JP2011239784A - Acquisition of antibody against cell surface antigen, and antigen identification of the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for screening an antibody bonding with a cell surface antigen.SOLUTION: This method for obtaining the antibody bonding with the cell surface antigen is provided by comprising the following processes: (1) a process of bringing a cell expressing the cell surface antigen on the cell membrane, or its fraction in contact with an antibody library in an aqueous medium having ≥80 relative permittivity at 25°C; (2) a process of preparing a two-phased system consisting of the aqueous medium in (1) and an oily low polarity solvent having ≤20 and ≥1 relative permittivity at 25°C and making contact with the aqueous medium through an interface; (3) a process of transferring the cell expressing the cell surface antigen on the cell membrane or its fraction to the low polarity solvent; and (4) a process of recovering the antigen bonding with the cell or its fraction, transferred to the low polarity solvent as the antibody bonding with the cell surface antigen.

Description

  The present invention relates to a method for obtaining an antibody that binds to a cell surface antigen.

  An animal individual has the ability to produce antibodies that recognize and specifically bind to various structures (epitopes) located on the surface of various foreign substances that enter the body fluid. The size of the antibody repertoire (total number of types of antibodies having different amino acid sequences) is enormous, from 1 million to 100 million species per animal. The antibodies that make up this huge repertoire are each produced by individual B cells.

  Conventional antiserum preparation techniques and monoclonal antibody production techniques by cell fusion utilize the antibody production mechanism of this animal. That is, the antigen substance is injected several times at regular intervals into an animal (rabbit, goat, mouse, etc.) together with adjuvant. When the animal's immune system recognizes the substance as a foreign substance, B cells expressing an antibody that binds to the antigen substance are stimulated for proliferation and differentiation, and secretion of a large amount of antibody into the body fluid starts. Various structures exist on the surface of the antigenic substance, and the antibody that binds to the purified antigen is usually secreted as a mixture of many kinds of antibodies. Serum containing such an antibody (antiserum) is called a polyclonal antibody. Even now, polyclonal antibodies are effectively used as research reagents. However, a polyclonal antibody often exhibits cross-reactivity with a molecule having a partially similar structure (for the antibody) in addition to the target antigenic substance. The cross-reaction has been a problem when using a polyclonal antibody as an antigen detection reagent.

  The establishment of cell fusion technology has completely changed this situation. In the spleen of an animal immunized with an antigenic substance, there are many B lymphocytes that produce antibodies that bind to the antigen. However, it is difficult to maintain the cells for a long time in a test tube. Thus, the idea of producing antibodies capable of producing antibodies and producing permanent cells by fusing the established tumor cells and antibody-producing cells so as to enable permanent culture was born and established as a method. Since the thus established fusion strain (hybridoma) is derived from one antibody-producing cell and one tumor cell, there is one kind of antibody produced, which is called a monoclonal antibody. This is a technology developed in 1975 by Keller and Milstein. Monoclonal antibodies are aggregates of uniform antibody molecules, and are therefore used as antibodies with excellent specificity that do not easily cause cross-reactions.

However, this method has the following problems.
(1) Having a necessary and sufficient amount of purified preparation as an antigenic substance
(2) The substance must be immunogenic to the animal being immunized
(3) It takes a lot of labor and days to obtain monoclonal antibodies

  The effectiveness of polyclonal and monoclonal antibody production techniques has been demonstrated by having provided many useful antibodies. However, it is also true that there are still many problems that are difficult to solve by these methods. For example, these methods can meet the demands of obtaining antibodies that bind to multiple types of antigens in a short period of time, or selectively obtaining antibodies that specifically bind to epitopes with special structures. Can not. It has been desired to prepare an antibody library composed of various antibody molecules so that a desired antibody can be obtained in a short period of time.

  The kind of antibody contained in such an antibody library should theoretically be comparable to the size of the antibody repertoire possessed by an animal individual. However, in reality, it is impossible to create such a large library using animal cells. The production of a monoclonal antibody is nothing but the work of screening an antibody having the expected reactivity from a library of antibody-producing cells possessed by animals. However, the repertoire composing the library is greatly lost through operations such as cell fusion.

  Therefore, an antibody gene expression system using Escherichia coli has been proposed. Better et al (1988) (Better M, Chang CP, Robinson RR, Horwitz AH Science 1988, 240: 4855 1041-3) and Skerra were the first to successfully express antigen-binding antibodies in E. coli. Plukthun (1988) (Skerra A, Plukthun A Science 1988, 240: 4855 1038-41). They succeeded in producing and subsequently secreting Fab and Fv antibodies in E. coli by adding a sequence that functions as a secretion signal in E. coli to the N-terminus of the antibody.

  Furthermore, the development of PCR in 1988 is immediately applied to the amplification of genes encoding antibody variable regions. Primer sequences for amplifying all VHDJH and VLJL genes expressed in animals (especially humans) have been proposed (Orlandi R et al. Proc Natl Acad Sci USA 1989 86:10 3833-7, Sastry L et al. al. Proc Natl Acad Sci USA 1989 86:15 5728-32). Using the antibody gene amplified by these primers, a vector for producing an antibody in E. coli was constructed (Huse WD et al. Science 1989 246: 4935 1275-81, Ward GE et al. J Clin Microbiol 1989 27:12 2717-23). At this stage, the antibody library repertoire size was dramatically improved. However, it has not been easy to screen a small amount of antibody produced in Escherichia coli using the antigen binding activity as an index. In order to perform screening efficiently, it was necessary to wait for the phage display method to be applied to antibody library production.

  The phage display method was devised by Smith in 1985 (Smith GP Science 1985 228: 4075 1315-7), and a linear bacteriophage having a single-stranded circular DNA such as M13 phage is used. Phage particles consist of a protein called cp8 that surrounds DNA and constitutes most of the phage particles, and five proteins called cp3 that function when phages infect E. coli. The phage display system is a system in which a gene is constructed so as to encode a polypeptide in a form fused with cp3 or cp8, and the protein is expressed on the surface of the phage particle.

  Phage particles holding a binding protein on the surface can be concentrated by utilizing the binding activity with the ligand. This method of concentrating the target DNA is called a panning method. The concentrated phage particles are packaged with DNA encoding a protein having the necessary binding activity. Thus, the use of filamentous phage has realized a system capable of performing screening based on binding activity and DNA cloning extremely efficiently.

Better M, Chang CP, Robinson RR, Horwitz AH Science 1988, 240: 4855 1041-3 Skerra A, Plukthun A Science 1988, 240: 4855 1038-41 Orlandi R et al. Proc Natl Acad Sci USA 1989 86:10 3833-7 Sastry L et al. Proc Natl Acad Sci USA 1989 86:15 5728-32 Huse WD et al. Science 1989 246: 4935 1275-81 Ward GE et al. J Clin Microbiol 1989 27:12 2717-23 Smith GP Science 1985 228: 4075 1315-7

  An object of the present invention is to provide a method for screening an antibody that binds to the cell surface from an antibody library.

At present, it is possible to produce an antibody library containing most of antibodies that specifically bind to all of the various possible three-dimensional structures made by biomolecules. Such an antibody library may be referred to herein as a super library. The recognition site of a molecule that is recognized as an antigen is called an epitope. On the other hand, the structure on the antibody side that recognizes an epitope is called a paratope. In other words, the super library can be considered to contain all of the paratopes for all of the possible epitopes. Specifically, the super library consists of about 100 billion (10 ¹¹ ) types of antibodies. For example, the antibody library AIMS4 prepared by the present inventors in the past is an antibody library having a diversity of the order of 10 ¹¹ (WO 01/62907).

Therefore, if a certain number or more of cancer cells are mixed with the super library, all epitopes present on the cancer cells always form an antigen-antibody complex at a certain frequency. The binding frequency between the epitope and the antibody follows the physicochemical laws regarding the equilibrium state of both. For example, assume that there are thousands of epitopes on a cell. On the other hand, assuming that the super library (10 ¹¹ species) contains an average of 10 antibodies corresponding to each epitope, tens of thousands of antibodies in the super library are identified as epitopes on cells. It will be bound by the antigen-antibody reaction. Even under these conditions, a complex based on an antigen-antibody reaction is created on a cell with a probability of tens of thousands of 10 ¹¹ species, that is, one out of millions of phage antibodies in a library. is there. Two major problems arise here.

(1) Since the antigen-antibody reaction is an equilibrium reaction, whether or not to form a complex is determined by the antigen concentration, antibody concentration, and binding constant. As a result, depending on the reaction conditions, even if there is an antibody that binds to the antigen, many of them exist in a free state without forming a complex.
(2) When a large amount of cells and phage particles are mixed, non-specific adsorption of phage particles always occurs. Nonspecific adsorption is binding that is not based on an antigen-antibody reaction.

  As described above, in an antibody library, it can be considered that an antibody constituting an antigen-antibody complex is present on cells at a ratio of 1 out of millions. Under these conditions, in order to separate phage particles that should bind to cells by antigen-antibody reaction, after mixing cells and phage particles, the cells are washed to remove nonspecifically adsorbed phages. There must be. Free antibody in equilibrium is removed by washing. The antigen-antibody complex is maintained by an equilibrium between the complex and the free antibody. Therefore, as a result of virtually zero free antibody concentration, the antibody constituting the antigen-antibody complex may be separated from the epitope over time. In this way, phage particles are removed from the cell surface.

