JP2012039881A - SCREENING METHOD USING PLEXIN A2 AS NEW SUBSTRATE OF γ-SECRETASE - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for screening a compound exerting influence on processing of Plexin A2 by γ-secretase.SOLUTION: The method for screening the compound exerting influence on processing of Plexin A2 by γ-secretase includes the following steps: (i) to bring a first biological composition containing γ-secretase or its biologically active fragment into contact with a Plexin second biological composition containing Plexin A2 in the presence and absence of a candidate compound; (ii) to measure cleavage of the Plexin A2 in the presence and absence of the candidate compound, (iii) to select the compound exerting influence on the cleavage of the Plexin A2 by γ-secretase and (iv) to identify the candidate compound obtained by the step (iii) as the compound exerting influence on processing of Plexin A2 by γ-secretase.

Description

  The present invention relates to a screening method using a novel substrate PlexinA2 of γ-secretase and a kit thereof.

  γ-secretase is a complex protein (aspartic protease) containing presenilin, nicastrin, Aph-1 and Pen-2 as basic components. The catalytic domain, presenilin, has been identified as a causative gene for familial Alzheimer's disease (AD). γ-secretase uses a single-transmembrane protein as a substrate. As most representative substrates, amyloid precursor protein (APP) and Notch are known. APP undergoes processing by cleavage of the β-site by β-secretase and cleavage of the γ-site by γ-secretase to form amyloid β protein (Aβ). The produced Aβ is classified into peptides having different lengths depending on the cleavage site of the amino acid (C-terminal side). Of these, Aβ42, which has strong hydrophobicity and is easy to aggregate (easily takes a β-sheet structure), exhibits neurotoxicity, and this phenomenon has been considered to be the main cause of Alzheimer's disease. Recently, however, it has been reported that presenilin 1 (PS1) and presenilin 2 (PS2) double knockout mice that cannot produce any Aβ exhibit AD-like phenotypes such as synapse reduction and neuronal cell death. The existence of the onset of AD has also been suggested (Non-patent Document 1).

  On the other hand, Plexin A2 is one of the receptor family of Semaphorin, and it is known that Semaphorin signal controls synaptic plasticity.

However, it has never been reported that PlexinA2 is a substrate for γ-secretase.
Saura CA, Choi SY, Beglopoulos V, Malkani S, Zhang D, Shankaranarayana Rao BS, Chattarji S, Kelleher RJ 3rd, Kandel ER, Duff K, Kirkwood A, and Shen J. Loss of presenilin function causes impairments of memory and synaptic plasticity followed by age-dependent neurodegeneration. Neuron. 2004 Apr 8; 42 (1): 23-36.

  An object of the present invention is to provide a screening method using a novel substrate PlexinA2 for γ-secretase, and in particular, a method for screening a compound that affects PlexinA2 processing by γ-secretase.

The present inventor confirmed that plexinA2 is cleaved by γ-secretase in HEK293 cells and hippocampal primary cultured neurons, γ-secretase inhibitor (2S) -2-{[(3,5-Difluorophenyl) acetyl] amino} This was demonstrated for the first time by using -N-[(3S) -1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-1,4-benzodiazepin-3-yl] propanamide. It was also found for the first time that cleavage of PlexinA2 can be detected by using an antibody specific for cleaved PlexinA2 or an antibody specific for the C-terminal hemagglutinin tag of PlexinA2.
That is, the present inventor has shown that the cleavage of PlexinA2 is suppressed by a γ-secretase inhibitor, so that PlexinA2 utilizing the degradation activity of γ-secretase on PlexinA2 (particularly, the cleavage promoting activity or the cleavage inhibiting activity). It was shown that the screening method using was effective.
The accelerator for PlexinA2 degradation activity of γ-secretase obtained by the screening method of the present invention is a compound that increases PlexinA2 processing through γ-secretase. Further, the inhibitor of PlexinA2 degradation activity of γ-secretase obtained by the screening method of the present invention is a compound that decreases the processing of PlexinA2 through γ-secretase. According to the present invention, by selecting a compound that selectively acts on γ-secretase, it becomes possible to create a therapeutic agent for a desired memory disorder, particularly dementia (preferably AD).

That is, the present invention provides the following aspects.
An embodiment of the present invention is a method of screening for compounds that affect PlexinA2 processing by γ-secretase. Specifically, (a) an assay step for examining the cleavage of PlexinA2 by γ-secretase, comprising a first biological substance containing γ-secretase or a biologically active fragment thereof in the presence and absence of a candidate compound. Contacting the composition with a second biological composition comprising PlexinA2 of the present invention and measuring the cleavage of the PlexinA2, and (b) whether the compound affects γ-secretase. In the next evaluation step, a candidate compound that affects the cleavage of the PlexinA2 by γ-secretase is selected, and the selected candidate compound is identified as a compound that affects the processing of PlexinA2 by γ-secretase It is a method including a process.

  In another aspect of the present invention, in addition to the above steps, when the undegraded product of PlexinA2 in the presence of the candidate compound is increased compared to the undegraded product of PlexinA2 in the absence of the candidate compound, A screening method comprising the step of evaluating the candidate compound as a compound that inhibits PlexinA2 processing via γ-secretase or an inhibitor of PlexinA2 degradation activity of γ-secretase.

  In another aspect of the present invention, in addition to the above steps, when the undegraded product of PlexinA2 in the presence of the candidate compound is reduced compared to the undegraded product of PlexinA2 in the absence of the candidate compound, It is a screening method comprising evaluating the candidate compound as a compound that promotes PlexinA2 processing via γ-secretase or an accelerator of PlexinA2 degradation activity of γ-secretase.

  In another embodiment of the present invention, in addition to the above steps, when the cleavage product of PlexinA2 in the presence of the candidate compound is increased compared to the cleavage product of PlexinA2 in the absence of the candidate compound, the candidate A screening method comprising a step of evaluating a compound as a compound that promotes PlexinA2 processing via γ-secretase or a promoter of PlexinA2 degradation activity of γ-secretase.

  According to another aspect of the present invention, in addition to the above steps, when the cleavage product of PlexinA2 in the presence of the candidate compound is reduced compared to the cleavage product of PlexinA2 in the absence of the candidate compound, the candidate A screening method comprising evaluating a compound as a compound that inhibits processing of PlexinA2 via γ-secretase or an inhibitor of PlexinA2 degradation activity of γ-secretase.

  In addition to the above method, another embodiment of the present invention further comprises the step of measuring the cleavage of a polypeptide containing APP cleavage site by APP or γ-secretase (polypeptide containing APPγ-secretase cleavage site). Screening method.

  In addition to the above method, another embodiment of the present invention further comprises a step of measuring the cleavage of a polypeptide containing a Notch cleavage site by Notch or γ-secretase (polypeptide containing a Notch γ-secretase cleavage site). This is a screening method.

  Another aspect of the present invention also provides a pharmaceutical composition comprising at least one compound or pharmaceutically acceptable salt identified by the screening method of the present invention and a pharmaceutically acceptable carrier. Preferably, the compound is (2S) -2-{[(3,5-Difluorophenyl) acetyl] amino} -N-[(3S) -1-methyl-2-oxo-5-phenyl-2,3- dihydro-1H-1,4-benzodiazepin-3-yl] propanamide (hereinafter sometimes referred to as “Compound E”).

  Another aspect of the present invention is a method of treating a disease or symptom in which PlexinA2 processing is abnormal by γ-secretase, wherein the patient in need of treatment preferably develops symptoms of dementia (preferably AD). Effective dose of a compound of the present invention or a pharmaceutical composition containing the same, preferably a therapeutic agent for dementia, preferably processing activity of PlexinA2 by γ-secretase in the cells of the patient. A method is provided comprising the step of administering an amount effective to vary.

  Another embodiment of the present invention includes, in addition to the above kit, PlexinA2, preferably a substrate for γ-secretase other than PlexinA2 (preferably APP and / or Notch), which can be used in the method of the present invention. Provided are assay kits for secretases or screening kits for identifying inhibitors or activators of γ-secretase.

  Another aspect of the present invention is a γ-secretase comprising a first biological composition comprising γ-secretase or a biologically active fragment thereof and a second biological composition comprising PlexinA2. A test kit for measuring PlexinA2 processing by is provided.

  According to the present invention, a method for screening a compound that affects PlexinA2 processing by γ-secretase and a kit used for the method are provided. The compound screened according to the present invention can be a therapeutic agent for a desired memory disorder, particularly dementia (preferably AD).

It is a figure which shows the result of Processing analysis using the 293 / EBNA-1 cell line which introduce | transduced PlexinA2 gene, and a hippocampal cultured nerve cell.

Hereinafter, the present invention will be described in detail.
The present invention has been completed by identifying PlexinA2 as one of the substrates of γ-secretase involved in the development of AD. Accordingly, the present invention provides a screening method for AD therapeutics using Plexin A2.

