JP2013027381A - Differentiation-inducing method of stem cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an inexpensive scaffolding material that does not contain a mammal origin factor, and further to provide a technique that induces differentiation in a higher efficiency than a case in which the mammal origin factor is used in a differentiation-inducing method of a stem cell.SOLUTION: The differentiation-inducing method of a stem cell includes a process in which a stem cell is differentiated on jellyfish collagen, and a culturing reagent for including stem cell differentiation induction and a kit including the reagent are disclosed.

Description

  The present invention relates to a method for inducing differentiation of stem cells, and a culture reagent and kit that can be used therefor.

The industrial scale of regenerative medicine is expected to exceed 10 trillion yen in the global market. In October 2010, the world's first clinical trial using human embryonic stem cells (ES cells) was started in the United States. As for human induced pluripotent stem cells (iPS cells), a new reprogramming factor (GLIS1) that improves establishment efficiency and eliminates incomplete iPS cells has been discovered. R & D is expected to progress further.
Nevertheless, tissue stem cells are the leading role in current stem cell transplantation medicine. Tissue stem cells, unlike ES cells, have no ethical issues and can be autotransplanted, so there is no concern about rejection. Among them, in clinical application, 80% of them are mesenchymal stem cells (MSC). Mesenchymal stem cells are present in mammalian bone marrow, etc., and can be differentiated into various tissues and cells such as bone, cartilage, fat, muscle, ligament, and nerve, and are relatively easy to prepare. Clinical application is progressing.
Specifically, mesenchymal stem cells are isolated from a patient and cultured under a predetermined condition to promote proliferation and differentiation to construct a tissue body, and the obtained tissue body is transplanted into the patient himself to obtain bone. And cartilage are being repaired.

It is known that mammal-derived collagen, gelatin and the like are generally used as scaffolding materials for stem cell differentiation induction (Patent Documents 1 to 3).
However, such mammal-derived factors are very expensive and there is a risk of causing zoonotic diseases. Furthermore, the current differentiation induction method has a complicated culture system, and requires 3 to 4 weeks for differentiation induction, which is inefficient and costly. Thus, a highly efficient method for inducing differentiation of stem cells that does not contain mammalian-derived factors is desired.

Attempts have been made to use marine collagen (marine collagen) as an alternative to mammalian-derived factors. For example, culturing skin cells using gels made from collagen extracted from salmon skin, three-dimensional culture of hepatocytes using collagen molded into a film, periodontal tissue regeneration using collagen sheets, etc. Research is ongoing (Non-Patent Document 1).
However, since marine collagen has a low denaturation temperature of 5 to 30 ° C., it denatures and weakens under physiological conditions of animal cells, and is rapidly degraded and absorbed by in vivo degrading enzymes. For this reason, in order to use marine collagen as a cell culture substrate, it is necessary to re-form collagen fibers with a cross-linking agent and raise the denaturation temperature, which is disadvantageous in terms of complexity and production cost.

By the way, jellyfish are generally treated as sea nuisances because they cause damage to bathers and, recently, a large amount of Echizen jellyfish cause serious fishing damage. In Japan and China, some are used for food, but most are treated as waste.
The body of jellyfish is composed of 95% moisture and 2% collagen, and jellyfish collagen has better moisture absorption and moisture retention than other collagens. It has also been reported that adding jellyfish extract to the medium promotes IgM production in human hybridomas and interferon γ (IFN-γ) and tumor necrosis factor α (TNF-α) in human peripheral blood lymphocytes. (Patent Document 4), and an immunostimulatory effect is expected. Recently, these properties have been commercialized as supplements.
However, no examples of using jellyfish collagen as a scaffold for tissue culture, in particular, differentiation induction culture of tissue from stem cells have been reported.

JP 2006-158975 A JP 2003-260123 A JP 2007-306922 A JP 2006-204248 A

http://www.meti.go.jp/committee/materials/downloadfiles/g61127a03j.pdf

  An object of the present invention is to provide an inexpensive and safe scaffold material that does not contain a mammal-derived factor in a method for inducing stem cell differentiation, and further induces stem cell differentiation with higher efficiency than when a mammal-derived factor is used. Is to provide technology.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have used jellyfish collagen as a scaffold material without cultivating stem cells without any special pretreatment such as crosslinking treatment. Surprisingly, it was found that differentiation can be induced with higher efficiency than the case of using a mammal-derived factor, and the present invention has been completed.