In order to avoid the loss of the antibody accompanying washing, the present inventors first thought that it was important to stably maintain the binding between the antibody based on the antigen-antibody reaction and the cell surface epitope. And in order to solve this subject, it discovered that it was effective to put an antigen antibody complex in a low polarity solvent, and completed this invention. That is, the present invention relates to a method for screening an antibody that binds to the following cell surface.
[1] A method for obtaining an antibody that binds to a cell surface antigen, comprising the following steps.
(1) A step of contacting a cell expressing a cell surface antigen on a cell membrane or a fraction thereof with an antibody library in an aqueous medium
(2) a step of preparing a two-phase system comprising a low-polarity solvent that contacts the aqueous medium of (1) via an interface
(3) a step of transferring a cell expressing a cell surface antigen on the cell membrane, or a fraction thereof, to a low polarity solvent; and
(4) A step of recovering cells that have migrated to a low-polarity solvent or an antibody bound to a fraction thereof as an antibody that binds to a cell surface antigen [2] Addition between steps (3) and (4) In particular, the method according to [1], comprising the following steps (3-a) to (3-c):
(3-a) In (3), a step of transferring a cell surface antigen transferred to a low polarity solvent on a cell membrane, or a fraction thereof, to an aqueous medium
Preparing a two-phase system comprising a low polarity solvent in contact with an aqueous medium of (3-b) (3-a) via an interface; and
(3-c) Step of transferring cells expressing cell surface antigen on cell membrane, or a fraction thereof to a low polarity solvent [3] The aqueous medium in step (3-a) is the aqueous medium of (1) The method according to [2], which is a step of contacting with a different aqueous medium.
[4] The method according to [2], wherein the low polarity solvent in the step (3-b) is the same as the low polarity solvent of (2).
[5] The method according to [2], wherein the low polarity solvent in the step (3-b) is a different low polarity solvent replaced with the low polarity solvent of (2).
[6] Cells expressing the cell surface antigen transferred to the low polarity solvent in (3-c) on the cell membrane, or a fraction thereof, and cell surfaces antigen transferred to the low polarity solvent in (3) on the cell membrane The method according to [2], wherein the steps (3-a) to (3-c) are repeated as the cells expressed in step 1 or the fraction thereof.
[7] The method according to [6], wherein the steps (3-a) to (3-c) are repeated 1 to 5 times.
[8] The method according to [7], wherein the steps (3-a) to (3-c) are repeated 2 to 3 times.
[9] The method according to [1], wherein the antibody library is an rgdp library displaying variable regions of antibodies.
[10] The method according to [9], wherein the rgdp library is a phage library.
[11] The method according to [1], comprising a step of repeating steps (1) to (3) using the antibody recovered in step (4) as a new antibody library.
[12] The method according to [1], wherein the fraction of cells expressing the cell surface antigen on the cell membrane is a soluble fraction of the cell surface antigen.
[13] The method according to [12], wherein a soluble fraction of the cell surface antigen is obtained by the following step.
(1) a step of disrupting cells expressing an antigen for which an antibody is to be obtained,
(2) a step of recovering a cell membrane fraction from the crushed material in step (1),
(3) a step of solubilizing the cell membrane fraction with a surfactant mixture, and
(4) A step of recovering the supernatant of step (3) as a soluble fraction of cell surface antigen [14] The surfactant constituting the surfactant mixture is composed of a nonionic surfactant and an amphoteric surfactant. The method according to [13], which is either or both.
[15] Nonionic surfactants include NP-40, Triton X100, n-Dodecyl β-D-maltoside, n-Octyl β-D-glucoside, n-Octyl β-D-maltopyranoside, and n-Decyl β The method according to [14], which is at least one compound selected from the group consisting of -D-maltoside.
[16] The method according to [14], wherein the amphoteric surfactant is Deoxycholic acid.
[17] The method according to [12], wherein the soluble fraction of the cell surface antigen is bound to a solid phase.
[18] The method according to [17], wherein the solid phase is a magnetic particle.
[19] The method according to [1], wherein the cell surface antigen-expressing cell is a cell immobilized on a solid phase.
[20] The method according to [19], wherein the solid phase is glass beads.
[21] The method according to [20], wherein the glass beads are glass-treated with collagen.
[22] The method according to [21], wherein the cells immobilized on the solid phase are cells obtained by culturing the cells together with collagen-treated glass beads.
[23] The method according to [1], wherein the aqueous medium is a cell culture solution or a buffer solution to which an inactive protein is added.
[24] The method according to [23], wherein the inactive protein is bovine serum albumin.
[25] The cell culture medium is MEM (Minimum Essential Medium), Basal Medium, Eagle (BME), Eagle's Minimum Essential Medium (EMEM), Dulbecco's Modified Eagle's Medium (DME), RPMI-1640 Medium (RPMI1640), and ES Medium ( The method according to [23], which is any cell culture medium selected from the group consisting of ES).
[26] The method according to [1], wherein the low polarity solvent is a mixed solvent containing cyclohexane and diphenyl ether.
[27] The method according to [26], which is a 1: 9 mixed solvent of cyclohexane and diphenyl ether.
[28] The method according to [1], wherein the low polarity solvent is a mixed solvent containing the solvents described in the following a and b, and has a solvent density (d) of 1.0-1.09.
a: at least one solvent selected from the group consisting of hexane, cyclohexane, isooctane, and diisopropyl ether b: at least one solvent selected from the group consisting of dibutyl phthalate, 1,1,1-trichloroethane, and diphenyl ether [ 29] The method according to [26] or [28], wherein a cell culture solution or a buffer solution to which an inactive protein is added is combined as an aqueous medium.

The antibody obtaining method of the present invention is based on the fact that the binding of the rgdp clone to the cell surface antigen is stabilized by a combination of an aqueous medium and a low polarity solvent. That is, the present invention relates to the following method comprising the step of stabilizing the hydrogen bond of the antigen-antibody complex.
[30] A method for screening an rgdp clone having an activity of binding to a surface antigen of a target cell from an rgdp library displaying an antibody variable region, comprising the following steps: A method comprising the step of stabilizing hydrogen bonds of an antigen-antibody complex by contacting them in an aqueous medium and then transferring them to a low polarity solvent phase.
(1) a step of contacting an rgdp library and a target antigen under conditions capable of antigen-antibody reaction; and
(2) The step of recovering the rgdp clone bound to the antigen [31] The method of [32], comprising the step of recovering the rgdp clone bound to the antigen after washing with a low polarity solvent [32] The cell surface [30] The method according to [30], wherein the antigen is a solid phase on which a soluble fraction of a cell or cell surface antigen is immobilized.
[33] The method according to [30], wherein the aqueous medium is a minimum essential medium containing serum albumin.
[34] The method according to [30], wherein the low polarity solvent is any solvent selected from the group consisting of the following ad.
a mixed solvent of diphenyl ether, 1,1,1-trichloroethane and hexane,
b. a mixed solvent of isopropyl ether, 1,1,1-trichloroethane and hexane, and
c. Mixed solvent of dibutyl phthalate and cyclohexane
d. Mixed solvent of diphenyl ether and cyclohexane [35] The method according to [34], wherein a minimum essential medium containing serum albumin is combined as a polar medium.

  A wide variety of molecules exist on the cell surface. Cell surface molecules are involved in various life activities such as information exchange through cell adhesion and contact, acceptance of humoral factors, uptake and excretion of nutrients. Cells have different molecules on their surface depending on the tissue, cell state, or differentiation stage. In cells infected with certain viruses, the product of the gene encoded by the virus is expressed as a membrane surface protein. It is also known that cancerous cells produce membrane surface proteins specific for cancer cells. Many molecules on the cell surface are closely related to the function of the cell. Molecules that are specifically found on the surface of specific cells are useful as marker molecules for cells.

  It is necessary to develop a system that comprehensively analyzes these cell membrane surface molecules and identifies tissue-specific surface antigen molecules. Wu et al. Have reported a method of degrading cell membranes with proteases and analyzing them by mass spectrometry (Nature Biotechnology vol. 21, 2003, 532-538, Wu, CC, MacCoss, M., J., Howell, K., E., & Yates, JRIII A method for the comprehensive proteomic analysis of membrane proteins). This method is an effective method for comprehensive analysis of proteins, but is insufficient as a means for observing quantitative differences in target antigen molecules or distribution in tissues.

  Antibodies are useful tools for revealing quantitative differences in antigen molecules, or localization of antigen molecules. However, in order to analyze all antigen molecules on the cell surface, it is necessary to obtain an antibody set that can comprehensively recognize the antigen molecule population. In general, in order to obtain an antibody, a method of immunizing an animal with a human cancer cell line to obtain a monoclonal antibody, or a method of selecting an antibody clone by screening an antibody library has been performed. In the technique of immunizing animals, exhaustive analysis is difficult because antigens that serve as immunity sources are limited to a small number. Screening using conventional antibody libraries has also limited the cells to which it can be applied. In addition, screening of antibody libraries using cell surface antigens tends to be limited to antibodies that bind to some limited epitopes or antigens. As a result, the antibody set that can be obtained from the antibody library is limited. Comprehensive antigen analysis is difficult to perform with limited epitopes or antibody sets that recognize limited antigens.

