JP2013034448A - Method for imparting acetic acid tolerance, method for producing acetic acid-tolerant yeast and method for producing ethanol by using acetic acid-tolerant yeast - Google Patents

Abstract

PROBLEM TO BE SOLVED: To improve acetic acid tolerance of yeast having ethanol fermentative ability.SOLUTION: The YOL046C gene and/or a gene functionally equivalent to the YOL046C gene are introduced into yeast having ethanol fermentative ability, or the expression level of the gene in the yeast is improved.

Description

  TECHNICAL FIELD The present invention relates to a method for imparting acetic acid resistance to yeast used for ethanol fermentation, a method for producing acetic acid resistant yeast, and a method for producing ethanol using acetic acid resistant yeast.

  Ethanol fermentation by yeast has been applied not only to brewing since ancient times, but also to reaction systems using biomass in recent years. In the past, attempts have been made to improve the ethanol fermentation ability of yeast. As an example, a technique is known in which yeast growth inhibition by acetic acid present in a culture environment is prevented by improving the acetic acid resistance of yeast (Non-patent Document 1). The method disclosed in Non-Patent Document 1 is a method of destroying an FPS1 gene having a function of taking a soluble small molecule into a cell. Yeast having disrupted the FPS1 gene is less likely to take up acetic acid into cells, and thus can grow in a medium containing acetic acid.

  Thus, although acetic acid resistance can be imparted to yeast by gene disruption, it cannot be said that the degree of acetic acid resistance is still sufficient.

Molecular and Cellular Biology, 2007, Vol. 27, p. 6446-6456

  Therefore, in view of the above-described circumstances, the present invention particularly provides an acetic acid resistance imparting method for improving acetic acid resistance in a yeast having ethanol fermentation ability, a method for producing acetic acid resistant yeast, and a method for producing ethanol using acetic acid resistant yeast. The purpose is to provide.

  As a result of intensive studies by the present inventors in order to achieve the above object, acetic acid resistance of the yeast by introducing a predetermined gene whose function is unknown or improving the expression level of the gene into yeast having ethanol fermentation ability As a result, the present invention has been completed.

  That is, the method for improving acetic acid resistance in yeast according to the present invention introduces a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene into a yeast having ethanol fermentation ability, or the yeast This is a method for improving the expression level of a gene.

  The method for producing acetic acid-resistant yeast according to the present invention introduces a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene into a yeast having ethanol fermentation ability, or the yeast This is a method for improving the expression level of a gene.

  Furthermore, the method for producing ethanol using acetic acid resistant yeast according to the present invention introduces a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene into a yeast having ethanol fermentation ability, or the yeast On the other hand, yeast in which the expression level of the gene is improved is cultured in a medium, and ethanol is recovered from the medium.

In the present invention, the YOL046C gene and the gene functionally equivalent to the YOL046C gene are preferably any of the following genes (a) to (c).
(a) a gene that encodes a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has a function of improving acetic acid resistance by introduction into a host yeast
(b) Encodes a protein containing an amino acid sequence in which one or more amino acids have been deleted, substituted, disabled or inserted with respect to the amino acid sequence shown in SEQ ID NO: 2 and introduced into host yeast to improve acetic acid resistance Genes that function
(c) It can hybridize under stringent conditions to part or all of a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1, and is resistant to acetic acid when introduced into a host yeast. Further, in the present invention, Saccharomyces cerevisiae can be used as the yeast having ethanol fermentation ability.

  ADVANTAGE OF THE INVENTION According to this invention, the acetic acid tolerance in the yeast which has ethanol fermentation ability can be provided or improved. That is, according to the present invention, yeast excellent in acetic acid resistance can be produced, and the ethanol yield in the presence of acetic acid can be improved. Therefore, by applying the present invention, for example, ethanol fermentation by yeast using biomass can be made efficient, and as a result, ethanol productivity can be improved.

It is a characteristic view which shows the result of having measured OD600 of the control strain in the presence of various concentrations of acetic acid. FIG. 6 is a characteristic diagram showing the results of measuring OD600 of OC-2Δfps1 strain in the presence of various concentrations of acetic acid. It is a characteristic view which shows the result of having measured OD600 about the ORF overexpression yeast library in various acetic acid presence. It is a characteristic view which shows the result of having measured OD600 of isolate No.1-No.4 and control yeast in the presence of 120 mM acetic acid.