That is, the present invention relates to the following.
[1] A method for inducing differentiation of a stem cell, comprising a step of differentiating the stem cell on jellyfish collagen.
[2] The method according to [1], wherein the jellyfish cogen is jellyfish acid-soluble collagen.
[3] The method according to [1], further comprising a step of proliferating stem cells on jellyfish collagen.
[4] The method according to [3], wherein the jellyfish collagen is jellyfish-soluble collagen.
[5] The method according to any one of [1] to [4], wherein the stem cell is a mesenchymal stem cell, and the differentiation is bone differentiation.
[6] The method according to [5], further comprising a step of confirming the differentiation status of mesenchymal stem cells by measuring the expression of a bone differentiation marker gene.
[7] The method according to [6], wherein the bone differentiation marker is BMP2, ALP and / or OCN.
[8] The method according to [7], comprising a step of measuring the expression of the BMP2 gene as an early marker of bone differentiation on days 1 to 12 of bone differentiation culture.
[9] The method according to [7], comprising a step of measuring ALP gene expression as a medium-term marker of bone differentiation on days 7 to 24 of bone differentiation culture.
[10] The method according to [7], comprising a step of measuring the expression of the OCN gene as a late marker of bone differentiation on days 10 to 30 of the bone differentiation culture.
[11] The method according to [7], comprising the following steps:
(A) a step of measuring the expression of BMP2 gene as an early marker of bone differentiation on days 1 to 12 of bone differentiation culture;
(B) a step of measuring the expression of ALP gene as an intermediate marker of bone differentiation on days 7 to 24 of bone differentiation culture; and (c) an OCN gene as a late marker of bone differentiation on days 10 to 30 of bone differentiation culture. Measuring the expression of.
[12] A method for producing a differentiated cell, comprising performing the method according to any one of [1] to [11].
[13] The production method of [12], wherein the differentiated cell is a bone differentiated cell.
[14] A differentiated cell obtained by the method according to [12].
[15] A bone differentiated cell obtained by the method according to [13].
[16] A cell culture containing differentiated cells obtained by the method of [12] and jellyfish collagen.
[17] A cell culture containing bone differentiated cells obtained by the method of [13] and jellyfish collagen.
[18] A jellyfish collagen, which is used in the method according to any one of [1] to [13].
[19] The jellyfish collagen according to [18], which is acid-soluble.
[20] A culture reagent for inducing stem cell differentiation, comprising jellyfish collagen, which is used in the method according to any one of [1] to [13].
[21] The culture reagent according to [20], wherein the jellyfish collagen is jellyfish-soluble collagen.
[22] The culture reagent according to [20], wherein the stem cell differentiation induction is bone differentiation induction of mesenchymal stem cells.
[23] A kit for inducing bone differentiation of mesenchymal stem cells, comprising the culture reagent according to [22] and a bone differentiation medium.
[24] The kit according to [23], further comprising a substance capable of detecting the expression of a bone differentiation marker gene.
[25] The kit according to [24], wherein the substance capable of detecting the expression of the bone differentiation marker gene is at least one selected from the group consisting of a nucleic acid probe, a primer and an antibody.

  According to the present invention, since a mammal-derived factor is not used as a scaffold material, it is possible to provide a highly safe differentiation induction technique for stem cells used in regenerative medicine. Furthermore, according to the present invention, a relatively simple culture system can be used, and a differentiation induction technique that is more efficient than the case of using a mammal-derived factor can be provided. Furthermore, since the jellyfish collagen used in the present invention is extracted from what is conventionally regarded as waste, it is possible to effectively utilize unused resources and to provide a relatively inexpensive scaffold material.

FIG. 1 is a graph showing proliferation of rat-derived mesenchymal stem cells. The horizontal axis of the graph indicates the cell culture time (hour), and the vertical axis indicates the viable cell density (10,000 cells / well). FIG. 2 is a diagram showing the results of examining the calcification deposition of cells induced to differentiate from rat-derived mesenchymal stem cells. FIG. 3 is a graph showing the results of examining the expression rate of the BMP2 gene, which is the early marker. The horizontal axis of the graph indicates the number of days of cell culture (days), and the vertical axis indicates the expression rate of the BMP2 gene. FIG. 4 is a graph showing the results of examining the expression rate of the ALP gene, which is a medium-term marker. The horizontal axis of the graph indicates the number of days of cell culture (days), and the vertical axis indicates the expression rate of the ALP gene. FIG. 5 is a graph showing the results of examining the expression rate of the OCN gene, which is a late marker. The horizontal axis of the graph indicates the number of days of cell culture (days), and the vertical axis indicates the OCN gene expression rate.

  The present invention provides a method for inducing differentiation of stem cells, comprising the step of differentiating stem cells on jellyfish collagen.

  The jellyfish collagen used in the present invention is collagen prepared from jellyfish. The type of the jellyfish is not particularly limited, but examples include jellyfish belonging to the cypress net (Scyphozoa), the box worm net (Cubozoa), the cross jellyfish net (Staurozoa), and the hydro insect net (Hydrozoa). Examples include moon jellyfish, red jellyfish, bizen jellyfish, Echizen jellyfish, Ephidra jellyfish, hiratakamuri jellyfish, black jellyfish jellyfish, Amakusa jellyfish, willow jellyfish, yellow jellyfish, Amaga jellyfish, samurai jellyfish, shrimp jellyfish, jellyfish jellyfish, purple jellyfish, etc. Preferably, a jellyfish and an Echizen jellyfish are used.

  The jellyfish collagen in the present invention is commercially available, and can also be prepared based on previous reports. For example, as described in Japanese Patent Application Laid-Open No. 2007-51191, Japanese Patent Application Laid-Open No. 2008-31106, and International Publication No. 2007/020889, after treatment of jellyfish with a buffer solution or an aqueous solution containing a salt content of about seawater, A method for extracting jellyfish collagen from the treatment liquid is mentioned.

In the present invention, preferably, jellyfish collagen can be prepared by the following procedure.
First, the jellyfish is crushed. The jellyfish crushing treatment can be performed using a commercially available apparatus such as a cutting machine, a mincing machine, and a cutter.

  And protein is extracted from the crushed jellyfish. Such protein extraction can be carried out, for example, by treating jellyfish with a phosphate buffer or a sodium chloride solution of about 0.2% and leaving it overnight at a low temperature of about 4 ° C. Thereby, an extract of jellyfish protein is obtained.

  Although it does not specifically limit after extracting protein from a jellyfish, It is preferable to filter and to perform sodium chloride precipitation or ethanol precipitation further. As a result, the extraction residue is removed, and the protein extract can be further purified.

  Purification of jellyfish collagen from the protein extract obtained as described above can be performed using a known method. For example, the obtained crude protein is centrifuged at 10,000 g to obtain a solid. Ethanol is added to the solid to redisperse it, and centrifugation is again performed at 10000 g to remove impurities transferred to the ethanol layer. Water is added to the precipitate and desalting is performed with a dialysis membrane to obtain crude collagen.

