are amplified using specific primer sets:
Total RNA was extracted from the leaves of RTYV-infected rice according to a conventional method. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen) according to the attached instructions. Using 1 μg of total RNA, reverse transcription was performed according to the SuperScript III (Invitrogen) manual to synthesize cDNA, and the following primer set:
About trigger leader Primer set 1:
Forward primer: CACCACACCACCAGATACATTC (SEQ ID NO: 26); and reverse primer: TTTTAAATCCTATCTCTTATTGACAT (SEQ ID NO: 27),
Primer set 2 for trigger leader + NP:
Forward primer: CACCACACCACCAGATACATTC (SEQ ID NO: 26); and reverse primer: GCATGCTATCTTTACGATGCTTC (SEQ ID NO: 28),
Trigger NP primer set 3:
Forward primer: CACCAACACCACATTAATCATG (SEQ ID NO: 29); and reverse primer: ACATATAAACGCAATGGCGCG (SEQ ID NO: 30),
Primer set 4 for Trigger P:
Forward primer: CACCAACACCTCATCACAAC (SEQ ID NO: 31); and reverse primer: CTATGTTGGTACATTCGGCC (SEQ ID NO: 32),
Primer set 5 for Trigger P3:
Forward primer: CACCAACTCCACATAGAAGG (SEQ ID NO: 33); and reverse primer: TGTCTTGTATAAACCCGCCC (SEQ ID NO: 34),
Primer set 6 for trigger M:
Forward primer: CACCAACACCACATAATAAACA (SEQ ID NO: 35); and reverse primer: TATACTGTGGTAATGATCTCTC (SEQ ID NO: 36),
Primer set 7 for trigger G:
Forward primer: CACCAACAACATCATACGTATC (SEQ ID NO: 37); and reverse primer: GACTGTGCTGTTTATGGCCC (SEQ ID NO: 38)
Primer set 8 for trigger P6:
Forward primer: CACCAATACCTCAACATTCTCAA (SEQ ID NO: 39); and reverse primer: TTATTTAATATACCAAGTCTTATGC (SEQ ID NO: 40)
Primer set 9 for trigger L:
Forward primer: CACCAACATATCCATTTTTCATTTC (SEQ ID NO: 41); and reverse primer: AAAGAAGTGATATGCACCTGCG (SEQ ID NO: 42)
Primer set 10 for trigger trailer + L:
Forward primer: CACCCTGGACTGTGACGAGA (SEQ ID NO: 43); and reverse primer: ACACCACCATATCCAAAGCCG (SEQ ID NO: 44)
PCR is performed using each. Trigger leader (sequence number 15), Trigger leader + NP (sequence number 16), Trigger NP (sequence number 17), Trigger P (sequence number 18), Trigger P3 (sequence number 19), Trigger G (sequence number 21), Trigger P6 As for (SEQ ID NO: 22) and Trigger L (SEQ ID NO: 23), each amplification product of the nucleic acid sequence was obtained as a result of PCR. Similarly, amplification products can be obtained for Trigger M (SEQ ID NO: 20) and Trigger trailer + L (SEQ ID NO: 24).

(2) Use a restriction enzyme or Gateway (Invitrogen) system to prepare an RNAi binary vector for transformation:
Using the pENTR ^™ / D-TOPO (registered trademark) cloning kit (Invitrogen cat. K2435-20), each amplification product obtained in (1) above was pENTR / D-TOPO (Invitrogen) according to the manufacturer's instructions. Entry vectors pENTR / trigger leader, pENTR / trigger leader + NP, pENTR / trigger NP, pENTR / trigger P, pENTR / trigger P3, pENTR / trigger G, pENTR / trigger P6, and pENTR / trigger L were obtained. For pENTR / trigger M and pENTR / trigger trailer + L, these can be obtained by the same operation.

  This cloning vector was used in the E.C. E. coli strains and similarly transformed under the appropriate conditions according to the manufacturer's instructions. E. coli was selected on LB plates containing 50 μg / ml kanamycin. Single colonies were isolated and inoculated into 1-2 ml LB medium containing 50 μg / ml kanamycin and transformed into E. coli containing this cloning vector according to standard methods. coli was grown. According to a standard method, plasmid DNA was isolated from the transformant and sequenced to confirm that the region of interest was cloned.

