JP2012005479A - Method of screening anticancer agent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new anticancer agent and a new method of screening an anticancer agent.SOLUTION: This method of screening the anticancer agent includes: a process of bringing a cancer cell manifesting TACC3 protein and a candidate substance into contact with each other; a process of measuring the percentage of a mitotic cell for the cell brought into contact with the substance; and a process of measuring the manifestation or function of the TACC3 protein in the cell brought into contact with the substance. An anticancer agent to at least one selected from a group including lymphoma, angiosarcoma, non-small cell lung cancer, breast cancer, digestive tract tumor and ovarian cancer contains shRNA or siRNA to the TACC3 taking at least one array selected from a group including specific arrays as a target.

Description

  The present invention relates to a novel screening method for anticancer agents. More specifically, the present invention relates to a method for screening an anticancer agent targeting TACC3 or TACC1 protein. The present invention also relates to a novel anticancer agent based on TACC3 or TACC1 protein.

  During mitosis, an extensive network of microtubules in interphase cells is disassembled and the bipolar spindle is reconstituted. Upon nuclear membrane disruption, a pair of centrosomes form a radial array of microtubules whose positive ends are captured and stabilized by the centromere. In addition to this plus-end search and capture model, spindle formation can occur in the absence of a centrosome, which is referred to as an acentric spindle. In this model, microtubule nucleation occurs near the chromosome, and microtubules (K fibers) bound to the centromere are eventually incorporated into the astrocyte. This dynamic formation of microtubules is coordinated by global and local regulation of various classes of proteins, including kinesin and dynein motor proteins and microtubule regulatory proteins.

  The spindle of tumor cells has become a molecular target for cancer chemotherapy (Non-patent Document 1). At present, drugs targeting the microtubules constituting the spindle, such as vinca alkaloids and taxanes, are in clinical use. Of these, the vinca alkaloids vinblastine and vincristine destabilize microtubules, while the taxane paclitaxel stabilizes microtubules. Its anti-mitotic effect on tumor cells is thought to result from the suppression of microtubule dynamic instability. However, drugs targeting microtubules also inhibit microtubule function in non-dividing cells, resulting in serious side effects such as peripheral neuropathy due to disruption of axonal transport of peripheral nerves. .

  To overcome this problem, the development of new drugs targeting non-spindle mitotic proteins that inhibit the spindle without affecting microtubules in non-dividing cells has been investigated (non- Patent Document 2). Spindle formation is coordinated by various microtubule regulatory proteins. In contrast to fundamentally conserved mechanisms, some microtubule regulatory proteins play a central role only in certain somatic cells without affecting spindle formation in other cells. Can be achieved. Develop new cancer chemotherapies that act specifically or selectively on tumor cells by using microtubule regulatory proteins that are involved in spindle formation in tumor cells but do not function in normal cells as molecular targets There is a possibility. However, to date no such protein is known.

Jordan, M.A. et al., Nat. Rev. Cancer, 4: 253-265 (2004) Wood, K.W. et al., Curr. Opin. Pharmacol., 1: 370-377 (2001)

  An object of the present invention is to provide a novel screening method for an anticancer agent and an anticancer agent.

  By inhibiting or depleting TACC3 and / or TACC1 protein, the present inventor causes abnormal spindles during mitosis, stops mitosis, and causes cell death. It was found that normal cells have no effect. Therefore, an anticancer agent targeting TACC3 and / or TACC1 protein can be an anticancer agent having no side effects.

The present invention
[1]
Contacting a cancer cell expressing TACC3 protein with a candidate substance, and measuring a proportion of mitotic cells in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:
[2]
Contacting a cancer cell expressing TACC3 protein with a candidate substance, and measuring the expression or function of TACC3 protein in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:
[3]
The method according to [1] or [2], wherein the anticancer agent is for at least one cancer selected from the group consisting of lymphoma, hemangiosarcoma, non-small cell lung cancer, breast cancer, gastrointestinal tumor and ovarian cancer;
[4]
The method according to [1] or [2], wherein the anticancer agent is for at least one cancer selected from the group consisting of thymic lymphoma, angiosarcoma, small intestine tumor, cecal tumor;
[5]
The cancer cell expressing TACC3 protein is at least one selected from the group consisting of lymphoma cells, hemangiosarcoma cells, non-small cell lung cancer cells, breast cancer cells, gastrointestinal tumor cells and ovarian cancer cells [1] to [4] The method according to any one of
[6]
The cancer cells expressing TACC3 protein are at least one selected from the group consisting of lymphoma cells obtained from p53-deficient animals, hemangiosarcoma cells, and gastrointestinal tumor cells obtained from Apc-deficient animals. 4];
[7]
The cancer cell expressing TACC3 protein is at least one selected from the group consisting of ovarian cancer cell SKOV3 strain, OVCAR3 strain, human Burkitt lymphoma cell and human T cell acute lymphoblastic leukemia cell [1] to [ 4];
[8]
Contacting a cancer cell expressing TACC1 protein with a candidate substance, and measuring a proportion of mitotic cells in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:
[9]
Contacting a cancer cell expressing TACC1 protein with a candidate substance, and measuring the expression or function of TACC1 protein in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:
[10]
The method according to [8] or [9], wherein the anticancer agent is for ovarian cancer;
[11]
The method according to any one of [8] to [10], wherein the cancer cell expressing TACC1 protein is an ovarian cancer cell;
[12]
From the group consisting of lymphoma, hemangiosarcoma, non-small cell lung cancer, breast cancer, gastrointestinal tumor and ovarian cancer comprising shRNA or siRNA against TACC3 targeting at least one sequence selected from the group consisting of SEQ ID NOs: 3-5 An anticancer agent for at least one selected.
[13]
An anticancer agent against ovarian cancer comprising shRNA or siRNA against TACC1 targeting the sequence of SEQ ID NO: 12.
[14]
Lymphoma, hemangiosarcoma, non-small cell lung cancer, breast cancer, gastrointestinal tumor and ovary comprising at least one selected from the group consisting of shRNA of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, 10 siRNA against TACC3 An anticancer agent for at least one selected from the group consisting of cancer.
[15]
The anticancer agent with respect to ovarian cancer containing shRNA of sequence number 13 or siRNA of sequence number 14 with respect to TACC1.
About.

  According to the present invention, a screening method for an anticancer agent targeting TACC3 or TACC1 protein is provided. In addition, new anticancer agents based on TACC3 or TACC1 protein are provided.