As used herein, “patient” is an animal, preferably a mammal.
As used herein, “mammal” is any mammal classified as a mammal, including a human or non-human mammal (eg, mouse, rat, hamster, guinea pig, rabbit, pig, dog, horse, cow, monkey, etc.). Means animals. Preferably, the mammal herein is a human. In this case, the term “patient” includes adults and children, and includes men and women. Children include newborns, infants and adolescents.

  In the present specification, “γ-secretase” means an enzyme or a complex composed of a plurality of molecules that controls the production of Aβ by cleaving (degrading) APP within its transmembrane region. The plurality of molecules includes at least one molecule of presenilin, nicastrin, Aph-1 or Pen-2. For example, mouse Presenilin1 (NM_008943), rat Presenilin1 (D82363), human Presenilin1 (NM_000021), mouse Presenilin2 (NM_011183), rat Presenilin2 (NM_031087), human Presenilin2 (NM_000447), mouse Nicastrin (NM_021607), 174 Nicastrin Human Nicastrin (NM_015331), mouse Aph-1 (NM_146104), rat Aph-1 (NM_001014255), human Aph-1 (NM_016022), mouse Pen-2 (NM_025498), rat Pen-2 (NM_001008764), human Pen-2 (NM_172341) and the like are included in the γ-secretase of the present invention. As long as γ-secretase of the present invention has at least the same enzyme activity as γ-secretase functioning in vivo, each constituent molecule may be full-length or a partial sequence thereof. The γ-secretase of the present invention may be a mutant of γ-secretase. A variant of γ-secretase may have one to several (preferably one or several) amino acids deleted, substituted, inserted and / or added to each full-length constituent molecule, or a combination thereof. A polypeptide comprising an amino acid sequence and having the same enzymatic activity as γ-secretase which functions in vivo.

In the present specification, “cleavage of PlexinA2” means that PlexinA2 is cleaved by γ-secretase and becomes a fragment shorter than the length before cleavage. “PlexinA2 undegraded product” means a polypeptide produced as a result of PlexinA2 not being cleaved by γ-secretase, and means a product before being degraded by γ-secretase.
In addition, “a biologically active fragment of γ-secretase” is a fragment having the same enzymatic activity as γ-secretase that functions in vivo, for example, a fragment that can cleave APP and PlexinA2. To do.
In the present specification, the term “γ-secretase” may be used including the meaning of “a biologically active fragment of γ-secretase”.

As used herein, “PlexinA2” is a known polypeptide that controls synapse formation and synaptic plasticity (Pasterkamp et al., Curr. Opni. Neurobiol. 2009: 263-74). For example, human PlexinA2 (BC132676, NM_025179), rat PlexinA2 (NM_001105988), mouse PlexinA2 (NM_008882, AK122289), domestic dog (Canis familiaris) PlexinA2 (XM_547389), horse (Equus caballus) PlexinA2 (XM_0014914in, bovine) (XM_584652), chicken (Gallus gallus) PlexinA2 (XM_417985), rhesus monkey (Macaca mulatta) PlexinA2 (XM_001110951, XM_001110980), bovine (Bos Taurus) PlexinA2 (XM_584652), etc. are included in PlexinA2 of the present invention. Preferably, it is PlexinA2 from mammals (eg mouse).

PlexinA2 structurally contains a Semaphorin binding domain, a γ-secretase cleavage site, a transmembrane domain, and a Ras GTPase activation protein domain (Kruger et al., Nature Rev. 2005: 789-800). Its ligand is the Semaphorin family (Kruger et al., Nature Rev. 2005: 789-800).
In the present invention, Plexin A2 may be any of the animal-derived polypeptide, recombinant polypeptide, or synthetic polypeptide.
PlexinA2 of the present invention may be full-length or a partial sequence, as long as it contains at least the γ-secretase cleavage site of PlexinA2.
In the present invention, PlexinA2 may be a mutant of PlexinA2. A variant of PlexinA2 includes an amino acid sequence in which one to plural (preferably one or several) amino acids may be deleted, substituted, inserted and / or added to full-length PlexinA2, or a combination thereof. A polypeptide that is functionally substantially identical to PlexinA2. The “polypeptide functionally substantially identical to PlexinA2” means a polypeptide having an activity of PlexinA2, for example, a cleavage activity depending on γ-secretase.

The gene encoding PlexinA2 and the PlexinA2 polypeptide are included in PlexinA2 of the present invention. Table 1 shows the correspondence between PlexinA2 derived from various animals and the base sequence or amino acid sequence. Table 2 shows the correspondence between γ-secretase derived from various animals and the base sequence or amino acid sequence.

  As used herein, “substitution” preferably means that one or more (preferably one or several) amino acid residues are chemically similar to each other so as not to substantially alter the activity of the peptide. Conservative substitutions that are substituted with amino acid residues. For example, when a certain hydrophobic residue is substituted by another hydrophobic residue, a certain polar residue is substituted by another polar residue having the same charge, and the like. Functionally similar amino acids that can make such substitutions are known in the art for each amino acid. Specific examples include non-polar (hydrophobic) amino acids such as alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Examples of positively charged (basic) amino acids include arginine, histidine, and lysine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

  The number of amino acids that may be deleted, substituted, inserted and / or added is, for example, 1 to 30, preferably 1 to 20, more preferably 1 to 10, still more preferably 1 to 5, Particularly preferably, the number is 1-2.

 Further, the Plexin A2 mutant is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, with the polypeptide represented by SEQ ID NO: shown in Table 1 above. A particularly preferred amino acid sequence having a homology (identity) of 98% or more, and most preferably 99% or more, having substantially the same activity as PlexinA2 (eg, changing the form of post-synapse, in particular γ -A polypeptide having an activity that causes a change dependent on secretase-degrading activity. As long as the PlexinA2 variant is the above polypeptide, it may be any of a polypeptide derived from the animal, a recombinant polypeptide, or a synthetic polypeptide.

  The identity may be a numerical value calculated using a homology search program known to those skilled in the art. For example, the homology algorithm BLAST (Basic local alignment search tool) http of the National Center for Biotechnology Information (NCBI) http: It can be calculated by using default (initial setting) parameters in //www.ncbi.nlm.nih.gov/BLAST/.

Any PlexinA2 derivative containing at least the γ-secretase cleavage site of PlexinA2 is included in PlexinA2 of the present invention. These polypeptides are particularly useful for detecting and purifying Plexin A2.
The Plexin A2 may be in the form of a fusion polypeptide fused with another polypeptide, a polypeptide to which a tag or label is added, or a polypeptide with other modifications. These polypeptides can be obtained by genetic engineering techniques, site-directed mutagenesis, mutagen treatment (eg, hydroxylamine), or automated peptide synthesis.

  Particularly useful systems as the PlexinA2 tagged polypeptide include hemagglutinin (HA) system, glutathione-S-transferase (GST) system, maltose binding protein system, 6 × histidine system, 8 × histidine system and the like.

Examples of modifications that incorporate the label or other detectable moiety include biotin labels, radioactive labels, fluorescent labels, chemiluminescent labels, and the like. Any Plexin A2 of the present invention can be equipped with one, two or more of these labels.
To monitor the cleavage of PlexinA2 by γ-secretase, it recognizes an anti-PlexinA2 antibody, an antibody that recognizes PlexinA2 undegraded product that is generated as a result of PlexinA2 not cleaving, or a PlexinA2 cleavage product that is generated as a result of cleavage of PlexinA2 An antibody, preferably an antibody that recognizes the intracellular region of Plexin A2, and more preferably an antibody that recognizes the C-terminal region of Plexin A2. When detecting a cleavage product or undegraded product of a tagged polypeptide of PlexinA2, an antibody that recognizes the selected tag can be used. For example, when an HA tag is attached to the C-terminus of PlexinA2, it is possible to detect undegraded PlexinA2 or cleavage of PlexinA2 using an anti-HA tag antibody. In this case, it is possible to clarify the presence and concentration of PlexinA2 produced as a result of not cleaving PlexinA2, and the presence and concentration of PlexinA2 produced as a result of cleavage of PlexinA2.
PlexinA2 in a preferred embodiment of the present invention is mouse PlexinA2, for example, a polypeptide comprising the amino acid sequence of SEQ ID NOs: 10 and 12. Further, PlexinA2 in a preferred embodiment of the present invention is a mouse PlexinA2 HA-tagged polypeptide. For example, a polypeptide (SEQ ID NO: 14) further comprising an HA tag at the C-terminus of mouse Plexin A2 (Example 1). Of course, a polypeptide comprising the whole or a part of the human PlexinA2 sequence, for example, the amino acid sequence of SEQ ID NO: 2, 4 or 6, can be used similarly to mouse PlexinA2.