  The following mechanism can be considered as the reason why it is difficult to obtain various antibodies that bind to cell surface antigens from an antibody library. First, clones with high binding activity as antibodies tend to be obtained preferentially. Also, if there is a difference in the number of antigen molecules on the cell surface, antibodies against a larger number of molecules are preferentially obtained even if the binding activity of the antibodies is equivalent. When screening a phage library displaying variable regions as an antibody library, amplification of the obtained phage and screening are repeated. During this iterative process, preferentially obtained antibodies are always easy to recover, while difficult to obtain antibodies are often lost. As a result, even if screening is repeated, an antibody that cannot be recovered is produced. This is why it is difficult to obtain an antibody set that enables comprehensive analysis of all antigens.

  As described above, if a super library is used as an antibody library, any antibody should be found by screening. However, in the known screening method, it has been difficult in principle to pick up an antibody with low binding activity or an antibody that binds to a rare antigen. In other words, it has been desired to provide a new screening method that can make full use of the diversity of antibody libraries.

The present inventors can create conditions that can pick up antibodies that are difficult to obtain with a high probability if an antibody collected in one screening can be realized so that it cannot be recovered in another screening. I thought. The inventors have found that an antibody that has already been collected or an antigen recognized by the antibody can be picked up by allowing the antibody to be easily picked up by presenting the antibody in the antigen-antibody reaction field, thereby completing the present invention. That is, the present invention relates to a screening method for antibodies that bind to the following cell surface antigens.
[36] Binding to a cell surface antigen, comprising a step of contacting a cell expressing a cell surface antigen on a cell membrane, or a solid phase retaining the fraction thereof with an antibody library, and recovering an antibody that binds to the cell surface antigen. In the method for obtaining an antibody, a method comprising any one of the following steps a) to c), wherein the antigen masking agent and the antibody masking agent each contain a component as defined below.
Antigen masking agent: Antibody containing an antibody that does not want to be acquired Masking agent: Contains a free antigen recognized by an antibody that does not want to be acquired
a) a cell in which a cell surface antigen is expressed on a cell membrane, or a solid phase retaining the fraction and an antibody library are contacted in the presence of either an antigen masking agent or an antibody masking agent;
b) contacting the antibody library with cells that have expressed cell surface antigens on the cell membrane after contact with the antibody masking agent, or with a solid phase retaining a fraction thereof, or
c) A cell expressing a cell surface antigen on the cell membrane, or a solid phase retaining the fraction thereof is contacted with an antigen masking agent after contact with an antigen mask [37] The antigen recognized by the antibody for acquisition is cancer The method according to [36], wherein the antigen that is a cell surface antigen and is recognized by an antibody that is not desired to be obtained is a normal cell surface antigen.
[38] The method according to [37], wherein the tissue from which the normal cells and the cancer cells are derived is common.
[39] The antigen recognized by the antibody to be acquired is a surface antigen of a cancer cell at a specific stage, and the antigen recognized by an antibody not desired to be acquired is the surface of the same type of cancer cell at a stage different from the above stage. The method according to [36], which is an antigen.
[40] The method according to [39], wherein any one of the specific stage and a stage different from the specific stage is advanced cancer, and the other is early cancer.
[41] The antibody that is not desired to be obtained is an antibody that binds to the cell surface antigen, and the target antibody binds to an antigen or antigenic determinant different from the antigen or antigenic determinant recognized by the antibody that is not desired to be obtained. [36] The method according to [36].
[42] The method according to [41], wherein the antibody that is not desired to be obtained is an antibody isolated in advance by a binding activity that binds to the cell surface antigen.
[43] The method according to [36], comprising the following steps.
(1) preparing a two-phase system composed of an aqueous medium containing a solid phase holding the cell or a fraction thereof and an antibody library, and a low polarity solvent in contact with the aqueous medium;
(2) transferring a cell expressing the target antigen on the cell membrane, or a solid phase retaining the fraction thereof to a low polarity solvent phase; and
(3) recovering the cells that have migrated to the low-polarity solvent phase or the antibody bound to the solid phase retaining the fraction as an antibody that binds to the cell surface antigen [44] [1] or [36] ] An antibody or a fragment comprising the variable region thereof obtainable by any of the methods.
[45] A polynucleotide encoding a variable region of an antibody obtainable by any one of the methods [1] or [36].

The antibody obtained according to the above method can be further used as a target for screening for an antibody that specifically binds to a target cell, using the binding activity to a cell surface antigen as an index. That is, the present invention relates to an antibody screening method including the following steps.
[46] A screening method for an antibody that binds to a surface antigen of a specific cell and does not bind to a similar cell when it is brought into contact with a similar cell under the same conditions, comprising the following steps:
(1) The antibody selected by the method according to [1] or [36] is applied to a solid phase holding the specific cell or a fraction thereof, and a solid phase holding the similar cell or a fraction thereof. Contacting under common conditions; and
(2) a step of selecting an antibody that binds to the solid phase holding the specific cell or a fraction thereof and does not bind to the similar cell or a solid phase that holds the fraction [47] The method according to [46], which is a cancer cell, and the similar cell is a normal cell of the same tissue as the cancer cell.
[48] The method according to [46], wherein the specific cell is a cancer cell at a certain stage, and the similar cell is the same type of cancer cell at another stage.
[49] The method according to [46], wherein the step (1) includes a step of bringing the antibody into contact with a cell fixed sample of the specific cell and the similar cell.
[50] The step (1) includes a step of bringing the antibody into contact with a solid phase holding the antigen fraction of the specific cell and a solid phase holding the antigen fraction of the similar cell. [46] The method described in 1.
[51] The method according to [39] or [40], comprising a step of detecting an antibody bound to the cell or a solid phase retaining an antigen fraction of the cell with a labeled antibody that recognizes the antibody.

The method of the present invention can be applied particularly to an rgdp library that maintains antibody diversity in vivo. That is, the present invention relates to an antibody screening method including the following steps.
[52] The method according to [1] or [36], wherein the antibody library is an antibody library containing at least 10 ⁹ types of antibodies.
[53] The method according to [52], wherein the antibody library is an antibody library containing at least 10 ¹⁰ types of antibodies.
[54] The method according to [53], wherein the antibody library is an antibody library containing at least 10 ¹¹ types of antibodies.

The present invention further relates to a method for identifying an antigen recognized by the antibody obtained by the present invention. That is, the present invention relates to the following antigen identification method and the antigen identified based on this method.
[55] A method for identifying an antigen to which the antibody according to [44] binds, comprising the following steps.
(1) contacting the antibody according to [44] with a cell surface antigen used for isolation of the antibody,
(2) recovering the antigen bound to the antibody; and
(3) The method according to [55], further comprising the step of identifying the recovered antigen [56], and further determining the amino acid sequence of the antigen identified in step (3).
[57] The method according to [56], comprising a step of digesting an antigen and identifying amino acids constituting the digested product.
[58] The method of [57], comprising a step of digesting an antigen with a proteolytic enzyme.
[59] The method according to [58], wherein the proteolytic enzyme is a serine protease.
[60] The method of [59], wherein the serine protease is trypsin.
[61] The method according to [57], comprising a step of identifying an amino acid constituting the digested product by mass spectrometry.
[62] An antigen identified by the method according to [55].

Now, in order to screen for an antibody that binds to a cell surface antigen, the cell itself or an extract of the cell surface antigen is required. Cell surface antigen extracts can be immobilized on a solid phase and used for screening antibody libraries. Some cell surface antigens have their structure maintained by the cell membrane. Therefore, it is often difficult to obtain cell membrane antigen as a soluble fraction. The present inventors have completed a technique for preparing a soluble fraction of a cell surface antigen, which is useful for screening as described above. That is, the present invention provides the following method for producing a soluble fraction of cell membrane antigen, or a mixed solution therefor.
[63] A method for producing a soluble fraction of a cell surface antigen, comprising the following steps.
(1) a step of disrupting cells expressing the target cell surface antigen,
(2) a step of recovering a cell membrane fraction from the crushed material in step (1),
(3) a step of solubilizing the cell membrane fraction with a surfactant mixture, and
(4) The step of recovering the supernatant of step (3) as a soluble fraction of cell surface antigen [64] The surfactant constituting the surfactant mixture is composed of a nonionic surfactant and an amphoteric surfactant. The method according to [63], which is either or both.
[65] Nonionic surfactants include NP-40, Triton X100, n-Dodecyl β-D-maltoside, n-Octyl β-D-glucoside, n-Octyl β-D-maltopyranoside, and n-Decyl β The method according to [64], which is at least one compound selected from the group consisting of -D-maltoside.
[66] The method according to [64], wherein the amphoteric surfactant is Deoxycholic acid.
[67] The method of [63], wherein the cell is a cancer cell.
[68] A method for isolating a cell surface antigen recognized by an antibody, comprising the following steps.
(1) contacting a soluble fraction of a cell surface antigen obtainable by the method according to [63] with an antibody; and
(2) The method according to [68], wherein the step of isolating an antigen bound to the antibody [69] is an antibody selected by the method according to [1] or [36].
[70] The method of [68], wherein the antibody is bound to a solid phase or has a tag capable of binding to the solid phase.
[71] In the step of contacting the soluble fraction of the cell surface antigen with the antibody, the concentration of the surfactant in the reaction solution is adjusted to 0.01% w / v-5% w / v [68] Method.
[72] A method for identifying a cell surface antigen recognized by an antibody, comprising the step of identifying an antigen isolated by the method according to [68].
[73] The method according to [72], comprising a step of digesting the antigen and identifying amino acids constituting the digested product.
[74] The method of [73], comprising a step of digesting the antigen with a proteolytic enzyme.
[75] The method according to [74], wherein the proteolytic enzyme is a serine protease.
[76] The method according to [75], wherein the serine protease is trypsin.
[77] The method according to [73], comprising a step of identifying an amino acid constituting the digested product by mass spectrometry.
[78] An antigen isolated by the method according to [68].
[79] A surfactant mixed solution for solubilizing a cell surface antigen, comprising the following composition.
NP-40,
Triton X100,
n-Dodecyl β-D-maltoside,
n-Octyl β-D-glucoside,
n-Octyl β-D-maltopyranoside
n-Decyl β-D-maltoside, and
Deoxycholic acid
[80] The surfactant mixture for cell surface antigen solubilization according to [79], wherein the amount of each surfactant used is 0.01 to 5% w / v.