Hereinafter, the present invention will be described in more detail with reference to the drawings and examples.
The method for imparting acetic acid resistance according to the present invention is characterized in that a predetermined gene is introduced into yeast having ethanol fermentation ability or the expression level of the gene is improved. In other words, a yeast excellent in acetic acid resistance can be produced by introducing the gene into yeast having ethanol fermentation ability or improving the expression level of the gene. Here, the predetermined gene is a gene functionally equivalent to the YOL046C gene and the YOL046C gene in Saccharomyces cerevisiae. Moreover, in order to improve the expression level of a gene, the technique which modifies the expression control area | region of the said gene can be mentioned as an example. The expression control region is meant to include a promoter region to which RNA polymerase binds and a region to which other transcription factors bind. As a modification of the transcription control region, it is preferable to replace, for example, the promoter region in the endogenous transcription control region with a promoter region capable of higher expression.

<YOL046C gene>
The YOL046C gene is a gene that has been identified as a function-unknown gene in Saccharomyces cerevisiae. References on the YOL046C gene include Molecular Biology of the Cell, Vol. 19, 284-296, January 2008. In order to investigate hyphal growth, this document produces and evaluates a gene disruption or ORF overexpression strain library of Saccharomyces cerevisiae Σ1278b strain that extends mycelia. And it has been clarified that the strain overexpressing the YOL046C gene exhibits a phenotype in which hyphal growth is promoted as compared with the wild type. However, the literature and other findings do not suggest that the YOL046C gene is involved in acetic acid resistance such as acetic acid uptake and metabolism in yeast.

  The base sequence of the coding region in the YOL046C gene is shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by the YOL046C gene is shown in SEQ ID NO: 2. However, these specific nucleotide sequences and amino acid sequences have been identified in standard strains in Saccharomyces cerevisiae, and other Saccharomyces cerevisiae YOL046C genes have different nucleotide sequences from the nucleotide sequence of SEQ ID NO: 1. In some cases, it encodes a protein having an amino acid sequence different from the amino acid sequence of SEQ ID NO: 2. That is, even in the case of the YOL046C gene of Saccharomyces cerevisiae, it is not limited to the one having the coding region consisting of the base sequence of SEQ ID NO: 1 or the one encoding the protein consisting of the amino acid sequence of SEQ ID NO: 2.

  YOL046C gene is a gene encoding a protein having an amino acid sequence having high similarity to the amino acid sequence of SEQ ID NO: 2 and having a function of improving acetic acid resistance when overexpressed in a host yeast. Also good. Here, high similarity means, for example, a degree of coincidence of 80% or more, preferably a degree of coincidence of 90% or more, more preferably a degree of coincidence of 95% or more, and most preferably a degree of coincidence of 97% or more. To do. The coincidence value is obtained by aligning the amino acid sequence of SEQ ID NO: 2 with another amino acid sequence using a program for searching for sequence similarity (sometimes referred to as a homology search program). This is a value calculated as the ratio of amino acid residues that coincide with the amino acid sequence of SEQ ID NO: 2 in the other amino acid sequences.

  The YOL046C gene is a protein having an amino acid sequence in which one or more amino acids in the amino acid sequence of SEQ ID NO: 2 have been substituted, deleted, added or inserted, and when overexpressed in host yeast, It may be a gene encoding a protein having a function of improving resistance. Here, a plurality of amino acids means, for example, 2 to 30 amino acids, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5 amino acids.

  Furthermore, the YOL046C gene is a polynucleotide that hybridizes under stringent conditions to part or all of a polynucleotide containing a base sequence complementary to the base sequence of SEQ ID NO: 1, It may be a polynucleotide encoding a protein having a function of improving acetic acid resistance when overexpressed in. Here, hybridizing under stringent conditions means maintaining binding at 60 ° C. under 2 × SSC washing conditions. Hybridization can be performed by a conventionally known method such as the method described in J. Sambrook et al. Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory (1989).

