JP2013031402A - Method for solubilizing alkaline earth metal carbonate, solubilizing agent thereof and new microorganism - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for solubilizing alkaline earth metal carbonate and a solubilizing agent using a microorganism or a cultured product thereof.SOLUTION: There is provided the method for solubilizing alkaline earth metal carbonate, in which a microorganism belonging to a specific group (Corynebacterium, genus Bacillus, Ochrobactrum) which can solubilize alkaline earth metal carbonate and a culture solution thereof are made to act to solubilize the alkaline earth metal carbonate. There is also provided the solubilizing agent of the alkaline earth metal carbonate containing the microorganism belonging to a specific group (Corynebacterium, genus Bacillus, Ochrobactrum) which can solubilize alkaline earth metal carbonate and a culture solution thereof.

Description

  The present invention relates to a method for solubilizing an alkaline earth metal carbonate using a specific microorganism or a culture thereof and a solubilizing agent. Furthermore, the present invention relates to a novel microorganism capable of solubilizing an alkaline earth metal carbonate.

  Since rare metals such as nickel, chromium, manganese, vanadium, indium and strontium are difficult to purify as an element, the cost is high and the production volume is low. However, since it exhibits excellent functions in a small amount, it is used in a wide range of fields such as electronic equipment and medical care, and rare metals are an indispensable resource for high-technology equipment that supports Japanese industry. For example, rare metals are used even in liquid crystal screens, cameras, batteries, and plastics in mobile phones that are essential for modern society.

  Japan uses the most rare metals in the world, but most of the rare metals exist only in limited countries such as China and South Africa. For this reason, Japan relies on imports to secure rare metal resources. Furthermore, in recent years, due to the rapid increase in demand for rare metals, there have been rare metals whose prices have soared to two to eight times in the past five years, and securing and stable supply of rare metals is an urgent need for the national policy.

  In Japan, a large amount of rare metals are buried in “urban mines”, which are wastes of electronic equipment, and in order to effectively reuse them, the movement of rare metal recovery has begun to flourish. LCD TVs and plasma TVs contain indium, but demand is rapidly increasing due to the terrestrial digital TV. Since these panels are not applicable to the Home Appliance Recycling Law, the necessity and importance of developing technologies for recovering indium from the panels have increased.

  On the other hand, as rare metal resource development becomes more prominent, there are concerns about environmental pollution caused by rare metals contained in mine mine and factory wastewater and the resulting effects on the human body. Some rare metals and their compounds are toxic. At present, environmental pollution is not recognized, but sufficient countermeasures are still required for wastewater treatment problems from manufacturing processes.

  In particular, strontium, an alkaline earth metal, along with rare earths, platinum, niobium, and tantalum, is included in the “Five Minerals to Watch”, and “A Minor that does not need to be stocked immediately but needs to be watched and examined” It is said that. These are likely to be added to the more important “stockpile rare metal 9 ore” as demand for IT-related industries increases rapidly and will increase in the near future. Strontium is mainly used in television cathode ray tubes and ferrite magnets in the form of strontium carbonate. Recently, demand for flat-screen televisions (liquid crystal and plasma) is increasing. Japan is a large consumer of strontium, accounting for about 30% of the world's consumption. In particular, the consumption of strontium in a cathode ray tube has been about 40,000 to 70,000 t / year in the past, and the amount of unused strontium buried in the waste cathode ray tube in Japan is expected to increase significantly for the time being. Analog TV broadcasting ended in 2011, and 50 million CRT TVs are estimated to be discarded, but there is currently no effective means for recycling strontium from CRTs. Accordingly, there is a need for means for solubilizing and recovering insoluble strontium contained in a mixed material such as a cathode ray tube at low cost.

