JP2012019728A - Method for screening substance having action of controlling transcription of human abca1 gene - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for screening a substance having the action of controlling the transcription of human ABCA1 gene and hopeful as a substance of effecting hyper-HDL(hyper-blood high-density lipoprotein) and, in addition, as a substance useful for the preventing/treating arteriosclerotic diseases.SOLUTION: The method for screening a substance having the action of controlling the transcription of human ABCA1 gene is characterized by comprising using: a DNA having promoter activity; and a second DNA containing sequence(s) in the intron 3 of human ABCA1 gene and having enhancer activity.

Description

  The present invention relates to a method for screening a substance having an action of regulating transcription of a human ABCA1 gene based on the discovery of a promoter / enhancer region that controls the expression of ABCA1 gene in human liver. In particular, the present invention relates to a method for screening a substance having an effect of preventing or treating arteriosclerotic disease by increasing ABCA1 expression in the liver, using an increase in promoter activity or an increase in mRNA containing a specific untranslated region as an index. .

  Reduction of high density lipoprotein (HDL) cholesterol in the blood is a risk factor for arteriosclerosis. If HDL cholesterol increases by 10 mg / dL, the risk of coronary artery disease is expected to decrease by 20-30%. In addition, it has been demonstrated that artificial HDL particles have a therapeutic effect to directly regress arteriosclerotic lesions, and HDL elevating drugs are expected, but drugs that directly increase HDL have not been put into practical use (Non-patent Document 1, Nat. Rev Drug Discov. 2005 4, 193-205).

  HDL is formed by ABC membrane transporter A1 (ABCA1) transporting intracellular phospholipids and cholesterol to extracellular apolipoprotein A-I. ABCA1 has an essential role in the formation of HDL, and a gene mutation that causes dysfunction causes HDL deficiency (Non-patent Document 2, Nat. Genet. 1999; 22: 352). On the other hand, HDL increases in ABCA1-overexpressing mice (Non-patent Document 3, J. Biol. Chem. 2001; 276: 33969). Although ABCA1 is expressed in each tissue, it has been revealed by liver specific deficient mice that liver ABCA1 produces 80% of blood HDL (Non-patent Document 4, J. Clin. Invest. 2005; 115, 1333). ). Therefore, to increase HDL, it is considered that increasing the expression of ABCA1 in the liver is an extremely effective means.

  Regarding ABCA1 gene transcription control, transcription of ABCA1 gene in peripheral cells such as macrophages is controlled by a promoter region (peripheral promoter) upstream of exon 1, and this promoter is activated by direct binding of nuclear receptor LXR. (Non-Patent Document 5, Biochem. Biophys. Res. Commun. 2000; 274, 794).

  LXR agonists show an HDL raising effect through ABCA1 expression promotion. However, LXR activation simultaneously promotes the expression of the transcription factor SREBP-1c, which is a master regulator of neutral lipid synthesis. As a result, fatty acid biosynthetic enzyme system gene expression is increased and fatty liver and serum triglycerides are increased, and such side effects are an obstacle to the development of LXR agonists as clinical drugs (Non-patent Document 6, Biochem). Pharmacol., 2009; 77, 1316-1327).

  The inventors have found that ABCA1 expression in rat liver is subject to dual control by a liver-specific liver-type promoter together with an LXR-dependent peripheral promoter (Non-patent Document 7, J. Biol. Chem. 2007; 282: 21090). That is, liver-specific ABCA1 mRNA (L2) whose transcription is initiated from exon 2 is present in the rat liver, and the exon 2 upstream region of ABCA1 gene functions as a liver-specific promoter. A sterol response element SRE exists in the liver type promoter, and the mechanism by which the transcription factor SREBP-2, which is converted into the active form by cholesterol reduction and translocates into the nucleus, is directly bound and activated is clarified. Since this promoter region is common to rats, mice, and humans, it was considered that a drug that activates this liver-type promoter can promote hepatic ABCA1 expression without showing side effects due to LXR activation. Then, the inventors considered that this liver-type promoter can be used for screening of an ABCA1 expression promoter effective for humans (Patent Document 1, Japanese Patent Application Laid-Open No. 2007-082445).

  In macrophages and fibroblasts, HMG-CoA reductase inhibitor statins, which are rate-limiting enzymes for cholesterol synthesis, reduce ABCA1 expression. This is because the endogenous ligand of LXR generated in the cholesterol synthesis process is decreased by the action of statin drugs, and the ABCA1 gene promoter activity is decreased (Non-patent Document 8, Arterioscler. Thromb. Vasc. Biol. 2004; 24, 2365). However, statin drugs have been shown to increase blood HDL levels in addition to lowering blood LDL levels. Statin drugs promote ABCA1 gene expression in human liver cancer-derived cells HepG2. (Non-patent document 9, Biochem. Biophys. Res. Commun. 2004; 324, 835). The inventors have clarified a mechanism in which statin drugs reduce the activity of peripheral promoters in liver-derived cells, while activating liver-type promoters to increase ABCA1 expression (Non-patent Document 7).

JP 2007-082445 A

Nat Rev Drug Discov. 2005 4, 193-205 Nat. Genet. 1999; 22: 352 J. Biol. Chem. 2001; 276: 33969 J. Clin. Invest. 2005; 115, 1333 Biochem. Biophys. Res. Commun. 2000; 274, 794 Biochem. Pharmacol., 2009; 77, 1316-1327 J. Biol. Chem. 2007; 282: 21090 Arterioscler. Thromb. Vasc. Biol. 2004; 24, 2365 Biochem. Biophys. Res. Commun. 2004; 324, 835

  Although ABCA1 is expressed in each tissue, it has been revealed by liver-specific deficient mice that liver ABCA1 produces 80% of blood HDL (Non-patent Document 4). It was also found that arteriosclerosis was exacerbated in liver-specific ABCA1-deficient mice (Arterioscler. Thromb. Vasc. Biol 2009; 29: 548). Therefore, it is considered that increasing the expression of ABCA1 in the liver is extremely important for HDL elevation and further prevention and treatment of arteriosclerotic diseases. Elucidation of the control mechanism of ABCA1 gene expression in the liver and further control using it A drug screening method has been desired.

  In view of the above, an object of the present invention is to provide a novel method for screening a substance that has an action of increasing ABCA1 in human hepatocytes and can be used in a medicament useful for the prevention and / or treatment of diseases associated with arteriosclerosis. Is to provide.

  The human ABCA1 gene used in the method of the present invention is disclosed as “ATP-binding cassette transporter A1” on the Gene Bank database. In addition, International Publication No. 00/078972 discloses a human ABCA1 gene that encodes “ABC1”, and a promoter upstream of the exon 1 described above.

  That is, according to one aspect of the present invention, transcription of a human ABCA1 gene is characterized by using DNA having promoter activity and DNA having an enhancer activity including a sequence in intron 3 of the human ABCA1 gene. There is provided a method for screening a substance having an action to act.

  The DNA having the promoter activity is preferably a DNA having a nucleotide sequence in intron 2 of the human ABCA1 gene and having promoter activity.

  The substance having an action of regulating transcription of the human ABCA1 gene is preferably a substance useful for the prevention or treatment of arteriosclerotic diseases.