  As described above, the YOL046C gene encoding a protein having a nucleotide sequence different from the nucleotide sequence of SEQ ID NO: 1 and an amino acid sequence different from the amino acid sequence of SEQ ID NO: 2 is isolated from various strains classified as Saccharomyces cerevisiae. can do. Alternatively, the YOL046C gene encoding a protein having a nucleotide sequence different from the nucleotide sequence of SEQ ID NO: 1 and an amino acid sequence different from the amino acid sequence of SEQ ID NO: 2 is, for example, a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 It can also be obtained by artificial modification by a technique known in the technical field. Mutation can be introduced into a base sequence by a known method such as Kunkel method or Gapped duplex method or a method according thereto, for example, a mutation introduction kit (for example, Mutant-) using site-directed mutagenesis. Mutations are introduced using K, Mutant-G (both trade names, manufactured by TAKARA) or the like, or LA PCR in vitro Mutagenesis series kit (trade name, manufactured by TAKARA).

  For a polynucleotide comprising a nucleotide sequence different from the nucleotide sequence of SEQ ID NO: 1 and a polynucleotide encoding a protein having an amino acid sequence different from the amino acid sequence of SEQ ID NO: 2, the polynucleotide is introduced into a host yeast and overexpressed. And acetic acid resistance in the polynucleotide-introduced yeast can be evaluated by verifying the growth ability in the acetic acid-containing medium. When the acetic acid resistance that can be evaluated in this way is significantly improved over the host yeast, the polynucleotide introduced into the host yeast can be determined to be the YOL046C gene.

  The gene functionally equivalent to the YOL046C gene means a gene encoding a protein that is derived from an organism other than Saccharomyces cerevisiae and has a function of improving acetic acid resistance when overexpressed in a host yeast. That is, the gene functionally equivalent to the YOL046C gene means a gene having a broad homologous relationship to the YOL046C gene in Saccharomyces cerevisiae or a gene having an orthologous relationship.

  Such a gene functionally equivalent to the YOL046C gene can be identified by searching a database storing sequence information of genomic DNA related to organisms other than Saccharomyces cerevisiae. Here, examples of the database include databases such as MBGD, GenBank, DDBJ, and EMBL. However, when searching for a gene functionally equivalent to the YOL046C gene, there is no limitation on the database to be used. In particular, as the database, it is preferable to use an MBGD equipped with a system that searches one genome information for one species. A search for a gene functionally equivalent to the YOL046C gene using a database can be performed based on the sequence similarity value described above using the base sequence of SEQ ID NO: 1 and / or the amino acid sequence of SEQ ID NO: 2 as a query sequence. In such a search, the sequence similarity described above is synonymous with homology. In such a search, for example, the amino acid sequence of SEQ ID NO: 2 is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and most preferably 95% or more. A gene encoding a protein having an amino acid sequence having a sex) can be specified as a gene functionally equivalent to the YOL046C gene.

  The gene functionally equivalent to the YOL046C gene has an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added to the amino acid sequence of SEQ ID NO: 2, for example, It may encode a protein having a function of improving acetic acid resistance when overexpressed in. Here, the term “several” refers to, for example, 2 to 30, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5.

  Furthermore, it hybridizes under stringent conditions to a gene functionally equivalent to the YOL046C gene, for example, all or part of the complementary strand of DNA consisting of the nucleotide sequence of SEQ ID NO: 1, and in host yeast It may encode a protein having a function of improving acetic acid resistance when overexpressed. The term “stringent conditions” as used herein means the conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed, and is determined appropriately with reference to, for example, Molecular Cloning: A Laboratory Manual (Third Edition). can do. Specifically, the stringency can be set according to the temperature at the time of Southern hybridization and the salt concentration contained in the solution, and the temperature at the time of the washing step of Southern hybridization and the salt concentration contained in the solution.

<Yeast having ethanol fermentation ability>
Examples of the target for introducing a gene functionally equivalent to the YOL046C gene and / or the YOL046C gene described above or improving the expression level of the gene include yeast having ethanol fermentation ability. Examples of such yeast include, but are not limited to, yeasts such as Candida Shehatae, Pichia stipitis, Pachysolen tannophilus, Saccharomyces cerevisiae and Schizosaccaromyces pombe, and Saccharomyces cerevisiae is particularly preferable. The yeast may be an experimental strain used for experimental convenience, or an industrial strain (practical strain) used for practical utility. Examples of industrial strains include yeast strains used for wine, sake and shochu making.