  In the present invention, the sample after dialysis can be used as it is as jellyfish collagen, but it is also possible to use jellyfish collagen by further centrifugation and distinguishing the supernatant from the precipitate. Since such a supernatant is soluble in a neutral solution such as water, it is referred to herein as “jellyfish neutral soluble collagen”. In addition, the precipitate is referred to as “jellyfish-soluble collagen” in the present specification because it is hardly soluble in a neutral solution but soluble in an acidic solution. That is, the “jellyfish neutral soluble collagen” in the present invention refers to collagen extracted from jellyfish that is soluble in a neutral solution, and “jellyfish acid soluble collagen” in the present invention. Refers to collagen extracted from jellyfish that is sparingly soluble in neutral solutions but soluble in acidic solutions. Here, neutral means, for example, a range of pH 5-8, and acidic means, for example, a range of pH 1-4. Hereinafter, the term “jellyfish collagen” in the present specification means that both jellyfish neutral soluble collagen and jellyfish acid soluble collagen are included unless otherwise specified.

  As described above, the extracted jellyfish collagen can be dehydrated by further treatment such as freeze drying or spray drying. For aqueous solutions containing jellyfish collagen, jellyfish collagen is precipitated by salting out using an inorganic salt such as ammonium sulfate or precipitation using an alcohol such as ethanol. It can also be used to separate jellyfish collagen.

  The jellyfish collagen obtained as described above can be in any form such as powder, granule and pellet, or can be dissolved in an appropriate solvent to form a solution. The solvent for dissolving jellyfish collagen is not particularly limited, and examples thereof include solvents usually used in neutral regions such as water, physiological saline and phosphate buffer, and acidic solvents such as hydrochloric acid and acetic acid. It can be used. In particular, when jellyfish-soluble collagen is dissolved, it is preferable to use an acidic solvent. When jellyfish collagen is powdered, it is preferably stored at −20 to 10 ° C., and more preferably stored together with a desiccant such as silica gel. When jellyfish collagen is used as a solution, it is preferably stored at 10 ° C. or lower.

  In the present invention, stem cells can be cultured on the jellyfish collagen described above to induce proliferation and differentiation of the stem cells. The stem cells to be cultured may be stem cells of any animal, for example, warm-blooded animals, preferably mammalian stem cells. Examples of mammals include primates such as humans and monkeys, rodents such as mice, rats, guinea pigs, and hamsters, rabbits, cats, dogs, sheep, pigs, cows, horses, goats, and the like. In the present invention, human stem cells are particularly preferred from the viewpoint that they can be used for human regenerative medicine and clinical applications.

  Stem cells in the present invention are not particularly limited as long as they have both differentiation ability and self-replication ability. For example, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, hepatic stem cells, pancreatic stem cells, skin stem cells, muscle stem cells, reproductive stem cells ES cells, embryonic tumor cells (EC cells), embryonic germ stem cells (EG cells), iPS cells and the like.

  Among the stem cells, mesenchymal stem cells are particularly preferable in the present invention. Mesenchymal stem cells are present in mesenchymal tissues such as bone marrow, adipose tissue, umbilical cord blood, endometrium, dermis, skeletal muscle, periosteum, periodontal ligament, pulp and tooth germ, and at least bone cells and adipocytes And cells having the ability to differentiate into mesenchymal cells such as muscle cells. Moreover, when mesenchymal stem cells are used in the present invention, the differentiated cells (cells induced to differentiate) are not particularly limited, but are preferably bone differentiated cells. In the present specification, the term “bone differentiated cell” means any cell observed in the differentiation from mesenchymal stem cells into bone, for example, a little from osteoblasts, bone cells, or mesenchymal stem cells. Examples include mesenchymal progenitor cells that have undergone differentiation.

  A mesenchymal stem cell may be a commercially available product or prepared according to a conventional method, but a mesenchymal stem cell isolated from a living body of a patient (human) can be preferably used. For example, mesenchymal stem cells can be isolated from human bone marrow while collecting bone marrow cell fluids according to the method reported by Haynesworth SE et al. (Bone. 1992; 13: 81-8.). it can. From the obtained bone marrow cell solution, other cells mixed in the bone marrow cell solution were removed using the method reported by Pittenger MF et al. (Science. 1999; 284: 143-7.), And mesenchymal stem cells were removed. Can be isolated. For example, when mesenchymal stem cells are isolated from human adipose tissue, Zuk PA et al. (Tissue Eng. 2001 Apr; 7: 211-28., Mol Biol Cell. 2002 Dec; 13 (12): 4279- 95.) can be used. For example, mesenchymal stem cells can be isolated from human umbilical cord according to the method reported by Romanov Y.A. et al. (Stem Cells. 2003; 21: 105-10.). Although mesenchymal stem cells can be collected as described above, the method is not limited to the above contents.

  Stem cells such as mesenchymal stem cells may be isolated from animals and used for differentiation induction as they are. However, they can have a certain number of cells, and can be proliferated in advance in order to condition the cells. Are preferably used. In the present invention, it is preferable to perform growth culture on the jellyfish collagen because it is safer than mammalian-derived factors, good growth is observed, and differentiation efficiency after growth is excellent.

  The jellyfish collagen used for stem cell growth is not particularly limited, but jellyfish-soluble collagen is preferred. Furthermore, it is more preferable to proliferate stem cells for a certain period of time on jellyfish neutral soluble collagen (early growth culture), and then grow on jellyfish soluble collagen (late growth culture). Here, in the present specification, the term “proliferation culture first term” refers to a period during which stem cells are proliferated and cultured under a normal culture condition in which no scaffold material is used (generally referred to as an induction period). The term “late growth culture period” means a period during which the number of cells increases logarithmically under normal culture conditions without using a scaffold material (generally, the logarithmic growth period) Period). Note that a period during which differentiation induction culture described below is performed may be referred to as a “differentiation culture period”. The period of the early phase of growth culture and the late phase of growth culture depend on the type of stem cells used in the culture, the culture conditions, and the like, and can be appropriately set based on technical information known to those skilled in the art. In the present invention, stem cells (particularly mesenchymal stem cells) can be more effectively proliferated by changing the mode of jellyfish collagen used in the early stage of growth culture and the later stage of growth culture.