(3) Cloning factors that cause RNAi into transformation vectors:
Using the LR clonase reaction system of the Gateway (Invitrogen) system, the plasmid DNA obtained as described above was cloned into a pANDA vector (distributed by Prof. Shimamoto, Nara Institute of Science), pANDA / trigger leader, pANDA / trigger leader + NP, pANDA / trigger NP, pANDA / trigger P, pANDA / trigger P3, pANDA / trigger G, pANDA / trigger P6, and pANDA / trigger L were obtained. pANDA / trigger M and pANDA / trigger trailer + L can be obtained by the same operation. Briefly, 2 μl LR reaction buffer (5 ×), 100-300 ng of the above entry vector, 300 ng pANDA vector, TE were added to a total volume of 8 μl. 2 μl of LR clonase enzyme mix (Invitrogen cat. 11791-019) was added, stirred and incubated at 25 ° C. overnight. Thereafter, 1 μl of proteinase K solution was added and incubated at 37 ° C. for 10 minutes. The resulting vector was E. coli. E. coli DH5α was transformed and grown in medium containing 50 μg / ml kanamycin and 50 μg / ml hygromycin.

Example 2: Production of RNA interference rice for each RTYV gene (1) The above vector prepared in Example 1 is introduced into Agrobacterium by electroporation method or the like:
Each vector was introduced into Agrobacterium according to the manufacturer's instructions using GenePulser (BioRad) by electroporation. As the Agrobacterium strain, EHA101 (Hood, 1986, J. Bacteriol. 168, 1291) was used. The expression vector constructed in Example 1 was transformed into Agrobacterium EHA101 by electroporation. The electroporation apparatus was GENE PULSER (registered trademark) II (BIO-RAD), and the introduction conditions were set to 200Ω, 25 μF, 2.5 kV, 0.2 cm cuvette. The electroporated Agrobacterium was suspended in the SOC medium and cultured with shaking at 28 ° C. for 2 hours. This culture solution is spread on LB plate medium (10 g / l tryptone, 5 g / l yeast extract, 10 g / l sodium chloride) containing 20 mg / l kanamycin and 100 mg / l spectinomycin, and the transformed individuals that have grown are selected. did. The grown transformed Agrobacterium is inoculated into YEP medium, incubated overnight, put equal volume of glycerol with this culture medium, mixed well by vortex mixer, and stock solution at -80 ° C until use. Saved as.

(2) Confirm that the vector has been introduced into Agrobacterium by PCR or the like;
The introduction of the vector into Agrobacterium was confirmed by PCR after extracting the plasmid by alkaline SDS method (see Molecular Cloning 3rd edition).

(3) Infect Agrobacterium in callus rice and re-differentiate after confirming the infection to produce RNA interference rice of each RTYV gene;
In order to create RNA interference rice for each RTYV gene, callus rice was prepared. Briefly, ripe rice seeds were put on a small rice grinder, and 100 to 150 seeds from which the straw was removed were placed in a 50 ml disposable centrifuge tube. 70% ethanol was placed in a centrifuge tube and the seeds were sterilized for a few seconds and rinsed with sterile water. After aspirating sterile water, 40 ml of 2.5% sodium hypochlorite solution was placed in the centrifuge tube and sterilized by shaking at 150 rpm for 20 minutes with a shaker. Sterile water was removed and washed with distilled water three times. The seeds were placed in callus induction medium (N6D medium) with 25 seeds / petri dish with tweezers, and the area around the petri dish was sealed with tape. Callus was induced by culturing for 18 to 21 days at 30 to 33 ° C. under conditions of 60 μmol / m ² s and 24 hours light period. During callus induction, the medium was replaced with fresh N6D medium every 7-10 days.

  3 weeks after induction, the seed endosperm and shoots are cut off with a scalpel, or removed with forceps, and only the scutellum-derived callus is placed in a new callus induction medium N6D medium at 16 calli / dish and taped around the dish. The callus was pre-cultured at 30-33 ° C. for 3 days under conditions of a light period of 24 hours. In parallel with the start of callus preculture, cells were collected from the Agrobacterium stock solution obtained in (1) above using a sterilized toothpick and applied to the AB medium. The applied cells were spread over the entire medium with a sterilized platinum loop and pre-cultured for 3 days at 28 ° C. with light shielding.