The surface antigen on the cell membrane can also be obtained by treating the cell with a protease. By adjusting the type and amount of protease to be added, it is possible to recover a partial degradation product of the membrane antigen retaining the antigenicity. This was recovered by reacting with the antibody to be examined, and cell surface antigen molecules could be identified. That is, the present invention relates to the following method for producing a soluble fraction of a cell surface antigen and a method for identifying a cell surface antigen using the same.
[81] A method for producing a soluble fraction of a cell surface antigen, comprising a step of incomplete digestion of a cell surface antigen and a step of recovering the cell surface antigen cleaved from the cell by incomplete digestion.
[82] The method according to [81], wherein the incomplete digestion step comprises a step of allowing a protease to act on cells.
[83] The method according to [82], wherein the proteolytic enzyme is a serine protease.
[84] The method according to [83], wherein the serine protease is trypsin.
[85] A soluble fraction of a cell surface antigen obtainable by the method according to [81].
[86] A method for identifying a cell surface antigen, comprising the following steps.
(1) a step of contacting an antibody that recognizes a cell surface antigen with the soluble fraction of the cell surface antigen according to [85],
(2) recovering the antigen bound to the antibody; and
(3) The step of identifying the recovered antigen [87] The method of [86], wherein the antibody is an antibody selected by the method of [1] or [36].
[88] The method according to [87], further comprising the step of determining the amino acid sequence of the antigen identified in step (3).

In fact, the present inventors have succeeded in obtaining an antibody that can specifically bind to liver cancer cells or the variable region thereof by the above method. That is, the present invention relates to the following polynucleotides or polypeptides, as well as immunoglobulins or fragments containing variable regions thereof, and uses thereof.
[89] A polynucleotide comprising the base sequence of SEQ ID NO: 82 or the base sequence encoding the amino acid sequence of SEQ ID NO: 83.
[90] A polypeptide comprising an amino acid sequence encoded by the polynucleotide according to [89].
[91] A polynucleotide comprising the base sequence of SEQ ID NO: 84 or the base sequence encoding the amino acid sequence of SEQ ID NO: 85.
[92] A polypeptide comprising an amino acid sequence encoded by the polynucleotide according to [91].
[93] An immunoglobulin molecule comprising the polypeptide of [90] and the polypeptide of [92], or a fragment containing the variable region thereof.
[94] An immunoglobulin H chain in which the amino acid sequences of CDR1, CDR2, and CDR3 are the amino acid sequences described in SEQ ID NO: 90, SEQ ID NO: 91, and SEQ ID NO: 92, respectively, or a fragment containing a variable region thereof .
[95] An immunoglobulin L chain in which the amino acid sequences of CDR1, CDR2, and CDR3 are the amino acid sequences described in SEQ ID NO: 93, SEQ ID NO: 94, and SEQ ID NO: 95, respectively, or a fragment containing the variable region thereof .
[96] An immunoglobulin molecule comprising the immunoglobulin H chain of [94] and the immunoglobulin L chain of [95], or a fragment comprising the variable region thereof.
[97] A polynucleotide comprising the base sequence of SEQ ID NO: 86 or the base sequence encoding the amino acid sequence of SEQ ID NO: 87.
[98] A polypeptide comprising an amino acid sequence encoded by the polynucleotide according to [97].
[99] A polynucleotide comprising the base sequence of SEQ ID NO: 88 or the base sequence encoding the amino acid sequence of SEQ ID NO: 89.
[100] A polypeptide comprising an amino acid sequence encoded by the polynucleotide according to [99].
[101] An immunoglobulin molecule comprising the polypeptide of [98] and the polypeptide of [100], or a fragment containing the variable region thereof.
[102] An immunoglobulin H chain whose amino acid sequences of CDR1, CDR2, and CDR3 are the amino acid sequences described in SEQ ID NO: 96, SEQ ID NO: 97, and SEQ ID NO: 98, respectively, or a fragment containing the variable region thereof .
[103] An immunoglobulin L chain whose CDR1, CDR2 and CDR3 amino acid sequences are the amino acid sequences set forth in SEQ ID NO: 99, SEQ ID NO: 100, and SEQ ID NO: 101, respectively, or a fragment containing the variable region thereof .
[104] An immunoglobulin molecule comprising the immunoglobulin H chain of [102] and the immunoglobulin L chain of [103], or a fragment comprising the variable region thereof.
[105] comprising at least one of the immunoglobulin molecules described in [93], [96], [101] and [104], or a fragment containing the variable region thereof, and a pharmaceutically acceptable carrier, A pharmaceutical composition for diagnosis or treatment of liver cancer.
[106] An immunoglobulin molecule, or a fragment containing a variable region thereof, is any molecule selected from the group consisting of a radioisotope, a drug having anticancer activity, a magnetic metal, a fluorescent dye, a luminescent dye, and an enzyme. The pharmaceutical composition according to [105], which is bound.
[107] A test kit for liver cancer comprising the following elements.
i) at least one of the immunoglobulin molecules described in [93], [96], [101] and [104], or a fragment containing the variable region thereof,
ii) normal hepatocyte tissue, and
iii) Cancer cell tissue of liver cancer

Further, the present inventors have revealed that ADCC activity can be confirmed by binding an antibody (secondary antibody) against a protein fused to scFv. It is a new finding found by the present inventors that a cytotoxic action dependent on an antibody fragment comprising an antigen-binding site can be detected with the aid of a secondary antibody. That is, the present invention relates to a method for detecting the cytotoxic effect of an antibody fragment comprising an antigen-binding site comprising the following steps.
[108] A method for detecting the cytotoxic effect of an antibody fragment containing an antigen-binding site, comprising the following steps.
(1) contacting the antibody fragment, a secondary antibody recognizing the antibody fragment, and a cell expressing an antigen recognized by the antibody fragment; and
(2) a step of detecting a cytotoxic effect [109] a secondary antibody that recognizes an antibody fragment after contacting a fragment containing an antigen-binding site of an antibody with a cell expressing an antigen recognized by the antibody fragment; [108].
[110] The method according to [108], wherein the fragment containing the antigen-binding site of the antibody is either a Fab fragment or scFv.
[111] The method according to [110], wherein the fragment containing the antigen-binding site of the antibody is scFv fused with a phage protein.
[112] The method of [111], wherein the secondary antibody is an antibody that recognizes the phage protein.
[113] The method according to [108], wherein the antibody fragment containing an antigen binding site is any fragment selected from the group consisting of the following fragments i to v and an rgdp clone or an rgdp clone.
i: a fragment containing an antigen-binding site of an antibody obtained by the method according to [1],
ii: rgdp clone obtained by the method according to [10];
iii: rgdp clone obtained by the method according to [30];
iv: a fragment comprising an antigen-binding site of an antibody obtained by the method according to [36]; and
v: A fragment comprising the antigen-binding site of an antibody obtained by the method of [46] [114] The method of [108], wherein the cytotoxic effect is antibody-dependent cellular cytotoxicity.
[115] An antigen binding of an antibody having a cytotoxic effect, comprising a step of detecting a cytotoxic activity by the method according to any one of [108] to [114] and selecting an antibody fragment in which the cytotoxic activity is detected. A method for selecting a fragment containing a site.
[116] A method for imparting a cytotoxic effect to an antibody fragment containing an antigen-binding site by binding a secondary antibody that recognizes the antibody fragment to the antibody fragment.
[117] The method according to [116], wherein the antibody fragment containing the antigen-binding site is scFv fused with a phage protein, and the secondary antibody is an antibody that recognizes the phage protein.