  Stem cells isolated from animals or stem cells grown as described above are induced to differentiate on jellyfish collagen (differentiation culture phase). The jellyfish collagen used for inducing differentiation of stem cells is not particularly limited, but jellyfish-soluble collagen is preferable.

  Stem cells in which differentiation is induced, for example, using DNA microarray, RT-PCR, real-time PCR, Western blot analysis, immunostaining, FACS, etc., using genes or proteins whose expression specifically increases with differentiation as an index Thus, it can be confirmed whether or not differentiation has progressed to a desired cell. The gene or protein used as an indicator can be appropriately determined according to the target of the cell in which differentiation is induced, and the expression level thereof controls the expression level of the housekeeping gene GAPDH, HPRT, or β-actin. Can be used as standardization.

  For example, when bone differentiation is induced using mesenchymal stem cells as stem cells, such bone differentiation is not particularly limited. For example, BMP2, alkaline phosphatase (ALP), osteocalcin (OCN), type I collagen, Runx2, osteopontin (OPN), osteonectin (OSN), bone sialoprotein (BSP) and the like can be confirmed as indicators. For example, when jellyfish collagen is used as a scaffold material in the present invention, it can be confirmed that differentiation into bone is promoted particularly by using BMP2, ALP and OCN. Specifically, the expression of BMP2 is significantly higher than that when conventional mammalian collagen such as porcine collagen or bovine collagen is used. In addition, the expression of ALP and OCN is also significantly increased, and furthermore, the time when both of these markers are confirmed to be highly expressed is significantly earlier than when conventional mammal-derived collagen is used. Here, “significantly” means that a significant difference is shown by statistical processing known per se, and this significant difference is considered by those skilled in the art in consideration of experimental materials, methods, conditions, and the like. Can be confirmed as appropriate. Because of these characteristics, in the present invention, BMP2 can be used as a pro-marker, and its expression is usually observed on the 1st to 12th day of bone differentiation culture, preferably 5th to 10th day, more preferably 7th to 9th day. Can be measured. Further, ALP can be used as a medium-term marker, and its expression can be measured usually on the 7th to 24th day of bone differentiation culture, preferably on the 8th to 21st day, more preferably on the 11th to 21st day. Furthermore, OCN can be used as a late marker, and its expression can usually be measured on the 10th to 30th day of bone differentiation culture, preferably on the 11th to 26th day, more preferably on the 11th to 24th day. By measuring the expression of various markers within the above period, it is possible to accurately determine the progress of bone differentiation and also to determine the progress of bone differentiation.

  The jellyfish collagen in the present invention is not particularly limited, but is preferably immobilized on the surface of a carrier and used as a scaffold material for inducing proliferation and differentiation of stem cells. Examples of the carrier include petri dishes, dishes, microplates, multiplates, chamber slides, tubes, and flasks used for normal cell culture. In order to immobilize jellyfish collagen on these carriers, for example, a solution in which jellyfish collagen is dissolved or suspended in a suitable solvent is prepared, and the jellyfish collagen-containing solution is placed on the carrier, and the temperature is -4 ° C to room temperature. In the temperature range of 30 minutes to overnight. The solvent for dissolving or suspending jellyfish collagen is as described above. The concentration of jellyfish collagen in the solution is usually 0.001 to 0.1% by weight, preferably 0.01 to 0.1% by weight, more preferably 0.01 to 0.05% by weight, and the pH of the solution is usually pH 1.0 to 4.0, preferably Is pH 1.0-3.0, more preferably pH 2.0-3.0. After leaving, the jellyfish collagen-containing solution can be discarded, and the carrier surface can be washed with a phosphate buffer or the like as necessary. The carrier on which jellyfish collagen is solid-phased can be stored as it is at -4 to 20 ° C.

  In the present invention, stem cells can be induced to proliferate and differentiate by culturing a suspension of stem cells on jellyfish collagen, preferably on jellyfish collagen immobilized on a carrier surface as described above. . The solution for suspending stem cells is not particularly limited, but a stem cell culture medium (culture solution) can be preferably used. As such a stem cell medium, a medium known per se suitable for culturing can be used according to the type of stem cell used. The basal medium used is not particularly limited, but for example, MEM medium, α-MEM medium, DMEM medium, Eagle MEM medium, BME medium, IMDM medium, Medium 199 medium, RPMI1640 medium, BGJb medium, CMRL1066 medium, Glasgow MEM medium Improved MEM Zinc Option medium, Ham medium, Fischer's medium, mixed medium thereof and the like. These media may contain serum (eg, fetal bovine serum, human serum, etc.). Alternatively, a serum replacement additive (for example, Knockout Serum Replacement (KSR) (manufactured by Invitrogen)) may be used. The concentration of serum is not particularly limited, but is usually in the range of 5 to 20 (v / v)%.

  Further, the medium may contain additives known per se. Examples of the additive include, but are not particularly limited to, for example, growth factors (such as insulin), iron sources (such as transferrin), minerals (such as sodium selenate), saccharides (such as glucose), organic acids (such as pyruvic acid, Lactic acid etc.), serum proteins (eg albumin etc.), amino acids (eg L-glutamine etc.), reducing agents (eg 2-mercaptoethanol etc.), vitamins (eg ascorbic acid, d-biotin etc.), antibiotics (eg streptomycin, etc.) , Penicillin, gentamicin, etc.), buffering agents (eg, HEPES, etc.) and the like. When stem cells are proliferated, stem cell differentiation inhibitors (eg, LIF, Wnt, TGF-β, bFGF, etc.) are usually used. Each of these additives can be contained within a concentration range known per se.