  Agrobacterium grown on AB medium is scraped with a small sterilized spoon, and 5 μl of 10 mg / ml acetosyringone is added to 10 ml of water, and Agrobacterium is suspended in this solution so that OD600 = 0.01. It became cloudy. The suspension was placed in a sterile petri dish. Place the callus that has been pre-cultured for 1 petri dish into a cylindrical glass tube whose one end is covered with a mesh, and shake it occasionally to make a glass tube with a mesh for 1.5 to 2 minutes. Soaked in. After immersion, a glass tube with a mesh was placed on a sterilized paper towel to remove excess water. The plate was placed on N6CO medium at 16 callus / petri dish, the petri dish was sealed with tape, and cultured at 23 ° C. with light shielding for 3 days.

  After culturing, all calli were transplanted to N6SE medium at 9 callus / petri dish, and cultured at 30-33 ° C. for 24 hours under the condition of light period. Meanwhile, the callus was moved to a new petri dish only once. The selected callus was transferred to RE medium and cultured at 30-33 ° C. until redifferentiation. Meanwhile, the callus was transferred to a petri dish containing a new medium every 7 to 10 days. The redifferentiated rice was transferred to an HF medium, cultured for 2 to 3 weeks, and then potted.

(4) Confirmation of transgene in transformant generation (T0) strain To confirm whether or not the target gene has been introduced into the transformant generation (T0) strain produced in (3) above, T0 strain PCR was carried out using DNA prepared by CTAB from a template with Gus-linker specific primer in the transformation vector and 4 kinds of mixed primers of actin specific primer as an internal control, and two DNA bands were obtained by agarose electrophoresis. Performed by being amplified. Detection of siRNA by fragmentation of the transgene transcript in the T0 strain is performed by extracting low molecular weight RNA (basically according to Hamilton, 1999, Science. 286, 950) and then trigger leader (SEQ ID NO: 15). Trigger leader + NP (sequence number 16), Trigger NP (sequence number 17), Trigger P (sequence number 18), Trigger P3 (sequence number 19), Trigger G (sequence number 21), Trigger P6 (sequence number 22), Trigger The hybridization was performed by Northern hybridization using the nucleic acid sequence of L (SEQ ID NO: 23) as a probe. The result is shown in FIG. As shown, it was revealed that the gene of interest was introduced in the T0 strain, and the introduced sequence was cleaved.

Example 3: RTYV resistance test in transformant T1 (1) pANDA / trigger leader, pANDA / trigger leader + NP, pANDA / trigger NP, pANDA / trigger P, pANDA / trigger P3, pANDA / trigger prepared in Example 1 G, RTYV infection of T1 plants transformed with pANDA / trigger P6, pANDA / trigger L;
Each T0 rice obtained was regarded as one strain, and all T1 seeds were collected from each strain. Inoculation of RTYV into rice is about 15% of T1 rice per transformant line grown to 2-3 leaf stages, and about 20% of adult leafhoppers that have RTYV preserved per healthy rice The animals were released so that there were about 5 animals, and the rice was soaked in a greenhouse at about 26 ° C. for about 2 days.

(2) Trigger leader (sequence number 15), Trigger leader + NP (sequence number 16), Trigger NP (sequence number 17), Trigger P (sequence number 18), Trigger P3 (sequence number 19), Trigger G (sequence) after infection No. 21), resistance test of T1 plants into which nucleic acid sequences of Trigger P6 (SEQ ID NO: 22) and Trigger L (SEQ ID NO: 23) were introduced;
Trigger leader (SEQ ID NO: 15), Trigger leader + NP (SEQ ID NO: 16), Trigger NP (SEQ ID NO: 17), Trigger P (SEQ ID NO: 18), Trigger P3 (SEQ ID NO: 19), Trigger G (sequence) inoculated in (1) No. 21), T1 plants transformed with any of the nucleic acid sequences of Trigger P6 (SEQ ID NO: 22) and Trigger L (SEQ ID NO: 23), rice leaves were collected about 60 days after the RTYV inoculation test of (1), and ELISA was performed. The presence or absence of RTYV infection was tested by the method and scored. PCR was performed using DNA prepared from a T1 plant by the CTAB method as a template, and the GUS sequence in the plant transformation vector as a primer, and individuals whose transgene was not inherited by the progeny T1 were excluded from scoring. . From the scoring results of the inoculation test, the infection rate was calculated when Nipponbare was set to 100, and the summarized results are shown in FIG. 3 and Table 1 below.

Table 1: RTYV inoculation test of each gene-targeted transgenic rice inbred first generation (T1)

  Transformed rice targeting P were all RTYV resistant (ie, obtained a “fully resistant” population). In wild-type rice (Nipponbare) used as a control, 4 out of all 22 strains failed to be infected, but the remaining 18 strains were all infected with RTYV.