  According to the screening method for a substance having an action of regulating transcription of ABCA1 gene according to the present invention, a substance having an action of regulating transcription of human ABCA1 gene, particularly, a prophylactic and / or therapeutic agent for arteriosclerotic disease is tested. It is useful for the development of HDL-elevating drugs. In addition, the method of the present invention may be able to detect a molecule that is more effective for human HDL elevating action than the conventional screening method for ABCA1 gene expression promoting substance.

FIG. 1A shows a schematic diagram of the human ABCA1 gene. The numerical value in the schematic diagram indicates the base position where the transcription start point of peripheral ABCA1 mRNA is 1 in the DNA of human ABCA1 gene. FIG. 1B shows a schematic diagram of the 5 ′ end of ABCA1 mRNA expressed in human liver analyzed by the 5′-RACE method. The parentheses indicate the abundance ratio of each mRNA in the human liver. FIG. 2A is a graph showing the total amount of ABCA1 mRNA expressed in each human tissue (liver, muscle, kidney, pancreas, heart, brain, placenta and lung), and FIG. 2B shows human liver expressed in each human tissue. It is the graph which showed the amount of type (L3 type) ABCA1 mRNA. FIG. 3A is a graph showing changes in the expression level of total ABCA1 mRNA in human liver-derived cultured cells JHH5 treated with compactin, and FIG. 3B shows human liver types (L3 in human liver-derived cultured cells JHH-5 treated with compactin). ) FIG. 3C is a graph showing changes in the expression level of ABCA1 mRNA, and FIG. 3C is a graph showing changes in the expression level of peripheral (P) ABCA1 mRNA in human liver-derived cultured cells JHH-5 treated with compactin. FIG. 4A is a photograph obtained by measuring the expression level of ABCA1 protein in human liver-derived cultured cells JHH-5 obtained by knocking down expression of human liver type (L3 type) ABCA1 mRNA using siRNA, as shown in FIG. 4B. These are graphs showing the amount of apoA-I-dependent cholesterol extracellular excretion (HDL production amount). FIG. 5 is a schematic diagram of a human ABCA1 gene and a configuration diagram of a reporter plasmid of a human liver type (L3 type) ABCA1 gene promoter / enhancer. The numerical value in the schematic diagram indicates the base position where the transcription start point of L3-type ABCA1 mRNA is 1 in the DNA of the human ABCA1 gene, and the downstream of the transcription start point is plus and the upstream is minus. FIG. 6 is a graph showing that the human liver type (L3 type) ABCA1 gene promoter / enhancer is activated by compactin. FIG. 7 is a graph showing that even when the L3-type enhancer sequence is incorporated into a luciferase plasmid into which the SV-40 promoter has been introduced, activation by compactin is observed, but it is not affected by increased expression of SREBP-2. FIG. 8 shows the sequence contained in the human liver type (L3 type) ABCA1 gene enhancer. The left end of the upper row is the 5 'side, and the right end of the lower row is the 3' side. FIG. 9 is a graph showing that the activity of human liver type (L3 type) ABCA1 gene promoter / enhancer disappeared due to deletion of sequence a, sequence b or sequence c. FIG. 10 is a graph showing that the activity of the human liver type (L3 type) ABCA1 gene enhancer was increased by introducing an expression vector of the transcriptional regulatory factor HNF4alpha and disappeared by deletion of the sequence c. FIG. 11 is a photograph in which the expression level of HNF4alpha protein in human liver-derived cultured cells JHH-5 treated with compactin was measured by Western blot.

  Hereinafter, embodiments of the present invention will be described. However, the present invention is not limited to the embodiments described below.

  The inventors analyzed the ABCA1 expression control in human liver and liver-derived cells in more detail, and in addition to the liver type (L2 type) ABCA1 mRNA common to mice and rats that are conventionally known in human liver, Further, it was found that another liver type (L3 type) ABCA1 mRNA exists. This human liver type (L3 type) ABCA1 mRNA corresponds to 25% of the total ABCA1 mRNA present in human liver, and it was found that expression was promoted when human liver-derived cells were treated with statin drugs. The transcription start point of L3 type is downstream from the translation start point of exon 2, but L3 type mRNA encodes functional ABCA1. When L3 type ABCA1 mRNA is knocked down using siRNA, ABCA1 protein This was confirmed by the fact that expression was reduced and HDL-forming ability was also reduced.

  Subsequently, when the corresponding L3 type promoter / enhancer region was identified, the enhancer region responsible for activation by the statin drug is different from the previously reported L2 type promoter (Patent Literature 1, Non-Patent Literature 7) in SREBP-2. We found no response and controlled human ABCA1 expression by a novel mechanism. Therefore, it can be considered that the L3-type promoter / enhancer region has an important role in regulating liver ABCA1 expression and regulating blood HDL levels in humans. The drug screening method using L3 type promoter / enhancer region activation or increased expression of L3 type ABCA1 mRNA containing a novel untranslated region as an index is considered to be extremely useful for the development of effective HDL elevating drugs in humans. It is done.

  Furthermore, the inventors have found that the L3-type enhancer promotes human ABCA1 expression even when a promoter other than the L3-type promoter is used.

  Based on the above discovery that a new control mechanism exists in the regulation of ABCA1 gene expression in the human liver, as a method for selecting or identifying a substance that regulates ABCA1 gene expression, a novel human liver type (in the present specification, A method using the upstream part of exon 3 (also referred to as exon L3 in the present specification) of the gene encoding ABCA1 mRNA (also referred to as L3 type), and the novel human liver type ABCA1 promoter and intron 3 present in intron 2 The present invention was completed by developing a method using an existing enhancer (also referred to as L3-type ABCA1 promoter in the present specification).

  The novel human liver type (L3 type) promoter disclosed in the present invention is a conventionally known promoter upstream of exon 1 of ABCA1 gene (see International Publication No. 00/078972 pamphlet) or L2 type promoter upstream of exon 2 Exists in a completely different region, and the DNA sequence is also different. With regard to this L3-type promoter, there has been no report on ABCA1 gene transcription control and HDL formation, and its usefulness as a test method for treating or preventing arteriosclerotic diseases is not known. As described above, pitavastatin, simvastatin, and atorvastatin have been shown to increase ABCA1 mRNA in human hepatoma cells HepG2 (Non-patent Document 9). Regarding the mechanism of action, the liver type (L2) promoter found by the inventors was assumed. However, the novel human liver type (L3 type) ABCA1 promoter and the expression control by the promoter according to the present invention are neither described nor suggested in the prior art literature. Similarly, the novel liver-type ABCA1 enhancer disclosed by the present invention has not been reported in these prior art documents, but has been clarified for the first time by the present inventors.

  According to one embodiment of the present invention, a DNA comprising a nucleotide sequence in intron 2 of a human ABCA1 gene and having a promoter activity and a DNA comprising a sequence in intron 3 of a human ABCA1 gene and having an enhancer activity The present invention relates to a method for screening a substance having an action of regulating transcription of a human ABCA1 gene.