  Of these, the Saccharomyces cerevisiae OC-2 strain is preferable because it is a strain that has been confirmed to be safe and has been used in the winemaking scene. Further, the Saccharomyces cerevisiae OC-2 strain is preferable because it has excellent promoter activity under conditions of high sugar concentration, as shown in the Examples described later. In particular, the Saccharomyces cerevisiae OC-2 strain is preferable because it has an excellent promoter activity of the pyruvate decarboxylase gene (PDC1) under high sugar concentration conditions.

  Further, the promoter of the gene to be introduced is not particularly limited. For example, the promoter of glyceraldehyde 3-phosphate dehydrogenase gene (TDH3), the promoter of 3-phosphoglycerate kinase gene (PGK1), the hyperosmotic response 7 gene ( HOR7) promoters can be used. Of these, the pyruvate decarboxylase gene (PDC1) promoter is preferred because of its high ability to highly express a downstream target gene. In addition, TEF1 gene promoter, ADH1 gene promoter, TPI1 gene promoter, HXT7 gene promoter, and PYK1 gene promoter can be used.

  That is, the above-described gene may be introduced into the yeast genome together with a promoter controlling expression and other expression control regions. Alternatively, the above-described gene may be introduced so that the expression is controlled by a promoter of a gene originally present in the genome of yeast as a host or other expression control regions.

  In addition, as a method for introducing the above-described gene, any conventionally known technique known as a yeast transformation method can be applied. Specifically, for example, electroporation method “Meth. Enzym., 194, p182 (1990)”, spheroplast method “Proc. Natl. Acad. Sci. USA, 75 p1929 (1978)”, acetic acid Lithium method “J. Bacteriology, 153, p163 (1983)”, Proc. Natl. Acad. Sci. USA, 75 p1929 (1978), Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual, etc. The method can be implemented, but is not limited thereto.

  On the other hand, the expression level of a gene functionally equivalent to the YOL046C gene and / or YOL046C gene endogenous to yeast having ethanol fermentation ability can be improved by a method of modifying the expression control region thereof. In other words, the YOL046C gene, a method of replacing the expression control region (eg, promoter) of a gene functionally equivalent to the YOL046C gene with a gene capable of higher expression, and a regulator that increases the expression of a given gene are introduced. You can use methods to do that. The promoter capable of high expression is not particularly limited, and the promoters listed above can be appropriately used. It is also possible to introduce a mutation into the underlying expression control region and modify it so that it can be expressed at a higher level.

  In order to improve the expression level of the YOL046C gene and / or YOL046C gene that is functionally equivalent to the endogenous YOL046C gene in yeast, the survival time of mRNA transcribed from the gene can be increased, or the transport protein cell It can also be achieved by preventing internal decomposition.

<Ethanol production>
When ethanol is produced using the recombinant yeast described above, ethanol fermentation is performed in a medium containing a carbon source such as glucose, and ethanol is recovered from the medium. In addition, as a medium, a yeast medium such as an SD medium, a YPD medium, an YPAD medium, or a YM medium can be appropriately used. Furthermore, the processed material after saccharifying biomass can also be used as a culture medium. Biomass contains polysaccharides such as cellulose, hemicellulose, and xylan, and hydrolyzes (saccharifies) these polysaccharides to constituent monosaccharides or oligosaccharides. The saccharide thus obtained is used as a substrate for ethanol fermentation by yeast. In general, a saccharification enzyme such as cellulase is used for this saccharification treatment. The saccharification method is not particularly limited, and examples thereof include an enzyme method using a cellulase preparation such as cellulase or hemicellulase. The cellulase preparation contains a plurality of enzymes involved in the degradation of cellulose chains and hemicellulose chains, and exhibits a plurality of activities such as endoglucanase activity, endoxylanase activity, cellobiohydrolase activity, glucosidase activity, and xylosidase activity. Although it does not specifically limit as a cellulase formulation, For example, the cellulase which Trichoderma reesei, Acremonium cellulolyticus, etc. produce can be mentioned. As the cellulase preparation, a commercially available product may be used.

  In order to improve the rate at which polysaccharides contained in biomass are decomposed into constituent monosaccharides, that is, the saccharification rate, in general, the biomass may be subjected to a pretreatment prior to the saccharification treatment. Examples of the pretreatment process include treatments such as a treatment in which pulverized cellulose biomass is immersed in a dilute sulfuric acid solution, an alkali solution, or an ionic liquid, a hydrothermal treatment, and a fine pulverization treatment. By these pretreatments, the saccharification rate of biomass can be improved.