  Transformed rice targeting P3 were all RTYV resistant (ie, obtained a “fully resistant” population). In wild-type rice (Nipponbare) used as a control, 12 of the 14 strains failed to infect, but the remaining 2 strains were all infected with RTYV.

  Transformed rice targeting P6 was all RTYV resistant (ie, obtained a “fully resistant” population). In wild type rice (Nipponbare) used as a control, 5 out of 17 strains failed to be infected, but the remaining 12 strains were all infected with RTYV.

  Of the 13 rice plants transformed with NP, 8 strains were resistant, 5 strains were sensitive, and 38% were infected. In wild-type rice (Nipponbare) used as a control, 2 of the 14 strains failed to infect, but the remaining 12 strains were all infected with RTYV, and the infection rate was 86%. That is, when the infection rate of wild-type rice is 100, it was found that transformed rice targeting NP has 45% “partial resistance”.

  Of the 12 rice strains, 11 rice strains were resistant and 1 strain was susceptible, and 8% of the total were infected with leader + NP as a target. In wild type rice (Nipponbare) used as a control, 12 out of 14 strains failed to infect, but the remaining 2 strains were all infected with RTYV, and the infection rate was 14%. That is, when the infection rate of wild-type rice was 100, it was found that transformed rice targeting leader + NP had “partial resistance” of 58%.

  Transformed rice targeting leader, G, and L did not show a reduction in infection rate compared to wild-type rice (Nipponbare) used as a control.

  Transformed rice targeting P showed complete resistance. Since P interacts with replication enzymes and is considered to play a role in RNA synthesis, suppressing P expression inhibits viral replication and can consequently quiesce virus activity. It is thought that the phenotype of complete resistance was shown. From the above, it was shown that P may play a particularly important role in plant infection and growth in plants.

  Transformed rice targeting P3 showed complete resistance. P3 is a viral cell-to-cell translocation protein. Therefore, if the expression of P3 is suppressed, the spread of the virus from the infected cell to the adjacent uninfected cell is effectively inhibited, resulting in the virus activity. It is thought that it was able to stand still and showed a complete resistance phenotype. From the above, it has been shown that P3 may play a particularly important role in plant infection and growth in plants.

  Transformed rice targeting P6 showed complete resistance. At this stage, P6 is unknown in function except that it is contained in virus particles. However, the present results indicate that P6 is essential for plant infection and / or propagation and is a particularly important protein. I can expect. Moreover, in other viruses having a single negative-strand RNA genome, it is known that a protein encoded by a gene located at the same location on the genome directly interacts with a biological membrane. In RTYV, P6 is It may have an important function of interacting with the nuclear membrane or cell membrane during the process of infection and proliferation.

  Transformed rice targeting NP and transformed rice targeting leader + NP showed partial resistance of about 50%. Since NP is a viral nucleoprotein, the suppression of NP expression probably inhibits the formation of nucleocapsid structures, resulting in the suppression of viral activity and a partially resistant phenotype. It is thought that it showed.

  From the above results, the transformed rice of the present invention, that is, the rice in which the expression of P, P3 and P6 is suppressed shows complete resistance to RTYV, and the rice in which the expression of NP is suppressed is partial resistance to RTYV. It became clear to show sex.

(3) Inoculation assay in progeny T3 plants of the produced RTYV resistant rice;
In order to confirm whether or not the RTYV resistance is inherited also in the progeny plants, T2 seeds are obtained from the T1 plant, and the T2 plant is grown. From this T2 plant, T3 seed is obtained and grown to the 9th leaf stage to obtain a test T3 plant. In the obtained T3 plant, in the same manner as in (2) above, about 10 T1 rices for each transformant line, about 20% of adult adults of leafhoppers that have RTYV-contained RTYV. It is released to the extent that it is soaked, and rice is soaked for about 2 days in a greenhouse at about 26 ° C. When an inoculation test is performed in the same manner as in (2) above, it can be confirmed that RTYV resistance or onset delay type resistance is also inherited in T3 plants.

  From the above results, it becomes clear that the transformed rice of the present invention exhibits resistance to RTYV.