The radioactive isotope ( ⁹⁰ Sr) of strontium is used for nuclear power generation. If this is released into the environment due to a nuclear power plant accident, etc., it contaminates the soil and hydrosphere, accumulates in the body of animals and plants, including humans, through the food chain, and continues to emit radiation over a long period (half-life 28.8 years). As it causes exposure, it is extremely dangerous. In the diffusion of radioactive strontium due to such an accident to the soil and hydrosphere, it is assumed that the concentration of strontium is wide, though low. Therefore, a technique for recovering strontium and particulate strontium in a dilute solution without cost and effort as much as possible is required. However, there is a big problem that there is no effective means at present.

  As a technique for recovering such radioactive strontium, for example, Patent Document 1 discloses a method for decontaminating strontium / sodium-containing radioactive nitrate aqueous waste, and Patent Document 2 discloses a method for calcium in a nitric acid solution containing high-level radioactive waste liquid and Although methods for efficiently extracting and separating strontium have been reported, all are methods by chemical treatment.

Japanese National Patent Publication No. 8-512404 JP 2004-212076 A

  In Japan, large quantities of alkaline earth metals such as strontium and barium are buried in urban mines. Alkaline earth metal recovery technology developed so far is limited to chemical treatment methods. However, chemical treatment methods require high environmental conditions such as strong acids, high-temperature conditions that consume a lot of energy, and large scale. Equipment is required. In addition, it is difficult to apply chemical treatment in the case of a mixed material in which miscellaneous metals other than alkaline earth metals are present at the same time, or in the case of a solution with a very dilute metal concentration. Therefore, it is extremely difficult to recover strontium from the above mixed materials such as cathode ray tubes, radioactive strontium contaminated soil, contaminated hydrosphere, etc. by the chemical treatment method. Therefore, development of an efficient technique for recovering rare metals using microorganisms is desired. However, it has not been known to date that alkaline earth metal contamination purification or alkaline earth metal recovery using microorganisms has been performed.

  Then, an object of this invention is to provide the solubilization method and solubilizer of alkaline earth metal carbonate using microorganisms or its culture. Furthermore, an object of the present invention is to provide a microorganism capable of solubilizing an alkaline earth metal carbonate.

  By screening metal-metabolizing microorganisms using various soil samples, the present inventors have found strontium carbonate in microorganisms belonging to certain genera (genus Corynebacterium, Bacillus, Ocrobacterium). The present inventors have found that there are microorganisms that can be solubilized, and obtained the knowledge that the above-described object can be achieved.

  The present invention has been completed through further studies based on these findings, and provides the following solubilization method, solubilizer and microorganism.

(I) Alkaline earth metal carbonate solubilization method
(I-1) It is characterized in that at least one microorganism selected from the group consisting of the following (a) to (c) or a culture solution thereof is allowed to act to solubilize an alkaline earth metal carbonate. Methods for solubilizing alkaline earth metal carbonates:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate;
(C) A microorganism belonging to the genus Ochrobactrum that can solubilize an alkaline earth metal carbonate.
(I-2) The method according to (I-1), wherein the microorganisms (a) to (c) are the following microorganisms (a1) to (c1):
(A1) a microorganism belonging to Corynebacterium efficiens capable of solubilizing alkaline earth metal carbonates,
(B1) a microorganism belonging to Bacillus megaterium, which can solubilize alkaline earth metal carbonates,
(C1) A microorganism belonging to Ochrobactrum oryzae that can solubilize an alkaline earth metal carbonate.
(I-3) The method according to (I-1), wherein the microorganisms (a) to (c) are the following microorganisms (a11) to (c11):
(A11) Corynebacterium efficiens FUJ3 strain (FERM AP-22150),
(B11) Bacillus megaterium FUJ29 strain (FERM AP-22151),
(C11) Ocrobacterium oryzae FUJ33 strain (FERM AP-22152).
(I-4) The method according to (I-1), wherein the microorganisms (a) to (c) are the following microorganisms (A) to (C):
(A) a microorganism belonging to the genus Corynebacterium, which can solubilize an alkaline earth metal carbonate and has 16S rDNA comprising the base sequence represented by SEQ ID NO: 1,
(B) a microorganism belonging to the genus Bacillus, which can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 2;
(C) A microorganism belonging to the genus Ocrobacterium that can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 3.
(I-5) The method according to any one of (I-1) to (I-4), wherein the alkaline earth metal is strontium or barium.