  The present invention provides a method by which antibodies that bind to cell surface antigens can be comprehensively picked up from an antibody library. First, the present invention provides a method for screening an antibody that binds to a cell surface antigen by placing the antibody bound to the cell surface antigen in a low polarity solvent. In the low polarity solvent, the hydrogen bond of the antigen-antibody complex is stabilized. On the other hand, molecules that nonspecifically bind to the cell surface can be effectively removed. Under these conditions, factors that are mixed non-specifically and hinder acquisition of the target antibody can be effectively removed.

  The present inventors have clarified the composition of a low-polarity solvent and an aqueous solvent that are useful when screening antibodies that bind to the cell surface using the soluble fraction of the cell surface antigen. By screening a phage library displaying antibodies using the solvent found in the present invention, it was possible to comprehensively recover antibodies that recognize cell surface antigens constituting the library. By combining the screening method of the present invention with a super library, it is possible to obtain antibodies that recognize all cell surface antigens.

The present invention also provides a new screening method that makes it possible to recover antibodies that are difficult to recover using known screening methods. In other words, antibodies that have not yet been acquired can be preferentially recovered by masking the antibodies that have already been recovered or the antigens recognized by the antibodies. Masking realized by the present invention is particularly useful for screening rgdp libraries such as phage libraries. In the screening of the rgdp library, if the previously obtained antibody is used as a masking, the acquisition of the rgdp clone having the same reactivity as the obtained antibody can be effectively prevented.
The present invention further provides a method for producing a soluble fraction of cell surface antigens. The soluble fraction of the cell surface antigen that can be obtained by the production method of the present invention maintains the immunological properties of the cell surface antigen at a high level. In addition, the diversity of antigens reflects the composition of cell surface antigens inherent in the cells.

It is a schematic diagram of the vector used for preparation of scFv antibody gene library. It is the figure which showed typically the structure of pscFvCA9-E8VHdVLd. It is the figure which showed the base sequence (sequence number: 25) of the insert part of pscFvCA9-E8VHdVLd, and the amino acid sequence (sequence number: 26) encoded by it. Continuation of FIG. 3-1. It is the figure which showed the base sequence (sequence number: 29) of the insert of pscFvCA-E8VHd, and the amino acid sequence (sequence number: 30) encoded by a restriction enzyme site and a base sequence. Continuation of FIG. 4-1. It is the figure which showed the base sequence (sequence number: 65) of pAALSC, and the amino acid sequence (sequence number: 66) encoded by it. Continuation of FIG. It is the figure which showed the base sequence (sequence number: 67) of pscFvCA-cam167, and the amino acid sequence (sequence number: 68) encoded by it. Continuation of FIG. It is the figure which showed the base sequence (sequence number: 69) of pAviBirA-cam167, and the amino acid sequence (sequence number: 70) encoded by it. Continuation of FIG. It is the figure which showed the base sequence (sequence number: 71) of pPPAviBirA-cam167, and the amino acid sequence (sequence number: 72) encoded by it. Continuation of FIG. It is a graph which shows the result of cell ELISA of the obtained anti- SKOv-3 cell antibody clone. It is a photograph which shows the identification result of the antigen molecule by immunoprecipitation. This was performed by western blot with anti-HER2 antibody. It is a graph which shows the result of ELISA with respect to solid-phase CEA. In the figure, the vertical axis indicates the absorbance at 492 nm. The antibody indicated on the horizontal axis represents the following antibody, respectively. Clone 2, 3, 6, 13, 24, 32; antibody clone against gastric cancer cell line MKN-45 CEA antibody; mouse monoclonal antibody It is a microscope picture (1000 times) which shows the result of the tissue dyeing | staining by an isolated antibody. Clone 035-112 stained the cancer cell membrane. It is a graph which shows the result of ELISA with respect to solid-phased TRAIL-R2. It is a microscope picture (1000 times) which shows the result of the tissue dyeing | staining by the clone 3172-120. It is a microscope picture (1000 times) which shows the result of the tissue dyeing | staining by isolated antibody 049-023 and 050-001. It is the photograph and figure which show the identification process of an unknown antigen molecule. It is a photograph which shows the electrophoresis result of the antigen identified by surfactant dilution immunoprecipitation reaction. It is a photograph which shows the electrophoresis result of the antigen identified by the membrane protein trypsin digestion method. It is a figure which shows ADCC activity at the time of using a human IgG antibody with respect to HER2 overexpression strain BT-474. It is a figure which shows ADCC activity at the time of combining a phage antibody and an anti-pIII rabbit antibody with respect to HER2 overexpression strain BT-474. It is a photograph which shows the cell strainer (A) in the glass bead adhesion culture method of a cell, and the cell (B) adhere | attached on the glass bead. It is a photograph which shows the installation method of the glass bead in the screening by an organic solvent centrifugation method. It is a figure which shows the result of cell ELISA. It is the photograph (400 times) which carried out the immunostaining using the clone acquired in cell ELISA, and observed with the microscope.

The present invention relates to a method for obtaining an antibody that binds to a cell surface antigen, comprising the following steps.
(1) a step of preparing a two-phase system composed of a cell expressing a cell surface antigen on a cell membrane, or an aqueous medium containing a fraction thereof and an antibody library, and a low polarity solvent in contact with the aqueous medium;
(2) transferring a cell expressing the target antigen on the cell membrane, or a fraction thereof, to a low polarity solvent phase; and
(3) A step of recovering the cells that have migrated to the low-polarity solvent phase or the antibody bound to the fraction as antibodies that bind to the cell surface antigen.

  In the present invention, the cell surface antigen includes any antigen having an antigenic determinant on the cell surface. A cell surface antigen can be a molecule that transmembranes the cell membrane or is present on the extracellular surface of the cell membrane. Alternatively, molecules present on the cell surface by binding to molecules penetrating the cell membrane or molecules present on the extracellular surface of the cell membrane are also included in the cell surface antigen. For example, an extracellular domain of a receptor bound to a transmembrane domain by -SS-bonding or the like is included in the cell membrane antigen in the present invention.

  Such molecules include receptors or transporters present in cell membranes. Many of these molecules are composed of proteins. However, the antigenic determinant is constituted not only by the structure of the protein but also by the modified structure of the protein. Specifically, proteins undergo modifications such as sugar chains, lipids, phosphate groups, or acetyl groups, and different antigenic determinants are configured depending on the modified structure.

  The cell in the present invention is not particularly limited as long as it is a cell having a membrane. That is, cells derived from animals, plants, or microorganisms can be used in the present invention. The cell may be a naturally-derived cell or an artificially modified cell. Artificially modified cells include cells cultured in special environments, cells introduced with foreign genes, and the like.

  Animal cells can be shown as preferred cells in the present invention. Animal cells have a variety of cell surface antigens. Many of these cell surface antigens are thought to function as an interface for exchanging signals with the outside of the cell. Therefore, identification of cell surface antigens, functional analysis, or structural analysis is an important research subject in elucidating the mechanisms of various changes or responses in adults, tissues, or cells. Antibodies are an important tool in these analyses.

  In the method of the present invention, a cell fraction can be used instead of the cell. An object of the present invention is to obtain an antibody that recognizes a cell surface antigen. Therefore, cell fractions containing cell surface antigens can be used in the present invention. Fractions containing cell surface antigens can be obtained by various methods. For example, a soluble fraction of a cell membrane surface antigen that can be obtained using various surfactants as described later is preferable as the fraction of cells in the present invention. In such cell fractions, many cell surface antigens maintain their structure. Therefore, it is useful for screening antibodies that recognize cell surface antigens.

On the other hand, in the present invention, the antibody library to be screened refers to a collection of antibodies having various binding activities. A mixture of antibodies having at least two different binding activities is included in an assembly having various binding activities. Preferred antibody diversity in the present invention can be realized by a repertoire of, for example, 10 ⁵ , usually 10 ⁶ , or 10 ⁷ , preferably 10 ⁸ , unless the type of antibody to be obtained is limited in advance. Furthermore, in order to realize a higher degree of diversity, a library prepared by the present inventors and having a repertoire size of 10 ⁹ to 10 ¹⁰ and further 10 ¹¹ is preferable as the library in the present invention.

  On the other hand, the screening method of the present invention can also be applied to an antibody library having a repertoire that is intentionally biased in advance. For example, as described later, a non-target antibody can be absorbed (masked) in advance using cells to which the non-target antibody binds. Even highly diverse antibody libraries cannot maintain a repertoire size as described above when their repertoire size is limited by absorption. However, even an antibody library with a limited repertoire size can be used as a screening target of the present invention.

  As the antibody constituting the antibody library, in addition to the immunoglobulin itself, a variant that can be derived from immunoglobulin can be used. As long as the variant maintains the binding activity to the antigen, it can constitute an antibody library in the same manner as an immunoglobulin. As a modified immunoglobulin, a fragment containing the variable region can be shown. In the present invention, the variable region can be any region including at least a region necessary for binding to an antigen. In other words, an arbitrary area including an area composed of three CDRs and a frame (FR) holding the CDRs can be used as the variable area of the present invention.

  Therefore, for example, even a fragment containing a constant region can be used as a variable region of the present invention as long as it contains a region necessary for binding to an antigen. Fab and Fab ′, which are often used as variable regions of antibodies, are the names given to fragments originally obtained by enzymatic cleavage of immunoglobulins. In the present invention, Fab should not be understood as a term for specifying a variable region.