  Thus, when manufacturing ethanol using the saccharide | sugar derived from biomass, fermentation inhibitory substances, such as an acetic acid and a furfural, may be produced in the pre-processing and saccharification process mentioned above. In particular, acetic acid is known as one factor that reduces ethanol productivity because it inhibits the growth and proliferation of yeast.

  However, in yeast having ethanol fermentation ability, growth and proliferation by acetic acid can be achieved by introducing a functionally equivalent gene to the above-mentioned YOL046C gene and / or YOL046C gene or modifying it so as to improve the expression level of the gene. Inhibition can be reduced or prevented. Therefore, by carrying out ethanol fermentation using yeast modified to improve the expression level of the above-mentioned YOL046C gene and / or YOL046C gene, which is functionally equivalent to the YOL046C gene, even in the presence of acetic acid Ethanol can be produced with excellent productivity. In particular, even when ethanol fermentation is performed using the sugar contained in the processed product after the pretreatment and saccharification treatment described above, growth / growth inhibition by acetic acid contained in the treated product can be prevented, Excellent ethanol productivity can be achieved.

  The medium used for ethanol fermentation may be a medium containing biomass. In this case, ethanol fermentation is a so-called simultaneous saccharification and fermentation process. The simultaneous saccharification and fermentation process means a process that is simultaneously performed without distinguishing between the biomass saccharification process and the ethanol fermentation process. Prior to the simultaneous saccharification and fermentation treatment, a conventionally known pretreatment may be applied to the biomass. Although it does not specifically limit as pre-processing, For example, the process which decomposes | disassembles a lignin with microorganisms, the grinding | pulverization process of a cellulose biomass, etc. can be mentioned.

  In the simultaneous saccharification and fermentation treatment, a cellulase preparation and the above-described recombinant microorganism are added to a medium containing cellulosic biomass (which may be after pretreatment), and the recombinant yeast is cultured in a predetermined temperature range. Although it does not specifically limit as culture | cultivation temperature, Considering the efficiency of ethanol fermentation, it can be set to 25-45 degreeC, and it is preferable to set it as 30-40 degreeC. Further, the pH of the culture solution is preferably 4-6. Moreover, you may stir and shake in the case of culture | cultivation.

  In the ethanol production method using the present invention, ethanol is collected from the medium after ethanol fermentation. The method for recovering ethanol is not particularly limited, and any conventionally known method can be applied. For example, after the above-described ethanol fermentation is completed, a liquid layer containing ethanol and a solid layer containing recombinant yeast and solid components are separated by solid-liquid separation operation. Thereafter, ethanol contained in the liquid layer is separated and purified by a distillation method, whereby high purity ethanol can be recovered. The purity of ethanol can be adjusted as appropriate according to the intended use of ethanol.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to a following example.
[Example 1]
In this example, a yeast library that overexpresses an open reading frame (ORF) in the yeast genome under the control of the GAL1 promoter was prepared as follows. First, Yeast ORF clone collection (manufactured by Open Biosystems), which is a collection of yeast expression vectors in which ORF of Saccharomyces cerevisiae was inserted downstream of the GAL1 promoter, was extracted from Escherichia coli as a host. Next, yeast S. cerevisiae OC-2Δura3 strain was transformed by the lithium acetate method using the extracted vector. The S. cerevisiae OC-2Δura3 strain is a strain in which the URA3 gene of the OC-2 strain is disrupted by UV mutation.

  The obtained transformant was cultured in 5 ml of SDCA (0.67% yeast nitrogen base w / o amino acids, 2% D-glucose, 2% Casamino acid) medium to prepare an ORF overexpression yeast library. At this time, the culture temperature was 30 ° C., and the culture was performed for 1 day with stirring at 120 rpm.