(II) Alkaline earth metal carbonate solubilizer
(II-1) An alkaline earth metal carbonate solubilizer containing at least one microorganism selected from the group consisting of the following (a) to (c) or a culture solution thereof:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate,
(C) Microorganisms belonging to the genus Ocrobacterium that can solubilize alkaline earth metal carbonates.
(II-2) The solubilizer according to (II-1), wherein the microorganisms (a) to (c) are the following microorganisms (a1) to (c1):
(A1) a microorganism belonging to Corynebacterium efficiens capable of solubilizing an alkaline earth metal carbonate,
(B1) a microorganism belonging to Bacillus megaterium capable of solubilizing an alkaline earth metal carbonate,
(C1) A microorganism belonging to Ocrobacterium oryzae that can solubilize an alkaline earth metal carbonate.
(II-3) The solubilizer according to (II-1), wherein the microorganisms (a) to (c) are the microorganisms (a11) to (c11) below:
(A11) Corynebacterium efficiens FUJ3 strain (FERM AP-22150),
(B11) Bacillus megaterium FUJ29 strain (FERM AP-22151),
(C11) Ocrobacterium oryzae FUJ33 strain (FERM AP-22152).
(II-4) The solubilizer according to (II-1), wherein the microorganisms (a) to (c) are the following microorganisms (A) to (C):
(A) a microorganism belonging to the genus Corynebacterium, which can solubilize an alkaline earth metal carbonate and has 16S rDNA comprising the base sequence represented by SEQ ID NO: 1,
(B) a microorganism belonging to the genus Bacillus, which can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 2;
(C) A microorganism belonging to the genus Ocrobacterium that can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 3.
(II-5) The solubilizer according to any one of (II-1) to (II-4), wherein the alkaline earth metal is strontium or barium.

(III) New microorganism
(III-1) A microorganism belonging to the genus Corynebacterium, Bacillus, or Ocrobacterium, which can solubilize alkaline earth metal carbonates.
(III-2) The microorganism according to (III-1), which is a microorganism belonging to Corynebacterium efficiens, Bacillus megaterium, or Ocrobacterium oryzae.
(III-3) Corynebacterium efficiens FUJ3 strain (FERM AP-22150), Bacillus megaterium FUJ29 strain (FERM AP-22151), or Ocrobacterium oryzae FUJ33 strain (FERM AP-22152), (III The microorganism described in -1).
(III-4) The microorganism according to (III-1), which is any one of the following microorganisms (A) to (C):
(A) a microorganism belonging to the genus Corynebacterium, which can solubilize an alkaline earth metal carbonate and has 16S rDNA comprising the base sequence represented by SEQ ID NO: 1,
(B) a microorganism belonging to the genus Bacillus, which can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 2;
(C) A microorganism belonging to the genus Ocrobacterium that can solubilize an alkaline earth metal carbonate and has 16S rDNA containing the base sequence represented by SEQ ID NO: 3.
(III-5) The microorganism according to any one of (III-1) to (III-4), wherein the alkaline earth metal is strontium or barium.

  According to the method and solubilizing agent of the present invention, it is possible to solubilize an alkaline earth metal carbonate (especially, strontium which is a rare metal) by using a microorganism or a culture solution thereof. In addition, the microorganism of the present invention has an excellent characteristic that it can solubilize carbonates of alkaline earth metals (especially strontium which is a rare metal).

  Therefore, the present invention can be expected to develop a system for efficiently purifying rare metal contamination and collecting rare metal resources.