  According to another embodiment, the present invention also includes a DNA comprising a nucleotide sequence in intron 2 of human ABCA1 gene and having promoter activity, and intron 3 of human ABCA1 gene, which can be used in such a screening method. And a DNA having an enhancer activity.

  DNA containing the nucleotide sequence in intron 2 of human ABCA1 gene and having promoter activity, and DNA containing intron 3 of human ABCA1 gene and having enhancer activity have a sequence derived from human. It may be natural or artificial. That is, according to another aspect of the present invention, a DNA comprising a base sequence in intron 2 of a human ABCA1 gene and having a promoter activity, a DNA comprising a base sequence in intron 3 of a human ABCA1 gene and having an enhancer activity A recombinant DNA comprising is provided.

  Intron 2 of the human ABCA1 gene is a region existing downstream of exon 2 and upstream of exon 3 of the human ABCA1 gene, and intron 3 is a region existing downstream of exon 3 and upstream of exon 4. Specifically, exon 2 of the human ABCA1 gene has a sequence from positions 24385 to 24542 of the DNA sequence of the human ABCA1 gene described in SEQ ID NO: 1, and intron 2 has the sequence of SEQ ID NO: 1 Those having the sequence from positions 24543 to 38960 are exon 3, and those having the sequence from positions 38961 to 39054 of the sequence described in SEQ ID NO: 1 are intron 3 and positions 39055 of the sequence described in SEQ ID NO: 1 Having a sequence from positions 43588 to 43435, and exon 4 having a sequence from positions 43588 to 43729 of the sequence set forth in SEQ ID NO: 1, respectively. In the present specification, the region indicated as exon L3 is a region having a sequence from positions 38481 to 38783 of the sequence described in SEQ ID NO: 1. SEQ ID NO: 2 shows the sequence of exon L3. SEQ ID NO: 1 is a sequence starting from exon 1 of the human ABCA1 gene. Further, the sequence of homologues, variants and derivatives of intron 2 and exon L3 in humans is determined by those skilled in the art based on homology with the sequences of intron 2 and / or exons 3 and 4 in humans. be able to.

  The DNA containing the nucleotide sequence in intron 2 of the human ABCA1 gene and having promoter activity preferably contains nucleotides from positions 38055 to 38960 in the nucleotide sequence of the human ABCA1 gene shown in SEQ ID NO: 1. The DNA having the nucleotide sequence in intron 2 of the human ABCA1 gene and having promoter activity is, in particular, (a) nucleotides from position 38055 to position 38960 of the nucleotide sequence of the human ABCA1 gene shown in SEQ ID NO: 1 (SEQ ID NO: 3 ), A DNA having the sequence described in the base from the position 38055 to the position 39054 (SEQ ID NO: 4) and the base in the position from the position 38055 to the position 39224 (SEQ ID NO: 5).

  Moreover, the DNA having the nucleotide sequence in intron 2 and having promoter activity can be a DNA having substantially the same sequence as the DNA of (a). Specifically, the DNA containing the nucleotide sequence in intron 2 and having promoter activity is (b) one or several (preferably) in the sequence described in SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. Has a sequence in which nucleotides of 1 to 80, more preferably 1 to 40, more preferably 1 to 20, more preferably 1 to 10) are substituted, inserted or deleted, and has promoter activity It can be at least part of the DNA. Those who have ordinary knowledge in the technical field can obtain DNA having promoter activity equivalent to or higher than that of the wild type promoter by modification such as partial substitution, insertion or deletion of the nucleotide sequence of the wild type promoter. It is possible to prepare.

  In addition, a DNA containing a nucleotide sequence in intron 2 of human ABCA1 gene and having promoter activity is (c) 60% or more homologous to the sequence described in any of SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. It has a sequence (preferably 80% or more, more preferably 90% or more) and can be at least a part of DNA having promoter activity. Such DNA includes a mutant gene existing in nature, a mutant gene artificially modified, or a homologous gene derived from a heterologous organism.

  Comparison of homology can usually be performed using a sequence comparison program that is readily available. Such commercially available computer programs can calculate% homology between two or more sequences. Most sequence comparison methods are designed to produce optimal alignments taking into account possible insertions and deletions without unduly penalizing the overall homology score. This is accomplished by inserting “gaps” into the sequence alignment to try to maximize local homology. In such a method, homology is calculated by assigning a “gap penalty” to each gap such that the alignment of the sequence in as few gaps as possible achieves a higher score than in many gaps. Most alignment programs can set gap penalties. However, it is preferred to use the default values when using such software for sequence comparisons. Examples of software that can perform such sequence comparisons include the BLAST package (see Ausubel et al., 1999 ibid-Chapter18), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and GENEWORKS. Suites are listed.

  Further, a DNA having a nucleotide sequence in intron 2 of the human ABCA1 gene and having promoter activity hybridizes with the DNA of (d) (a) under stringent conditions, and at least a part of the DNA having promoter activity can do. Here, DNA usually has double-stranded DNA structures complementary to each other. For this reason, it should be noted that the DNA that hybridizes with the DNA of (a) refers to DNA having a strand that hybridizes with any strand of the DNA of (a).

  Stringent conditions and hybridization methods can be set according to, for example, J. Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989. Specifically, the stringent condition may be “1 × SSC, 0.1% SDS, 37 ° C.”, and the more stringent condition may be “0.5 × SSC, 0.1% SDS, 42 ° C.” More stringent conditions can be “0.2 × SSC, 0.1% SDS, 65 ° C.” (1 × SSC: 0.15 M NaCl, 0.015 M sodium citrate, pH 7 0.0). However, combinations of these conditions are exemplary, and those skilled in the art can appropriately change the above or other factors that determine the stringency of hybridization (for example, probe concentration, probe length, hybridization reaction time, etc.). By combining them, the same stringency as described above can be realized.

  The promoter activity of the DNAs (b) to (d) can be measured by, for example, a luciferase assay method as described in detail below. In addition, the DNAs (b) to (d) preferably have a promoter activity similar to that of the DNA (a). Here, “having similar promoter activity” means having qualitatively similar promoter activity, for example, the DNAs of (b) to (d) are at least one factor with the DNA of (a) The case where the same control is received is included. On the other hand, having “similar” promoter activity does not intend to have quantitatively similar promoter activity. Further, as will be apparent to those skilled in the art, in order to exert promoter activity, the DNA is a sequence described in any one of SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 (or a sequence substantially identical thereto). ) Is not necessary, and may be a part thereof. As described above, a region necessary for having promoter activity can be appropriately determined by those skilled in the art by a luciferase assay method or the like.

  DNA containing the nucleotide sequence in intron 3 of human ABCA1 gene and having enhancer activity is (e) the transcription start position of L3-type mRNA in human ABCA1 gene shown in SEQ ID NO: 1 (38481 of human ABCA1 DNA of SEQ ID NO: 1). Position) It preferably includes a base from 3103 downstream to 3378 downstream (SEQ ID NO: 6). In the human ABCA1 gene shown in SEQ ID NO: 1, from the transcription start position of L3-type mRNA from 3172 downstream to 3378 downstream More preferably, a base (SEQ ID NO: 7) is included, and the human ABCA1 gene shown in SEQ ID NO: 1 includes a base (SEQ ID NO: 8) from the position 3172 downstream to the position 3259 downstream from the transcription start position of the L3 type mRNA. Most preferred.