FIG. 1 shows that destruction of TACC3 leads to regression of thymic lymphoma in vivo. FIG. 1a shows the schedule of 4OHT administration of p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2 mice (TACC3 ^{S / W} ) and p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice (TACC3 ^{S / D} ) (top), MRI images (center) and tumor burden (bottom) of thymic lymphoma tissue are shown. In the middle diagram of FIG. 1a, thymic lymphomas are indicated by asterisks (*). In the lower graph of FIG. 1a, gray bars and black bars represent p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2 mice (TACC3 ^{S / W} ) and p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice (TACC3 ^{S / D), respectively.} ) Shows the change in tumor mass in FIG. FIG. 1 b shows the pOH ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mouse schedule of 4OHT administration (top), MRI image of thymic lymphoma tissue (middle) and tumor burden (bottom). In the middle diagram of FIG. 1b, thymic lymphomas are indicated by asterisks (*). FIG. 1c shows a summary of tumor volume response. In FIG. 1c, the black and gray bars represent 4OHT-treated p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 (TACC3 ^{S / D} 40OHT (+)) and 4OHT untreated p53 ^{− / −} ; TACC3 ^{S / D} ; The changes in tumor burden in CreERT2 (TACC3 ^{S / D} 40OHT (−)) or 4OHT-treated p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2 (TACC3 ^{S / W} 4OHT (+)) mice are shown. FIG. 2 shows that TACC3 depletion leads to abnormal spindle and mitotic arrest followed by rapid induction of apoptosis. FIG. 2a treats thymic lymphoma cells from p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2 (TACC3 ^{S / W} ) and p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 (TACC3 ^{S / D} ) mice with 4OHT. (4OHT (+)) or left untreated (4OHT (-)) and the results of analysis of TACC3 protein expression over time by immunoblot are shown. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. FIG. 2b shows the results of the cell proliferation assay. Lymphoma cells with the indicated allele (TACC3 ^{S / W} or TACC3 ^{S / D} ) were treated with 4OHT (4OHT (+)) or left untreated (4OHT (−)) and viable cells were counted. FIG. 2c shows the results of FACS analysis. Cells were treated as described for FIG. 2b and stained with propidium iodide (PI). FIG. 2d shows an increase in the mitotic index. Cells were treated as described with respect to FIG. 2b, fixed and identified by immunostaining mitotic cells with anti-MPM-2 antibody. TACC3 negative and positive cells are indicated by black and gray bars, respectively. FIG. 2e shows the induction of multipolar spindles in TACC3-depleted lymphoma cells. Cells from p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice were treated with 4OHT (4OHT (+)) or left untreated (4OHT (−)), fixed and stained (FIG. 2e) . FIG. 2f shows the induction of multipolar spindles in TACC3-depleted lymphoma cells. ^{p53 - / -; TACC3 S /} W; CreERT2 mice (TACC3 ^{S / W)} or ^{p53 - / -; TACC3 S /} D; CreERT2 mice (TACC3 ^{S / D)} derived cells are treated with 4OHT or (4OHT (+ )) Or left untreated (4OHT (-)), fixed and stained. Percentage of cells including normal bipolar spindle (dark gray and diagonal bars) and multipolar spindle (black and light gray bars) count at least 50 mitotic cells in 3 independent experiments Decided by. TACC3 positive and negative cells are shown as dark gray and black bars, and hatched and light gray bars, respectively. FIG. 2g shows cell fate analysis of TACC3-depleted lymphoma cells. The chromosomal behavior of cells during mitosis was examined by time-lapse photography of H2B-GFP expressing cells. The time of nuclear membrane collapse is defined as 0:00. FIG. 2h shows cell fate analysis of TACC3-depleted lymphoma cells. Normal mitosis is indicated by dark gray diamonds. Death after mitosis and mitotic slippage is indicated by white triangles and black circles, respectively (FIG. 2h). FIG. 3 shows that TACC3 depletion leads to apoptosis in human lymphoma cells. FIG. 3a shows the expression of TACC3 protein in human lymphoma. TACC3 immunohistochemistry was performed using a human lymphoma tissue array. A representative view of the displayed tumor tissue is shown. The inset shows the results at a lower magnification. FIG. 3b shows TACC3 depletion. One control (C) and two TACC3 shRNAs (sh1 (SEQ ID NO: 7) and sh2 (SEQ ID NO: 8)) were introduced into cells and TACC3 expression was examined by immunoblot analysis, with NADPH as a loading control. Show. FIG. 3c shows the induction of apoptosis. Apoptosis of control (SEQ ID NO: 18) or TACC3 shRNA (sh1, sh2) transduced cells was examined by Annexin V staining followed by FACS analysis. FIG. 3d shows the viability of TACC3-depleted human lymphoma cells. Relative cell viability after TACC3 depletion was determined by MTT assay. The viability of control shRNA transduced cells was defined as 1.0. FIG. 3e shows an increase in the mitotic index. Mitotic index was determined by immunostaining with anti-MPM-2 antibody. FIG. 3f displays cells showing multipolar spindle induction. shRNA was used for transduction, fixation, and analysis by immunofluorescence. A representative diagram of Jurkat cells is shown. FIG. 3g displays cells showing multipolar spindle induction. shRNA was used for transduction, fixation, and analysis by immunofluorescence. The percentage of cells containing multipolar spindles was determined by counting at least 50 mitotic cells in 3 independent experiments. FIG. 4a shows an immunoblot of TACC3 protein in cervical cancer cells (Hela) and ovarian cancer cells (SKOV3 and OVCAR3) treated with TACC3 siRNA (SEQ ID NO: 9). (+) Indicates TACC3 siRNA treatment, and (−) indicates treatment with control siRNA (SEQ ID NO: 19). Anti-TACC3 indicates that an anti-TACC3 antibody was used as the first antibody, and anti-GAPDH indicates that an anti-GAPDH antibody (control) was used as the first antibody. FIG. 4b shows the mitotic index in cervical cancer cells (Hela) and ovarian cancer cells (SKOV3 and OVCAR3) treated with TACC3 siRNA. The mitotic index was determined by counting the proportion of mitotic cells in at least 50 cells in 3 independent experiments. FIG. 4c is a photograph showing the morphology (Normal, bipolar-misalinged, multipolar, monopolar) of the cells treated with TACC3 siRNA. FIG. 4d is a summary of spindle abnormalities in ovarian cancer cells (SKOV3 and OVCAR3) treated with TACC3 siRNA. Control indicates SKOV3 and OVCAR3 treated with control siRNA, and TACC3 indicates SKOV3 and OVCAR3 treated with TACC3 siRNA. Spindle morphology (%) counts the proportion of cells with spindles in the normal, bipolar-misalinged, multipolar or monopolar form in at least 50 mitotic cells in 3 independent experiments Determined by. FIG. 5a shows the change in tumor size after transplantation of ovarian cancer cells SKOV3 into NOD-scid mice. # 1 ctrl, # 2 ctrl and # 3 ctrl indicate mice (control) transplanted with SKOV3 treated ovarian cancer cells treated with a vector containing control shRNA (SEQ ID NO: 18), # 1 exp, # 2 exp and # 3 exp indicates a mouse transplanted with ovarian cancer cells SKOV3 treated with a vector having shRNA (SEQ ID NO: 7). The day when the ovarian cancer cell SKOV3 is transplanted is defined as the first day. FIG. 5 (b-1) is a photograph of the transplantation site of the # 1 ctrl mouse on day 111. Figure (b-2) is a photograph of the tumor taken from the transplantation site of the # 1 ctrl mouse on day 111. The tumor volume was 4878.4 m ³ . FIG. 5 (c-1) is a photograph of the transplantation site of # 2 ctrl mouse on day 70. The tumor volume removed from the transplantation site of the # 2 ctrl mouse on day 70 was 389.8 m ³ . Figure (d-1) is a photograph of the transplantation site of the # 3 ctrl mouse on day 111. Figure (d-2) is a photograph of a tumor taken from the transplantation site of a # 3 ctrl mouse on day 111. The tumor volume was 4854.4 m ³ . FIG. 6a shows mitotic arrest in ovarian cancer cells SKOV3 treated with TACC3, TACC1 or TACC2 siRNA. The mitotic index indicates the proportion of mitotic cells in at least 50 cells (n = 3). Control indicates control siRNA, TACC1 is treated with siRNA of SEQ ID NO: 14, TACC2 is treated with siRNA of SEQ ID NO: 12, and TACC3 is treated with siRNA of SEQ ID NO: 9. FIG. 6b is a summary of the spindle morphology of ovarian cancer cells SK-OV3 treated with TACC3, TACC1 or TACC2 siRNA. Normal, bipolar-misalinged or Multipola-A represent the proportion of cells having a spindle of normal, bipolar-misalinged or bipolar-A form among at least 50 cells exhibiting mitosis (n = 3). Multipolar-A refers to a form in which a central body is present only in two of the many spindle poles. FIG. 7 shows that TACC3 depletion leads to a decrease in tumor number in vivo in Apc580S mice. W ^/ W represents Tacc3W / W, ApcS / W, Villin-Cre (+) mice, and S / D represents Tacc3S / D, ApcS / W, Villin-Cre (+) mice. Shown as the average total number of small and large intestine cancers per mouse.

  “TACC3” (also referred to as “Tacc3”) and “TACC1” (also referred to as “Tacc1”) are one type of protein belonging to the TACC (transforming acidic coiled-coil containing) family. In mammals, proteins belonging to three TACC families of TACC1, TACC2, and TACC3 have been identified. As used herein, the terms “TACC3” and “TACC1” refer to mammalian TACC3 and TACC1 proteins. The mammal can be any mammal such as a mouse, rat, rabbit, guinea pig, dog, cat, cow, horse, goat, sheep, monkey, human. Preferably the mammal is a human. Nucleotide sequences of genes encoding TACC3 and TACC1 and amino acid sequences of TACC3 and TACC1 proteins are available from a database (GenBank accession number NM_006342.1 (SEQ ID NO: 1), NM_006283 (SEQ ID NO: 2), UniProt accession, respectively) The sequences of numbers Q9Y6A5 and O75410-1 are preferred).