  When inducing stem cell differentiation, a differentiation-inducing factor is usually added to the medium. Such a differentiation-inducing factor can be appropriately determined according to the stem cell to be used and the target for which the differentiation is induced. For example, when mesenchymal stem cells are used as stem cells and induced to differentiate into bone differentiated cells, immunosuppressive agents such as dexamethasone, tacrolimus and cyclosporine; BMP-2, BMP-4, BMP-5, BMP-6 , Bone morphogenetic proteins such as BMP-7 and BMP-9; osteogenic factors such as TGF-β and the like can be used. These differentiation-inducing factors can be used alone or in combination of two or more. In addition, the concentration of the differentiation-inducing factor added is not particularly limited, and can be within a concentration range known per se.

  The number (density) of stem cells to be seeded can be appropriately set according to the type of stem cells used, the culture method, the culture conditions, the target for inducing stem cell differentiation, and the like. When cell proliferation is performed, the number of cells is usually 10,000 to 500,000 cells / ml, preferably 10,000 to 100,000 cells / ml, more preferably 10,000 to 50,000 cells / ml. In addition, when cell differentiation is induced, the number of cells is usually 100,000 to 1,000,000 cells / ml, preferably 100,000 to 500,000 cells / ml, more preferably 100,000 to 250,000 cells / ml.

Stem cell culture conditions are not particularly limited as long as they are conditions normally used in cell culture techniques. For example, the culture temperature is usually in the range of 30 to 40 ° C, preferably about 37 ° C. The CO ₂ concentration is usually in the range of 1 to 10%, preferably about 5%. The humidity is usually in the range of 70 to 100%, preferably 85 to 95%.

  As described above, differentiated cells can be obtained by using the differentiation induction method of the present invention. Therefore, this invention can also provide the differentiated cell obtained by said method. Such differentiated cells are preferably bone differentiated cells. In addition, the confirmation that bone differentiated cells are obtained by the present invention can be performed by using a method for detecting a calcification component produced by bone differentiated cells, in addition to using the marker gene (or protein) described above. . The detection method is not particularly limited, and examples thereof include von Kossa staining and alizarin red staining.

  Von Kossa staining is a method of detecting calcium phosphate, which is a calcifying component, using silver nitrate. Specifically, 1 to 5% by weight of an aqueous silver nitrate solution is reacted with cells fixed with paraffin or the like. After the reaction, the portion where calcium phosphate is present is colored black by applying light. Bone differentiation can be evaluated by measuring the area of the colored portion.

  Alizarin red staining is a method utilizing the binding of alizarin red S specifically to calcium ions and staining the deposited portion of calcium ions. Specifically, when 0.01 to 5% by weight of alizarin red S solution is reacted with cells fixed with paraffin or the like, a reddish purple to orange red color reaction is observed. Bone differentiation can be evaluated by measuring the area of the colored portion.

  In the present invention, the differentiated cells can be further cultured and expanded to obtain a cell culture. Therefore, the present invention can also provide a cell culture containing differentiated cells (preferably bone differentiated cells) obtained by the above method and jellyfish collagen. As used herein, “cell culture product” refers to a product obtained by culturing cells. The culture method and conditions for differentiated cells for obtaining the cell culture of the present invention can be appropriately set according to the type of cells used. The definitions and embodiments of each term relating to the cell culture of the present invention are the same as those described for the above method.

  The present invention also provides a culture reagent that can be used in the method for inducing differentiation of stem cells as described above.

  The jellyfish collagen mentioned above is used for the culture reagent of this invention, The preparation method is the same as the above. The jellyfish collagen is not particularly limited, but jellyfish-soluble collagen is preferable. In addition, the culture reagent of the present invention is mainly used for culturing cells, and the cells are preferably stem cells, and specific examples relating to stem cells are the same as described above. The culture reagent of the present invention is preferably used for culturing mesenchymal stem cells, more preferably used for inducing proliferation and differentiation of mesenchymal stem cells. It is.

  The form of the culture reagent of the present invention is not particularly limited, and may be, for example, liquid (including slurry), gel, paste, solid (including film), and the like. In addition, the culture reagent of the present invention can be prepared by a method known per se by appropriately using additives such as a pH adjuster. The concentration of jellyfish collagen contained in the culture reagent of the present invention is not particularly limited as long as differentiation induction of stem cells is promoted, but is usually 0.001 to 10% by weight, preferably 0.001 to 1% by weight, and more preferably. Is 0.01 to 1% by weight. The jellyfish collagen contained in the culture reagent of the present invention is preferably jellyfish acid-soluble collagen from the viewpoint that it can be used for inducing differentiation of stem cells.

  One embodiment of the culture reagent of the present invention includes, for example, using a jellyfish collagen-containing solution as a coating agent. The solvent for dissolving or suspending jellyfish collagen is the same as that described in the above differentiation induction method, and the concentration of jellyfish collagen can be the same. The target to which the coating agent is applied is not particularly limited, and examples thereof include carriers (petri dish, dish, etc.) on which the jellyfish collagen shown above can be solid-phased. Moreover, the said coating agent can also be made into a kit in this invention.