It is a photograph of a plate when cultivating a soil sample of the Japan Trench. The medium is none, In ₂ O _3, Fe ₂ O ₃ in order from the upper left, and Sn ₂ O ₄ , V ₂ O ₅ , and SrCO ₃ in order from the lower left. It is a photograph of a plate when a soil sample of Ashio Copper Mine is cultured. The medium is none, In ₂ O _3, Fe ₂ O ₃ in order from the upper left, and Sn ₂ O ₄ , V ₂ O ₅ , and SrCO ₃ in order from the lower left. It is a photograph of a plate when a soil sample at the summit of Mt. Fuji is cultured. The medium is SrCO ₃ , Sn ₂ O ₄ , V ₂ O ₅ in order from the upper left, none, In ₂ O ₃ in order from the lower left. SrCO ₃ is a plate photo of the solubilizing bacteria. All were obtained from Mt. Fuji summit soil samples (from the top, FUJ3 strain, FUJ29 strain, FUJ33 strain). The left column is a photograph of the back side of the plate, and the right column is a photograph of the plate surface. Is a photograph showing the bacterial metallic specificity solubilizing SrCO _3. SrCl, SrO, MnCO _{3 in} order from the upper left, BaCO ₃ , SrCO ₃ in order from the lower left. It is a graph which shows the growth curve of each bacterium, pH change, and the solubility of strontium carbonate. The SrCO ₃ shows a phylogenetic tree of solubilizing bacteria.

  Hereinafter, the present invention will be described in detail.

Method for Solubilizing Alkaline Earth Metal Carbonate The method for solubilizing an alkaline earth metal carbonate according to the present invention comprises at least one microorganism selected from the group consisting of: It is characterized by solubilizing alkaline earth metal carbonate by the action of a culture solution:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate,
(C) Microorganisms belonging to the genus Ocrobacterium that can solubilize alkaline earth metal carbonates.

  According to the method of the present invention, the alkaline earth metal carbonate can be solubilized by using a specific microorganism or a culture solution thereof.

  The alkaline earth metal carbonate in the present invention is calcium (Ca), strontium (Sr), barium (Ba) and radium (Ra) carbonate, preferably rare metal strontium and barium carbonate, Particularly preferred is strontium carbonate.

  The alkaline earth metal carbonate to be solubilized by the method of the present invention may be contained in another substance, for example, an ore containing an alkaline earth metal carbonate, electronic equipment The method of the present invention can also be applied to waste liquids from urban mines and factories. Therefore, it is possible to easily recover alkaline earth metals, particularly strontium and barium, by solubilizing alkaline earth metals, particularly rare metals such as strontium and barium, from the waste of electronic equipment by the method of the present invention. It becomes possible.

  The solubilization in the present invention is specifically a reaction in which an alkaline earth metal carbonate is decomposed to generate an alkaline earth metal ion.

  The microorganism used in the present invention is a microorganism belonging to the genus Corynebacterium, the genus Bacillus, the genus Ocrobacterium, or the like, which can solubilize the alkaline earth metal carbonate, preferably Corynebacterium efficiens, Bacillus.・ Microorganisms belonging to megaterium, Ocrobacterium oryzae, etc. A method for classifying microorganisms (identification of genus species) based on 16S rRNA information and the like for microorganisms collected from soil and the like is known. The microorganism used in the present invention may be any microorganism such as a wild-type strain, a mutant strain, and a recombinant produced by genetic engineering techniques.

  It can be confirmed by the method described in the Examples that the microorganism can solubilize the alkaline earth metal carbonate. Specifically, it can be confirmed by culturing the microorganism in a medium such as YPG to which an alkaline earth metal carbonate is added, and observing that the transparency of the agar medium and the culture solution after the culture is increased. Microorganisms capable of solubilizing the alkaline earth metal carbonate used in the present invention can be isolated and collected by screening from wild strains, mutant strains and the like by using the above method.