  A CDR constituting a variable region is a region that is rich in variations of amino acid sequences and is called a complementarity-determining region (CDR). There are three CDRs in each of the immunoglobulin heavy and light chains. It can be said that the various binding activities of antibodies are brought about by the diversity of amino acid sequences constituting CDRs. The three CDRs are arranged via a frame. The frame is highly conserved in amino acid sequence between antibodies with different binding properties.

  In the present invention, an rgdp library (replicable genetic display package library) can be shown as an antibody library composed of immunoglobulin variable regions. The rgdp library refers to a library configured to hold genes and display the expression products of the genes on the surface. Accordingly, an rgdp library of an antibody refers to a library comprising a gene encoding an antibody and a package displaying an antibody protein encoded by the gene on its surface. For example, when a phage library expresses an antibody protein on its surface, it is included in the rgdp library. As the rgdp library, in addition to the phage library, a library composed of transformed cells or ribosomes expressing a foreign protein on the surface thereof can be shown. For example, an rgdp library can be obtained by using a system for expressing a foreign gene as a fusion protein of Escherichia coli flagella protein.

  A typical rgdp library is a phage library. A phage library displaying the above antibody genes can be obtained as follows. In general, phagemids and helper phages are used to express foreign proteins on the phage surface. For example, a phagemid vector such as pTZ19R (Pharmacia) is commercially available. In the phagemid, a gene encoding a foreign protein to be expressed is linked to a gene encoding a phage constituent protein such as cp3 or cp8.

  The phagemid can be amplified by infecting a host such as E. coli. However, in this state, it cannot be recovered as phage particles. In other words, it is in the same state as a general gene library. In order to obtain phage particles displaying the foreign protein held by the phagemid on the surface, a host infected with the phagemid is superinfected with helper phage. For example, the phagemid vector pTZ19R can be recovered as phage particles by superinfection with helper phage M13K07. If the cp3 protein of the phagemid used at this time is fused with a foreign protein, the foreign protein is displayed on the surface of the completed phage.

  If a restriction enzyme site suitable for antibody gene cloning is introduced into a commercially available phagemid, the light chain variable region gene library according to the present invention can be incorporated together with the heavy chain variable region gene library. A method for introducing an appropriate restriction enzyme site into the phagemid vector pTZ19R and incorporating an antibody gene library amplified by PCR is known (Gene 194, 35-46, 1997). In the examples described below, an SfiI site and an AscI site were introduced downstream of the signal sequence PelB of the phagemid vector. On the other hand, a primer introduced with the same site is used for amplification of the light chain variable region gene. By digesting the PCR amplification product with the restriction enzyme and incorporating it into this site, an antibody variable region gene is inserted downstream of PelB, and further a phagemid vector (pFCAH9) encoding a fusion protein with cp3 located downstream thereof. -E8d / Fig. 2-D; Iba Y. et al., Gene 194: 35-46, 1997.).

  Alternatively, the heavy chain variable region gene can be inserted into a vector for bacterial host expression. In this case, the heavy chain variable region gene is expressed by transforming the vector into bacteria. The resulting transformed cell is further infected with a phage library carrying the light chain variable region gene, thereby completing the gene library for the present invention. Examples of E. coli transformation vectors include pFK. For transformation into bacteria, the heavy chain variable region gene can be secreted into the periplasm by linking the heavy chain variable region gene downstream of an appropriate secretion signal. pFK is a vector with pelB as a secretion signal.

In the screening method of the present invention, cells or a fraction thereof and an antibody library are contacted in an aqueous medium. The aqueous medium in the present invention is any aqueous medium capable of antigen-antibody reaction. The aqueous medium of the present invention includes any medium having the following physicochemical properties.
i) It is liquid in the range of 4 ° C to 25 ° C, and when mixed with water it mixes perfectly and does not form two phases
ii) The relative permittivity kε (= ε / ε0) is 80 or more at 25 ° C. The relative permittivity kε (= ε / ε0) is the electric capacity stored between the electrodes in contact with the solvent. It can be measured by measuring electrically. In general, a solvent having a large relative dielectric constant is called a polar solvent and dissolves a salt well. Therefore, the aqueous medium in the present invention contains a polar solvent.

  For example, Good buffer, physiological saline, phosphate buffer, or the like, which is generally used as a buffer for antigen-antibody reaction, can be used as the aqueous medium of the present invention. Alternatively, various basal medium components used for culturing animal cells can also be used as an aqueous medium. Medium for animal cell culture includes MEM (Minimum Essential Medium), Basal Medium, Eagle (BME), Eagle's Minimum Essential Medium (EMEM), Dulbecco's Modified Eagle's Medium (DME), RPMI-1640 Medium (RPMI1640), and ES Medium (ES) can be indicated.

  Various inactive proteins can be added to the aqueous medium of the present invention for the purpose of inhibiting nonspecific binding. For example, albumin, skim milk, gelatin or the like is effective in suppressing nonspecific binding. In the present invention, minimum essential medium (MEM) containing bovine serum albumin is a preferred aqueous medium. Bovine serum albumin is, for example, 0.1-5% w / v, usually 0.5-2% w / v, preferably 0.8-1.5% w / v, preferably 1% w / v Can be added.

  The present invention includes the step of adjusting a two-phase system of an aqueous medium and a low polarity solvent. A two-phase system means that two liquid phases are in contact with each other and are separated. In the present invention, a two-phase system can be constituted by using a polar solvent as an aqueous medium and combining it with a low polarity solvent.

In the present invention, the low polarity solvent for constituting the two-phase system may be any low polarity solvent capable of constituting the two-phase system with an aqueous medium for carrying out the antigen-antibody reaction. As long as the low polarity solvent constitutes a two-phase system (that is, forms an interface), a part of the low polarity solvent is allowed to be mixed with the aqueous solvent. A preferred low polarity solvent in the present invention is a solvent capable of stabilizing hydrogen bonding between substances as compared with an aqueous medium. Such low polarity solvents include those defined by the following physicochemical properties. The low polarity solvent in the present invention is preferably selected from organic solvents.
i) Liquid in the range of 4 ° C to 25 ° C, forming two phases when mixed with water
ii) The relative dielectric constant kε (= ε / ε0) is 20 or less and 1 or more at 25 ° C. However, ε is the dielectric constant and ε0 is the dielectric constant in vacuum. Hydrogen bonds are positive for specific antigen-antibody reactions. Has been involved in. In aqueous media, hydrogen bonds are destabilized by the action of water molecules contained therein, and as a result, specific bonds are weakened. On the other hand, this hydrogen bond is stable in a low-polarity solvent, and the specific binding is strongly retained. Therefore, efficient concentration of the specific binding antibody occurs after several washings.

More specifically, as the low polarity solvent in the present invention, for example, a mixed solvent containing the solvents described in the following a and b and having a solvent density (d) of 1.0-1.09 can be used.
a: at least one solvent selected from the group consisting of hexane, cyclohexane, isooctane, and diisopropyl ether b: at least one solvent selected from the group consisting of dibutyl phthalate, 1,1,1-trichloroethane, and diphenyl ether

As preferred examples of such low polarity solvents, the following mixed solvents can be shown.
A mixed solvent of diphenyl ether, 1,1,1-trichloroethane and hexane,
A mixed solvent of isopropyl ether, 1,1,1-trichloroethane and hexane,
A mixed solvent of dibutyl phthalate and cyclohexane, and a mixed solvent of diphenyl ether and cyclohexane In the present invention, the mixing ratio of diphenyl ether, 1,1,1-trichloroethane, and hexane can be 44:27:33. The mixing ratio of isopropyl ether, 1,1,1-trichloroethane and hexane can show 20:50:30. The mixing ratio of dibutyl phthalate and cyclohexane can be 9: 1. The mixed solvent mixed at this ratio has a solvent density (d) of 1.0-1.09.
In the present invention, a cell expressing a cell surface antigen immobilized on a solid phase on a cell membrane, or a fraction thereof can be used. When the specific gravity of the solid phase is large, a low-polarity solvent that is out of the above specific gravity range can be used. For example, when glass beads are used as the solid phase, a low-polarity solvent having a smaller specific gravity can be combined. For example, a mixed solvent composed of diphenyl ether and cyclohexane is preferable as a solvent combined with glass beads. A mixture of diphenyl ether and cyclohexane is a preferred mixed solvent that improves phage recovery in phage library screening. In the present invention, the mixing ratio of diphenyl ether and cyclohexane can be 9: 1.

  The screening method of the present invention includes a step of transferring cells or a fraction thereof contacted with an antibody library in an aqueous medium to the low polarity solvent phase. Any method for transferring cells or fractions thereof to the low polarity solvent phase is optional. For example, if the aqueous medium constitutes the upper phase of a two-phase system, the cells or fractions thereof can be dropped into the low polarity solvent phase by centrifugation.

  Conversely, when the low polarity solvent phase constitutes the upper layer, the cell or a fraction thereof can be transferred to the low polarity solvent phase by removing the aqueous medium. For this purpose, for example, a reaction vessel having an ultrafiltration membrane at the bottom of the vessel can be used. The ultrafiltration membrane can discharge the liquid inside by making the outside negative pressure. At this time, large molecules such as proteins are retained in the ultrafiltration membrane and remain in the container. Eventually, when all of the aqueous medium in the container is removed, the transfer of cells or fractions thereof to the low polarity solvent phase is complete.