  For comparison, an FPS1 gene disrupted yeast known to be able to grow in an acetic acid-containing medium was prepared. A gene fragment for disrupting the FPS1 gene was prepared as follows. First, PCR was performed using primers I and II based on the genomic DNA of the S. cerevisiae OC-2 strain, and a partial sequence of the FPS1 gene (1st to 500th) was amplified by 500 residues. Similarly, PCR was performed using primers V and VI to amplify 500 residues of the partial sequence of the FPS1 gene (from 1511 to 2011). Next, based on the plasmid pRS406 (Stratagene), a part of the FPS1 gene was added to the 5 'end and 3' end using primers III and IV (5 'end side: 471 to 500 of FPS1). URA3 gene containing 3 'terminal side: FPS1 1511 to 1540 added) was amplified.

  As described above, a gene fragment for destroying the FPS1 gene was prepared by PCR using the three fragments amplified by PCR and primers I and VI. The prepared gene fragment was used to transform S. cerevisiae OC-2Δura3 strain by the lithium acetate method. Since the S. cerevisiae OC-2Δura3 strain is a homothalism yeast, the resulting transformant was sporulated and cultured again in a selective medium, so that the diploid yeast OC-2Δfps1 that homozygously disrupted the FPS1 gene Was made.

The primers used are summarized below.
Primer I: ATGAGTAATCCTCAAAAAGCTCTAAACGACTTTCTGTCCA (SEQ ID NO: 3)
Primer II: ATGAGTAATCCTCAAAAAGCTCTAAACGACTTTCTGTCCA (complementary) (SEQ ID NO: 4)
Primer III: AGATTTTTACAAAAATGCAGACGATGCGCAtcaattcatcattttttttttattcttttt (SEQ ID NO: 5)
Primer IV: CCATGGGAACCCAAAAGAAATGATGATGATgggtaataactgatataattaaattgaagc (complementary) (SEQ ID NO: 6)
Primer V: ATCATCATCATTTCTTTTGGGTTCCCATGGTAGGCCCATT (SEQ ID NO: 7)
Primer VI: TCATGTTACCTTCTTAGCATTACCATAATGCGAATCTTCT (complementary) (SEQ ID NO: 8)
The base sequence of the FPS1 gene is shown in SEQ ID NO: 9, and the base sequence of the URA3 gene is shown in SEQ ID NO: 10.

  The acetate resistance of the ORF overexpressing yeast library, OC-2Δfps1 strain, and control strain not producing ORF prepared as described above was compared and examined. First, the ORF overexpressing yeast library, OC-2Δfps1 strain, and control strain that does not produce ORF were ODized in 5 ml SGCA (0.67% yeast nitrogen base w / o amino acids, 2% galactose, 2% Casamino acid) medium. = 0.03, and the cells were cultured at 30 ° C. with stirring at 120 rpm for 1 day. Next, inoculate the cultured yeast into SGCA + acetic acid medium (acetic acid 0-130 mM, 0.67% yeast nitrogen base w / o amino acids, 2% galactose, 2% Casamino acid) containing acetic acid so that OD = 0.03. OD600 was measured over time. The results of measuring OD600 for the control strain are shown in FIG. The results of measuring OD600 for the OC-2Δfps1 strain are shown in FIG. The results of measuring OD600 for the ORF overexpressing yeast library are shown in FIG.

  Next, for the ORF overexpressing yeast library, a culture solution cultured in SGCA medium containing 120 mM acetic acid for about 70 hours was plated on SGCA agar medium, and 4 strains were randomly selected from the grown single colonies. Plasmids were extracted from 4 single colonies, and the sequence of the plasmids was determined using sequencing primers (GAATAAGAA GTAATACAAA CCGAAAATG: SEQ ID NO: 11). Using the extracted plasmid, yeast strain S. cerevisiae OC-2Δura3 was transformed by the lithium acetate method to obtain isolated strains No. 1 to No. 4.

  Next, the control yeast and the isolated strains No. 1 to No. 4 were inoculated into 5 ml of SGCA medium so that OD = 0.03, and cultured at 30 ° C. with stirring at 120 rpm for 1 day. The cultured yeast was inoculated into SGCA + acetic acid medium containing 120 mM acetic acid so that OD = 0.03, and OD600 was measured over time. The results of measuring OD600 for these isolated strains No. 1 to No. 4 and control yeast are shown in FIG.