  The present invention provides a method for screening an anticancer agent targeting TACC3 and / or TACC1 protein. The cancer to be treated using the substance identified by the screening method of the present invention as an anticancer agent is any cancer. As described below, TACC3 has been shown to be aberrantly expressed in various human cancers, but we were the first to show in vivo that inhibition or depletion of TACC3 could cause tumor regression. It is. In one embodiment, the cancer is selected from lymphoma or sarcoma. “Lymphoma” refers to any tumor of lymphoid tissue, and “sarcoma” refers to any tumor of connective tissue. In one embodiment, the lymphoma is a thymic lymphoma that is a tumor arising from the thymus, one of the lymphoid tissues. In another embodiment, the sarcoma is an angiosarcoma that is a blood vessel-derived tumor. TACC3 has been reported as one of the genes whose expression is increased in mouse lymphomas caused by insertion of MoMuLV-ts1 retrovirus (Chakraborty, J. et al., Virology, 377: 100-109 (2008)). This report does not suggest that lymphomas can be treated targeting the TACC3 protein. There is no example described about the relationship between TACC3 and sarcoma.

  Ovarian cancer means a cancer that occurs in the ovary, but is not limited to, preferably a germ cell tumor (preferably immature teratoma, yolk sac tumor, choriocarcinoma, anaplastic germ cell tumor), sex stroma Tumor (preferably Sertoli / stromal cell tumor, fibrosarcoma, granulosa cell tumor), superficial epithelial / stromal tumor (preferably serous adenocarcinoma, endometrioid tumor, clear cell carcinoma) .

  A gastrointestinal tumor refers to a tumor that develops in the gastrointestinal tract, and is preferably colon cancer or small intestine cancer. Colorectal cancer means cecal cancer, colon cancer, rectal cancer, which occurs in the cecum, colon, and rectum. Small intestine cancer means a duodenal tumor or a jejunum / ileal tumor that occurs between the duodenal bulb and the ileocecal valve.

  Breast cancer means cancer that begins in breast tissue. Although not limited, Adenocarcinoma is preferable. Non-small cell lung cancer refers to cancer that develops in lung tissue that is not in the form of small cells. Although not limited, Adenocarcinoma, Large cell carcinoma, and Squamous cell carcinoma are preferable.

  In the present invention, cancer and tumor are used interchangeably.

  The screening method for an anticancer agent of the present invention comprises a step of contacting a candidate substance with a cell expressing TACC3 and / or TACC1 protein. A cell expressing TACC3 or TACC1 protein may be any cell that can observe the effects resulting from decreased or lost expression or function of TACC3 or TACC1 gene, or TACC3 or TACC1 protein by the action of a candidate substance. Cells can be used. In one embodiment, the cell expressing TACC3 protein is a lymphoma cell or sarcoma cell obtained from a p53-deficient animal. In another embodiment, the cell expressing TACC3 protein is a human Burkitt lymphoma cell or a human T cell acute lymphoblastic leukemia (T-ALL) cell. In another embodiment, ovarian cancer cells, intestinal tumor cells, breast cancer cells, non-small cell lung cancer cells, breast cancer cells can also be used as cells that express TACC3 or TACC1 protein.

  For example, the influence of a candidate substance on the TACC3 or TACC1 gene or TACC3 or TACC1 protein can be determined by observing the formation of abnormal spindles such as multipolar spindles in cells contacted with the candidate substance or by the percentage of mitotic cells It can be observed by measuring the length of the mitosis period, the degree of cell death, and the like.

  Conventionally, when screening for anticancer agents using cells, generally, the survival rate of cells after contact with a candidate substance has been used as an index. The inventors have found that depletion of TACC3 or TACC1 protein results in abnormal spindle morphology (such as multipolar spindles) and affects cell fate. Therefore, these can be used as an index in screening for anticancer agents. For example, an expression vector of a fusion protein of α-tubulin and a reporter gene product (for example, green fluorescent protein (GFP)) is introduced into a target cell to visualize the microtubule, and the cell contacted with a candidate substance is a fixed specimen An anti-cancer agent can be selected using as an indicator that the cell fate of mitotic slippage or mitosis indicates cell death after observation by fluorescence staining, time-lapse photography, or the like.

Therefore, in one embodiment, the screening method (A) for an anticancer agent of the present invention comprises:
Contacting cancer cells with a candidate substance;
Counting mitotic cells; and selecting the substance having an increased proportion of mitotic cells compared to the percentage of mitotic cells in the cells not in contact with the substance;
It can be a method including.

  An anticancer agent means an agent that regresses cancer or delays or suppresses the growth of cancer.

  The candidate substance is not limited, but is preferably a low molecular compound, a nucleic acid, a protein, or the like. Candidate substances may be naturally derived or artificially synthesized.

  A cancer cell will not be limited if it is a cancer cell expressing TACC3 or TACC1. Preferred are lymphoid tumor cells, vascular sarcoma cells, ovarian cancer cells, intestinal tumor cells, non-small cell lung cancer cells, breast cancer cells and the like. Cancer cells introduce a fusion gene of a protein related to the spindle such as tubulin and a reporter gene product (for example, a fluorescent protein gene such as GFP, DsRed, a luminescent protein gene such as luciferase, an enzyme gene such as galactosidase). Alternatively, it may be an expressing cell.

  Contacting a cancer cell with a candidate substance means adding a candidate substance to the cell and bringing the candidate substance into contact with TACC3 or TACC1 protein in the cancer cell.

  The contact (incubation) time between the cancer cell and the candidate substance is not limited, but is 24 hours to 72 hours, preferably 36 hours to 60 hours. The cells are not limited, but are preferably seeded on a microchip or a microplate. The number of cells may not be limited as long as it is a number suitable for screening.

  Methods for determining mitotic cells are well known to those skilled in the art and are not limited, but it is preferable to observe the presence or absence of spindles with a microscope after fixing the cells.

  Methods for fixing cells are well known to those skilled in the art and include, but are not limited to, organic solvents, preferably methanol, glutaraldehyde or paraformaldehyde.

  The method of observing the spindle is well known to those skilled in the art and is not limited, but it is preferable to use immunostaining using an antibody against a protein related to the spindle, such as an anti-tubulin antibody.

  Immunostaining is well known to those skilled in the art, and it is preferable to use a fluorescent label such as FITC, Cy3, a luminescent label such as luciferase, an enzyme such as peroxidase, and an antibody labeled with a radioactive substance. A fluorescent label is preferable because fluorescence can be observed directly. In the case of a luminescent label, it can be observed by luminescence after reaction with the corresponding substrate. In the case of enzyme labeling, it can be observed by color development after reaction with the corresponding substrate. Further, an unlabeled antibody may be used. When an unlabeled antibody is used as the first antibody, it can be observed using the labeled second antibody by the method corresponding to the label as described above.

  Introducing a fusion gene between a tumor cell-related protein such as tubulin and a reporter gene product (for example, a fluorescent protein gene such as GFP, DsRed, a luminescent protein gene such as luciferase, an enzyme gene such as galactosidase). In the case of the treated cells, the spindle can be observed by detecting the reporter gene product.

  Stained spindles and cells are preferably observed using a microscope equipped with a detection device and an image capturing device corresponding to the label. Determination of mitotic cells and counting thereof may be performed visually or using image processing software.

  The ratio of mitotic cells means the percentage (%) of cells having spindles in a predetermined number of cells (preferably 50 or more, more preferably 50 to 100). An increase in the proportion of mitotic cells is at least 1.5 times, preferably at least 2 times, more preferably at least 3 times compared to the proportion of mitotic cells in cancer cells that have not been contacted with the candidate substance. Means an increase.

  Furthermore, the ratio of normal and abnormal spindles (bipolar-misalinged, multipolar or monopolar) of mitotic cells may be measured. An abnormal spindle means a state in which the spindle has a bipolar and is not aligned (normal), and is bipolar but not aligned (bipolar-misalinged), multipolar or unipolar. There are polar (monopolar). The determination of normal and abnormal spindles and the counting thereof may be performed visually or using image processing software.

  The ratio of abnormal spindles means the percentage (%) of abnormal spindles in a predetermined number of mitotic cells (preferably 50 or more, more preferably 50 to 100). An increase in the proportion of abnormal spindles is an increase of at least 1.5 times, preferably at least two times, more preferably at least three times compared to the proportion of abnormal spindles in cancer cells that have not been contacted with the candidate substance. Means.

  The influence of the candidate substance on the expression or function of the TACC3 or TACC1 gene, or the TACC3 or TACC1 protein is, for example, binding of the candidate substance and TACC3 or TACC1 protein in vitro, TACC3 or TACC1 gene transcript in a cell, Or the amount of TACC3 or TACC1 protein (eg Northern blotting, RT-PCR, Western blotting, ELISA, detection of production of fusion protein of TACC3 or TACC1 protein and reporter gene product), subcellular localization of TACC3 or TACC1 protein Etc. can be confirmed by examining using any known method.