  Another embodiment of the culture reagent of the present invention includes a carrier having jellyfish collagen immobilized on the surface thereof. The carrier is the same as the carrier described in the differentiation induction method, and for example, a petri dish, a dish, a microplate, a multiplate, a chamber slide, a tube, and a flask can be used. The method of immobilizing jellyfish collagen on these carriers is also the same as described above, for example, preparing a solution in which jellyfish collagen is dissolved or suspended in a suitable solvent, placing such a jellyfish collagen-containing solution on the carrier, What is necessary is just to stand for 30 minutes-overnight in the temperature range of -4 degreeC-room temperature. The solvent for dissolving or suspending jellyfish collagen is as described above. The concentration of jellyfish collagen in the solution is usually 0.001 to 0.1% by weight, preferably 0.01 to 0.1% by weight, more preferably 0.01 to 0.05% by weight, and the pH of the solution is usually pH 1.0 to 4.0, preferably Is pH 1.0-3.0, more preferably pH 2.0-3.0. After leaving, the jellyfish collagen-containing solution can be discarded, and the carrier surface can be washed with a phosphate buffer or the like as necessary. The carrier on which jellyfish collagen is solid-phased can be stored as it is at -4 to 20 ° C. In addition, such a carrier can be made into a kit in the present invention.

  Still another embodiment of the culture reagent of the present invention includes, for example, a jellyfish collagen immobilized on a carrier such as sponge, mesh, cloth, unclothed cloth, and granular material. Examples of the material of these carriers include synthetic polymer materials such as polylactic acid (PLA), polyglycolic acid (PGA), polylactic glycolic acid (PLGA) and polycaprolactone (PCL); calcium phosphate (for example, β-TCP, Hydroxyapatite and the like) and inorganic materials such as calcium carbonate; natural materials such as coral and ivory. These carriers are preferably porous, and the porosity and pore diameter can be appropriately set according to the type of cells to be cultured, the culture conditions, and the like. These carriers are immersed in the jellyfish collagen-containing solution, for example, and brought into contact with the solution to such an extent that the surface of the carrier is covered, and the temperature ranges from −4 ° C. to room temperature for 30 minutes to 1 hour. The jellyfish collagen can be solidified by allowing it to stand overnight. After leaving, the jellyfish collagen-containing solution and the carrier can be separated, and the carrier surface can be washed with a phosphate buffer or the like, if necessary. Moreover, when a support | carrier is porous, a support | carrier can be immersed in the jellyfish collagen containing solution under reduced pressure, and a solution can fully be contained in the hole of a support | carrier. Furthermore, after that, the support containing the solution can be frozen, and then lyophilized under vacuum and reduced pressure to make the solution contained in the support porous. Further, by making a number of puncture holes in the carrier with an injection needle or the like, the infiltration of the solution can be improved, and a more uniform solid phase can be achieved. The jellyfish collagen solid phase support thus obtained can be stored at -4 to 20 ° C as it is. In addition, such a carrier can be made into a kit in the present invention.

  Moreover, as another embodiment of the culture reagent of this invention, the film-form composition formed by containing a jellyfish collagen is mentioned, for example. Further, the culture reagent of the present invention may be a gel, paste, or cream composition. The composition can be prepared by a method known per se using a gelling agent, a thickener, and the like. As described above, a suspension of stem cells can be prepared, and the suspension can be placed on these culture reagents and cultured to induce proliferation and differentiation of the stem cells. Alternatively, the stem cell suspension can be cultured so as to be embedded in these culture reagents. For example, if the culture reagent of the present invention is in the form of a gel, add a stem cell suspension before the gel solidifies, thoroughly agitate by shaking or the like, and finally solidify the gel to obtain a stem cell suspension. Liquid (stem cells) can be embedded. Even after the culture reagent of the present invention is prepared, the stem cell suspension can be embedded in the culture reagent using, for example, an injection needle. Moreover, the said composition can also be made into a kit in this invention.

  The present invention also provides a kit for inducing bone differentiation of mesenchymal stem cells, comprising the culture reagent and the bone differentiation medium. The bone differentiation medium is not particularly limited as long as it can induce bone differentiation of mesenchymal stem cells. For example, the medium shown in the above differentiation induction method can be used.

  It is preferable that the bone differentiation-inducing kit further includes a substance capable of detecting the expression of a bone differentiation marker gene. The bone differentiation marker is not particularly limited as long as it is a marker that can confirm bone differentiation of mesenchymal stem cells, and for example, the marker shown in the above differentiation induction method can be used. Preferably, BMP2, ALP and OCN bone differentiation markers are used.

  The substance capable of detecting the expression of the bone differentiation marker gene is not particularly limited as long as the presence or absence of the bone differentiation marker gene or the expression level thereof can be confirmed. For example, a nucleic acid probe for the bone differentiation marker gene And primers, and antibodies that can specifically recognize bone differentiation marker proteins can be used. Such nucleic acid probes, primers, antibodies and the like can be prepared by a method known per se. Alternatively, a commercially available product can be used. In addition, detection and measurement of bone differentiation marker gene expression using the above substances can also be performed using methods known to those skilled in the art.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, these are merely examples and do not limit the scope of the present invention.

1. Preparation of jellyfish collagen A jellyfish individual was washed with distilled water and cut into 5 mm to 1 cm square pieces. The cut jellyfish was put into the same amount of 0.2% aqueous sodium chloride solution, and protein extraction was performed at 4 ° C. for 24 hours while stirring. After extraction of the protein, the extract was filtered with gauze and subjected to solid-liquid separation. Three times the amount of local ethanol was added to this extract to obtain a precipitate. The same amount of local ethanol was again added to the precipitate and centrifuged at 10,000 g. The solid matter of the separated precipitate layer was desalted with a dialysis membrane having a molecular weight cut-off (MWCO) of 14000. After dialysis, the mixture was centrifuged again at 10000 g and separated into an upper layer (jellyfish neutral soluble collagen layer) and a precipitate layer (jellyfish acid soluble collagen layer), and each jellyfish collagen was obtained by lyophilization.