  The present invention further provides a polynucleotide comprising a base sequence encoding the PlexinA2. The polynucleotide encoding PlexinA2 of the present invention is represented by the nucleotide sequence of SEQ ID NO: listed in Table 1, and an example thereof is a polynucleotide encoding mouse PlexinA2 (for example, the polynucleotide of SEQ ID NO: 9 or 11). Furthermore, the polynucleotide encoding PlexinA2 in a preferred embodiment of the present invention is a polynucleotide encoding the HA-tagged polypeptide of mouse PlexinA2. For example, a polynucleotide (SEQ ID NO: 13) encoding a polypeptide further comprising an HA tag at the C-terminus of mouse Plexin A2 (Example 1). Of course, a polynucleotide comprising the whole or a part of the human Plexin A2 sequence, for example, the base sequence of SEQ ID NO: 1, 3 or 5, can be used in the same manner as mouse Plexin A2.

The polynucleotide encoding PlexinA2 of the present invention may be a polynucleotide encoding a mutant of PlexinA2 or a derivative of PlexinA2. For example, the base sequence of SEQ ID NO: shown in Table 1, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, even more preferably 95% or more, particularly preferably 98% or more, and most Preferably, the polynucleotide includes a nucleotide sequence having a nucleotide sequence having 99% or more homology (identity) and encoding a polypeptide having substantially the same activity as PlexinA2.
The polynucleotide encoding PlexinA2 of the present invention hybridizes under stringent conditions with a polynucleotide consisting of a base sequence complementary to the polynucleotide consisting of the base sequence of SEQ ID No. shown in Table 1, and with PlexinA2. A polynucleotide encoding a polypeptide having substantially the same activity is included. Here, the stringent conditions are, for example, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.”, and more stringent conditions. Examples of the conditions include “1 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 50 ° C.”, and the like. More specifically, as a method using Rapid-hyb buffer (Amersham Life Science), pre-hybridization is performed at 68 ° C for 30 minutes or more, and then a probe is added and kept at 68 ° C for 1 hour or more for hybridization. Then, 3 washes for 20 minutes at room temperature in 2 × SSC, 0.1% SDS, 3 washes for 20 minutes at 37 ° C. in 1 × SSC, 0.1% SDS, and finally, 1 × SSC, 0.1 It is also possible to perform 20 minutes of washing at 50 ° C. twice in% SDS. In addition, for example, prehybridization in Expresshyb Hybridization Solution (CLONTECH) at 55 ° C for 30 minutes or more, add labeled probe, incubate at 37-55 ° C for 1 hour or more, in 2 x SSC, 0.1% SDS at room temperature Can be washed 3 times for 20 minutes and 1 time for 20 minutes at 37 ° C. in 1 × SSC, 0.1% SDS. Here, for example, by raising the temperature at the time of pre-hybridization, hybridization or the second washing, more stringent conditions can be obtained. For example, the prehybridization and hybridization temperatures can be 60 ° C., and the stringent conditions can be 68 ° C. Those skilled in the art will consider the conditions such as salt concentration and temperature of the buffer, as well as other conditions such as probe concentration, probe length, reaction time, etc., and PlexinA2 isoforms and allelic variants , And corresponding conditions for obtaining genes from other species.
Such polynucleotides can be obtained by gene amplification techniques, hybridization techniques, gene recombination techniques, and the like.

  In the present specification, the “biological composition” is not particularly limited as long as it is a composition containing γ-secretase or a biologically active fragment thereof, or PlexinA2, for example, a cell-free reconstitution system, a mammal An animal or part thereof, or a transgenic non-human mammal or part thereof engineered to overexpress APP.

As used herein, in “a first biological composition comprising γ-secretase or a biologically active fragment thereof” or “second biological composition comprising PlexinA2,” γ-secretase or PlexinA2 May be endogenous or exogenous.
In the case of endogenous, it is not particularly limited as long as it is a composition containing γ-secretase or PlexinA2 derived from the animal or a part thereof.

  Examples of the part of the animal include the animal tissue, its cells, its cell lysate, its cell membrane fraction, or its purified membrane. Examples of such cells include central nervous system cells, brain-derived neurons, cerebral cortex-derived neurons, cerebral cortex-derived primary cultured neurons, hippocampal-derived primary cultured neurons, or glial cells. Can be mentioned. Further, γ-secretase or Plexin A2 may be contained in a mammal or a part thereof, or may be a γ-secretase fraction or a Plexin A2 fraction of a cell lysate prepared from a mammal. May be. The cell lysate may be prepared, for example, by lysis of cells containing γ-secretase or Plexin A2 with hypotonic solution or detergent, or by ultrasonic disruption or physical disruption. Alternatively, it may be treated with a purification means such as a column.

  When exogenous, when expressed in a host cell using all or a part of each expression vector containing a polynucleotide encoding each molecule constituting γ-secretase or a polynucleotide encoding PlexinA2, γ-secretase-expressing cells or PlexinA2-expressing cells may be used, or γ-secretase fraction of cell lysate derived from γ-secretase-expressing cells or PlexinA2 fraction or cell membrane of cell lysate derived from PlexinA2-expressing cells It may be a fraction. The cell lysate may be prepared, for example, by lysis of cells containing γ-secretase or Plexin A2 with hypotonic solution or detergent, or by ultrasonic disruption or physical disruption. Alternatively, it may be treated with a purification means such as a column. The expression vector may be one that is transformed or transfected into a host cell and transiently expresses the gene, or one that is integrated into the genome of the host cell and stably expresses the gene.

  As used herein, “transformation” or “transfection” means any method of changing the DNA content of a eukaryotic cell or microorganism. Examples include calcium phosphate transfection, protoplast fusion transfection, electroporation transfection, DEAE-dextran-treated transfection, liposome transfection, polybrene transfection, direct microinjection transfection (Sambrook, et al., Molecular Cloning 3). : 16.30-16.31 (1989)).

  The host cell transformed or transfected with the expression vector may be a cell, a cell line or a microorganism capable of expressing a gene, and includes known cultured cells. For example, mammalian cells or cell lines include HEK293 cells, Chinese hamster ovary (CHO) cells, fibroblasts, primary endothelial cells (HUVEC cells), human glioma cells, Hela cells, COS cells, PC12 cells, lymphoblasts Examples of spheres, melanoma cells, hybridoma cells, oocytes, embryonic stem cells, etc., or known microorganisms include, for example, E. coli, yeast, and insect cells (eg, Bmn4 cells).

The expression vector used for the transformation or transfection is not particularly limited as long as it contains a polynucleotide encoding each molecule constituting γ-secretase or a polynucleotide encoding PlexinA2, and it is not limited to the host cell to be used. A plasmid obtained by inserting the polynucleotide into a known expression vector appropriately selected accordingly can be mentioned.
Examples of the expression vector include pUC, pTV, pGEX, pKK, or pTrcHis for E. coli; pEMBLY or pYES2 for yeast; pcDNA3 for CHO cells, HEK293 cells, and COS cells. PMAMneo or pBabe Puro; for BmN4 cells, a vector having a polyhedrin promoter of silkworm nuclear polyhedrosis virus (BmNPV) (for example, pBK283) can be mentioned.

  For example, in mammalian cells, the expression plasmid preferably contains a promoter because the promoter functions effectively to give strong transcriptional activity. For example, promoters include CMV immediate early promoter, retroviral promoter (eg LTR from MLV or MMTV), SV40, RSV LTR, HIV-1 LTR, HIV-2 LTR promoter, adenoviral promoter (eg E1A region, E2A region, MLP region), AAV LTR, cauliflower mosaic virus, HSV-TK, avian sarcoma virus promoter, etc.

  The transformed or transfected host cell is not particularly limited as long as it includes a polynucleotide encoding each molecule constituting γ-secretase or a polynucleotide encoding PlexinA2, for example, the polynucleotide is a host. It can be a transformant integrated into the chromosome of the cell, a transformant contained in the form of a plasmid containing the polynucleotide, or a trait that does not express γ-secretase or PlexinA2. It can also be a converter. The transformant can be obtained, for example, by transforming a desired host cell with the plasmid or with the polynucleotide itself.

  The cells containing γ-secretase and / or PlexinA2 are not particularly limited as long as γ-secretase and / or PlexinA2 can be expressed on the cell membrane surface. For example, endogenous γ-secretase and endogenous Cells expressing sexual PlexinA2, one expressing endogenous and the other exogenous γ-secretase and PlexinA2, or a cell expressing both exogenous γ-secretase and exogenous PlexinA2. Such cells can also be obtained by culturing under conditions that allow expression of γ-secretase and / or PlexinA2. Moreover, by injecting RNA encoding each molecule constituting γ-secretase and / or RNA encoding PlexinA2 into appropriate cells, and culturing under conditions that allow expression of γ-secretase and / or PlexinA2. It can also be obtained.