  Furthermore, a DNA comprising the nucleotide sequence in intron 3 of the human ABCA1 gene and having enhancer activity is a nucleotide (positions 3172 to 3383 from the transcription start position of the L3 mRNA in the human ABCA1 gene shown in SEQ ID NO: 1 ( SEQ ID NO: 9), bases from positions 3230 to 3243 from the transcription start position of L3 type mRNA (SEQ ID NO: 10), and bases from positions 3244 to 3256 from the transcription start position of L3 type mRNA (SEQ ID NO: 11) It is necessary that the DNA has all of

As long as these three sequences are retained, the DNA containing the nucleotide sequence in intron 3 of the human ABCA1 gene and having enhancer activity is described in (f) SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In the preferred DNA sequence, one or several (preferably 1 to 80, more preferably 1 to 40, more preferably 1 to 20, more preferably 1 to 10) nucleotides are substituted, inserted or inserted. It may be a deleted sequence.
Further, as long as these three sequences are retained, (g) homology with the sequence described in any one of SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8 is 60% or more (preferably 80% or more, more preferably May have a sequence of 90% or more. The comparison of homology can be performed in the same manner as described for the DNA in (c).
Furthermore, as long as these three sequences are retained, the DNA containing the nucleotide sequence in intron 3 of the human ABCA1 gene and having enhancer activity is any one of (h) SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8. The DNA can be hybridized with the preferable DNA described in 1) under stringent conditions to form at least a part of DNA having enhancer activity.

  Even if the sequence is not shown above, the region necessary for having enhancer activity in the present invention can be appropriately determined by those skilled in the art. The enhancer activity can be measured by, for example, a luciferase assay method, a CAT method or the like as described in detail below.

  Next, recombinant DNA that can be used in a method for screening a substance having an action of regulating transcription of the human ABCA1 gene using these DNAs according to an embodiment of the present invention will be described. The recombinant DNA comprises DNA having promoter activity and DNA having a sequence in intron 3 of human ABCA1 gene and having enhancer activity.

As the DNA having promoter activity, the DNA having the nucleotide sequence in intron 2 of the human ABCA1 gene described above and having promoter activity can be used. Furthermore, DNA having promoter activity is not limited to DNA having a sequence derived from the human ABCA1 gene, and DNA having an arbitrary promoter base sequence can be used. Examples of promoters known to those skilled in the art include, but are not limited to, the SV-40 promoter, the herpesvirus thymidine kinase (TK) gene promoter, the CMV early promoter, the EF promoter, and the CAG promoter.
On the other hand, as the DNA having an enhancer activity, the DNA having the enhancer activity including the sequence in the intron 3 of the human ABCA1 gene described above can be used.

  These DNAs having promoter activity and DNAs having a sequence in intron 3 of human ABCA1 gene and having enhancer activity can be used in any combination in recombinant DNA. That is, DNA having a promoter activity selected from any one of (a), (b), (c), and (d) or other DNA having any promoter activity, and (e), (f), (g ) And (h) can be used as a recombinant DNA containing any combination of DNAs having enhancer activity.

  In addition, in the recombinant DNA according to the present invention, even when a DNA containing a nucleotide sequence in intron 2 of human ABCA1 gene and having promoter activity is used, it can further have a minimal transcription promoter. Examples of minimal promoters include, but are not limited to, herpesvirus thymidine kinase (TK) gene promoter, CMV early promoter, PGK promoter, SV40 promoter, and the like.

  The DNA according to the present invention can be obtained by selection from a genomic library or polymerase chain reaction (PCR) using genomic DNA as a template. Selection from a genomic library can be performed by hybridization of genomic DNA incorporated into an appropriate vector and labeled DNA having a partial sequence of the target DNA. Hybridization can be performed, for example, according to the method described in J. Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989. Moreover, when using a commercially available library, it can carry out according to the method as described in an attached instruction manual. PCR using genomic DNA as a template can be performed using a primer having a partial sequence of the target DNA. The nucleotide sequence is modified by methods such as deletion introduction using restriction enzymes or DNA exonuclease, mutation introduction by site-directed mutagenesis, modification by PCR using mutation primers, and direct introduction of synthetic mutant DNA. be able to.

  According to another aspect of the present invention, there is provided a recombinant vector having a DNA having promoter activity and a DNA having a sequence in intron 3 of human ABCA1 gene and having enhancer activity. The recombinant vector may further have a structural gene operably linked to the DNA having the promoter activity and the DNA having the enhancer activity. As will be described in detail below, for example, when a recombinant vector is used for screening, the structural gene may be any gene as long as its transcription amount and / or expression level can be measured.

  In the present invention, the vector may be any vector such as bacteriophage, plasmid, cosmid, phagemid and the like. More specifically, examples of vectors that can be used in the present invention include pCD vectors, cDM8 vectors, retrovirus vectors, adenovirus vectors, herpesvirus vectors, adenoassociate virus vectors, etc., which are vectors for animal cells, Examples thereof include pUC which is a vector for bacteria. In order to incorporate the structural gene into the vector, it is downstream of the promoter region in the direction in which the structural gene is correctly transcribed, and so that the promoter and enhancer function properly with respect to the structural gene, A structural gene may be linked upstream of the enhancer region. Linkage between the promoter and the structural gene, and between the enhancer and the structural gene can be performed using a restriction enzyme cleavage site. Moreover, even if there is no appropriate restriction enzyme site, the ligase reaction can be used.

  Note that “operably linked” means that one genetic element is arranged so that it can function as predicted with respect to another genetic element. For example, a promoter is operably linked to a structural gene if the promoter helps initiate transcription of the structural gene. Similarly, an enhancer is operably linked to a structural gene if the enhancer promotes transcription of the structural gene. As long as this functional relationship is maintained, residues may intervene between the promoter and the structural gene or between the structural gene and the enhancer.

  According to another aspect of the present invention, a transformation comprising exogenous DNA having promoter activity and a structural gene operably linked to exogenous DNA having enhancer activity, comprising a sequence in intron 3 of human ABCA1 gene. The body is provided. In the present specification, a transformant widely refers to an organism that has acquired a new trait as a result of introducing DNA from the outside. A transformant may be any organism and any cell or tissue derived from any organism. In particular, the transformant according to the present invention includes a transformant transformed with the above recombinant vector.

  Examples of hosts that can be transformed with a recombinant vector include, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells, and the like. Examples of methods for transformation into these hosts include the calcium phosphate method, lipofection method, electroporation method, gene transfer method using adenovirus vector or retrovirus vector, and microinjection method.

  According to another aspect of the present invention, a kit for screening a substance having an action of regulating transcription of a human ABCA1 gene is provided. The kit according to the present invention can be used for screening substances useful for the prevention or treatment of arteriosclerotic diseases. As described in detail below, by using DNA having promoter activity and DNA having a sequence in intron 3 of human ABCA1 gene and having enhancer activity, it has an action of regulating transcription of human ABCA1 gene. Substances can be screened. That is, the kit according to the present invention has the above recombinant vector and / or the above transformant.