  Examples of the microorganism used in the present invention include Corynebacterium efficiens FUJ3 strain, Bacillus megaterium FUJ29 strain, and Ocrobacterium oryzae FUJ33 strain. Examples show that the Corynebacterium efficiens FUJ3 strain, Bacillus megaterium FUJ29 strain, and Ocrobacterium oryzae FUJ33 strain have the ability to solubilize strontium carbonate. Yes. The following are the mycological and genetic properties of these strains.

(Corynebacterium efficiens FUJ3 strain)
(i) Mycological properties
The shape characteristics of FUJ3 strain are yellow in color, dotted in shape, hemispheric in the raised state, full edge in the periphery, smooth on the surface, etc., opaque in transparency, and butter-like in consistency.

(ii) Genetic properties
Analysis of the 16S rRNA gene nucleotide sequence (SEQ ID NO: 1) shows a high identity with Corynebacterium efficiens at 98.3%, confirming that the FUJ3 strain belongs to the genus.

(Bacillus megaterium FUJ29)
(i) Mycological properties
The shape characteristics of FUJ29 strain are: white color, circular shape, ridged wave shape or protrusion, peripheral edge wave shape, surface shape etc. mucoid, transparency is translucent, viscosity is viscous .

(ii) Genetic properties
Analysis of the 16S rRNA gene base sequence (SEQ ID NO: 2) shows that the identity with Bacillus megaterium is as high as 99.5%, confirming that the FUJ29 strain belongs to the genus species.

(Ocrobacterium oryzae FUJ33 strain)
(i) Mycological properties
The shape characteristics of FUJ33 are as follows: color is ivory color, shape is punctiform, raised state is flat, peripheral edge is full edge, surface shape is rough, transparency is translucent, viscosity is butter-like doing.

(ii) Genetic properties
Analysis of the 16S rRNA gene base sequence (SEQ ID NO: 3) shows a high value of 95.9% with O. oryzae, confirming that the FUJ33 strain belongs to the genus species.

  On July 11, 2011, the Corynebacterium efficiens FUJ3 strain, Bacillus megaterium FUJ29 strain, and Ocrobacterium oryzae FUJ33 strain were established on July 11, 2011 by the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba, Ibaraki Prefecture, Japan). The deposit numbers FERM AP-22150, FERM AP-22151, and FERM AP-22152 are deposited in the city center 1-1-1 center 6 (postal code 305-8566).

  In addition to the above-mentioned Corynebacterium efficiens FUJ3 strain, Bacillus megaterium FUJ29 strain, and Ocrobacterium oryzae FUJ33 strain, as microorganisms that can solubilize alkaline earth metal carbonates, SEQ ID NO: 1 And a microorganism having 16S rDNA containing the nucleotide sequence represented by 3 or a nucleotide sequence having 98%, 99%, or 99.8% identity with these.

  As a medium for culturing the microorganism used in the present invention, any medium can be used without limitation as long as the microorganism can grow. For example, the medium to be used includes those containing carbohydrates such as glucose, sucrose, fructose, glycerol and starch as a carbon source. Further, those containing an inorganic or organic nitrogen source (for example, ammonium sulfate, ammonium chloride, casein hydrolyzate, yeast extract, polypeptone, bactotryptone, beef extract, etc.) are also included. Furthermore, if desired, other nutrient sources (for example, inorganic salts, vitamins, trace metal salts, etc.) may be added to the medium. These can also be prepared as a solid medium by adding about 1.5% agar.

  Culture of the microorganism used in the present invention can be carried out usually under pH conditions of pH 4.0 to 7.0; usually temperature conditions of 30 to 37 ° C.

  When solubilizing the alkaline earth metal carbonate using the microorganism used in the present invention, the microorganism may be immobilized on carrageenan gel, alginic acid gel or the like by a known method. The method of the present invention is a method of culturing the microorganism using a medium to which an alkaline earth metal carbonate has been added from the beginning, or a method of adding an alkaline earth metal carbonate to the culture solution of the microorganism. There may be.