  The cell membrane fraction can be obtained, for example, by crushing cells expressing the γ-secretase or PlexinA2 of the present invention and then separating a fraction containing a large amount of cell membrane. Examples of cell crushing methods include crushing cells with a homogenizer, crushing with a Waring blender or polytron, crushing with ultrasonic waves, or crushing by ejecting cells from a thin nozzle while applying pressure with a French press. be able to. Examples of the cell membrane fractionation method include a fractionation method using centrifugal force, such as a fractional centrifugation method or a density gradient centrifugation method.

  For purification, a known protein purification method can be used. The method includes, as one step, an operation of roughly fractionating cells into a polypeptide fraction and a non-polypeptide fraction. After the γ-secretase or PlexinA2 of the present invention is separated from other polypeptides by a column or the like, the desired γ-secretase or PlexinA2 is further purified using a chromatographic method or an electrophoretic method, and partially or completely purified. (Or homogenization by purification). Analytical methods particularly suitable for the preparation and purification of pure peptides are, for example, precipitation with ammonium sulfate, PEG, antibodies, etc., or centrifugation after heat denaturation; chromatography steps (eg ion exchange chromatography, gel filtration chromatography) , Reverse phase chromatography, hydroxylapatite chromatography, affinity chromatography, high performance protein liquid chromatography (FPLC), high performance liquid chromatography (HPLC) or immobilized metal affinity chromatography (IMAC)), isoelectric focusing, gel electrophoresis , SDS (Sodium dodecyl sulfate) -polyacrylamide gel electrophoresis (SDS-PAGE), and combinations of these methods with other methods. Alternatively, tag the γ-secretase or PlexinA2 in advance, and pass it through a purification column to which the protein that recognizes the tag is bound, so that the desired γ-secretase or PlexinA2 is adsorbed in the column, Purify by desorbing from the column by flowing solvent. The order in which the various purification steps are performed may be changed, or some steps may be omitted. One preferred method of assessing the purity of the fraction is to calculate the specific activity of the fraction, compare it to the specific activity of the original extract, and calculate and evaluate the magnitude of purity.

  As used herein, “APP” means β-amyloid precursor protein (βAPP) or a mutant thereof. APP is a single-transmembrane protein expressed in a wide variety of cells of many mammals, and means a peptide containing an Aβ region in its C-terminal region. APP is encoded by the gene of the same name located in the long arm of chromosome 21 in humans, and there are three major isotypes (APP695, APP751 and APP770). APP695, APP751 and APP770 consist of 695, 751 and 770 amino acid residues, respectively. For example, human APP695 (NM_201414, NP_958817, P05067-4), human APP751 (NM_201413, NP_958816, P05067-8), human APP770 (NM_000484, NP_000475, P05067-1, P05067), mouse APP695 (NM_007471, NP_031497, P12023-2) ), Mouse APP751 (P12023-3), mouse APP770 (AY267348, AAP23169, P12023-1, P12023), rat APP695 (P08592-2), rat APP751 (P08592-7), rat APP770 (NM_019288, NP_062161, P08592-1) , P08592). APP mutants include Swedish FAD double mutant, London mutant, valine 717 → phenylalanine mutant, valine 717 → isoleucine mutant, valine 717 → glycine mutant.

  As used herein, “Aβ” means the terms β-amyloid protein, amyloid β protein, β-amyloid peptide, amyloid β peptide or amyloid beta. For example, Aβ is a peptide consisting of about 33 to about 44 amino acid residues of the human APP695 amino acid isotype, and preferably any peptide containing some or all of the amino acid residues at positions 597 to 640 of APP. Including means all peptides produced by N-terminal proteolysis of APP followed by C-terminal proteolysis. Aβ40 and Aβ42 are peptides containing 40 amino acid residues and 42 amino acid residues, respectively.

  As used herein, “Notch” is a competing substrate for γ-secretase belonging to the Notch family of cell surface receptors. Examples include human notch 1 (AF308602.1), mouse notch 1 (NM_008714.2), and rat notch 1 (NM_001105721.1). Since Notch-1 plays an important function in hematopoiesis, suppressing Notch-1 processing can lead to immunodeficiency and anemia.

  As used herein, “candidate compound” means a substance to be tested in a compound screening method. The candidate compound can be any molecule, but is preferably any compound that can alter the activity of γ-secretase, preferably the activity of mammalian γ-secretase. Candidate compounds are released by, for example, gene library expression products, natural or synthetic small molecule libraries, nucleic acids (oligo DNA, oligo RNA), natural or synthetic peptide libraries, antibodies, bacterial release materials (bacterial metabolism) Substance), cell (microbe, plant cell, animal cell) extract, cell (microbe, plant cell, animal cell) culture supernatant, purified or partially purified peptide, extract from marine organism, plant or animal, One or more compounds contained in soil, a random phage peptide display library. The compound may be a novel compound or a known compound.

In addition, the compounds may be modified by conventional chemical, physical and / or biochemical means such as direct chemical modification such as acylation, alkylation, esterification, amidation, etc. Alternatively, it may be changed to a structural analog by random chemical modification. The compound may be a compound identified by a pharmacophore search for the compound, a structure comparison program using a computer, or the like. The candidate compound may form a salt, and the candidate compound and the salt thereof may form a solvate (including a hydrate).
Further, the candidate compound may be a known γ-secretase promoter or γ-secretase inhibitor related to APP processing and / or Notch processing, or a structural analog thereof. Known compounds that promote or inhibit γ-secretase activity and / or APP processing and / or Notch processing may be compounds that can be designed through rational drug design. For example, DAPT (N- [N- (3,5-difluorophenacetyl) -L-alanyl] -S-phenylglycine t-butyl ester), CM256, (2S) -2-{[(3,5-Difluorophenyl) acetyl] amino } -N-[(3S) -1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-1,4-benzodiazepin-3-yl] propanamide (Alexis Biochemicals).

  In the present specification, “a compound that affects the processing of PlexinA2 by γ-secretase” means a compound that inhibits the cleavage activity of PlexinA2 by γ-secretase (γ-secretase inhibitor), or the cleavage activity of PlexinA2 by γ-secretase Means any of the compounds (γ-secretase promoter) that promotes Here, the γ-secretase inhibitor includes an antagonist, and the γ-secretase promoter includes an agonist. γ-secretase inhibitors and γ-secretase promoters also include compounds that alter the cleavage site of the PlexinA2 cleavage product of γ-secretase to produce PlexinA2 cleavage products of different peptide lengths.

  As used herein, the term “salt” refers to a pharmaceutically acceptable salt and is not particularly limited as long as it forms a pharmaceutically acceptable salt with the compound. Specifically, for example, preferably a hydrohalide (eg, hydrofluoride, hydrochloride, hydrobromide, hydroiodide, etc.), an inorganic acid salt (eg, sulfate, nitrate, perchlorate) Acid salt, phosphate, carbonate, bicarbonate, etc.), organic carboxylate (eg acetate, oxalate, maleate, tartrate, fumarate, citrate, etc.), organic sulfonate (Eg methane sulfonate, trifluoromethane sulfonate, ethane sulfonate, benzene sulfonate, toluene sulfonate, camphor sulfonate, etc.), amino acid salts (eg aspartate, glutamate, etc.), quaternary Amine salt, alkali metal salt (eg lithium salt, sodium salt, potassium salt etc.), alkaline earth metal salt (eg magnesium salt, calcium salt) And the like) and the like.

According to the first aspect of the present invention, (a) an assay for examining cleavage of Plexin A2, and (b) secondary evaluation of whether or not the compound affects γ-secretase using such an assay. (Screening method) is provided. The following methods are provided as the method of the present invention. The method of the present invention is characterized by utilizing a novel substrate PlexinA2 for γ-secretase. The method of the present invention can be carried out in a suitable cell line in vitro or in a cell-free system (a cell-free system).
In the first embodiment of the present invention, γ-secretase and PlexinA2 are incubated in the presence or absence of a candidate compound, and cleavage of PlexinA2 by γ-secretase can be evaluated.

The method of screening for a compound that affects PlexinA2 processing by γ-secretase, which is the first embodiment, includes the following steps (steps).
(i) a first biological composition comprising γ-secretase or a biologically active fragment thereof in the presence and absence of a candidate compound, and a second biological composition comprising PlexinA2. Contact;
(ii) measuring the cleavage of the Plexin A2 in the presence and absence of the candidate compound, respectively;
(iii) selecting the candidate compound that affects the cleavage of the PlexinA2 by γ-secretase; and
(iv) The candidate compound selected in (iii) above is identified as a compound that affects the processing of Plexin A2 by γ-secretase.