Example 4: Confirmation of other RTYV strain infection and RNAi induction in transformant T1 (1) Infection of other RTYV strains to T1 plants;
Using the vector obtained in Example 1, RTYV resistant rice is produced as described in Example 2, with each T0 rice being one strain. Collect all T1 seeds from each strain. Inoculation of rice with a Chinese strain of RTYV (RYSV) resulted in about 10% of T1 rice for each transformant line, and about 20% of adult leafhoppers that had infected each strain of RTYV were 5 per healthy rice. It is released so that it becomes more than the head, and the rice is soaked in a greenhouse at about 26 ° C. for about 2 days. By performing these experiments, it can be confirmed that expression inhibitors based on Japanese strains not only provide resistance to RTYV infection of Japanese strains but also resistance to infection of RTYV strains other than Japanese strains.

Example 5: Production of expression-suppressed rice of a Chinese strain (RYSV) protein (P, P3, P6, NP, etc.) and confirmation of RNAi induction (China strain (RYSV) strain)
As described in Example 1, as described in Example 1, total RNA was extracted from leaves of rice infected with a Chinese strain of RTYV (RYSV) using accession number NC_003746, and a reverse transcription reaction was performed. , CDNA is synthesized and PCR is performed using a primer set specific to the target region (Trigger P (Chinese strain (RYSV)), Trigger P3 (Chinese strain (RYSV)) or Trigger P6 (Chinese strain (RYSV))). To obtain an amplification product of the target region.

As described in Example 1 (2) above, the amplification product obtained above was purified using the pENTR ^™ / D-TOPO® Cloning Kit (Invitrogen cat. K2435-20). And cloned into pENTR / D-TOPO (Invitrogen) as described in the entry vector pENTR / Trigger P (Chinese stock (RYSV)), pENTR / Trigger P3 (Chinese stock (RYSV)) or pENTR / Trigger P6 (Chinese stock (RYSV)) )

  This cloning vector was similarly transformed into E. coli as described in Example 1 (2) above. transformed into E. coli strains. E. coli are selected on LB plates containing 50 μg / ml kanamycin. In accordance with standard methods, a single colony is isolated and transformed into this cloning vector. Grow coli. Plasmid DNA is isolated from the transformants and sequenced to confirm that the region of interest has been cloned.

  As described in Example 1 above, the plasmid DNA obtained as described above is transferred to the pANDA vector (distributed from Prof. Shimamoto, Nara Institute of Science and Technology) using the LR clonase reaction system of the Gateway (Invitrogen) system. Clone.

  RTYV resistant rice is produced as described in Example 2, and each T0 rice is taken as one strain. Collect all T1 seeds from each strain. Inoculation of rice with Japanese strains of RTYV and Chinese strains (RYSV) resulted in healthy rice 1 The animals are released so that there are 5 or more per strain, and the rice is soaked in a greenhouse at about 26 ° C for about 2 days. Trigger P (Chinese stock (RYSV)), Trigger P3 (Chinese stock (RYSV)) or Trigger P6 (Chinese stock (RYSV)) designed based on information on Chinese stocks (RYSV) by performing these experiments It can be confirmed that the expression-suppressing agent containing R imparts not only resistance to RTYV infection of Chinese strain (RYSV) but also resistance to infection of strains other than RTYV of Chinese strain (RYSV).

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, it is understood that the scope of this invention should be construed only by the claims. The patents, patent applications, and literature cited herein are to be incorporated by reference in their entirety, as if the contents themselves were specifically described herein.

  INDUSTRIAL APPLICABILITY According to the present invention, there is provided a method for producing a virus-resistant rice of the Rhabdoviridae family, which exhibits higher resistance to virus infection suppression or a high level of disease-free symptoms, and is provided with stable resistance, and a resistance-type cultivar. It is used as one of the control measures for