2. Proliferation of Mesenchymal Stem Cells Using Jellyfish Collagen Neutral soluble and acid soluble jellyfish collagen prepared as described above were each dissolved in hydrochloric acid at pH 3.0 to 300 μg / ml. After dissolving by inversion for 30 minutes, it was sterilized with a 0.2 μm filter. Thereafter, various jellyfish collagen solutions were added to a 24-well plate at 200 μl / well and coated at room temperature for 2 hours. Subsequently, phosphate buffer was added at 1 ml / well and washed twice. After washing, 1 ml / well of phosphate buffer was added and stored overnight at 4 ° C.
On the other hand, bone marrow fluid was extracted from 2 hind paws of Wistar rats (male, 3 weeks old), and undifferentiated medium (α-MEM (GIBCO, Japan) + 15 (v / v)% FBS (biowest, USA)) (37 ° C, CO ₂ 5%, humidity 90%). The medium was changed every 3 days after isolation, and only the cells attached on the 6th day were collected. Thereafter, confluent cells were subcultured once and then detached with 0.1% trypsin / EDTA, and suspended in an undifferentiated medium so as to be 20,000 cells / well.
The phosphate buffer was removed from the jellyfish collagen-coated plate stored overnight, and the cells obtained as described above were seeded at 20,000 cells / well. The number of cells after culture was measured by trypan blue staining. The result is shown in FIG.
As shown in FIG. 1, the proliferation of mesenchymal stem cells was significantly promoted on jellyfish collagen as compared to the case of no treatment. In particular, on jellyfish neutral soluble collagen, growth was promoted in the early stage of culture, whereas on jellyfish soluble collagen, growth was promoted in the later stage of culture. From these, it was suggested that the action on cells differs depending on the jellyfish collagen fraction.

3. Induction of bone differentiation of mesenchymal stem cells using jellyfish collagen (1) Conditioned cells: Rat bone marrow-derived mesenchymal stem cell medium: Undifferentiated medium (α-MEM (GIBCO, Japan) + 15 (v / v)% FBS (biowest , USA)), bone differentiation medium (α-MEM (GIBCO, Japan) + 3.06 mg / ml β-glycerolphosphate (Calbiochem, Germany) + 14.4 μg / ml ascorbic acid-2-phosphate (SIGMA, Japan) + 39 ng / ml Dexamethasone (SIGMA, Japan) + 10% FBS (biowest, USA))
Culture vessel: 6 well-plate (SMILON, Japan)
Target initial cell number: 200,000cells / well
Scaffolding material:
Porcine type I collagen (Nitta Gelatin: Type IC), diluted with hydrochloric acid at pH 3.0 Jellyfish collagen (jellyfish neutral soluble collagen and jellyfish acid soluble collagen prepared according to 1 above)
Collagen concentration: 300μg / ml

(2) Coating of Jellyfish Collagen and Porcine Type I Collagen on Culture Container Various jellyfish collagens and porcine type I collagen prepared as described above were dissolved in hydrochloric acid at pH 3.0 so as to be 300 μg / ml. After dissolving by inversion for 30 minutes, it was sterilized with a 0.2 μm filter. Various collagen solutions were added to a 6-well plate at 600 μl / well and coated at room temperature for 2 hours. Thereafter, phosphate buffer was added at 2 ml / well and washed twice. After washing, 2 ml / well of phosphate buffer was added and stored overnight at 4 ° C.

(3) Stem cell seeding in collagen-coated culture vessels Bone marrow fluid was extracted from two hind paws of Wistar rats (male, 3 weeks old) and cultured in undifferentiated medium (37 ° C, CO ₂ 5%, humidity) 90%). The medium was changed every 3 days after isolation, and only the cells attached on the 6th day were collected. After 1 passage, proliferated cells (mesenchymal stem cells) were obtained.
The obtained mesenchymal stem cells are collected using an undifferentiated medium, divided into two, centrifuged (1000 rpm, 5 minutes, room temperature), bone differentiation medium is added to one, and undifferentiated to the other Medium was added to adjust the cell density to 20 × 10 ⁴ cells / ml. PBS was removed from the plate prepared in (2) above, a bone differentiation medium or an undifferentiation medium was added, and a cell suspension was further added (cell density in bone differentiation culture: 20 × 10 ⁴ cells / well). The medium was replaced with a new bone differentiation medium every 3 days.

(4) Evaluation of bone differentiation On the 14th day after initiation of bone differentiation induction, alizarin red staining was performed according to the protocol attached to the product (SIGMA, Japan). Alizarin Red S solution is prepared by dissolving 1 g of Alizarin Red S (SIGMA) in 100 ml of distilled water and adding ammonium hydroxide solution (prepared with 0.1 ml of 28% ammonium hydroxide and 100 ml of distilled water) to pH 4.1 to 4.3 It was prepared as follows.
The cells on the 14th day after induction of bone differentiation were washed twice with PBS, 1 ml of formalin was added, and the cells were fixed by leaving for 30 minutes. Thereafter, the plate was washed twice with distilled water, 1 ml / well of the alizarin red S solution was added, and the mixture was allowed to stand at room temperature for 6 minutes for staining. After leaving it, it was washed 4-5 times with distilled water and photographed. The result is shown in FIG.
As shown in FIG. 2, the wells coated with jellyfish collagen were stained more strongly with alizarin than the untreated wells that were not coated at all, and it became clear that bone differentiation was promoted. . In addition, compared with porcine type I collagen, when jellyfish collagen was used, it was more strongly stained with alizarin, and bone differentiation was further promoted. In particular, when jellyfish-soluble collagen was used, bone differentiation was promoted with the highest efficiency.