The method of this embodiment can be carried out in an appropriate cell line containing γ-secretase and PlexinA2, or a cell-free system containing γ-secretase and PlexinA2 (a system not containing cells).
The cell line containing γ-secretase and PlexinA2 may be an endogenous gene-expressing cell line, or any cell line containing a foreign gene. By culturing cells containing γ-secretase and PlexinA2 in an appropriate medium in the presence or absence of the candidate compound and incubating under reaction conditions that allow cleavage of PlexinA2 by γ-secretase activity, γ-secretase is A first biological composition comprising can be contacted with a second biological composition comprising PlexinA2. In the case of a cell line containing an exogenous gene, the contact can be carried out under culture conditions that allow the gene to be expressed. Conditions under which other γ-secretase substrates are cleaved, such as reaction conditions known to those skilled in the art when the substrate is APP, can also be applied.

Examples of reaction conditions are given below. In the endogenous gene-expressing cell line, in the case of primary cultured neurons, for example, in MEM (Invitrogen) medium, 5% FBS (Hyclone), 1X B27 Supplement (Invitrogen), 0.5 mM L-Glutamine (Invitrogen), 25 μg / ml Culture conditions of 5% CO ₂ and 37 ° C. with addition of Insulin (SIGMA) and 8 μM AraC (SIGMA). In a system containing an exogenous gene, in the case of the HEK293 cell line, for example, the culture conditions are 10% FBS (Hyclone) / DMEM (Invitrogen), 5% CO ₂ and 37 ° C.
In a cell-free system, a first biological composition comprising γ-secretase or a biologically active fragment thereof (eg, a cell membrane fraction containing γ-secretase) in the presence and absence of a candidate compound. Can be brought into contact by incubating the mixture with a second biological composition containing PlexinA2 (eg, a cell membrane fraction containing PlexinA2). These are reaction conditions that enable cleavage of Plexin A2 by γ-secretase activity, such as 10 mM HEPES, pH 7.4, 150 mM NaCl, 10% glycerol, 5 mM EDTA, 5 mM 1,10-phenanthroline, 10 μg / ml phosphoramidon , Complete protease inhibitor cocktail (Roche Biochemicals) (Tomita et al., Molecular Neurodegeneration 2006 1: 2), or conditions under which other γ-secretase substrates are cleaved, such as when the substrate is APP. Reaction conditions known to those skilled in the art can be applied and mixed. The γ-secretase or PlexinA2 may be a purified γ-secretase or PlexinA2, a biologically active fragment thereof, an analog thereof, or a variant thereof.
By contacting the first biological composition containing γ-secretase and the second biological composition containing PlexinA2 as described above, a cleavage reaction of PlexinA2 by γ-secretase occurs.

  Candidate compounds can generally be added at concentrations ranging from about 1 nM to 1 mM, usually from about 10 μM to 1 mM. In order to identify a compound that changes the PlexinA2 cleavage activity of γ-secretase, the above steps were performed in the presence and absence of the candidate compound, and the PlexinA2 cleavage activity of γ-secretase in the presence of the candidate compound was determined. A compound that alters the cleavage of PlexinA2 by γ-secretase is identified by assessing the ability of the candidate compound by comparing it with the activity in the absence of the candidate compound. Any change in the amount or degree of PlexinA2 in the presence of the candidate compound is an indicator that the PlexinA2 cleavage activity of γ-secretase has changed in the presence of the candidate compound. Can be identified as compounds that affect the processing of PlexinA2. For example, a compound that increases the PlexinA2 cleavage product or decreases the PlexinA2 undegraded product compared to the control is evaluated as an accelerator for the PlexinA2 degradation activity of γ-secretase. On the other hand, a compound that decreases PlexinA2 cleavage product or a compound that increases PlexinA2 undegraded product compared to control is evaluated as an inhibitor of PlexinA2 degradation activity of γ-secretase. The accelerator for PlexinA2 degradation activity obtained by the method of the present invention may be useful for the treatment of AD.

When PlexinA2 is tagged, an undegraded product of PlexinA2 or a cleavage product of PlexinA2 can be detected using a conjugate with the tag, such as an antibody. For example, in the case of a peptide having a hemagglutinin tag attached to the C-terminus of Plexin A2, it can be detected with a known anti-HA antibody.
Analysis of cleavage of PlexinA2 is performed by measuring an index indicating cleavage of one or both of the N-terminal fragment and the C-terminal fragment of PlexinA2.
Analysis of Cleavage of PlexinA2 by γ-secretase is based on anti-PlexinA2 antibody, an antibody that recognizes PlexinA2 derivative (PlexinA2 undegraded product) that is produced as a result of not cleaving PlexinA2, or PlexinA2 is not degraded. An antibody that recognizes a PlexinA2 cleavage product produced as a result of cleavage or an antibody that recognizes an intracellular region of PlexinA2 can be used.

Here, when detecting a PlexinA2 tagged undegraded product and / or a PlexinA2 tagged cleavage product, an antibody against the selected tag can be used.
For example, when an undegraded product of PlexinA2 polypeptide is detected, an HA tag is attached to the C terminus of the PlexinA2 polypeptide, and detection can be performed using an anti-HA tag antibody. In this case, by detecting or quantifying the HA tag, the presence and concentration of the C-terminus of PlexinA2 produced as an undegraded product of PlexinA2 can be clarified. When PlexinA2 or tagged PlexinA2 is labeled, it can be detected by detecting or quantifying the label.
On the other hand, when detecting the cleavage product of PlexinA2 polypeptide, the membrane fraction is purified from cells that express PlexinA2, and the purified membrane fraction is used for cleavage reaction with γ-secretase to cleave PlexinA2. The product is released from the membrane fraction. When this reaction product is centrifuged, the undegraded PlexinA2 precipitates into the membrane fraction, so it can be distinguished from the membrane fraction and other fractions, and the PlexinA2 cleavage product can be detected by detecting the released fragments. Can be detected. For this detection, in the case of endogenous Plexin A2, an antibody that recognizes the intracellular region of Plexin A2 is used, and in the case of using exogenous recombinant Plexin A2, recombinant Plexin A2 using a cDNA with a tag sequence added to the C terminus. And the PlexinA2 cleavage product is detected using an antibody that recognizes the tag. The tag is not particularly limited. For example, HA, Myc, FLAG, etc. can be used.

The PlexinA2 antibody is not particularly limited as long as it recognizes PlexinA2, but is preferably an antibody that recognizes the intracellular region of PlexinA2.
An antibody recognizing PlexinA2 can be produced by a person skilled in the art according to an existing general production method for monoclonal antibodies after immunizing an immunogen (antigen). As the immunogen, PlexinA2 or a fragment thereof, or a fusion protein to which a tag or a label is added can be used.
For example, the antigen is immunized to a non-human mammal with Freund's Adjuvant as necessary. Polyclonal antibodies can be obtained from serum obtained from the immunized animal. A monoclonal antibody is prepared by preparing a fusion cell (hybridoma) from the antibody-producing cell obtained from the immunized animal and a myeloma cell (myeloma cell) having no autoantibody-producing ability, cloning the hybridoma, It is produced by selecting clones that produce monoclonal antibodies that show specific affinity for the antigens used to immunize animals. The monoclonal antibody is produced from the hybridoma in vitro, or in vivo in a non-human mammal, preferably a mouse or rat, more preferably a mouse ascites, or the obtained culture supernatant, or the relevant It can be carried out by isolation from ascites of mammals. For the isolation and purification of monoclonal antibodies, the above-described culture supernatant or ascites can be obtained by using saturated ammonium sulfate, Euglobulin precipitation method, caproic acid method, caprylic acid method, ion exchange chromatography (DEAE or DE52, etc.), anti-immunoglobulin column or It can be performed by subjecting to affinity column chromatography such as a protein A column. The monoclonal antibody includes a heavy chain and / or a light chain having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequences of the heavy chain and / or light chain constituting the antibody. Monoclonal antibodies consisting of chains are also included.

In another embodiment of the present invention, whether or not a candidate compound affects APP and / or notch processing in parallel with, simultaneously with, or in parallel with the first embodiment of the present invention described above. Can be evaluated. For example, in parallel with or simultaneously with the above-described method of the present invention, the cleavage of a polypeptide containing a cleavage site of APP or APP by γ-secretase (polypeptide containing APPγ-secretase cleavage site) is measured. Steps may be included. Furthermore, the method may further comprise the step of measuring the cleavage of Notch or a polypeptide containing a Notch cleavage site by γ-secretase (polypeptide containing a Notch γ-secretase cleavage site).
Thereby, for example, it can be evaluated whether a candidate compound selectively affects the processing of PlexinA2 as compared with the processing of APP and / or Notch. The term “selective action” means that the cleavage of the substrate PlexinA2 by γ-secretase has a more suppressive effect or a promoting effect than the cleavage of other substrates. According to this embodiment, specifically, a compound that selectively acts only on PlexinA2 processing, a compound that selectively acts only on APP processing, or a compound that selectively acts only on Notch processing, or APP and PlexinA2 Compounds that selectively act on the processing of can be identified.