  As shown in FIG. 1, in the control yeast, the tendency of growth / proliferation inhibition was observed in the presence of 50 mM acetic acid, and it was found that the control yeast was almost killed in the presence of 100 mM or more acetic acid. On the other hand, as shown in FIG. 2, the OC-2Δfps1 strain lacking the FPS1 gene is able to grow and proliferate even in the presence of 100 m of acetic acid, although its growth and proliferation are slightly inhibited. However, it can be seen that the OC-2Δfps1 strain was almost completely killed in the presence of 130 mM acetic acid.

  In contrast, isolates No. 1 to No. 4 isolated from the ORF-overexpressing yeast library exhibiting excellent acetic acid resistance as shown in FIG. 3 were acetic acid such as 120 mM as shown in FIG. Even in the presence, it showed excellent growth and proliferation characteristics. From this result, it was shown that the genes that are highly expressed in the isolated strains No. 1 to No. 4 confer acetic acid resistance to the yeast.

  As a result of sequencing the plasmid using a sequencing primer (GAATAAGAA GTAATACAAA CCGAAAATG: SEQ ID NO: 11), it was found that all the genes highly expressed in the isolated strains No. 1 to No. 4 are YOL046C genes. did. From the above results, it was revealed that acetic acid resistance can be imparted to the yeast by introducing the YOL046C gene into a predetermined yeast or improving the expression level of the YOL046C gene.

Claims (10)

  A method for improving acetic acid resistance in yeast, wherein a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene is introduced into yeast having ethanol fermentation ability, or the expression level of the gene is improved in the yeast . The method for improving acetic acid resistance according to claim 1, wherein the YOL046C gene and the gene functionally equivalent to the YOL046C gene are any of the following genes (a) to (c):
(a) a gene that encodes a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has a function of improving acetic acid resistance by introduction into a host yeast
(b) Encodes a protein containing an amino acid sequence in which one or more amino acids have been deleted, substituted, disabled or inserted with respect to the amino acid sequence shown in SEQ ID NO: 2 and introduced into host yeast to improve acetic acid resistance Genes that function
(c) It can hybridize under stringent conditions to part or all of a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1, and is resistant to acetic acid when introduced into a host yeast. Genes with functions to improve   2. The method for improving acetic acid resistance according to claim 1, wherein the yeast having ethanol fermentation ability is Saccharomyces cerevisiae.   A method for producing acetate-resistant yeast, wherein a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene is introduced into a yeast having ethanol fermentation ability, or the expression level of the gene is improved with respect to the yeast . The method for producing acetate-resistant yeast according to claim 4, wherein the YOL046C gene and the gene functionally equivalent to the YOL046C gene are any of the following genes (a) to (c):
(a) a gene that encodes a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has a function of improving acetic acid resistance by introduction into a host yeast
(b) Encodes a protein containing an amino acid sequence in which one or more amino acids have been deleted, substituted, disabled or inserted with respect to the amino acid sequence shown in SEQ ID NO: 2 and introduced into host yeast to improve acetic acid resistance Genes that function
(c) It can hybridize under stringent conditions to part or all of a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1, and is resistant to acetic acid when introduced into a host yeast. Genes with functions to improve   The method for producing acetic acid-resistant yeast according to claim 4, wherein the yeast having ethanol fermentation ability is Saccharomyces cerevisiae.   Introducing a YOL046C gene and / or a gene functionally equivalent to the YOL046C gene into a yeast having ethanol fermentation ability, or culturing a yeast in which the expression level of the gene is improved relative to the yeast in a medium And a method for producing ethanol by recovering ethanol from the medium. The method for producing ethanol according to claim 7, wherein the YOL046C gene and the gene functionally equivalent to the YOL046C gene are any of the following genes (a) to (c):
(a) a gene that encodes a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has a function of improving acetic acid resistance by introduction into a host yeast
(b) Encodes a protein containing an amino acid sequence in which one or more amino acids have been deleted, substituted, disabled or inserted with respect to the amino acid sequence shown in SEQ ID NO: 2 and introduced into host yeast to improve acetic acid resistance Genes that function
(c) It can hybridize under stringent conditions to part or all of a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1, and is resistant to acetic acid when introduced into a host yeast. Genes with functions to improve   The method for producing ethanol according to claim 7, wherein the yeast having ethanol fermentation ability is Saccharomyces cerevisiae.   The method for producing ethanol according to claim 7, wherein the medium contains 120 mM or more of acetic acid.

Images