  The culture solution in the present invention includes a state containing microorganisms after culturing microorganisms and a culture solution after microorganisms are removed.

  Examples of the action of a microorganism or a culture solution thereof include a mode in which a microorganism or the like is added to an ore containing an alkaline earth metal carbonate or an urban mine.

  The alkaline earth metal solubilized by the method of the present invention can be isolated and recovered by using a known method such as biomineralization using shrimp or boulder algae.

Alkaline earth metal carbonate solubilizer The alkaline earth metal carbonate solubilizer of the present invention is at least one microorganism selected from the group consisting of: It is characterized by containing a culture solution:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate,
(C) Microorganisms belonging to the genus Ocrobacterium that can solubilize alkaline earth metal carbonates.

  According to the solubilizing agent of the present invention, it is possible to solubilize an alkaline earth metal carbonate. In addition, by using the solubilizer of the present invention, alkaline earth metals, particularly strontium and barium, which are rare metals, are solubilized from wastes of electronic equipment, etc., thereby recovering alkaline earth metals, particularly strontium and barium. It becomes possible to carry out easily.

  The explanation, definition, etc. of the above-mentioned “microorganism”, “alkaline earth metal”, “solubilization” and the like are the same as those described in the item “Method for solubilizing carbonate of alkaline earth metal”. .

  Examples are given below to illustrate the present invention in more detail. However, the present invention is not limited to these examples.

[reagent]
Tryptone, yeast extract, sodium chloride, agar powder, indium oxide, vanadium oxide, tin oxide, iron oxide, strontium carbonate, strontium chloride, strontium oxide, barium carbonate, manganese carbonate, and agarose were purchased from Nacalai Tesque. D (+)-glucose was purchased from Wako Pure Chemical Industries.

[Method]
1. Screening for bacteria excellent in solubilizing ability of insolubilized metals Several milligrams of soil samples from the Japan Trench, Ashio Copper Mine, and Mt. Fuji summit were weighed into an Eppendorf tube. Suspend in 700 μl of 1 M Tris buffer (pH 8.0), sprinkle 100 μl of the supernatant on a YPG agar plate (Table 2) containing 20 mM indium oxide, iron oxide, tin oxide, vanadium oxide, and strontium carbonate (Table 1). In culture. Bacteria grown on each plate were passaged to another plate containing the same metal.

2. Metallic properties of bacteria with strontium carbonate solubilizing ability
It was investigated whether bacteria with SrCO ₃ solubilization ability would cause metal solubilization with other metal carbonates and strontium salts. The bacteria were cultured at 28 ° C. using YPG agar plates (Table 2) each containing 20 mM strontium oxide, strontium chloride, barium carbonate, and manganese carbonate (Table 3).

3. Culture of bacteria with solubilizing ability
Bacteria were inoculated into a test tube containing 5 ml of YPG liquid medium, and cultured with shaking at 30 ° C. until suspended. This solution is used as a preculture solution. 1 ml of the preculture was added to 100 ml of YPG liquid culture, and main culture was performed at 30 ° C. The absorbance and pH at OD = 600 were measured for the change with time. In addition, in order to investigate the ability of the culture supernatant to solubilize strontium carbonate, collect 1 ml of the culture solution for each culture time, and centrifuge (6,000 rpm, 5 min, 4 ° C) to remove the supernatant. Obtained. These supernatants and 20 mM SrCO ₃ -containing YPG liquid medium were mixed at 2: 1 (total 300 μl), allowed to stand for several hours, and the absorbance at OD = 600 was measured.