  As a drug discovery candidate compound, a compound that acts in the same manner as the metabolic activity in vivo of a healthy animal or a compound that regulates the metabolism is preferable. For example, a compound that suppresses the production of Aβ42 by suppressing APP cleavage activity by γ-secretase, does not suppress PlexinA2 cleavage activity by γ-secretase, and does not suppress Notch cleavage activity by γ-secretase is preferable. In addition, for example, the promotion of APP cleavage activity by γ-secretase promotes the production of Aβ40 and suppresses the production of Aβ42, the promotion of PlexinA2 cleavage activity by γ-secretase promotes the processing of PlexinA2, and the increase by γ-secretase. Compounds that do not inhibit Notch cleavage activity are preferred.

  Assay methods known to those skilled in the art can be applied to the method for measuring the cleavage of APP, Notch, or a polypeptide containing a γ-secretase cleavage site of APP or Notch by this γ-secretase (Song et al. PNAS 1999 96 6959-6963, Moehlmann et al. PNAS 2002 99 8025-8030). For example, a first biological composition comprising γ-secretase or a biologically active fragment thereof in the presence and absence of a candidate compound comprises a polypeptide comprising an APP or APP γ-secretase cleavage site. A biological composition, or a biological composition comprising a polypeptide comprising a Notch or Notch γ-secretase cleavage site, and the polypeptide comprising the APP or APPγ-secretase cleavage site, or Notch or Notch γ-secretase Cleavage of the polypeptide containing the cleavage site can be measured. The measurement may be performed by measuring a cleavage product of a polypeptide containing an APP or APPγ-secretase cleavage site, or a polypeptide containing a Notch or Notch γ-secretase cleavage site. For example, a cleavage product of a polypeptide containing an APP or APPγ-secretase cleavage site includes Aβ, the amount of which is measured, and the quantitative variation in the presence and absence of the candidate compound may be compared. In addition, using a known antibody that recognizes the cleavage product of a polypeptide containing an APP or APPγ-secretase cleavage site, or a polypeptide containing a Notch or Notch γ-secretase cleavage site, the degree of cleavage and the amount of the cleavage product are measured. be able to. A commercially available product (SIGMA, Chemicon) can be used as an antibody that recognizes a cleavage product of a polypeptide containing an APP or APPγ-secretase cleavage site. The measuring method can be performed by Western Blot, for example. A commercially available product (Santacruze) can be used as an antibody that recognizes a cleavage product of a polypeptide containing a Notch or Notch γ-secretase cleavage site. The measuring method can be performed by Western Blot, for example.

  The method of the present invention also includes a method of evaluating the post-synaptic morphology or the function of neurotransmission using the compound identified by the method of the present invention. For example, the post-synaptic morphology evaluation is a method of evaluating the number of spines (Spine), which are small thorn-shaped ridges on dendrites, and the spine shape (Pak D et al. Neuron 2001 31. 289-303). In addition, the evaluation of the neurotransmitter function is a method of evaluating electrical changes occurring on the synaptic membrane using, for example, cultured cells and cultured slices (Saura et al., Neuron 2004 42 23-36).

The methods of the present invention also include high throughput screening (HTS) methods known to those skilled in the art for testing a large number of compounds simultaneously (US5876946, US5902732, Jayawickreme and Kost, Curr. Opin. Biotechnol., 8, pp. 629-634, 1997, Houston and Banks, Curr. Opin. Biotechnol., 8, pp. 734-740, 1997).
The method of the present invention includes the use of a known model animal. A compound selected by the in vitro method of the present invention can be analyzed for its effects in vivo using, for example, APP processing and / or a non-human model of AD. For example, APP transgenic non-human animal models are well known in the art, such as Tg2576 mice (J. Neurosci. 21 (2), 372-381, 2001, J. Clin. Invest., 112, 440-449, 2003). It is. For example, DAPT, a (2S) -2-{[(3,5-Difluorophenyl) acetyl] amino} -N-[(3S) -1-methyl-2-oxo, a known γ-secretase inhibitor in Tg2576 mice -5-phenyl-2,3-dihydro-1H-1,4-benzodiazepin-3-yl] propanamide (Alexis Biochemicals), or in the brain, cerebrospinal fluid, and serum when the compound of the present invention is administered Evaluation by the method of measuring the amount of each Aβ (J. Pharmacol. Exp. Ther. 305, 864-871, 2003), changes in the brain that the activity of γ-secretase has changed (for example, changes in the production of Aβ, Pathological examination of the degree of atrophy), methods of assessing survival, exercise, or food intake.

A pharmaceutical composition comprising a compound identified by the method of the present invention, preferably the AD therapeutic agent of the present invention, can be administered to a patient in various forms, oral or parenteral (eg, intravenous injection, intramuscular injection, subcutaneous administration, rectal administration, It can be administered by any route of administration such as transdermal administration. Accordingly, the pharmaceutical composition containing the compound of the present invention can be used alone, but can be formulated into an appropriate dosage form using a pharmaceutically acceptable carrier by a method conventionally used depending on the administration route. It is possible to
Preferred dosage forms include tablets, powders, fine granules, granules, coated tablets, capsules, syrups, lozenges, oral preparations, inhalants, suppositories, injections (including drops), and ointments. And parenteral preparations such as eye drops, eye drops, eye ointments, nasal drops, ear drops, poultices, lotions, and liposomes.

Carriers used for formulating these preparations include, for example, commonly used excipients, binders, disintegrants, lubricants, colorants, flavoring agents, and if necessary, stabilizers, emulsifiers, absorption promoters, Surfactants, pH adjusters, preservatives, antioxidants, bulking agents, wetting agents, surface activators, dispersants, buffers, preservatives, solubilizers, soothing agents, etc. can be used In general, it is possible to formulate by a conventional method by blending components used as raw materials for pharmaceutical preparations. Non-toxic components that can be used include, for example, animal and vegetable oils such as soybean oil, beef tallow and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane and solid paraffin; esters such as octyldodecyl myristate and isopropyl myristate Oils; higher alcohols such as cetostearyl alcohol and behenyl alcohol; silicone resins; silicon oils; eg polyoxyethylene fatty acid esters, sorbitan fatty acid esters, glycerin fatty acid esters, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene hydrogenated castor oil, polyoxyethylene -Surfactants such as polyoxypropylene block copolymers; for example, hydroxyethyl cellulose, polyacrylic acid, carboxyvinyl polymer, polyester Water-soluble polymers such as ethylene glycol, polyvinyl pyrrolidone and methyl cellulose; lower alcohols such as ethanol and isopropanol; polyhydric alcohols (polyols) such as glycerin, propylene glycol, dipropylene glycol, sorbitol and polyethylene glycol; Examples thereof include sugars such as sugar; inorganic powders such as silicic anhydride, magnesium aluminum silicate, and aluminum silicate; inorganic salts such as sodium chloride and sodium phosphate; and purified water.

Examples of excipients include lactose, fructose, corn starch, sucrose, glucose, mannitol, sorbitol, crystalline cellulose, and silicon dioxide.Examples of binders include polyvinyl alcohol, polyvinyl ether, methyl cellulose, ethyl cellulose, gum arabic, tragacanth, Gelatin, shellac, hydroxypropylmethylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, polypropylene glycol polyoxyethylene block polymer, meglumine, etc. are disintegrants such as starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, hydrogen carbonate Sodium, calcium citrate, dextrin, pectin, carboxymethylcellulose / calcium, etc. Magnesium allate, talc, polyethylene glycol, silica, hydrogenated vegetable oil, etc. are permitted to be added to pharmaceuticals as coloring agents, but as flavoring agents, cocoa powder, mint brain, aroma powder, mint oil , Borneolum, cinnamon powder, etc. are used respectively. The above components may be their salts or solvates thereof.

  For example, an oral preparation is prepared by adding excipients to the compound of the present invention, and if necessary, for example, a binder, a disintegrant, a lubricant, a coloring agent, a flavoring agent, etc. Agents, granules, tablets, coated tablets, capsules, etc. In the case of tablets / granules, for example, sugar coating or other appropriate coating may be used if necessary. In the case of a syrup or a preparation for injection, it is formulated by a conventional method with, for example, a pH adjuster, a solubilizer, an isotonic agent and the like, and if necessary, a solubilizing agent, a stabilizer and the like. Moreover, in the case of an external preparation, a manufacturing method in particular is not limited, It can manufacture by a conventional method. As the base material to be used, various raw materials usually used for pharmaceuticals, quasi drugs, cosmetics, etc. can be used. For example, animal and vegetable oils, mineral oils, ester oils, waxes, higher alcohols, fatty acids , Silicone oils, surfactants, phospholipids, alcohols, polyhydric alcohols, water-soluble polymers, clay minerals, purified water, etc., pH adjusters, antioxidants as necessary Agents, chelating agents, antiseptic / antifungal agents, coloring agents, fragrances and the like can be added. Furthermore, components such as blood flow promoters, bactericides, anti-inflammatory agents, cell activators, vitamins, amino acids, humectants, and keratolytic agents can be blended as necessary. The ratio of the active ingredient to the carrier at this time can vary between 1 and 90% by weight. When the compounds used in the present invention, the peptides used in the present invention or the polynucleotides used in the present invention are used for the treatment, at least 90% or more, preferably 95% or more, more preferably 98% or more. Further, it is preferable to use those purified to 99% or more.