In the kit according to the present invention, an enzyme, an enzyme substrate, a reagent such as a buffer, a medium, a tool, and the like can be combined according to the screening method. Examples of enzyme substrates include luciferin, ATP, [ ¹⁴ C] chloramphenicol, and acetyl CoA. As the buffer solution, a buffer solution suitable for maintaining the activity of the enzyme used for the analysis can be appropriately selected. Examples of tools include a TLC spread sheet, a membrane, and the like.

  According to another aspect of the present invention, there is provided a screening method for a substance having an action of regulating transcription of a human ABCA1 gene, in particular, a substance having an action of regulating transcription of a human ABCA1 gene in the liver. It can be used to search for substances useful for prevention or treatment. The screening method according to the present invention is characterized by using DNA having promoter activity and DNA having a sequence in intron 3 of human ABCA1 gene and having enhancer activity.

Specifically, the screening method according to the present invention includes:
Providing a test substance;
Providing a plurality of groups of cells or organisms having DNA having promoter activity and DNA having a structural gene comprising a sequence in intron 3 of the human ABCA1 gene and operably linked to DNA having enhancer activity;
Contacting the analyte with at least one group of cells or organisms;
Measuring the transcription amount and / or the expression level of the gene in a group that has been contacted with the test substance and a group that has not been contacted;
It is preferable to include a step of comparing the transcription amount and / or the expression amount of the group not contacted with the test substance and the group not contacted.

  Provide a single compound or composition, natural or synthetic compound, organic or inorganic compound, protein, peptide, oligonucleotide, polynucleotide, cell extract, cell culture supernatant, or any other substance as a test substance Can do.

  Screening can be performed both in vitro and in vivo. Cells or organisms used in the screening method according to the present invention include prokaryotes such as bacteria (such as E. coli), yeast (genus Saccharomyces, genus Kluyveromyces, etc.), insects, plants or animals, or these Cells derived from. Examples of animals include homeothermic animals, particularly mammals such as humans, monkeys, mice, rats, cows, pigs, and dogs. The cells used in the present invention are preferably cultured cells that can be cultured in a laboratory, and more preferably primary cultured hepatocytes. The cells can be derived from a thermostat animal, particularly mammals such as humans, monkeys, mice, rats, cows, pigs and dogs, and preferably derived from humans. The cells are preferably derived from the liver.

  The cell or organism used in the present invention has a DNA having a promoter activity and a DNA having a structural gene that includes a sequence in intron 3 of the human ABCA1 gene and is operably linked to a DNA having an enhancer activity. preferable. The DNA may be endogenous or exogenous. If exogenous, the DNA may be introduced into the cell or organism by any means. For example, when using cultured cells for screening, any method commonly used in the technical field to which the present invention belongs can be adopted as a method for introducing the DNA into the cultured cells. Examples of DNA introduction methods include, but are not limited to, calcium phosphate-DNA coprecipitation method, lipofection method, DEAE-dextran method, and electric pulse perforation method. In any method, it is preferable to use transfection conditions optimized according to the cells to be used.

  The structural gene may be any gene as long as its transcription amount and / or expression level can be measured. As will be apparent to those skilled in the art, the structural gene can be appropriately selected depending on the method for measuring the transcription level and / or the expression level. Examples of the structural gene include human ABCA1, a protein having a predetermined activity (such as luciferase), a protein that can bind to a predetermined antibody, a protein that can specifically bind to a predetermined substance (such as GST), and the like. In particular, a gene encoding a protein selected from the group consisting of firefly luciferase, chloramphenicol acetyltransferase, β-galactosidase, secreted alkaline phosphatase and green fluorescent protein (so-called reporter gene) can be mentioned. .

  As will be apparent to those skilled in the art, the test substance can be brought into contact with cells or organisms by any method. For example, when using a cultured cell, it can contact by adding a test substance in a culture medium. That is, when using cultured cells, the cells are preferably cultured in the presence or absence of the test substance. Moreover, when using an animal, it can contact by administration by arbitrary means, for example, the injection from arbitrary routes. The time for which the test substance is brought into contact with the cell or the organism can be appropriately set according to the effect of the test substance, the concentration, the type of the cell or the organism and the technical consideration. In addition, the concentration of the test substance can be appropriately set according to its toxicity, permeability, cell number, treatment time, etc., and is usually preferably 1 nM to 1 mM. When using cultured cells, it is generally preferable to perform such treatment in a multi-well plate that can perform many tests simultaneously. When cultured cells are used, the conditions under which reporter gene expression can be measured by treatment with a test compound may be any conditions that allow cells to survive and produce an expression product of the reporter gene. Under particularly preferable conditions, a medium suitable for the cell line to be used is preferably used and cultured at 36 to 38 ° C. for 5 to 72 hours in the presence of 4 to 6% carbon dioxide gas.

  By measuring the transcriptional amount and / or expression level of the structural gene in the group contacted with the test substance and the group not contacted, and comparing the transcriptional amount and / or expression level of the structural gene, It can be determined whether or not a substance can be a candidate substance for a substance having an action of regulating transcription of the human ABCA1 gene. Specifically, when the amount of transcription and / or expression of the gene is changed in the group in which a certain test substance is contacted, compared to the group in which the test substance is not contacted, Can be a candidate substance.

  A step of measuring a transcription amount and / or an expression level of the structural gene in a group not contacted with a test substance contact group, and a transcription of a group not contacted with the test substance contacted group The step of comparing the amount and / or the expression level can be performed by any method, as will be apparent to those skilled in the art. Specifically, the transcription amount of the gene can be measured by Northern blotting method, DNA array method or the like. In addition, the expression level of the gene can be measured by a luciferase assay method, a CAT method, or the like. Furthermore, when an antibody against the predetermined gene is available, the expression level of the gene can be measured by ELISA, immunoprecipitation, or western blotting. In addition, when a gene of a protein that specifically binds to a predetermined substance such as GST is used as the predetermined gene, the expression level of the gene is determined by precipitating the protein and measuring the amount of the precipitated protein. Can be measured.

[Northern blotting method]
In the Northern blotting method, denatured RNA is separated by agarose electrophoresis under denaturing conditions, transferred to a nitrocellulose filter, and detected with a labeled specific probe. RNA is denatured because RNA has a secondary structure in the molecule, and as such, cannot be accurately separated according to size, and the filter can bind only single-stranded nucleic acids.

[Luciferase assay method, CAT method]
The luciferase assay method and the CAT method are prepared by preparing a plasmid incorporating the LUC (luciferase) or CAT (chloramphenicol acetyltransferase) gene as a reporter downstream of the transcriptional regulatory region of the target gene, and introducing the plasmid into the cell. The enzyme activity is measured. Specifically, the luciferase assay method uses a luminometer to detect light having a wavelength of 560 nm that is emitted when luciferase catalyzes a reaction for producing luciferin and AMP from luciferin and ATP in the presence of magnesium. In the case of the CAT method, the substrate [ ¹⁴ C] chloramphenicol is acetylated by CAT to produce [ ¹⁴ C] acetylchloramphenicol. This sample is extracted with ethyl acetate, developed on a thin layer silica gel plate, and then the radioactivity of spots having different mobilities is measured.