Therefore, in one embodiment, the screening method (B) of the anticancer agent of the present invention comprises:
Contacting cancer cells with a candidate substance;
Measuring the expression or function of TACC3 or TACC1 protein in the cell; and comparing the expression or function of TACC3 or TACC1 protein compared to the expression or function of TACC3 or TACC1 protein in a cancer cell not contacted with the substance; Selecting the reduced material;
It can be a method including.

  A decrease in the expression of TACC3 or TACC1 protein indicates that the expression of TACC3 or TACC1 protein is at least 1/2 or less, preferably at least 1 / compared to the expression of TACC3 or TACC1 protein in cancer cells not contacted with the candidate substance. It means 10 or less, more preferably a level that cannot be detected. Moreover, the decrease in the function of TACC3 or TACC1 protein may be a change in the intracellular localization of TACC3 or TACC1 protein in cancer cells that have not been contacted with the candidate substance.

  The screening methods (A) and (B) may be used in combination. Furthermore, a conventional screening method for anticancer agents using cell viability as an index may be added to the method of the present invention.

  We first showed that TACC3 or TACC1 protein can be a target for cancer chemotherapy as a non-spindle mitotic protein. Non-spindle mitotic proteins such as Eg5, polo-like kinase, and Aurora kinase have been used in cancer chemotherapy for the purpose of avoiding side effects caused by drugs that target the microtubules that make up the spindle, such as vinca alkaloids and taxanes. Was expected as a potential candidate for target. However, there have been no cases where cancer has been regressed targeting these.

  We have shown for the first time in vivo that tumors can be regressed by inhibition or depletion of TACC3. Furthermore, no obvious abnormalities were observed in normal tissues (including thymus expressing TACC3 protein). In addition, it was found that the same spindle abnormality as TACC3 occurs in tumor cells due to TACC1 depletion. Therefore, by the screening method of the present invention that targets TACC3 and / or TACC1 protein for cancer chemotherapy, an anticancer agent that selectively or specifically acts on cancer cells without showing side effects on normal tissues can be obtained. .

  The present inventors have found that depletion of TACC3 protein leads to regression of lymphomas such as thymic lymphoma and sarcomas such as hemangiosarcoma in p53-deficient mice, but almost no abnormality is observed in rhabdomyosarcoma cells. The function was shown to be “cell context-dependent”. As described below, the function of TACC3 was not clear before the present invention. The type-dependent function of TACC3 is thought to explain the reason.

  Maskin, a Xenopus TACC homolog, is important in spindle formation, and Drosophila TACC family member D-TACC affects the stability of centrosome microtubules, and Caenorhabditis elegans TAC-1 which is a TACC homologue of) has an effect on early embryogenesis. Thus, the TACC family of proteins is known to exist in a wide range of organisms and play a conserved role in mitosis.

  On the other hand, the human TACC3 gene was originally isolated as a cancer-related gene mapped to 4p16 near the translocation breakpoint in multiple myeloma (Still, IH et al., Genomics, 58: 165-170 (1999) ), And then, it was shown to be abnormally expressed in various human cancers such as ovarian cancer, non-small cell lung cancer, and breast cancer, suggesting that TACC3 protein may have an important function in tumor cells (Lauffart , B. et al., BMC Women's Health, 5: 8 (2005); Jung, CK et al., Pathol. Int., 56: 503-509 (2006); Ma, X-.J. Et al., Proc. Natl. Acad. Sci. USA, 100: 5974-5979 (2003); Jacquemier, J. et al., Cancer Res., 65: 767-779 (2005)).

In HeLa cells, TACC3-depleted cells have been reported to construct correctly configured bipolar spindles (Gergely, F. et al., Genes Dev., 17: 336-341 (2003)). On the other hand, the inventors previously have depleted the TACC3 protein to form abnormal spindles in ovarian cancer cell lines, leading to mitotic arrest and leading to cell death in mitotic slippage or mitosis. It has been found that the TACC3 protein has an important role in the spindle formation of ovarian cancer cell lines (The 68th Annual Scientific Meeting of the Japanese Cancer Association (2009 Abstracts, 252nd, Abstract No. O- 641) Moreover, in NIH3T3 cells, depletion of TACC3 protein does not impair mitotic progression, but has been reported to induce post-mitotic p53-p21 ^WAF pathway leading to reversible cell cycle arrest. (Schneider, L. et al., Oncogene, 27: 116-125 (2008)).

  When the TACC3 protein is depleted in lymphoma, the spindle formation checkpoint (SAC) is activated due to spindle dysplasia (multipolar spindle formation), leading to mitotic arrest, Tumors have been shown to undergo apoptotic cell death at mitosis or after mitotic slippage. Cell fate after mitotic arrest depends on two antagonizing networks, one is a pathway of apoptotic cell death involving caspase activation and the other is protection from cyclin B1 degradation (Gascoigne, KE et al., Cancer Cell, 14: 111-122 (2008)). Rapid apoptosis after mitotic arrest suggests that there is a strong endogenous cell death signal in the cell. Cell death after mitotic slippage can be explained in a similar manner, with cells being constrained to apoptosis during mitotic arrest and thought to result in cell death soon after cell cycle progression. This suggests that the efficacy of cancer chemotherapy targeting non-spindle mitotic proteins such as TACC3 protein is determined in a cell type-dependent manner by the cellular response to SAC.

Furthermore, the inventors have found that depletion of TACC3 protein induces thymic lymphoma apoptosis in p53-deficient and p53 wild-type mice, whereas normal thymus does not show increased apoptosis upon depletion of TACC3 protein, It was shown that the role of TACC3 protein is not “cell lineage dependent”. This feature indicates that anti-cancer agents can be developed that can selectively or specifically treat cancer cells without side effects on normal cells, even cells of the same cell lineage.
The present inventors have also found that depletion of TACC3 protein reduces gastrointestinal tumor development and does not cause side effects on normal cells in Apc-deficient mice and Apc wild-type mice.

  Anticancer agents obtained by the methods of the present invention may be effective for any cancer that is regressed or killed by depletion of TACC3 or TACC1 protein, including lymphomas and sarcomas. By identifying those among a wide range of tumor types that are sensitive to TACC3 or TACC1 protein depletion, additional cancers for which treatment targeting TACC3 or TACC1 protein is effective can be identified. The depletion of TACC3 or TACC1 protein can be achieved by any known means such as an anticancer agent obtained by the screening method of the present invention, deletion of TACC3 or TACC1 gene in transgenic animals, shRNA, siRNA, ribozyme, antisense DNA against TACC3 or TACC1. It can be achieved by using. In particular, the TACC3 conditional knockout animal obtained by the present inventors is useful for the functional analysis of TACC3, the study of cancer sensitive to TACC3 depletion, and the like. It should be noted that nucleic acids such as shRNA, siRNA, ribozyme, and antisense DNA against TACC3 or TACC1 can be used as an anticancer agent in a pharmaceutical composition.

  The shRNA or siRNA against TACC3 is not limited as long as it silences TACC3, but the sequence at positions 2000 to 2024 in the TACC3 gene (NM_006342.1): 5'GACCTATAGTGGACCTGCTCCAGTA 3 (SEQ ID NO: 3), positions 1905 to 1925 The target sequence is 5′GCTTGTGGAGTTCGATTTCTT 3 ′ (SEQ ID NO: 4) or the sequence of positions 589 to 609: 5′CCAGGAAGTTCTGAGAACCAA 3 ′ (SEQ ID NO: 5).

  The shRNA targeting the sequence of SEQ ID NO: 3 is preferably, but not limited to, one having the sequence of SEQ ID NO: 6: 5′CCGGGACCUAUAGUGGACCUGCUCCAGUACUCGAGUACUGGAGCAGGUCCACUAUAGGUCUUUUUG 3 ′.

The shRNA targeting the sequence of SEQ ID NO: 4 is not limited, but preferably has the sequence of SEQ ID NO: 7 (TRCN0000062026): 5′CCGGGCUUGUGGAGUUCGAUUUCUUCUCGAGAAGAAAUCGAACUCCACAAGCUUUUUG 3 ′.

  The shRNA targeting the sequence of SEQ ID NO: 5 is not limited, but preferably has the sequence of SEQ ID NO: 8 (TRCN0000062027): 5′CCGGCCAGGAAGUUCUGAGAACCAACUCGAGUUGGUUCUCAGAACUUCCUGGUUUUUG 3 ′.