The effective dosage of the pharmaceutical composition of the present invention containing the compound of the present invention varies depending on, for example, the degree of symptoms, age, sex, body weight, dosage form, type of salt, specific type of disease, etc. In general, for adults, the body weight is 60 kg, and the daily oral administration is about 30 μg to 10 g, preferably 100 μg to 5 g, more preferably 100 μg to 100 mg. 30 μg to 1 g, preferably 100 μg to 500 mg, more preferably 100 μg to 30 mg are each administered in one or several divided doses. Given the differing efficiencies of the routes of administration, the required dosage is expected to vary widely. For example, oral administration is expected to require a higher dose than administration by intravenous injection. When administered to children, the dose may be less than that administered to adults. These dosage level variations can be adjusted using standard empirical optimization procedures, as is well understood in the art.

As used herein, “treatment” generally means obtaining a desired pharmacological and / or physiological effect. The effect is prophylactic in terms of completely or partially preventing the disease and / or symptoms and therapeutic in terms of partial or complete cure of the adverse effects caused by the disease and / or disease. As used herein, “treatment” includes any treatment of a disease of a patient, particularly a human, and includes, for example, at least one of the following treatments (a) to (c):
(A) prevent the occurrence of a disease or symptom in a patient who may have a predisposition to the disease or symptom but has not yet been diagnosed;
(B) inhibit disease symptoms, ie prevent or delay its progression;
(C) Alleviating disease symptoms, ie, causing the disease or symptom to regress, disappear, or reverse the progression of the symptom.

  For example, clinical symptoms of Alzheimer's disease (AD) include progressive disorientation, memory loss, and aphasia, eventually resulting in incapacity, language loss, and ataxia. Pathological signs of AD include, for example, the presence of neurofibrillary tangles, senile plaques and amyloid angiopathy. Preventing AD progression is taken to mean preventing the onset or further progression of AD clinical symptoms and / or pathological signs. For example, patients who do not have clinical symptoms or pathological signs of AD can prevent the progression of clinical symptoms or pathological signs. Furthermore, patients with mild AD can prevent the development of more severe AD forms. Delaying AD progression delays the onset of AD-related symptoms and / or pathological signs or slows the rate of AD progression as determined by the rate of progression of clinical symptoms and pathological signs Is meant to mean Reversing AD progression is taken to mean reducing the severity of AD symptoms, that is, changing the patient's AD symptoms from severe to milder. In so doing, a change to mild is indicated by a decrease in clinical symptoms or pathological signs.

  A patient's AD diagnosis can be implemented using various well-known methods. Typically, clinical and pathological assessments are combined to diagnose AD. For example, the progression or severity of AD is measured by the Mini Mental State Examination (MMSE) (Mohs et al. (1996) Int Psychogeriatr 8: 195-203), Alzheimer's Disease Assessment Scale-Cognitive Factor (ADAS-cog) (Galasko et al. (1997) Alzheimer Dis Assoc Disord, 11 suppl 2: S33-9), Alzheimer's disease collaborative research-Daily life movement scale (ADCS-ADL) (McKhann et al. (1984) Neurology 34: 939-944), National Neurology National Institute of Neurologic Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria (Folstein et al. (1975) J Psychiatr Res 12: 189- 198, McKhann et al. (1984) Neurology 34: 939-944,). In addition, methods can be used to evaluate different areas of the brain and allow estimation of the frequency of senile plaques and neurofibrillary tangles (Braak et al. (1991) Acta Neuropathol 82: 239-259; Khachaturian (1985) Arch Neuro 42: 1097-1105; Mirra et al. (1991) Neurology 41: 479-486; and Mirra et al. (1993) Arch Pathol Lab Med 117: 132-144).

  Another aspect of the present invention is a kit for assaying γ-secretase, or an inhibitor of γ-secretase, comprising PlexinA2, preferably further comprising a substrate of γ-secretase other than PlexinA2, preferably APP and / or Notch , Kits for identifying active agents or modulators are provided. The kit of this embodiment can be used for the screening method of the present invention.

The present invention provides a test kit for measuring PlexinA2 processing by γ-secretase. The kit of the present invention comprises γ-secretase or a biological composition containing the same and a biological composition containing PlexinA2. Further, the kit may contain a substrate of γ-secretase other than PlexinA2 (for example, APP and / or Notch), or a biological composition containing the same. The kit preferably includes a plurality of γ-secretase substrates, and preferably includes APP and / or Notch in addition to PlexinA2. Further, the kit includes instruments (for example, reaction vessels, blotting membranes, etc.), reagents (for example, buffer solution, culture solution, anti-Plexin A2 antibody, etc.), instructions, etc. used for immunoblotting and Western blotting techniques. . The assay kit of the present invention makes it possible to evaluate whether a candidate compound acts on PlexinA2 processing by γ-secretase.

  The present invention also includes the use of the kit for measurement of PlexinA2 processing, a method for screening or testing a γ-secretase inhibitor.

EXAMPLES The present invention will be further described in the following examples and production examples, but the present invention is not limited to these examples and is presented to provide a complete disclosure to those skilled in the art. is there. Nor does it imply or imply that these experiments described are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used here (eg, amounts, temperature, concentrations, etc.) but some experimental errors and deviations will be considered and will vary without departing from the scope of the invention May be allowed

293 / EBNA-1 cell line transfected with PlexinA2 gene, and processing analysis using cultured hippocampal neurons . Gene expression HEK293 cell with HA tag added to C-terminal of PlexinA2 in the presence of γ-secretase inhibitor Was used to evaluate whether PlexinA2 was a substrate for γ-secretase. The γ-secretase inhibitor is (2S) -2-{[(3,5-Difluorophenyl) acetyl] amino} -N-[(3S) -1-methyl-2-oxo-5-phenyl-2,3- dihydro-1H-1,4-benzodiazepin-3-yl] propanamide (hereinafter also referred to as “Compound E”) (Alexis Biochemicals) was used.

1. Experimental conditions and experimental method (1) Cloning of mouse PlexinA2 gene RNA was purified from mouse brain using Trisol (Invitrogen), and 1st strand cDNA was synthesized using RNA PCR Kit (TaKaRa). PlexinA2 is first amplified into two fragments, 5 ′ untranslated region-3426bp and 3132-3 ′ untranslated region, and further amplified with 1-3180bp and 3121-5682bp for each amplified fragment. The fragment was amplified. Specifically, amplification was performed with Pyrobest (Takara) using 1 μl of the final synthesized 1st strand cDNA product and the following primers. Primer 1 and 2 were used for the 5 'untranslated region-3426 bp fragment, and Primer 3 and 4 were used for the 3132-3' untranslated region fragment. Furthermore, Primer 5 and 6 were used for the amplification of 1-3180 bp, and Primer 7 and 8 were used for the amplification of 3121-5682 bp.
primer1: GAGCTCGAGGTGGACAAATACATAGAGGAGCTGTC (SEQ ID NO: 59)
primer2: GTTGGGGTAGTAGATGAACTTGGTGT (SEQ ID NO: 60)
primer3: ACGTATTGAGCCAGAGTGGAGTATC (SEQ ID NO: 61)
primer4: GAGGCGGCCGCGGTTCTACTCAGCATCTCTCAGGTAT (SEQ ID NO: 62)
primer5: GAGCTCGAGGCCACCATGGAGCAGAGGAGGTTCTATCTG (SEQ ID NO: 63)
primer6: GGTTAGGGGTGTGTGCCCACTAG (SEQ ID NO: 64)
primer7: CCACGGGTCCAACGTATTGAGCC (SEQ ID NO: 65)
primer8: GAGGCGGCCGCGCTCTCTATGGACATGGCGTTGAT (SEQ ID NO: 66)

In the PCR cycle, after treatment at 94 ° C. for 30 sec, 35 cycles of [94 ° C. 15 sec → 65 ° C. 30 sec → 72 ° C. 5 min 30 sec] were performed, followed by treatment at 72 ° C. for 15 min. The PCR product was purified with a Quiaquick PCR purification kit (QIAGEN), and a 1-3180 bp fragment and 3120-5682 bp were further amplified from each purified amplified fragment. The 1-3180 bp fragment was enzymatically treated with XhoI (TaKaRa) and SpeI (TaKaRa), and the 3120-5682 bp fragment was enzymatically treated with SpeI (TaKaRa) and NotI (TaKaRa). Thereafter, each of the enzyme-treated fragments was cloned into pBluescript (Stratagene) to obtain a pBluescript1-3180bp fragment (1-3180bp) and a pBluescript3120-5682bp fragment (3120-5682bp).
The DNA sequences of the obtained pBluescript1-3180bp fragment and pBluescript3120-5682bp fragment were confirmed using a DNA sequencer (Applied Biosystems 3130xl). After confirmation, the pBluescript3120-5682bp fragment was treated with XhoI and SpeI, and a fragment excised from the pBluescript1-3180bp p fragment using XhoI and SpeI was inserted into the fragment after the treatment to complete the full-length PlexinA2.