  According to another aspect of the present invention, there is provided a substance having an action of regulating transcription of a human ABCA1 gene, particularly a substance having an action of regulating transcription of a human ABCA1 gene in the liver, which has been screened by the above screening method. . In particular, as described above, according to the screening method of the present invention, a substance that promotes transcription of the human ABCA1 gene can be screened. For this reason, according to the other aspect of this invention, the substance useful for the prevention or treatment of an arteriosclerotic disease screened by the said screening method is provided.

  According to still another aspect of the present invention, human ABCA1 can be expressed using a primer prepared based on a sequence in a novel exon L3 of a human ABCA1 gene encoding the 5 ′ region of a novel human liver-type ABCA1 mRNA. There is provided a screening method for a substance having an action of promoting expression of human ABCA1 gene, characterized by measuring mRNA expression level.

  The novel exon L3 of the human ABCA1 gene is shown in SEQ ID NO: 2, and corresponds to 303 bases from the 38481 position to the 38783 position of the base sequence of the human ABCA1 gene shown in SEQ ID NO: 1. The primer used in this embodiment may be a primer pair that is substantially complementary to a part of the upstream and downstream sequences of the novel exon L3 in the human ABCA1 gene. The primer sequence length and the human ABCA1 gene There is no particular limitation as to which site is substantially complementary. Here, “substantially complementary” means that it is sufficient if it is complementary to the human ABCA1 gene sequence so that it can anneal. For example, these primers are included in the primers of the present invention as long as they can be annealed to the 5 ′ side, 3 ′ side, or both, even if they contain sequences that are not partially complementary to the human ABCA1 gene sequence. Shall be. In order to prevent non-specific amplification or to introduce an appropriate restriction enzyme recognition site, a primer having a mismatch sequence that is not complementary to the human ABCA1 gene can be used. The primer may be labeled for detection. For example, the primer may be labeled with a radioisotope, a fluorescent substance, an enzyme, other chemical substances, and the like.

  Specifically, preferred forward primers for detecting human L3 type ABCA1 include, but are not limited to, those described in SEQ ID NO: 12. Moreover, as a reverse primer for a human L3 type | mold ABCA1 detection, although what is described in sequence number 13 is mentioned, it is not limited to these. Moreover, as a preferable probe which can be used in combination with these primers, the one described in SEQ ID NO: 14 can be used. In addition, the preferred combinations of probe, forward primer and reverse primer are those described in SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17. 18, those described in SEQ ID NO: 19 and SEQ ID NO: 20.

A screening method for a substance having an action of promoting expression of human ABCA1 gene, characterized by measuring the mRNA expression level of human ABCA1 using these PCR primers,
Providing a test substance;
Providing a plurality of groups of cells or organisms having DNA having promoter activity and DNA having a structural gene comprising a sequence in intron 3 of the human ABCA1 gene and operably linked to DNA having enhancer activity;
Contacting the analyte with at least one group of cells or organisms;
In the step of measuring the transcription amount and / or expression level of the gene in the group that has been brought into contact with the test substance and the group that has not been brought into contact, the mRNA expression level of human ABCA1 is measured using PCR primers A step characterized by:
It is preferable to include a step of comparing the transcription amount and / or the expression amount of the group not contacted with the test substance and the group not contacted.

  Specifically, such a method can be performed according to the screening method using the DNA having the promoter activity described above and the DNA having a sequence in intron 3 of the human ABCA1 gene and having an enhancer activity. In the step of measuring the mRNA expression level of human ABCA1 using PCR primers, preferably, the mRNA expression level of human novel liver-type ABCA1 is measured using the primer pairs described in SEQ ID NOs: 12 and 13. According to such a screening method, a substance having an action of regulating transcription of the human ABCA1 gene in the liver and a substance useful for preventing or treating arteriosclerotic disease in humans can be provided.

  According to another aspect of the present invention, there is provided an ABCA1 gene transcription regulator containing a substance having an action of changing the amount or activity of the transcription factor HNF4alpha. Substances having the action of changing the amount or activity of the transcription factor HNF4alpha include PGC-1alpha which acts as a transcriptional coactivator of HNF4alpha by increasing intracellular cAMP levels, such as forskolin, isobutylmethylxanthine (IBMX), cAMP analog and the like. It also includes substances that increase the expression of. Such a substance that increases the expression level or activity of the transcriptional regulatory factor HNF4alpha is expected to increase L3-type ABCA1 mRNA.

  The ABCA1 gene transcription regulator containing a substance having an action of changing the amount or activity of the transcription factor HNF4alpha according to the present embodiment is the transcription of the human ABCA1 gene in the liver described as one embodiment of the present invention. The substance can be identified by a screening method for a substance having an effect of regulating the above. More specifically, in the screening method, in particular, a sequence containing a base (SEQ ID NO: 11) from position 3244 to position 3256 from the transcription start position of the L3 type mRNA of human ABCA1 gene shown in SEQ ID NO: 1 is used as an enhancer. Can be identified. As long as such a sequence is included, the length of the enhancer sequence is not limited, and the promoter may be arbitrary.

  The invention is more specifically described in the following examples. However, the present invention is not limited to these examples.

[Detection of ABCA1 mRNA expressed in human liver]
By the 5′-RACE method, the 5 ′ terminal region of ABCA1 mRNA expressed in human liver was analyzed. Primers were designed based on the sequences of ABCA1 mRNA exon 4 and exon 5. SEQ ID NO: 21 shows the sequence of the gene-specific primer used. Using these primers, cDNA was amplified using human liver total RNA (manufactured by Clontech) as a template according to the attached protocol of GeneRacer kit (manufactured by Invitrogen).

  In human liver, ABCA1 mRNA having three different transcription start sites was detected. The two types are the previously reported peripheral type (SEQ ID NO: 22) and liver type (L2 type) (SEQ ID NO: 23). The newly found human liver type (L3 type) ABCA1 mRNA first exon sequence is shown in SEQ ID NO: It is shown in 2. The base sequence of L3-type ABCA1 mRNA is shown in SEQ ID NO: 24. FIG. 1B is a schematic diagram of the 5 ′ end of the detected ABCA1 mRNA. Here, the mRNA tentatively referred to as the peripheral type is ABCA1 mRNA [NM_005502] identified from human fibroblasts and human monocyte-derived THP-1 cells using the 5′-RACE method, and has already been reported in the promoter region. (Upstream of exon 1, Proc. Natl. Acad. Sci. 2000; 97, 7987). The mRNA named L2 is commonly expressed in humans, mice, and rats, and is a mRNA whose transcription is initiated from exon 2. The previously reported liver-type promoter region (exon 2 upstream, Patent Document 1: Non-patent document) It is considered that the transfer is controlled according to the literature 7). The mRNA named human liver type (L3 type) is mRNA whose transcription is initiated from a new exon (exon L3) in intron 3. A region homologous to the human exon L3 region does not exist in mice and rats.