4). Bacterial 16S rRNA sequence analysis Bacterial genome extraction was performed by the bead phenol method. Suspend bacteria in an Eppendorf tube containing 100 μl of sterilized water, 125 μl of 200 mM Tris buffer (80 mM EDTA, pH 8.0), 25 μl of 10% SDS, 150 mg of sterile glass beads (φ ≦ 106 μm), TE saturated phenol (pH 7.9 ) 250 μl was added. After stirring for 1 minute using Vortex, centrifugation (15,000 rpm, 4 ° C., 5 min) was performed, and 200 μl of an aqueous supernatant was collected to collect genomic DNA. In order to collect highly pure genomic DNA, 200 μl of PCI was added to the supernatant and stirred gently, and then 125 μl of supernatant containing genomic DNA was collected by centrifugation (15,000 rpm, 4 ° C., 5 min). To this supernatant, 12.5 μl of 5M NaCl and 310 μl of 99.5% ethanol were added by ethanol precipitation to precipitate DNA. The precipitate was washed with 200 μl of 70% ethanol and then dissolved with 100 μl of TE buffer.

  In order to identify the bacteria obtained by screening, PCR was used to amplify the 16S rDNA base sequence. The reaction solution (Table 4) was put into a PCR microtube, and PCR reaction (Table 5) was performed.

Primer
16S_fD2_RT AGAGTTTGATCATGGCTCAG
16S_rP2_RT ACGGCTACCTTGTTACGACTT

  The gene amplified by PCR was subjected to agarose gel electrophoresis, and the PCR product confirmed to be amplified was recovered using NucleoSpin (registered trademark) Extract II of MACHEREY-NAGEL. In order to analyze the base sequence of the gel-extracted PCR product, we requested a sequence analysis service from Fasmac. Using the obtained sequence analysis results, a phylogenetic tree was created to determine the genus level, and based on this, a phylogenetic tree was created between closely related species to identify the species.

[result]
1. Screening of bacteria excellent in solubilizing ability of insolubilized metals FIGS. 1 to 3 show the state of soil samples cultured at the Japan Trench, Ashio Copper Mine, and Mt. Fuji summit in each medium. It shows that selection by insolubilized metal is possible because each group and bacteria group that can grow by insolubilized metal are different. Among them, bacteria that solubilize strontium carbonate were identified.

2. Among the bacteria isolated with regard to the metal characteristics of bacteria having strontium carbonate solubilization ability, the bacteria (FUJ3, FUJ29, FUJ33) that have solubilized water-insoluble SrCO ₃ were discovered. They are shown in FIG.

Of these bacteria that solubilize SrCO ₃ , FUJ3 is cultured in a YPG agar medium containing 20 mM strontium oxide, strontium chloride, barium carbonate, and manganese carbonate, respectively, as shown in FIG.

Although there was no change in the YPG medium containing strontium oxide, strontium chloride, and manganese carbonate, bacteria that solubilize SrCO ₃ solubilized not only strontium carbonate but also barium carbonate. From this, it is considered that bacteria that solubilize SrCO ₃ selectively solubilize alkaline earth metal carbonates.

3. Culture of Bacteria with Solubilization Capability Growth curves, pH changes, and solubility of strontium carbonate for each bacterium are shown in FIG. Both FUJ3 and FUJ29 show no significant change in growth, pH change and strontium carbonate solubility. However, FUJ33 is less grown and less soluble in strontium carbonate than FUJ3 and FUJ29.

4). Genome sequence analysis
FIG. 7 shows a phylogenetic tree of bacteria that solubilize SrCO ₃ .

  From the phylogenetic tree, it was clarified that the bacteria obtained from the soil at the top of Mt. Fuji, FUJ3 is a genus Corynebacterium, FUJ29 is a genus Bacillus, FUJ33 is a bacterium belonging to the genus Ocrobacterium.

<FUJ3: Corynebacterium>
The following is information on the identity (%) of the nearest relative species and its neighboring species by searching the DNA sequence (BLAST etc.) of the FUJ3 16S rRNA gene base sequence (total sequence length: 1,484 bp, SEQ ID NO: 1). Table 6 shows. From this result, FUJ3 strain was identified as Corynebacterium efficiens.