  In the present invention, the use of magnetic particles can be shown as a preferred method for transferring cells or fractions thereof to a low polarity solvent phase. Cells or fractions thereof can be fixed to magnetic particles in advance. Or the label | marker which can be fix | immobilized to a magnetic particle can be combined. Magnetic particles can be collected at any position by placing them in a magnetic field. After the antigen-antibody reaction, the transfer to the low polarity solvent phase is completed by collecting the magnetic particles to which the cells or fractions thereof are bound in the low polarity solvent phase.

  In the present invention, the step of transferring the antigen-antibody complex from the aqueous medium to the low polarity solvent can be repeated a plurality of times before the step of recovering the antibody. That is, the step of returning the cell once completed to the low-polarity solvent or the fraction thereof to the aqueous medium and then transferring to the low-polarity medium can be included. The number of repetitions is usually 1 to 5 times, for example 2 to 4 times, preferably 3 times. By repeating the transfer step to a low polarity solvent, the recovery rate of the antibody that specifically binds to the cell or a fraction thereof can be improved. This was confirmed also in the examples described later.

  In the present invention, the transfer step to a plurality of low polarity solvents can replace both the aqueous medium and / or the low polarity solvent with the first one. Preferably, both are replaced in every transfer cycle. For example, when cells are collected by centrifugation, the aqueous medium and the low polarity solvent that make up the two phase system utilized in the first wash cycle are transferred to the new two phase system after transfer of the cell or fraction thereof to the low polarity medium. Is replaced with Specifically, the collected cells are dispersed in a new aqueous medium to form a two-phase system with a new low polarity solvent. Similarly, in the third washing cycle, cell recovery and two-phase system replacement are performed.

  Alternatively, multiple washing cycles can be performed by reciprocating between the same two-phase systems. For example, cells or fractions thereof are collected after the first transfer to a low polarity solvent. Then at least the aqueous medium is replaced with a new one. At this time, the low polar solvent can be substituted together. A plurality of washes can be performed by reciprocating the cell or fraction thereof between the aqueous medium and the low polarity solvent.

  In the screening method of the present invention, the binding of the antigen-antibody complex placed in the low polarity solvent phase is thus stabilized. Also, the transition from aqueous media to low polarity solvents minimizes the introduction of free antibodies. As a result, an antibody recovered as an antibody bound to a cell or a fraction thereof is highly likely an antibody that immunologically recognizes a cell surface antigen. Thus, antibodies that specifically bind to cell surface antigens can be specifically recovered.

The screening method of the present invention utilizes the fact that the hydrogen bond is stabilized by the transfer of the antigen-antibody complex from an aqueous medium to a low polarity solvent. That is, the present invention includes a method for screening an rgdp clone having an activity of binding to a surface antigen of a target cell from an rgdp library displaying an antibody variable region, comprising the following steps: Provided is a method comprising stabilizing a hydrogen bond of an antigen-antibody complex by contacting an antigen with an aqueous medium and then transferring to a low polarity solvent phase.
(1) a step of contacting an rgdp library and a target antigen under conditions capable of antigen-antibody reaction; and
(2) recovering the rgdp clone bound to the antigen

  As shown in Examples 13-1, 13-2, and 13-3, in the case of a solvent that merely forms two phases, for example, a sucrose solution, it is expected that an antigen-antibody binding retention effect is achieved by stabilizing hydrogen bonds. Absent. This type of solvent reduces the amount of recovered phage and has little effect on screening efficiency. On the other hand, in the case of a low polarity solvent, recovery of positive antibodies is increased by hydrogen bond stabilization. Conversely, negative antibody recovery is reduced. Therefore, screening efficiency is improved and specific phage recovery is possible. It is a novel finding that the antigen-antibody complex composed of the rgdp library displaying the variable region of the antibody and the reaction with the corresponding antigen is stabilized by migration to a low-polarity solvent. It is. The present invention has been completed based on this finding.

  The washing with the low polarity solvent in the present invention is preferably repeated 1 to 5 times, so that the effect of improving the screening efficiency can be expected. The preferable number of times for washing the low polarity solvent in the present invention is, for example, 1 to 5 times, alternatively 2 to 4 times, and more preferably 3 times. As shown in Example 13 (Table 4), the number of specifically bound antibodies recovered by three washes with a low-polarity solvent should be about twice that of the case with an aqueous solvent. Was confirmed. In other words, it was found that the recovery of specific antibodies is increasing. This result is thought to be due to specific hydrogen bond stabilization. Washing with a low polarity solvent is effective when repeated around 3 times.

  The screening of the present invention can be repeated to concentrate antibodies that bind to the cell surface. That is, the screening of the present invention can be repeated using the collected antibody mixture as a starting material again. The recovered antibody can be amplified as necessary prior to the second round of screening. If the antibody library is a phage library, phage particles can be collected and infected with Escherichia coli, followed by helper phage superinfection to generate phage particles. The generated phage particles are amplification products of infected phages.

Furthermore, the present invention includes a step of recovering an antibody that binds to a cell surface antigen by contacting a cell in which the cell surface antigen is expressed on a cell membrane, or a solid phase retaining the fraction with an antibody library, and collecting the antibody that binds to the cell surface antigen. In the method for obtaining an antibody that binds to an antibody, the method comprises any one of the following steps a) to c), wherein the antigen masking agent and the antibody masking agent each contain the components defined below: Provide a method.
Antigen masking agent: Including antibodies that you do not want to acquire Antibody masking agent: Including free antigens that are recognized by antibodies that you do not want to acquire
a) a cell in which a cell surface antigen is expressed on a cell membrane, or a solid phase retaining the fraction and an antibody library are contacted in the presence of either an antigen masking agent or an antibody masking agent;
b) contacting the antibody library with cells that have expressed cell surface antigens on the cell membrane after contact with the antibody masking agent, or with a solid phase retaining a fraction thereof, or
c) Contacting the antibody library with the cell that expressed the cell surface antigen on the cell membrane or the solid phase retaining the fraction with the antigen masking agent

The masking agent of the present invention is a component used for masking unintended antibody binding activity when a cell surface antigen is obtained from an antibody library. Masking agents act on either antigens or antibodies. In the present invention, a masking agent that acts on an antigen is called an antigen masking agent. On the other hand, the masking agent acting on the antibody is an antibody masking agent.
Antigen masking agents include antibodies that are not desired to be acquired. In the antibody obtaining method, the antibody bound to the antibody is recovered as the target antibody. Here, when there is an antibody that is not desired to be acquired in advance, the antibody can be used as an antigen masking agent. An antigen masking agent binds to the antigen it recognizes. As a result, antibodies that are not desired to be acquired in the library cannot bind to the antigen. Thus, antibodies that are not desired to be obtained are not recovered by antigen masking.

  Antibody masking agents are masking agents that act on antibodies. When there is an antibody that is not desired to be acquired in advance, an antigen recognized by the antibody can be used as an antibody masking agent. In the acquisition method, the antigen is immobilized or has a label capable of being immobilized. Free antigens contained in the antibody masking agent bind to antibodies that are not desired to be obtained in the antibody library. As free antigen does not bind to the solid phase, this results in no recovery of this antibody. Thus, antibody masking is established.

  Masking agents are useful in obtaining antibodies that specifically recognize surface antigens of specific cells. For example, when the purpose is to obtain an antibody that recognizes a surface antigen that is present in cell X but not in cell Y, the surface antigen of cell Y is an antibody masking agent. Similarly, an antibody that recognizes the surface antigen of cell Y can be used as an antigen masking agent. By using these masking agents, antibodies that recognize the surface antigen of cell Y contained in the antibody library cannot be recovered. As a result, an antibody that recognizes a surface antigen that specifically exists in the cell X is recovered.

The method for obtaining a cell-specific antibody using a masking agent is particularly useful for obtaining an antibody that can specifically recognize a specific cell among similar cells. The following combinations can be shown as similar cell combinations. These cells may be primary cultured cells or established cells.
Cancer cells and normal cells Cancer cells and normal cells of the same tissue as the cancer cells Cells derived from different stages of cancer Advanced cancer cells and early cancer cells

  Specific examples of the masking agent include combinations of immortalized normal hepatocytes and various liver cancer cells. For example, immortalized normal hepatocytes such as THLE-3 are known. Therefore, the cell surface antigen of THLE-3 can be used as an antibody masking agent. Alternatively, an antibody that recognizes a cell surface antigen of THLE-3 can be used as an antigen masking agent. On the other hand, liver cancer cells can be combined with patient liver cancer lesions that can be obtained as clinical specimens. Alternatively, various liver cancer cell lines can be used. Examples of established liver cancer cells include HepG2, HuH-7, Nuk-1, OCTH-16, HT-17, Li-1, or PLC / PRF / 5.