SEQ ID NO: 1 is a nucleic acid sequence encoding the NP gene of RTYV.
SEQ ID NO: 2 is the amino acid sequence of the NP gene of RTYV.
SEQ ID NO: 3 is a nucleic acid sequence encoding the P gene of RTYV.
SEQ ID NO: 4 is the amino acid sequence of the P gene of RTYV.
SEQ ID NO: 5 is a nucleic acid sequence encoding the P3 gene of RTYV.
SEQ ID NO: 6 is the amino acid sequence of the P3 gene of RTYV.
SEQ ID NO: 7 is a nucleic acid sequence encoding the M gene of RTYV.
SEQ ID NO: 8 is the amino acid sequence of the M gene of RTYV.
SEQ ID NO: 9 is a nucleic acid sequence encoding the RTYV G gene.
SEQ ID NO: 10 is the amino acid sequence of the G gene of RTYV.
SEQ ID NO: 11 is a nucleic acid sequence encoding the P6 gene of RTYV.
SEQ ID NO: 12 is the amino acid sequence of the P6 gene of RTYV.
SEQ ID NO: 13 is a nucleic acid sequence encoding the RTYV L gene.
SEQ ID NO: 14 is the amino acid sequence of the LTYV L gene.
SEQ ID NO: 15 is the nucleic acid sequence of the leader sequence region used in the examples. (Trigger leader)
SEQ ID NO: 16 is the nucleic acid sequence of the leader sequence + NP gene region used in the examples. (Trigger leader + NP)
SEQ ID NO: 17 is the nucleic acid sequence of the NP gene region used in the examples. (Trigger NP)
SEQ ID NO: 18 is the nucleic acid sequence of the P gene region used in the examples. (Trigger P)
SEQ ID NO: 19 is the nucleic acid sequence of the P3 gene region used in the examples. (Trigger P3)
SEQ ID NO: 20 is the nucleic acid sequence of the M gene region used in the examples. (Trigger M)
SEQ ID NO: 21 is the nucleic acid sequence of the G gene region used in the examples. (Trigger G)
SEQ ID NO: 22 is the nucleic acid sequence of the P6 gene region used in the examples. (Trigger P6)
SEQ ID NO: 23 is the nucleic acid sequence of the L gene region used in the examples. (Trigger L)
SEQ ID NO: 24 is the nucleic acid sequence of the trailer sequence + L gene region used in the examples.
SEQ ID NO: 25 is the genome sequence of RTYV (Rice yellow stunt virus viral cRNA, complete genome, country: Japan: Okinawa, ishigaki; GenBank accession No. AB516283).
SEQ ID NO: 26 is the nucleic acid sequence of the forward primer for confirming the leader sequence.
SEQ ID NO: 27 is the nucleic acid sequence of the reverse primer for confirming the leader sequence.
SEQ ID NO: 28 is the nucleic acid sequence of the reverse primer for confirmation of the leader sequence + NP gene.
SEQ ID NO: 29 is the nucleic acid sequence of the forward primer for confirmation of the NP gene.
SEQ ID NO: 30 is the nucleic acid sequence of the reverse primer for confirmation of the NP gene.
SEQ ID NO: 31 is the nucleic acid sequence of the forward primer for confirmation of the P gene.
SEQ ID NO: 32 is the nucleic acid sequence of the reverse primer for confirmation of the P gene.
SEQ ID NO: 33 is the nucleic acid sequence of the forward primer for confirmation of the P3 gene.
SEQ ID NO: 34 is the nucleic acid sequence of the reverse primer for confirmation of the P3 gene.
SEQ ID NO: 35 is the nucleic acid sequence of the forward primer for confirmation of the M gene.
SEQ ID NO: 36 is the nucleic acid sequence of the reverse primer for confirmation of the M gene.
SEQ ID NO: 37 is the nucleic acid sequence of the forward primer for confirmation of the G gene.
SEQ ID NO: 38 is the nucleic acid sequence of the reverse primer for confirmation of the G gene.
SEQ ID NO: 39 is the nucleic acid sequence of a forward primer for confirmation of the P6 gene.
SEQ ID NO: 40 is the nucleic acid sequence of the reverse primer for confirmation of the P6 gene.
SEQ ID NO: 41 is the nucleic acid sequence of the forward primer for confirmation of the L gene.
SEQ ID NO: 42 is the nucleic acid sequence of the reverse primer for confirmation of the L gene.
SEQ ID NO: 43 is the nucleic acid sequence of the forward primer for confirmation of trailer sequence + L gene.
SEQ ID NO: 44 is the nucleic acid sequence of the reverse primer for confirmation of trailer sequence + L gene.
SEQ ID NO: 45 is a trimming array.
SEQ ID NO: 46 is a ubiquitin promoter sequence (derived from Genbank accession number AY452736).