4). Expression analysis of bone differentiation marker Jellyfish collagen or porcine type I collagen was coated on a culture vessel (6 well plate) in the same manner as in the above 3, and mesenchymal stem cells isolated from rat bone marrow were cultured. At this time, the initial cell density in the bone differentiation culture was 20 × 10 ⁴ cells / well, and the cell density in the undifferentiation culture was 17 × 10 ⁴ cells / well.
Total RNA was extracted from the cells on days 11, 11, 14, 17 and 20 after the start of culture using the phenol / chloroform method. Thereafter, reverse transcription was performed on 1 μg of RNA using a random primer (random hexamer (Invitrogen, UK)), and expression analysis of bone differentiation markers was performed by real-time PCR.
As bone differentiation markers, BMP2 gene was used as an early bone differentiation marker, ALP gene was used as a medium bone differentiation marker, and OCN gene was used as a late bone differentiation marker. GAPDH was used as a housekeeping gene for expression analysis of BMP2 gene and ALP gene, and HPRT was used as a housekeeping gene for expression analysis of OCN gene. Primers and probes for various genes used for real-time PCR were as follows.

BMP2 gene: Rn01484736_m1 (TaqMan Gene Expression Assays, ABI)
ALP gene: Rn00689820_m1 (TaqMan Gene Expression Assays, ABI)
OCN gene: The following primers and probes were purchased from Roche.
Primer (left): atagactccggcgctacctc (SEQ ID NO: 1)
Primer (right): ccaggggatctgggtagg (SEQ ID NO: 2)
Probe: Universal Probelibrary Probe # 125
GAPDH gene: Rn99999916_s1 (TaqMan Gene Expression Assays, ABI)
HPRT gene: The following primers and probes were purchased from Roche.
Primer (left): ctctcgtgccatgtgaacc (SEQ ID NO: 3)
Primer (right): ttctctaaattggtcccaggaa (SEQ ID NO: 4)
Probe: Universal Probelibrary Probe # 95

  The results are shown in FIGS. Regarding the BMP2 gene, it was shown that the expression rate was higher when neutral soluble and acid soluble jellyfish collagen was used than porcine type I collagen at the 8th day after the start of culture. In particular, expression was further enhanced on jellyfish neutral soluble collagen. In addition, the expression rate of ALP gene increased on the 14th day for porcine type I collagen, whereas the expression rate increased on the 8th day for neutral and acid-soluble jellyfish collagen, and was stable until the 14th day. Was shown to do. As for the OCN gene, it was shown that the expression rate increased at an earlier stage when neutral soluble and acid soluble jellyfish collagen was used than porcine type I collagen. As described above, it has been clarified that jellyfish collagen promotes bone differentiation more efficiently from the viewpoint of bone differentiation markers.

  According to the present invention, a safe and highly efficient technique for inducing differentiation of stem cells can be provided, which is useful for human regenerative medicine. Moreover, what was conventionally considered as a waste can be used, can contribute to effective utilization of unused resources, and can provide an inexpensive scaffold material for inducing stem cell differentiation.

Claims (25)

  A method for inducing differentiation of stem cells, comprising a step of differentiating stem cells on jellyfish collagen.   The method according to claim 1, wherein the jellyfish cogen is jellyfish-soluble collagen.   The method according to claim 1, further comprising the step of proliferating the stem cells on jellyfish collagen.   The method according to claim 3, wherein the jellyfish collagen is jellyfish-soluble collagen.   The method according to any one of claims 1 to 4, wherein the stem cells are mesenchymal stem cells and the differentiation is bone differentiation.   The method according to claim 5, further comprising the step of confirming the differentiation status of mesenchymal stem cells by measuring the expression of a bone differentiation marker gene.   The method according to claim 6, wherein the bone differentiation marker is BMP2, ALP and / or OCN.   The method according to claim 7, comprising a step of measuring the expression of the BMP2 gene as an early marker of bone differentiation on days 1 to 12 of the bone differentiation culture.   The method according to claim 7, comprising a step of measuring the expression of the ALP gene as a medium-term marker of bone differentiation on days 7 to 24 of the bone differentiation culture.   The method of Claim 7 including the process of measuring the expression of an OCN gene as a late stage marker of bone differentiation on the 10th-30th days of bone differentiation culture. The method of claim 7 comprising the following steps:
(A) a step of measuring the expression of BMP2 gene as an early marker of bone differentiation on days 1 to 12 of bone differentiation culture;
(B) a step of measuring the expression of ALP gene as an intermediate marker of bone differentiation on days 7 to 24 of bone differentiation culture; and (c) an OCN gene as a late marker of bone differentiation on days 10 to 30 of bone differentiation culture. Measuring the expression of.   A method for producing differentiated cells, wherein the method according to any one of claims 1 to 11 is carried out.   The production method according to claim 12, wherein the differentiated cell is a bone differentiated cell.   A differentiated cell obtained by the method according to claim 12.   A bone differentiated cell obtained by the method according to claim 13.   A cell culture containing the differentiated cells obtained by the method according to claim 12 and jellyfish collagen.   A cell culture containing bone differentiated cells obtained by the method according to claim 13 and jellyfish collagen.   A jellyfish collagen, which is used in the method according to any one of claims 1 to 13.   The jellyfish collagen according to claim 18, which is acid-soluble.   A reagent for culturing stem cell differentiation, comprising jellyfish collagen, which is used in the method according to any one of claims 1 to 13.   The culture reagent according to claim 20, wherein the jellyfish collagen is jellyfish-soluble collagen.   The culture reagent according to claim 20, wherein the stem cell differentiation induction is bone differentiation induction of mesenchymal stem cells.   A kit for inducing bone differentiation of mesenchymal stem cells, comprising the culture reagent according to claim 22 and a bone differentiation medium.   Furthermore, the kit of Claim 23 containing the substance which can detect the expression of a bone differentiation marker gene. The kit according to claim 24, wherein the substance capable of detecting the expression of a bone differentiation marker gene is at least one selected from the group consisting of a nucleic acid probe, a primer and an antibody.