  The siRNA targeting the sequence of SEQ ID NO: 3 is not limited, but preferably has a sequence of SEQ ID NO: 9 (TACC3-HSS116027): 5 ′ UACUGGAGCAGGUCCACUAUAGGUC 3 ′.

  The siRNA targeting the sequence of SEQ ID NO: 4 is not limited, but preferably has the sequence of SEQ ID NO: 10: 5′AAGAAAUCGAACUCCACAAGC 3 ′.

  The siRNA targeting the sequence of SEQ ID NO: 5 is not limited, but preferably has the sequence of SEQ ID NO: 11: 5 ′ UUGGUUCUCAGAACUUCCUGG 3 ′.

  The shRNA or siRNA against TACC1 is not limited as long as it silences TACC1, but it targets the complementary sequence at position 2448 to 2522 in the TACC1 gene (NM_006283): 5'AAGAATGAAGAAGCCTTGAAGAAAT 3 '(SEQ ID NO: 12) Those are preferred.

  The shRNA targeting the sequence of SEQ ID NO: 12 is preferably, but not limited to, one having the sequence of SEQ ID NO: 13: 5′CCGGAAGAAUGAAGAAGCCUUGAAGAAAUCUCGAGAUUUCUUCAAGGCUUCUUCAGCAACUUUUUUG3 ′.

  The siRNA targeting the sequence of SEQ ID NO: 12 is not limited, but preferably has the sequence of SEQ ID NO: 14 (TACC1-HSS186179): 5'AUUUCUUCAAGGCUUCUUCAGCAACU 3 '.

  In the case of siRNA, it is preferable to have a 2-base overhang at the 3 'end of each strand. A more preferred overhang is TT.

  siRNA or shRNA may be synthesized intracellularly based on DNA.

  In DNA-based shRNA synthesis, a vector that expresses (transcribes) a sense strand and an antisense strand linked via a hairpin sequence is introduced into the cell, and the sense strand and the antisense strand linked via a hairpin sequence in the cell. The single-stranded RNA is produced and the sense strand and the antisense strand are naturally paired via a hairpin.

  The shRNA having the sequence shown in SEQ ID NO: 7 can be synthesized from an expression vector having the DNA of SEQ ID NO: 7 (provided that U in the sequence is replaced with T) linked to a promoter. Similarly, the shRNA having the sequence shown in SEQ ID NO: 6, 8 or 13 can be synthesized from the expression vector.

  In siRNA synthesis based on DNA, a vector that expresses (transcribes) each of the sense strand and the antisense strand is introduced into the cell, and the sense strand and the antisense strand are separately produced in the cell, This can be done by spontaneously forming pairs of antisense strands.

  The siRNA having the sequence shown in SEQ ID NO: 10 comprises SEQ ID NO: 10 linked to the first promoter (provided that U in the sequence is replaced with T) and a complementary sequence of SEQ ID NO: 10 linked to the second promoter (U in the sequence). Can be synthesized by introducing into a cell an expression vector having the DNA of Similarly, siRNA having the sequence shown in SEQ ID NO: 9, 11 or 14 can be synthesized from the expression vector.

  The promoter and expression vector are not limited as long as they enable RNA synthesis in cells.

The present inventors have shown that depletion of TACC3 protein in p53-deficient mice causes p53-independent cell death such as lymphoma. This finding was observed in NIH3T3 cells, where TACC3 protein depletion induced post-mitotic p53-p21 ^WAF pathway, leading to cell cycle arrest (ie, TACC3 protein depletion suppressed cell death). (Schneider, L. et al., Oncogene, 27: 116-125 (2008)). Therefore, although not limited thereto, the anticancer agent obtained by the screening method of the present invention may be particularly effective for a wide range of cancers involving mutations in the p53 gene.

  The present inventors have also shown that gastrointestinal tumor development is suppressed by depleting the TACC3 protein in Apc-deficient mice. Therefore, the anticancer agent obtained by the screening method of the present invention may be particularly effective for cancers involving mutations in the Apc gene.

  In one embodiment, the present invention can include the use of a nucleic acid of the present invention, in particular siRNA or shRNA, for the manufacture of an anticancer agent. Moreover, the therapeutic method which administers the effective amount of the anticancer agent of this invention to a cancer patient can be included.

  The anticancer agent of the present invention includes an expression vector. The expression vector is not limited as long as it can express the siRNA or shRNA of the present invention, but a viral vector or a plasmid is preferable. Moreover, you may introduce | transduce as naked DNA.

The anticancer agents of the present invention preferably comprise a physiologically acceptable vehicle, excipient, carrier, or diluent suitable for administration to a subject, or a combination thereof.
Although the anticancer agent of the present invention is not limited, it can be administered preferably once or several times a day locally in the tumor site. The administration period can be arbitrarily determined according to age and symptoms. For example, it can be administered in 2 to 10 days at regular intervals of several days. Systemic administration may also be performed. Examples of the preparation include injections and drops.

  The effective amount or dose of the anticancer agent of the present invention is not particularly limited, and may be appropriately selected depending on the administration form, age, weight, and symptoms. For topical administration, it can contain about 1 to about 1000 μg, preferably about 10 to about 500 μg of siRNA or shRNA per topical dose. In the form of an expression vector, about 0.05 to about 10 μg, preferably about 0.1 to about 1 μg of expression vector can be included. In the case of systemic administration, it may contain 1 to 200 mg / kg, preferably 2 to 25 mg / kg siRNA or shRNA per adult. When in the form of an expression vector, it can contain about 0.01 to about 10 mg / kg, preferably about 0.1 to about 1 mg / kg of the expression vector.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to these Examples.

Materials and Methods Antibodies and TUNEL Assays Antibodies against mouse TACC3 were generated as previously described (Yao, R. et al., Cancer Sci., 98: 555-562 (2007)). Antibodies against human TACC3 were generated by immunizing rabbits with a peptide corresponding to amino acids 213-224 of human TACC3 and purified using a peptide-binding immunoaffinity column. Anti-PCNA antibody (CBL407) and anti-GADPH antibody (sc-25778) were purchased from Chemicon and Santa Cruz, respectively. An antibody against α-tubulin (DM1A) and an antibody against γ-tubulin (GTU-88) were obtained from Sigma. For triple staining shown in FIG. 2, FITC-conjugated anti-α-tubulin (Sigma) antibody and Cy3-conjugated anti-γ-tubulin antibody (Sigma) together with anti-human TACC3 antibody labeled with Alexa Flour 647 (Molecula Probe). used. Anti-phospho-histone H3 (ser10) and anti-MPM-2 antibodies were purchased from Cell Signaling and Novus, respectively. The TUNEL assay was performed using the ApoTag PLUS Fluorescein In Situ Apoptosis Detection kit (Chemicon) according to the manufacturer's instructions.

Mouse tumor cells To generate mouse cell lines from thymic lymphoma and rhabdomyosarcoma, tumors are minced with a razor, filtered through a 70 μm filter, and supplemented with GIT medium (thymic lymphoma cells) or 10% calf serum. In DME medium (rhabdomyosarcoma cells). To determine DNA content, cells were fixed in ice-cold methanol, stained with propidium iodide, and analyzed using a FACS caliber (Becton Dickinson).

TACC3 knockdown of human lymphoma cells and cell viability assay Cells were transferred to pLKO. From the TRC shRNA Library. Transduction was performed using 1 puro lentiviral shRNA vector (TRC0000062023-27, Open Biosystems). Lentiviral particles were isolated from pLKO. Using lipofectamine 2000 (Invitrogen). 1 construct (Open Biosystems) and pMD2. Produced by co-transfection of 293T cells with G (Open biosystems) and psPAX2 (Open biosystems) plasmids and supernatants were harvested 48 and 72 hours after transfection. Cells are incubated with lentiviral supernatant for 24 hours in the presence of 6 μg / ml polybrene (Sigma) and infected cells are treated with 2 μg / ml (Daudi, Jurkat and CCRF-CEM) or 4 μg / ml (Raji) puromycin. Selected using. Immunoblot analysis was performed 48 hours after infection. Viable cell numbers were determined using the MTT assay (Roche) for 4 consecutive days. Annexin V staining was performed 72 hours post infection using Annexin-V-FLUOS staining kit (Roche) according to manufacturer's instructions.

Immunoblot Whole cell lysates were prepared in 1% NP-40 buffer (1% NP-40, 50 mM Tris-HCl (pH 8.0), 150 mM NaCl and 10% glycerol). Equal amounts of protein were separated by SDS-PAGE and transferred to nitrocellulose. Blots were incubated with primary antibody followed by peroxidase conjugated secondary antibody and visualized using ECL detection system (GE Healthcare). For quantification, blots were scanned and total pixel intensity was counted using ImageJ1.42a software.