[ABCA1 mRNA expression distribution in human tissues]
Using mRNA obtained from human liver (Human Liver Total RNA; manufactured by Clontech), the abundance ratio of human peripheral ABCA1 mRNA and human liver (L3) ABCA1 mRNA was examined. Human liver type (L3) ABCA1 mRNA level is a primer / probe that recognizes exon L3 region (untranslated region specific to human L3 type), and human peripheral type ABCA1 mRNA level is exon 1 region (untranslated region specific to peripheral type) A primer / probe that recognizes the total ABCA1 mRNA amount was prepared using a primer / probe prepared based on the sequence of the exon 12 region encoding the protein, and a calibration curve was prepared using human liver-type ABCA1 cDNA as a standard, Quantified by real-time RT-PCR. The amount of mRNA in each sample was normalized to the amount of 18SRNA or GAPDH mRNA. The sequences of the human liver type (L3 type) ABCA1 detection probe and the total ABCA1 detection probe are shown below.

-Labeled probe for human L3 type ABCA1 detection (SEQ ID NO: 14)
FAM-TGCCTGCTTTCAGAGTGCTCAATGTGC -TAMRA
-Human L3 type ABCA1 detection forward primer (SEQ ID NO: 12)
GCACTATGCTAAGGCTGGGAAT
-Reverse primer for detecting human L3 type ABCA1 (SEQ ID NO: 13)
TCGTGCTTTATCTGGTTCACTTCT
-Labeled probe for detection of human peripheral ABCA1 (SEQ ID NO: 25)
FAM- TTCCCCGGTTCTGTTTTCTCCCCTT -TAMRA
-Human peripheral type ABCA1 detection forward primer (SEQ ID NO: 26)
GGCGCTTTGCTCCTTGTTT
-Reverse primer for detecting human peripheral ABCA1 (SEQ ID NO: 27)
TCTCTTTCTCCTACCCCTTGACA
-Labeled probe for detecting human total ABCA1 (SEQ ID NO: 28)
FAM-ACACCTGGAGAGAAGCTTTCAACGAGACTAACC -TAMRA
-Forward primer for detecting human total ABCA1 (SEQ ID NO: 29)
TGTCCAGTCCAGTAATGGTTCTGT
-Reverse primer for detecting human total ABCA1 (SEQ ID NO: 30)
AAGCGAGATATGGTCCGGATT

  Using mRNA (human MTC panel I; manufactured by Clontech) obtained from human tissues (liver, muscle, kidney, pancreas, heart, brain, placenta and lung), total ABCA1 mRNA and human liver type (L3 Type) ABCA1 mRNA distribution was quantified by real-time RT-PCR and expressed as a relative ratio to the amount of skeletal muscle abundance (FIG. 2). Total ABCA1 mRNA was also expressed in the liver about twice as much as skeletal muscle, but L3 type was almost specifically expressed in the liver, and it was decided to call it human liver type (L3 type).

[Abundance ratio of liver type (L3 type) ABCA1 mRNA in human liver]
For 4 cases of mRNA (manufactured by Clontech) obtained from human liver, human peripheral type and L3 type ABCA1 mRNA were quantified and compared with the total amount of ABCA1 mRNA, and the peripheral type was found to be 33.4 ± 5.5%. On the other hand, the L3 form was 26.3 ± 9.4%.

[Induction of human liver type (L3 type) ABCA1 mRNA expression by statin drugs]
Human hepatoma-derived cells JHH-5 were cultured in a Williams medium containing 10% FCS and treated with a serum-free medium (0.2% BSA) containing a test compound for 24 hours. As a test compound, HMG-CoA reductase inhibitor / compactin, which is a kind of statin (final concentration 50 μM), was added, and a solvent alone was used as a control. RNA was prepared from the cells using RNeasy (QIAGEN). The total ABCA1 and L3 type ABCA1 mRNA levels in the prepared RNA were measured by real-time quantitative RT-PCR. The amount of mRNA in each sample was normalized to the amount of 18SRNA or GAPDH mRNA.

  When human hepatoma-derived cell JHH-5 cells were treated with 50 μM compactin, the total amount of ABCA1 mRNA increased (FIG. 3A). In compactin-treated cells, peripheral ABCA1 mRNA was decreased (FIG. 3C), but L3-type ABCA1 mRNA was increased (FIG. 3B). Therefore, the usefulness of screening a substance having an effect of regulating ABCA1 mRNA expression in the liver using the amount of L3-type ABCA1 mRNA as an index was shown.

[Function of human liver type (L3 type) ABCA1 mRNA]
Human hepatoma-derived cells JHH-5 cells were treated with siRNA against L3-type ABCA1 mRNA for 32 hours, and then treated with serum-free medium (0.2% BSA) containing 50 μM compactin for 16 hours. As a control, Stealth RNAi negative control high GC (Invitrogen) was used. Cells were solubilized and the expression level of ABCA1 protein was measured by Western blot. Alternatively, after treatment with RNAi, [3H] cholesterol was added to the cell culture medium, cultured for 24 hours, washed, and then treated with 50 μM compactin for 16 hours. Subsequently, the cells were cultured for 6 hours in a medium with or without apolipoprotein AI, and the amount of cholesterol excreted into the medium depending on apolipoprotein AI was measured. The sequence of siRNA for human liver type (L3 type) ABCA1 is shown below.

SiRNA sense 1 (SEQ ID NO: 31) against human liver type (L3 type) ABCA1
AACCCAGGCACACUCCUCCUGUAGC
SiRNA antisense 1 (SEQ ID NO: 32) against human liver type (L3 type) ABCA1
GCUACAGGAGGAGUGUGCCUGGGUU

  When the L3-type ABCA1 mRNA of JHH-5 cells was knocked down using siRNA, ABCA1 protein expression decreased as shown in FIG. 4A. Further, cholesterol excretion (HDL production) into the medium depending on apolipoprotein AI decreased by about 50% (FIG. 4). Accordingly, it was found that L3-type ABCA1 mRNA encodes an ABCA1 protein that is functional and contributes to HDL production.

[Activation of a novel human liver type (L3 type) ABCA1 gene promoter / enhancer by compactin]
The expression regulatory region of human liver type (L3 type) ABCA1 mRNA was analyzed. From human genomic DNA, the region from 426 bases upstream to 480 bases downstream (SEQ ID NO: 3) of the transcription start point of L3-type ABCA1 mRNA (position 38481 of human ABCA1 DNA of SEQ ID NO: 1) was cloned, It was incorporated into the vector pGL3 (Promega) and a promoter reporter plasmid was constructed. A schematic diagram of the construction of the plasmid is shown in FIG. 5, and the structure of the reporter plasmid is shown in FIG. 6 (b). In the following drawings, the numbers in the figure indicate the position of the base from the transcription start point of L3-type ABCA1 mRNA, plus indicates downstream from the transcription start point, and minus indicates upstream from the transcription start point. In addition, 3103 bases to 3378 bases (SEQ ID NO: 6) downstream of the transcription start point of the L3 type mRNA, which is a partial sequence belonging to intron 3, are cloned into the downstream of the luciferase gene of the promoter reporter plasmid, and the promoter / enhancer A reporter plasmid was constructed. The structure of the promoter / enhancer reporter plasmid is shown in FIG. 6 (c). FIG. 6 (a) shows the construction of a plasmid used as a control, in which neither a promoter nor an enhancer is incorporated.