Claims (25)

Use of a nucleic acid sequence encoding a nucleoprotein (NP), phosphoprotein (P), transfer protein (P3) or P6 protein of a virus belonging to Rhabdoviridae to confer resistance to a virus belonging to Rhabdoviridae. NP, P, P3 or P6 is a nucleotide sequence shown in SEQ ID NO: 1, 3, 5 or 11, respectively, or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the nucleotide sequence Or an amino acid sequence comprising an amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12, respectively, or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the amino acid sequence. The use according to claim 1, which codes. The use according to claim 1, wherein the virus is rice yellow leaf virus (RTYV). The use according to claim 1, wherein the resistance is imparted to a plant of the genus Graminea. Use according to claim 1, wherein the resistance is imparted to rice. A lesion caused by a virus belonging to Rhabdoviridae or a virus belonging to Rhabdoviridae, which contains an expression inhibitor of at least one gene of NP, P, P3 or P6 present in the genome of a virus belonging to Rhabdoviridae A composition for imparting resistance to a disease. NP, P, P3 or P6 is a nucleotide sequence shown in SEQ ID NO: 1, 3, 5 or 11, respectively, or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the nucleotide sequence Or an amino acid sequence comprising an amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12, respectively, or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the amino acid sequence. The composition of claim 6, which encodes. The composition according to claim 6, wherein the virus is rice yellow leaf virus (RTYV). The composition according to claim 6, wherein the resistance is imparted to rice plants. The composition according to claim 6, wherein the resistance is imparted to rice. The composition according to claim 6, wherein the expression inhibitor is an RNAi, cosuppression, ribozyme, chimeric oligo, antisense suppressor of the gene, or an antibody against the gene product. The composition according to claim 11, wherein the expression inhibitor is RNAi of the gene and has a length of 20 bases or more. 13. The composition of claim 12, wherein the RNAi has a length of about 500 bases. The RNAi is a nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 17, 18, 19 and 22, or a modified sequence having one or several substitutions, additions, insertions and / or deletions in the nucleotide sequence. The composition according to claim 13. The expression inhibitor is RNAi of the gene (a) a ubiquitin promoter comprising the nucleic acid sequence represented by SEQ ID NO: 46;
(B) (i) a nucleic acid sequence shown in SEQ ID NO: 1, 3, 5 or 11 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12; or (ii) SEQ ID NO: 1, A variant having one or several substitutions, additions, insertions and / or deletions in the nucleic acid sequence shown in 3, 5 or 11 or the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12 ,
An antisense sequence complementary to
(C) a trimming sequence consisting of the nucleic acid sequence shown in SEQ ID NO: 45;
(D) (i) a nucleic acid sequence shown in SEQ ID NO: 1, 3, 5 or 11 or a nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12; or (ii) SEQ ID NO: 1, A variant having one or several substitutions, additions, insertions and / or deletions in the nucleic acid sequence shown in 3, 5 or 11 or the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6 or 12 ,
A sense sequence consisting of; and (e) a terminator sequence,
The composition of claim 6 comprising: At least one of NP, P, P3 or P6 present in the genome of a virus belonging to the Rhabdoviridae family for imparting resistance to a lesion or disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family An expression inhibitor of one gene. A vector comprising the expression inhibitor of claim 16. A plant cell comprising the vector according to claim 17. A plant comprising the vector according to claim 17. A seed comprising the vector of claim 17. The plant body of Claim 19 which shows the resistance with respect to the virus which belongs to Rhabdoviridae. A method for producing a plant belonging to the genus Rhabdoviridae that can be infected with a virus belonging to the Rhabdoviridae family, to which resistance against a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family has been imparted,
A) providing a vector according to claim 17;
B) introducing the vector into cells of the plant;
C) selecting a plant cell into which the vector has been introduced; and D) redifferentiating the selected cell to produce a transgenic plant;
Including the method. A method for producing seeds of a rice genus plant of a plant capable of being infected with a virus belonging to the Rhabdoviridae family, to which resistance against a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family is provided,
A) providing a vector according to claim 17;
B) introducing the vector into cells of the plant;
C) selecting a plant cell into which the vector has been introduced;
D) redifferentiating the selected cells to produce a transgenic plant; and E) obtaining seeds from the transgenic plant;
Including the method. A method for regenerating a plant belonging to the genus Rhabdoviridae, which can be infected with a virus belonging to the Rhabdoviridae family, which has been given resistance to a disease caused by a virus belonging to the Rhabdoviridae family or a virus belonging to the Rhabdoviridae family,
A) providing a seed comprising the vector of claim 17;
B) growing the seed to obtain a mature plant;
C) obtaining seeds from the plant body;
Including the method. A plant or seed containing the expression inhibitor according to claim 16, or a processed product thereof.