Immunofluorescence Cells were fixed in 3.7% PFA, permeabilized in 0.2% Triton-X100 in PBS, and incubated with primary antibody. Following incubation, cells were washed with PBS and then incubated with FITC-conjugated anti-mouse IgG and / or Cy3-conjugated rabbit IgG (Chemicon). DNA was detected using 4,6-diamidino-2-phenylindole (DAPI). Image processing was performed using a Leica DM6000B microscope equipped with a × 100 / 1.40-0.70 PlanApo objective and Z-projections.

Time Lapse Mouse lymphoma cells were plated on 60 mm glass bottom plates (Iwaki) and fluorescence images were obtained using a Leica AF6000 and x40 / 1.40-0.70 PlanApo objective lens per minute. For cell fate determination, images were collected every 10 minutes and cell fate was determined manually using ImageJ1.42a software.

Tissue arrays Two formalin-fixed human lymphoma tissue arrays (NHL401 (BioMax) and A224 (AccuMax)) were deparaffinized and hydrated according to the manufacturer's protocol. After antigen activation using microwaves in 0.1 M citrate buffer (pH 6.0), sections were incubated with human TACC3 antibody (x500) overnight at 4 ° C. Colorimetric detection was performed using histone simple stain MAX-PO (R) (Nichirei) and peroxidase substrate kit (Vector).

Example 1
In order to explore the function of TACC3 in tumor tissues, first, the expression of TACC3 protein in various mouse tumors that developed in p53-deficient mice was examined, and it was found that TACC3 was expressed in various tumors. In particular, thymic lymphoma cells showed high expression of TACC3 protein.

To further study the function of TACC3 in vivo, TACC3 conditional knockout mice were utilized (Yao, R. et al., Cancer Sci., 98: 555-562 (2007)). The mice were divided into p53-deficient mice (Jacks, T. et al., Curr. Biol., 4: 1-7 (1994)) and R26-CreERT2 mice (Ventura, A. et al., Nature, 445: 661-665). (2007); obtained from Dr. Tyler Jacks) and p53 homozygous mutant mice carrying the TACC3 silent / null and CreERT2 alleles (p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2) and TACC3 as a control P53 homozygous mutant mice carrying silent / wild-type and CreERT2 alleles (p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2) were generated. They have a mixed genetic background of 129Sv / J and C57 / B6. Our previous studies have shown that knockout mice lacking a functional gene for TACC3 die late in pregnancy. The silent (S) allele of TACC3 can be deleted in p53-deficient tumors by administering 4-hydroxy tamoxifen (4OHT) to these mice to induce the Cre-loxP recombination system. Since subcutaneous (SC) injection was found to induce recombination more efficiently than intraperitoneal (IP) injection, administration of 4OHT was performed by SC injection (100 μl of a 10 mg / ml solution in corn oil). ).

These animals were routinely subjected to magnetic resonance imaging (MRI) and tumor-bearing mice were treated with 4OHT and then examined again at various time points. The tumor burden of thymic lymphoma in p53 ^{− / −} ; TACC3 ^{S / W} ; CreERT2 mice treated with 4OHT increased to 156% at 3 days and 368% at 10 days (FIG. 1a), which is consistent with previous reports (Ventura, A. et al., Nature, 445: 661-665 (2007)). In contrast, the same treatment with 4OHT caused thymic lymphoma regression in p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice. Tumor volume decreased to 96% and 26% of the original volume at 3 and 10 days, respectively.

To eliminate the possibility that the above results were due to individual differences in tumors, tumor volume was examined without 40OHT treatment, and then the same tumor was treated with 4OHT (FIG. 1b). Without treatment, tumor volume increased to 600% in 7 days and 4OHT treatment induced its regression to 57% in the same tumor. In total, 4 control mice (2 p53 ^{− / −} treated with 4OHT; TACC3 ^{S / W} ; CreERT2 mice and 2 p53 ^{− / −} without 4OHT treatment; TACC3 ^{S / D} ; CreERT2 mice) The tumor volume was increased in the range of 189% to 607%. On the other hand, 4 p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice treated with 4OHT showed thymic lymphoma regression ranging from 96% to 26% (FIG. 1c). These results clearly demonstrate that TACC3 plays an important role in the progression and maintenance of thymic lymphoma in p53-deficient mice and that its destruction causes rapid regression.

Example 2
Next, the role of TACC3 in normal tissues was examined. Staining with hematoxylin and eosin (HE) showed that administration of 4OHT to p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice did not cause gross changes in normal tissues. Immunofluorescence studies using anti-TACC3 antibody, TUNEL and 4,6-diamidino-2-phenylindole (DAPI) against thymic lymphomas of mice with TACC3 ^{S / W} or TACC3 ^{S / D} genotypes treated with 4OHT showed that TACC3 It has been shown that the regression of thymic lymphoma caused by the destruction of is accompanied by massive apoptosis.

  In contrast, despite high expression of TACC3 protein and active proliferation, normal thymus did not show a significant increase in apoptosis and cell proliferation was not affected by TACC3 depletion. This was the same for p53 wild type mice. This indicates that the lack of apoptosis is not simply due to loss of p53 function. These results indicate that the requirement for TACC3 function in the proliferation of thymic lymphoma cells is not cell lineage dependent.

  Two additional normal tissues expressing high levels of TACC3 protein were also examined. TACC3 was highly expressed in intestinal TA (transit amplifying) cells, and 4OHT treatment effectively enabled recombination in these cells. However, these cells did not induce apoptosis or inhibit cell proliferation. Similarly, hair follicle matrix cells expressed high levels of TACC3 protein, but deletion of the TACC3 locus by the Cre-loxP recombination system did not show obvious changes for more than 2 years, proliferating cell nuclei. The proliferation of these cells as shown by antigen (PCNA) staining was not affected. These results demonstrate that TACC3 has an important function in lymphoma cells but does not have an important function in normal cells including lymphocytes, intestinal TA cells and hair follicle matrix cells.

Example 3
To study the mechanisms responsible for the regression of thymic lymphoma, four cell lines (p53 ^{− / −} ; TACC3 ^{S / W} ; two strains from CreERT2 mice and p53 ^{− / −} ; TACC3 ^{S / D} ; 2 from CreERT2 mice) Established). The mouse lymphoma cell line was cultured in GIT medium (Nippon Pharmaceutical) supplemented with penicillin / streptomycin. 4OHT (Sigma) was diluted in ethanol to a concentration of 25 mM and used at a final concentration of 1 μM. Since each cell line with the same genotype showed essentially the same results, data for one cell line from each genotype was presented.

A significant decrease in TACC3 protein was observed in TACC3 ^{S / D} cells 2 days after 40OHT treatment, and cell proliferation of these cells was simultaneously suppressed (FIGS. 2a and b, TACC3 ^{S / D} 40OHT (+)). No changes in proliferation were detected after 4OHT treatment in TACC3 ^{S / W} cells. Furthermore, FACS analysis showed that administration of 4OHT led to a significant increase in sub-G1 cell population (FIG. 2c).

  As in previous reports (Gergely, F. et al., Proc. Natl. Acad. Sci. USA, 97: 14352-14357 (2000); Piekorz, RP et al., EMBO J., 21: 653-664 (2002)), TACC3 is accumulated during mitosis and is localized to the spindle and centrosome in mouse lymphoma cells, suggesting that TACC3 plays a role in mitosis. Consistent with this idea, destruction of TACC3 by 4OHT treatment led to an increase in the mitotic index (FIG. 2d).

  To understand the mitotic defects induced by the destruction of TACC3, we examined mitotic cells by immunofluorescence analysis and found that TACC3-deficient cells contain multipolar spindles (FIG. 2e). Three days after 4OHT administration, TACC3 expression was lost in 90.9% of the cells, and 57.9% of them contained multipolar spindles (FIG. 2f). These results demonstrate that TACC3 is required for proper bipolar spindle formation in thymic lymphoma cells, unlike HeLa and NIH3T3 cells. Spindle defects activate the spindle formation checkpoint (SAC), leading to mitotic arrest. After prolonged arrest, the cells die or escape from mitosis (this phenomenon is called mitotic slippage). FACS analysis showed that TACC3 disruption led to a significant increase in apoptotic cell population, but little change in tetraploid cell population was observed (FIG. 2c). This result suggests that lymphoma cells undergo mitotic cell death. Alternatively, these cells undergo apoptosis rapidly after mitotic slippage.