(2) Construction of gene and expression vector with HA tag added to the C-terminus of mouse PlexinA2 gene
pCAG was enzymatically treated with SalI (TaKaRa) and NotI (TaKaRa), and PBlueinA obtained by enzymatic treatment of pBluescript obtained in (1) above with XhoI (TaKaRa) and NotI (TaKaRa) was inserted into pCAG. An expression vector was prepared. pCAG can be produced with reference to Gene108,193-200,1991, Japanese Patent No. 2824433, Japanese Patent No. 2824434, and the like. The expression vector was constructed so that an HA tag was added to the C-terminus of the incorporated PlexinA2 (PlexinA2-HA). The DNA sequence of Plexin A2-HA was decoded with a DNA sequencer (Applied Biosystems 3130xl). Its DNA sequence is shown in SEQ ID NO: 13. In SEQ ID NO: 13, the nucleotide sequence from 5692 to 5721 is a nucleotide sequence encoding an HA tag. The resulting DNA sequence was identical to mouse Plexin A2 (NM_008882). The expression vector was prepared in large quantities using Endofree Plasmid Maxi Kit (QIAGEN).

(3) Preparation of gene-expressing cells with HA tag added to the C-terminus of mouse PlexinA2
293 / EBNA-1 cell line (Invitrogen) is cultured in 10% FBS (Hyclone) / DMEM (Invitrogen) under 5% CO ₂ and 37 ° C, and a gene with an HA tag added to the C-terminus of mouse PlexinA2 Was transfected with Lipofectamine2000 (Invitrogen). After culturing for 1 day under the same conditions, 50 nM Compound E (γ-secretase inhibitor, Alexis Biochemicals) was added to the culture solution. After further culturing for 1 day under the same conditions, the transfected HEK293 cells were collected with PBS (SIGMA) and sonicated using Sonicator (TAITEC VP-5S) to disrupt the cells. Protein amount was quantified using Protein assay kit (BioRad). 2 ug each of the proteins obtained from the cells to which Compound E was added and the cells to which Compound E was not added were subjected to SDS-PAGE and Western blotted using an anti-HA antibody (Roche) (final concentration 0.2 μg / ml).
As primary cultured neurons, hippocampus isolated from embryonic day 18 SD rats (Charles River) was used. Specifically, fetuses were aseptically removed from pregnant rats under ether anesthesia. The brains were removed from the fetuses and immersed in 20% FBS (Hyclone) / HBSS (SIGMA). The hippocampus was collected from the removed brain under a stereomicroscope. Cells were dispersed by treating the collected hippocampus with an enzyme solution containing 0.25% trypsin (Invitrogen) and 0.5 mg / ml DNase (SIGMA) at 37 ° C. for 10 minutes. At this time, the enzyme reaction was stopped by adding 20% FBS (Hyclone) / HBSS (SIGMA). 2 ml of HBSS (SIGMA) was added to the obtained cells. Cells were re-dispersed by a gentle pipetting operation on the cell mass to which HBSS (SIGMA) was added. Then, PlexinA2 was introduced into the gene with Nuculeofector (Amaxa) using 2 × 10 ⁶ neurons. The medium used was Neurobasal (Invitrogen) medium supplemented with 1X B27 Supplement (Invitrogen) and 0.5 mM L-Glutamine (Invitrogen). The seeded cells were cultured in a 5% CO ₂ , 95% air, 37 ° C. incubator. After 2 weeks of culture, Compound E (final 50 nM) was added, further cultured for 1 week, collected in PBS, protein quantified, each 10 ug SDS-PAGE, anti-HA antibody (Roche) (final concentration 0.2 μg) / ml) was Western blotted.

2. Experimental Results FIG. 1 shows the results. The left figure shows the results of experiments using HEK293 cells. The left lane is a Compound E untreated sample, and the right lane is a Compound E treated sample. The arrow indicates CTF (C terminal fragment), which corresponds to the C-terminal region from the transmembrane region of Plexin A2. When Compound E was added, a band around 65 kDa (CTF) was accumulated specifically. Since this band is equal in size from the transmembrane region to the C-terminal region of PlexinA2, it was revealed that PlexinA2 is cleaved by γ-secretase in HEK293 cells.
The right figure shows the results of experiments using hippocampal cultured neurons. The left lane is a Compound E untreated sample, and the right lane is a Compound E treated sample. The arrow indicates CTF (C terminal fragment), which corresponds to the C-terminal region from the transmembrane region of Plexin A2. When Compound E was added, a band around 65 kDa (CTF) was accumulated specifically. Since this band is equal in size from the transmembrane region to the C-terminal region of PlexinA2, it was revealed that PlexinA2 was cleaved by γ-secretase in hippocampal cultured cells.
As for the substrate of γ-secretase, the extracellular region is first cleaved by another protease, and γ-secretase further cleaves the transmembrane region of CTF (from the transmembrane region to the C terminus), which is a digested fragment thereof. The final degradation product (intracellular region) is rapidly degraded by the proteasome. Since the initial cleavage reaction to the final proteasome degradation reaction are very fast, the substrate is detected as a single band when detected by Western blot. However, it was found that CTF accumulation was specifically detected when treated with a γ-secretase inhibitor.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, reference can be made to the foregoing descriptions of preferred methods and materials.
All publications mentioned herein are for the purpose of describing and disclosing cell lines, constructs and methods described, for example, in the publications used in connection with the invention described herein. , Incorporated herein by reference in its entirety, or incorporated herein by reference for its disclosure of methods and compositions for compound identification methods, screening methods, and techniques of the present invention. It can be used for the practice of the invention.

Sequence number 59: Synthetic DNA
Sequence number 60: Synthetic DNA
Sequence number 61: Synthetic DNA
Sequence number 62: Synthetic DNA
Sequence number 63: Synthetic DNA
Sequence number 64: Synthetic DNA
Sequence number 65: Synthetic DNA
SEQ ID NO: 66: synthetic DNA

Claims (9)

A method of screening for compounds that affect PlexinA2 processing by γ-secretase, comprising the following steps:
(i) a first biological composition comprising γ-secretase or a biologically active fragment thereof, and a second biological composition comprising PlexinA2, in the presence and absence of a candidate compound Contact with;
(ii) measuring the cleavage of the Plexin A2 in the presence and absence of the candidate compound, respectively;
(iii) selecting the candidate compound that affects the cleavage of the PlexinA2 by γ-secretase; and
(iv) identifying the candidate compound selected in (iii) as a compound that affects PlexinA2 processing by γ-secretase;
Including the above method.   Further, in the cleavage of PlexinA2 measured in the above (ii), when the PlexinA2 undegraded product in the presence of the candidate compound is greater than the PlexinA2 undegraded product in the absence of the candidate compound, the candidate compound The method according to claim 1, wherein the method is evaluated as an inhibitor of PlexinA2 degradation activity of γ-secretase.   Furthermore, in the cleavage of PlexinA2 measured in the above (ii), when the PlexinA2 undegraded product in the presence of the candidate compound is less than the PlexinA2 undegraded product in the absence of the candidate compound, the candidate compound The method according to claim 1, wherein the method is evaluated as an accelerator for PlexinA2 degradation activity of γ-secretase.   Further, in the cleavage of PlexinA2 measured in (ii) above, when the PlexinA2 cleavage product in the presence of the candidate compound is greater than the PlexinA2 cleavage product in the absence of the candidate compound, the candidate compound is The method according to claim 1, comprising evaluating as an accelerator for PlexinA2 degradation activity of γ-secretase.   Further, in the cleavage of PlexinA2 measured in the above (ii), when the PlexinA2 cleavage product in the presence of the candidate compound is less than the PlexinA2 cleavage product in the absence of the candidate compound, the candidate compound is The method according to claim 1, comprising evaluating an inhibitor of PlexinA2 degradation activity of γ-secretase.   The method of claim 1, further comprising measuring cleavage of a polypeptide comprising an APP or APPγ-secretase cleavage site.   The method of claim 1, further comprising measuring cleavage of a polypeptide comprising a Notch or Notch γ-secretase cleavage site.   A kit for γ-secretase assay comprising PlexinA2 and / or a substrate of γ-secretase other than PlexinA2.   To measure the processing of PlexinA2 by γ-secretase comprising a first biological composition comprising γ-secretase or a biologically active fragment thereof and a second biological composition comprising PlexinA2. Inspection kit.