  In addition, 3378 bases (SEQ ID NO: 6) from 3103 bases downstream of the L3 transcription start site were incorporated into a firefly luciferase vector (Promega) having an SV-40 promoter to construct an enhancer reporter plasmid. The structure of the reporter plasmid is shown in FIG. FIG. 7 (a) shows the structure of a plasmid having an SV-40 promoter but not incorporating an enhancer, which was used as a control.

Transient transfection into JHH-5 cells transduced with reporter plasmid and Renilla luciferase reporter plasmid phRL-TK (Promega) for gene transfer efficiency correction, 5% defatted serum containing 50 μM compactin Treated with medium for 16 hours. As a control, it was similarly treated with a solvent (dimethyl sulfoxide (DMSO)). Thereafter, the cells were collected, and intracellular luciferase activity was measured by a dual luciferase assay system (Promega). The transcription activity was defined and evaluated as follows.
(Transcriptional activity) = (Measured value of firefly luciferase activity) / (Measured value of Renilla luciferase activity)

  Furthermore, instead of treating with statin drugs, the transcriptional activity when overexpressing active SREBP2 was also measured. Active SREBP2 was overexpressed by introducing pME-SREBP2 (1-480) (J. Biol. Chem. 2003; 278, 36176) in addition to the enhancer reporter plasmid. The pME-SREBP2 (1-480) plasmid is a vector capable of expressing amino acid residues 1 to 480 of SREBP2, which is an active SREBP2. An empty vector pME-18S plasmid was co-introduced as a control (mock in FIG. 7).

  When JHH-5 cells were treated with compactin, the transcription activity of the reporter plasmid incorporating the upstream region of the human liver type (L3 type) transcription start site was slightly increased (FIG. 6 (b)). Furthermore, the transcription activity of the reporter plasmid incorporating the downstream region of the transcription start point was greatly increased by the compactin treatment (FIG. 6 (c)). This result was in good agreement with the response of L3-type ABCA1 mRNA by statin drugs (Example 4, FIG. 3C). Even when the L3 type downstream region (enhancer region) was incorporated into a reporter plasmid having an artificial SV-40 promoter, it showed an enhancer activity that greatly increased the activity by compactin treatment (FIG. 7 (b)). However, enhancer activity was not affected by overexpression of SREBP2. Therefore, it was shown that the upstream region (promoter region) and the downstream region (enhancer region) of the liver-type transcription start point regulate ABCA1 gene expression in the liver. In addition, it was shown that activation by statin drugs is based on a mechanism different from that of the L2 promoter that SREBP2 directly activates.

[Sequence regulating human liver type (L3 type) ABCA1 gene enhancer activity]
Regarding the L3 type ABCA1 gene enhancer sequence obtained in Example 6, a reporter plasmid in which the 5 ′ side and 3 ′ side were shortened and a plasmid in which the enhancer sequence was partially deleted were prepared (FIG. 9). FIG. 9 (a) is a plasmid in which no enhancer sequence is incorporated, and FIG. 9 (b) is a plasmid in which the enhancer sequence shown in SEQ ID NO: 6 is incorporated as in FIG. 6 (c). FIG. 9 (c) shows 3378 bases to 3378 bases downstream of the L3 transcription start site as an enhancer sequence (shown in SEQ ID NO: 7), and FIG. 9 (d) shows 3378 bases from 3184 bases downstream of the L3 transcription start site as an enhancer sequence. FIG. 9 (e) shows 3259 bases (SEQ ID NO: 8) downstream from the L3 transcription start point as an enhancer sequence, and FIG. 9 (f) shows 3172 bases downstream from the L3 transcription start point as an enhancer sequence. FIG. 9 (g) shows plasmids incorporating 3246 bases from 3172 bases to 3228 bases downstream from the L3 transcription start site and 3242 bases to 3259 bases as enhancer sequences. These plasmids were transduced into JHH-5 cells by the method described in Example 6, treated with 50 μM compactin, and transcriptional activity was measured.

  By shortening the L3-type ABCA1 gene enhancer obtained in Example 6 (FIGS. 9 (c) to 9 (g)), 3172 to 3259 bases downstream of the L3 transcription start point (SEQ ID NO: 8) are responsible for activation by compactin treatment. Further, it was found that the sequence a (SEQ ID NO: 9), sequence b (SEQ ID NO: 10), or sequence c (SEQ ID NO: 11) in the human ABCA1 gene shown in FIG. (Figs. 9 (d), (f), (g)), the three sequences present in the enhancer are therefore transcriptionally regulated by the human ABCA1 gene. It seems that it is functioning.

[Modification of human liver type (L3 type) ABCA1 gene enhancer activity by transcriptional regulatory factor HNF4alpha]
Regarding the sequence of the L3 type ABCA1 gene enhancer obtained in Example 6, a plasmid in which the enhancer sequence was partially deleted was prepared (FIG. 10). SV40 was used as the promoter. FIG. 10 (a) is a plasmid in which no enhancer sequence is incorporated, and FIG. 10 (b) is a plasmid in which 3172 to 3259 bases (SEQ ID NO: 8) are incorporated downstream from the L3 transcription start site. FIG. 10 (c) shows 3246 bases from 3172 bases downstream of the L3 transcription start site as an enhancer sequence, FIG. 10 (d) shows 3259 bases from 3184 bases downstream of the L3 transcription start site as an enhancer sequence, and FIG. ) Is a plasmid in which 3172 bases to 3229 bases and 3244 bases to 3259 bases downstream of the L3 transcription start site are incorporated as enhancer sequences. By the method described in Example 6, these plasmids were transduced into HepG2 cells, and in addition to the enhancer reporter plasmid, an expression vector of the transcriptional regulatory factor HNF4alpha was introduced, and the transcriptional activity was measured. As a mock, the empty vector pCMV5 plasmid was co-introduced. FIG. 11 is a western blot showing that the expression level of the transcriptional regulatory factor HNF4alpha protein is increased in JHH-5 cells treated with 50 μM compactin. As a control, it was treated with a solvent (dimethyl sulfoxide (DMSO)). It was revealed that 50 μM compactin increases HNF4alpha protein expression, activates L3-type ABCA1 gene promoter / enhancer, and increases L3-type ABCA1 mRNA. Furthermore, as shown in the graph of FIG. 10, it was found that the transcriptional regulatory factor HNF4alpha increases the transcription of the reporter gene depending on the sequence c.

  According to the screening method of the present invention, a substance useful for the prevention or treatment of arteriosclerotic diseases can be found, and is extremely useful for the prevention and treatment of HDL elevation and arteriosclerotic diseases.

Claims (3)

  A screening method for a substance having an action of regulating transcription of a human ABCA1 gene, which comprises using DNA having promoter activity and DNA having a sequence in intron 3 of human ABCA1 gene and having enhancer activity.   The method according to claim 1, wherein the DNA having promoter activity comprises a nucleotide sequence in intron 2 of a human ABCA1 gene and has promoter activity.   The method according to claim 1 or 2, wherein the substance having an action of regulating transcription of the human ABCA1 gene is a substance useful for preventing or treating arteriosclerotic diseases.

Images