These possibilities were tested by a single cell based assay (FIGS. 2g and h). Thymic lymphoma cells expressing histone H2B-GFP were established and chromosomal behavior during mitosis was examined by time-lapse photography. Stable clones expressing H2B-GFP were obtained by lentiviral transduction using the pLenti4 / V5-DEST vector (Invitrogen), and infected cells were selected by puromycin followed by FACS sorting using FACSAria (Becton Dickinson). After nuclear envelope disruption (NEB), TACC3 ^{S / W} cells completed mitosis, 53.8 ± 8.9 minutes and 60.0 ± 13.19 minutes in the absence and presence of 4OHT, respectively. To generate daughter cells. Similarly, TACC3 ^{S / D} cells completed mitosis in 59.6 ± 15.3 minutes in the absence of 4OHT. In contrast, most cells were killed by administration of 4OHT. 17.6% of TACC3 ^{S / D} cells died in mitosis and 70.6% of cells underwent mitotic slippage and died in later interphases. The time required to induce cell death was 116.7 ± 16.1 minutes for previously reported lung and colon cancers (cells killed in mitosis and cells killed in later stages and 155.4 ± 39.6 min) (Gascoigne, KE et al., Cancer Cell, 14: 111-122 (2008)). These results demonstrate that loss of TACC3 function leads to abnormal spindles in lymphoma cells, which causes mitotic arrest and subsequent rapid cell death.

Example 4
In addition to thymic lymphoma, three sarcomas from p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 mice were analyzed. 4OHT treatment caused regression of two sarcomas and immunohistochemical analysis showed that they were angiosarcomas. One of these rapidly regressed (80.5% at 10 days) and the other ruptured relatively slowly (14.3% at 7 days, 37.0% at 14 days), but the remaining tissue was necrotic It contains a large mass of tissue, suggesting that these tumors require TACC3 for progression and maintenance.

In contrast, regardless of the administration of 4OHT, the third sarcoma increased tumor burden by 247% on day 7 and 350% on day 14. This progression is not due to failure of recombination at the TACC3 locus. This is because Southern blot analysis demonstrated that approximately 25% of the TACC3 ^S allele was converted to a TACC3 ^D allele. Immunohistochemical analysis showed that the sarcoma expresses desmin and was identified as rhabdomyosarcoma. In contrast to thymic lymphoma, TACC3 depletion did not induce extensive mass apoptosis in this tumor.

To investigate the role of TACC3 in rhabdomyosarcoma, rhabdomyosarcoma cell lines were identified as p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 (+) mice and p53 ^{− / −} ; TACC3 ^{S / D} ; CreERT2 (− ) Established from mice. Similar to thymic lymphoma cells, TACC3 was localized to the spindle and centrosome in rhabdomyosarcoma cells. However, despite efficient recombination, a slight suppression of cell proliferation was observed in response to 4OHT treatment and no significant increase in mitotic index was observed.

  Immunofluorescence analysis showed no increase in spindle pole number. However, 53.1% of the cells contained unaligned chromosomes in metaphase and many micronuclei were detected in interphase cells. This may explain the weak suppression of cell proliferation. Thus, although TACC3 disruption did not interfere with spindle formation in rhabdomyosarcoma cells, TACC3 appears to be required for chromosome alignment. These observations raise the possibility that long-term inhibition of TACC3 or abnormal TACC3 function may be required with other chemotherapeutic agents for tumor regression of rhabdomyosarcoma.

Example 5
Since the above results demonstrate that TACC3 is required for the proliferation of mouse lymphoma cells, we next examined the role of TACC3 in human lymphoma cells. The human protein atlas database (http://www.proteinatlas.org) has shown that malignant lymphoma is one of the cancer tissues that most highly expresses TACC3 protein. To further explore the expression of TACC3 protein in human lymphoma tissue, 25 T cell lymphomas, 35 B cell lymphomas, 5 myeloma and 6 undifferentiated large cells in a tissue array and 9 Non-tumor tissues were examined (Figure 3a). TACC3 was expressed in all tissues including non-tumor tissues. High rates of TACC3 protein in 76.0%, 85.7%, 60.0%, 85.7% and 75.0% of tissues in T lymphoma, B lymphoma, myeloma, undifferentiated large cells and normal tissue, respectively (Over 75% positive).

  Next, to investigate the role of TACC3 in human lymphoma cells, two Burkitt lymphoma cell lines (Daudi and Raji) and two T-cell acute lymphoma leukemia (T-ALL) cell lines (Jurkat and CCRF-CEM) ) Was depleted of TACC3 protein using lentivirus-mediated shRNA infection. Human lymphoma cell lines were cultured in RPMI 1640 medium (Gibco) supplemented with 10% calf serum. To deplete TACC3, the human pLKO.1 lentivirus shRNA target gene set was used and two clones TRCN0000062026 (sh1, SEQ ID NO: 7 in FIG. 3) and TRCN0000062027 (sh2, SEQ ID NO: 8) in their Used for efficient depletion (detailed information about each clone is available from The RNAi Consortium website (http://www.broadinstitute.org/rnai/public/)).

  Two independent shRNAs significantly reduced TACC3 expression (FIG. 3b). Decreased TACC3 induced apoptosis and suppression of cell viability as shown by Annexin V staining in T-ALL as well as Burkitt lymphoma cells (FIGS. 3c and d). Furthermore, as observed in mouse lymphoma cells, these cells showed a significant increase in mitotic index (FIG. 3e), and the percentage of cells containing multipolar spindles increased significantly (FIG. 3). 3f and g). These results demonstrate that in addition to mouse lymphoma cells, TACC3 is essential for the viability of human lymphoma cells.

  Meanwhile, SEQ ID NO: 15 (TRCN0000062023): 5 'CCGGCCACGGAGCCGCUGUCCCCGCCUCGAGGCGGGGACAGCGGCUCCGUGGUUUUUG 3', SEQ ID NO: 16 (TRCN0000062024): 5 'CCGGGCAGUCCUUAUACCUCAAGUUCUCGAGAACUUGAGGUAUAAGGACUGCUUUUUG 3', SEQ ID NO: 17 (TRCN0000062025): 5 'CCGGCGCACAGGAUUCUAAGUCCUACUCGAGUAGGACUUAGAAUCCUGUGCGUUUUUG 3', SEQ ID NO: 18 (Control): 5 'CCGGACCGGUCCGCAGGUAUGCACGCGUGAAUUCCUCGAGGAAUUCACGCGUGCAUACCUGCGGACCGGUUUUUUG 3') shRNA showed no depletion of TACC3, suppression of cell viability and increase of mitotic index.

Example 6
Induction of mitotic arrest by TACC3 in ovarian cancer cells and cervical cancer cells

Materials and Methods Cervical cancer cells (Hela and 2 types of ovarian cancer cells (SKOV3, OVCAR3) are seeded on 8-well chamber slides (100 ul / well at 1x10 ⁵ / ml) and using Lipofectamine ^TM RNAiMAX from Invitorgen. According to the instructions, TACC3 siRNA of SEQ ID NO: 9 (Invitrogen TACC3-HSS116027), TACC3 siRNA of SEQ ID NO: 20 (Invitrogen TACC3-HSS116026), TACC3 siRNA of SEQ ID NO: 21 (Invitrogen) were transfected, and 48 hours later, The cells were fixed with 3.7% PFA, and cells stopped in M phase by immunostaining with phosphohistone H3 (pH3) antibody (Cell Signaling). The cells after phosphohistone H3 (pH3) antibody staining were further stained with FITC-conjugated α-tubulin antibody (sigma), and the spindle morphology of mitotic arrest cells was visually observed. did.

  SEQ ID NO: 20 (TACC3-HSS116026): The 5′AUAAGGACUGCUUCCUCAAGGCCGA 3 ′ TACC3 siRNA targets the sequence at positions 1762 to 1786, and the SEQ ID NO: 21 (TACC3-HSS116028): 5′UUUAGUCUUCUGCUCCACUGUCUUCUC 3 ′ TACC3 siRNA at positions 2541 to Targets 2565 sequences.

  The siRNAs of SEQ ID NOs: 9, 20, and 21 were obtained by requesting synthesis from Invitorgen.

Results As shown in FIG. 4 (a), TACC3 protein depletion in cervical cancer cells (Hela) and ovarian cancer cells (SKOV3 and OVCAR3) was observed by treatment with TACC3 siRNA of SEQ ID NO: 9.