<FUJ29: Bacillus genus>
FUJ29 16S rRNA gene base sequence (total sequence length: 1,516 bp, SEQ ID NO: 2) on DNA database (BLAST, etc.) searched for information on the identity (%) of the nearest relative species and its neighboring species Table 7 shows. From this result, FUJ29 strain was identified as Bacillus megaterium.

<FUJ33: Ocrobacterium genus>
Information on the identity (%) of the nearest relative species and its neighboring species by searching on the DNA database (BLAST etc.) of the 16S rRNA gene base sequence of FUJ33 (total sequence length: 1,449 bp, SEQ ID NO: 3) It shows in Table 8. From this result, the FUJ33 strain was identified as O. oxybacterium.

Claims (12)

An alkaline earth metal carbonate comprising solubilizing an alkaline earth metal carbonate by acting at least one microorganism selected from the group consisting of the following (a) to (c) or a culture solution thereof: Carbonate solubilization method:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate;
(C) A microorganism belonging to the genus Ochrobactrum that can solubilize an alkaline earth metal carbonate. The method according to claim 1, wherein the microorganisms (a) to (c) are the following microorganisms (a1) to (c1):
(A1) a microorganism belonging to Corynebacterium efficiens capable of solubilizing alkaline earth metal carbonates,
(B1) a microorganism belonging to Bacillus megaterium, which can solubilize alkaline earth metal carbonates,
(C1) A microorganism belonging to Ochrobactrum oryzae that can solubilize an alkaline earth metal carbonate. The method according to claim 1, wherein the microorganisms (a) to (c) are the following microorganisms (a11) to (c11):
(A11) Corynebacterium efficiens FUJ3 strain (FERM AP-22150),
(B11) Bacillus megaterium FUJ29 strain (FERM AP-22151),
(C11) Ocrobacterium oryzae FUJ33 strain (FERM AP-22152).   The method according to claim 1, wherein the alkaline earth metal is strontium or barium. Solubilizer of alkaline earth metal carbonate containing at least one microorganism selected from the group consisting of the following (a) to (c) or a culture solution thereof:
(A) a microorganism belonging to the genus Corynebacterium capable of solubilizing an alkaline earth metal carbonate;
(B) a microorganism belonging to the genus Bacillus capable of solubilizing an alkaline earth metal carbonate,
(C) Microorganisms belonging to the genus Ocrobacterium that can solubilize alkaline earth metal carbonates. The solubilizer according to claim 5, wherein the microorganisms (a) to (c) are the following microorganisms (a1) to (c1):
(A1) a microorganism belonging to Corynebacterium efficiens capable of solubilizing an alkaline earth metal carbonate,
(B1) a microorganism belonging to Bacillus megaterium capable of solubilizing an alkaline earth metal carbonate,
(C1) A microorganism belonging to Ocrobacterium oryzae that can solubilize an alkaline earth metal carbonate. The solubilizer according to claim 5, wherein the microorganisms (a) to (c) are the following microorganisms (a11) to (c11):
(A11) Corynebacterium efficiens FUJ3 strain (FERM AP-22150),
(B11) Bacillus megaterium FUJ29 strain (FERM AP-22151),
(C11) Ocrobacterium oryzae FUJ33 strain (FERM AP-22152).   The solubilizer according to any one of claims 5 to 7, wherein the alkaline earth metal is strontium or barium.   A microorganism belonging to the genus Corynebacterium, Bacillus or Ocrobacterium, which can solubilize an alkaline earth metal carbonate.   The microorganism according to claim 9, which is a microorganism belonging to Corynebacterium efficiens, Bacillus megaterium, or Ocrobacterium oryzae.   The microorganism according to claim 9, which is Corynebacterium efficiens FUJ3 strain (FERM AP-22150), Bacillus megaterium FUJ29 strain (FERM AP-22151), or Ocrobacterium oriza FUJ33 strain (FERM AP-22152). .   The microorganism according to any one of claims 9 to 11, wherein the alkaline earth metal is strontium or barium.

Images