  As shown in FIG. 4 (b), an increase in mitotic arrest cells was observed in ovarian cancer cells (SKOV3 and OVCAR3) cervical cancer cells (Hela) by TACC3 siRNA treatment of SEQ ID NO: 9. Surprisingly, the increase in mitotic arrest cells was significantly higher in ovarian cancer cells (SK-OV3 and OVCAR3) compared to cervical cancer cells (Hela).

  As shown in FIG. 4 (d), the spindle morphology of mitotic arrested ovarian tumor cells (SKOV3 and OVCAR3) by TACC3 siRNA treatment of SEQ ID NO: 9 is mostly about 75% in multipolar spindle (SKOV3). , About 60% with OVCAR3).

  On the other hand, the siRNAs of SEQ ID NOs: 20 and 21 did not show these effects (data not shown).

Example 7
The effect of TACC3 depletion on tumor cells was examined in vivo.

Materials and methods
^Seven SKOV3 cells 1.0X10 were transplanted into the dorsal skin of a NOD-scid mouse (Nippon Charles River), and the length (W) and width (W) of the tumor were measured with calipers, and the tumor volume (TV (tumor volume)) = LxWxW / 2) was measured over time. As described above, in the control group (Ctrl), TRCN-control (expression vector pShag Magic Version 2.0 (pSM2) inserted with a control shRNA sequence (SEQ ID NO: 18) (open biosystem product, Funakoshi Co., Ltd.) SKOV3 cells were infected with the recombinant lentivirus prepared by using a) and the experimental group (exp) group using SEQ ID NO: 7 (open biosystems product, obtained from Funakoshi Co., Ltd.) Thereafter, uninfected cells were removed with puromycin and inoculated.

  In SKOV3 cells, the same five sequences (SEQ ID NOs: 7, 8, 15-17) were used as in the case of lymph tumors, but unlike in the case of lymph tumors, only SEQ ID NO: 7 showed significant TACC3 depletion by immunoblotting. (Data not shown). Therefore, only SEQ ID NO: 7 was used for in vivo experiments.

Results As shown in FIG. 5a, in the three control groups (# 1 ctrl, # 2 ctrl and # 3 ctrl: SEQ ID NO: 18), all of the tumors showed significant growth after about 60 days of inoculation, whereas 3 In one experimental group (# 1 exp, # 2 exp and # 3 exp: SEQ ID NO: 7), no tumor growth was observed. Thereby, the anticancer effect with respect to the ovarian tumor in vivo of shRNA of sequence number 7 was shown.

Example 8
The effect of siRNAs of TACC3, TACC1, and TACC2 on mitosis of SKOV3 ovarian cancer cells was examined.

Materials and Methods Ovarian cancer cells (SKOV3) are seeded on 8-well chamber slides (100 ul / well at 1x10 ⁵ / ml), and TACC1 siRNA (SEQ ID NO: 14, Invitorgen), TACC2 (SEQ ID NO: 20, Invitorgen) or TACC3 siRNA (SEQ ID NO: 9, Invitorgen) was transfected, and after 48 hours fixation with methanol, mitotic cells were identified by immunostaining using an anti-MPM2 antibody (Novus). Subsequently, staining was performed using a FITC-conjugated α-tubulin antibody, and the morphology of the spindle was observed.

Sequence number of siRNA SEQ ID NO: 19 (Control): 5 'GAAUUCACGCGUGCAUACCUGCGGACCGGU 3'
Sequence number 14 (TACC1-HSS186179): 5'AUUUCUUCAAGGCUUCUUCAGCAACU 3 '
Sequence number 20 (TACC2-HSS116289): 5'UACUCCUGCGCGCACAUCUCUUAACA 3 '
These siRNAs were obtained by requesting synthesis from Invitorgen.

result
TACC1 (p = 0.001) and TACC3 (p = 0.0009) showed a significant increase in mitotic index (FIG. 6a) and an increase in spindle abnormalities (FIG. 6b). On the other hand, TACC2 siRNA showed no change in the mitotic index and almost no increase in spindle abnormalities despite the presence of TACC2 depletion by immunoblotting (data not shown) ( 6a and b). Unlike TACC1 (p = 0.001) and TACC3, TACC2 was shown not to be associated with anticancer effects.
For TACC1, in addition to SEQ ID NO: 14 (TACC1-HSS186179), siRNAs for different regions (TACC1-HSS186178 and TACC1-HSS186180) and TACC2 also differ in addition to SEQ ID NO: 20 (TACC2-HSS116289). SiRNAs against the region (TACC2-HSS116287 and TACC2-HSS116288) were synthesized and tested, but no effect was seen (data not shown).

Example 9
TACC3 and Apc conditional knockout mice Apc580S depletion

Materials and methods
TACC3 conditional knockout mice (Yao, R. et al., Cancer Sci., 98: 555-562 (2007)) to Apc conditional knockout mice (Shibata et al. Science 278: 120-3 (1997)) and Vilin -Cre mice (Ventura, A. et al., Nature, 445: 661-665 (2007); obtained from Dr. Tyler Jacks) and crossed with Tacc3W / W, ApcS / W, and Villin-Cre (+) Some Apc580S mice (W / W) and Tacc3S / D, ApcS / W, and Villin-Cre (+) Apc580S mice (S / D) were prepared.

  APC is a tumor suppressor gene, and the Apc conditional knockout mouse is a mouse that develops a tumor in the small intestine and large intestine (including the cecum) with age by conditional knockout of Apc.

  Each mouse was bred, 2 W / W mice and 4 S / D mice at 8 weeks of age (8.0 W), 3 W / W mice and 3 S at 12 weeks of age (12.0 W). / D mice, 3 W / W mice and 4 S / D mice at 16 weeks of age (16.0 W) were dissected, and the number of tumors developed in the small intestine and large intestine (including the cecum) was visually counted.

Results As shown in FIG. 7, in the W / W type Apc580S mouse (Apc is knocked out, but Tacc3 is functioning), the number of tumors generated with aging increased. On the other hand, in S / D type Apc580S mice (knocked out to Apc and Tacc3), the number of tumors increased at 12 weeks compared to 8 weeks, but compared to 12 weeks at 16 weeks. And decreased. And compared with the W / W type, the number of tumors is much smaller. This indicates that depletion of TACC3 can suppress small intestine, large intestine and cecal tumors, indicating that TACC3 can be a target for the development of anticancer agents for small intestine, large intestine and cecal tumors.

  According to the present invention, a screening method for an anticancer agent targeting TACC3 protein is provided. In addition, a new anticancer agent targeting TACC3 or TACC1 protein is provided.

Claims (10)

Contacting a cancer cell expressing TACC3 protein with a candidate substance, and measuring a proportion of mitotic cells in the cell contacted with the substance,
A method for screening an anticancer agent, comprising: Contacting a cancer cell expressing TACC3 protein with a candidate substance, and measuring the expression or function of TACC3 protein in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:   The method according to claim 1 or 2, wherein the anticancer agent is against at least one cancer selected from the group consisting of lymphoma, hemangiosarcoma, non-small cell lung cancer, breast cancer, gastrointestinal tumor and ovarian cancer.   Cancer cells expressing TACC3 protein are ovarian cancer cells SKOV3 strain, OVCAR3 strain, human Burkitt lymphoma cells, human T-cell acute lymphoblastic leukemia cells, lymphoma cells and hemangiosarcoma cells obtained from p53-deficient animals, and Apc-deficient animals The method according to any one of claims 1 to 3, which is at least one selected from the group consisting of gastrointestinal tumor cells obtained from the above. Contacting a cancer cell expressing TACC1 protein with a candidate substance, and measuring a proportion of mitotic cells in the cell contacted with the substance,
A method for screening an anticancer agent, comprising: Contacting a cancer cell expressing TACC1 protein with a candidate substance, and measuring the expression or function of TACC1 protein in the cell contacted with the substance,
A method for screening an anticancer agent, comprising:   The method according to claim 5 or 6, wherein the anticancer agent is for ovarian cancer.   The method according to any one of claims 5 to 7, wherein the cancer cell expressing TACC1 protein is an ovarian cancer cell.   From the group consisting of lymphoma, hemangiosarcoma, non-small cell lung cancer, breast cancer, gastrointestinal tumor and ovarian cancer comprising shRNA or siRNA against TACC3 targeting at least one sequence selected from the group consisting of SEQ ID NOs: 3-5 An anticancer agent for at least one selected.   An anticancer agent against ovarian cancer comprising shRNA or siRNA against TACC1 targeting the sequence of SEQ ID NO: 12.