  In the above combination, the stage of cancer is distinguished based on indicators such as the level of cancer invasion, tumor size, and the presence or absence of metastasis. Antibodies that bind to cell surface antigens whose expression specifically changes at each stage of cancer are useful for cancer diagnosis and treatment. If such an antibody can be obtained, an antigen recognized by the antibody can be isolated. Antigens specifically expressed in the cancer stage thus isolated are important as cancer therapeutic target candidates.

  Alternatively, the masking agent is also effective when antibodies that recognize surface antigens of a certain cell are comprehensively obtained. In general, when recovering an antibody using the binding activity to an antigen as an index, antibodies that are easily recovered are preferentially recovered, and it is often difficult to acquire antibodies that are difficult to recover. As an antibody that is preferentially recovered, for example, when a large number of antigen molecules are expressed on the cell surface, an antibody that recognizes this antigen is likely to be preferentially recovered. In addition, if an antibody library contains an antibody exhibiting a particularly strong binding affinity for an antigen molecule, this antibody is also likely to be recovered preferentially over other antibodies.

  In particular, in obtaining antibodies from an rgdp library such as a phage library displaying the variable region of the antibody, amplification and selection of the recovered clones is often repeated. In a series of iterative processes, clones displaying preferentially recovered antibodies will occupy the majority of the population. Even if such an acquisition process is repeated many times, there is a high possibility that an antibody that binds to a major antigen will be acquired preferentially.

  In such a situation, a masking agent can be applied to the antibody recovered preferentially. That is, the antibody that is preferentially recovered is itself useful as an antigen masking agent. And the antigen which this antibody recognizes can be utilized as an antibody masking agent. As a result, there is an increased possibility that antibodies that are acquired preferentially can be acquired in a normal acquisition method. This is because the masking agent prevents the binding and recovery of the antibody that is preferentially recovered, and as a result, it becomes easy to bind and recover the antibody that has been prevented from being acquired.

As the antibody that is preferentially recovered, for example, an antibody obtained under conditions without a masking agent and an antigen recognized by the antibody can be used. Since the significance of recovering the antibody once recovered is small, it is used as a masking agent. Next, in the presence of a masking agent, acquisition of antibodies that bind to the target cells from the antibody library is repeated. Furthermore, if necessary, the antibody recovered in the second acquisition step can be used as a masking agent. In this way, by combining the antibody obtained in another obtaining step with the antibody obtaining step from the antibody library as a masking agent, it is possible to comprehensively collect antibodies that recognize surface antigens possessed by a certain cell.
According to the method for obtaining an antibody using a masking agent, for example, the possibility of obtaining an antibody that recognizes different antigenic determinants while recognizing the same antigen can be expected.

  In the present invention, the antigen masking agent can be mixed with the antibody library after previously contacting the cells or a fraction thereof. Alternatively, in the presence of an antigen masking agent, the cell or a fraction thereof can be contacted with the antibody library. Similarly, the antibody masking agent can be previously contacted with the antibody library and then contacted with the cells or fractions thereof.

  In the present invention, the masking agent, the antibody library, and the cell or fraction thereof can be contacted under conditions that allow an antigen-antibody reaction in an aqueous medium. Preferably, an antigen-antibody complex composed of cells or a fraction thereof and an antibody derived from an antibody library, which is constituted in an aqueous medium, is transferred into a low-polarity solvent. At this time, a method of forming a two-phase system of an aqueous medium and a low polarity solvent and transferring to a low polarity solvent phase by transfer between phases is included in the present invention.

The cell or fraction thereof has a label that is either retained on the solid phase or capable of binding to the solid phase. Therefore, an antigen-antibody complex constituted by binding to a cell or a fraction thereof is finally formed on a solid phase. By moving the solid phase to the low polarity solvent phase, the antigen-antibody complex can be easily transferred to the low polarity solvent phase. Further, the antibody bound to the cell or a fraction thereof is recovered as the antibody to be obtained from the solid phase in the low polarity solvent phase.
Alternatively, in the case of cells, the cells themselves can be precipitated and separated by applying a centrifugal force without being solid-phased. The antibody can be recovered from the separated cells in the same manner as in the solid phase.

  Masking agents are particularly advantageous when using an rgdp library as the antibody library. The rgdp library presenting the antibody can be amplified after recovery. However, the antibody used as a masking agent is not accompanied by a gene. Therefore, it is not amplified at this stage. The antibody library after amplification does not already contain an antibody having the same reactivity as the masking agent, or even if it contains, the population in the antibody library is greatly reduced. Therefore, in the subsequent screening, the possibility of acquisition is significantly reduced. As a result, the possibility of obtaining the target antibody increases.

  In addition, the present invention relates to an antibody obtained by the above method, or a variable region thereof. The antibody that can be obtained by the present invention is an antibody that has been difficult to obtain. The antibodies, their variable regions, and the polynucleotides that encode them are therefore novel.

In the present invention, the binding activity of the antibody obtained through the above-described steps can be further evaluated as necessary. That is, the present invention relates to a method for screening an antibody that binds to a surface antigen of a specific cell and does not bind to a similar cell when it is brought into contact with a similar cell under the same conditions, comprising the following steps.
(1) The antibody selected based on the present invention is contacted with the solid phase holding the specific cell or fraction thereof and the solid phase holding the similar cell or fraction thereof under common conditions. Process, and
(2) A step of selecting an antibody that binds to the solid phase holding the specific cell or a fraction thereof and does not bind to the solid phase holding the similar cell or a fraction thereof.

In the present invention, a similar cell is a cell having immunologically similar characteristics. For example, cells that have a common cell surface antigen are cells that are similar to each other. Specifically, cells having the same or very similar cellular tissue origin and mutant cells thereof are similar cells.
Alternatively, if an antibody obtained by the present invention is used for a certain cell and a cell ELISA using another cell as an antigen is performed and if the positive rate exceeds 90%, they are regarded as similar cells. You can also. Usually, when both are derived from completely different tissues, the positive rate of cell ELISA is at most about 60 to 80%. Cell ELISA can be performed by the method described in the Examples.

  That is, the cells for confirming the binding activity are fixed in a suitable container. For example, a microplate or the like is suitable as a reaction container for cell ELISA. Next, an antibody whose reactivity is to be confirmed is brought into contact with the fixed cells. At this time, the antibody having the activity of binding to the cell is captured by the immobilized cell. The antibody captured by the cell can be detected by a second antibody that recognizes the antibody. If the second antibody is labeled, the antibody bound to the cells can be easily detected. If the antibody to be detected is IgG, for example, an anti-IgG antibody can be used as the second antibody.

For example, when the similarity between a certain cell X and cell Y is evaluated, the obtained overlapping ratio of antibodies can be performed as follows. First, an antibody group obtained as an antibody that binds to cell X is brought into contact with cell X, and the total amount of antibody that binds to cell X is determined. Next, the same antibody is bound to cell Y, and the total amount of the similarly bound antibody is determined. By comparing the two measurement results, the ratio of the antibody binding to the cell Y in the antibody binding to the cell X can be determined. Or conversely, if the total amount of the antibody that binds to cell Y and cell X is determined for each antibody group obtained as an antibody having binding activity to cell Y, the ratio of the antibody that binds to both can be determined.
Furthermore, when the antibody library is an rgdp library, the antibody variable region genes of the obtained clones can be sequenced to determine the proportion of the clones obtained in common.

As a combination of similar cells in the present invention, for example, a combination in which specific cells are cancer cells and similar cells are normal cells of the same tissue as the cancer cells can be shown. Alternatively, a combination in which a specific cell is a cancer cell at a certain stage and a similar cell is the same type of cancer cell at another stage is also a combination of similar cells.
Furthermore, a certain cell and its mutant cell can be shown as a combination of similar cells. Mutant cells include virus-infected cells, cells with disease-specific protein expression mutations, cancer cells, externally damaged cells, and the like, and protein expression may be mutually mutated in each disease state stage.

In the antibody evaluation method of the present invention, an immunohistological technique is used when evaluating the binding activity to the cell itself as an index. That is, the antibody to be evaluated is reacted with a fixed specimen of specific cells and similar cells, and an antibody bound to the fixed specimen is detected. The antibody bound to the fixed specimen can be detected by a labeled antibody against the antibody.
On the other hand, when the evaluation is based on the binding activity of the antibody to the solid phase retaining the cell or a fraction thereof, for example, the principle of ELISA can be applied. That is, the antibody to be evaluated binds to the cell or cell fraction fixed on the solid phase. Next, the amount of antibody to be evaluated bound to the solid phase is detected by an antibody that recognizes the antibody (second antibody). When the second antibody is labeled with an enzyme, the binding level of the antibody to be evaluated can be determined using the enzyme activity as an index.

Based on the present invention, antibodies that bind to certain cells and not to similar cells can be selected. This antibody is considered to recognize an antigen specifically expressed in a certain cell. Therefore, by isolating and identifying the antigen recognized by this antibody, the antigen specifically expressed in the cell can be identified. That is, the antibody selected according to the present invention can be used for isolation and identification of cell surface antigens. That is, this invention relates to the identification method of the antigen which the antibody selected based on this invention couple | bonds including the following processes.
(1) contacting the antibody selected by the method of the present invention with the cell surface antigen used for isolation of the antibody,
(2) recovering the antigen bound to the antibody; and
(3) Identifying the recovered antigen

  In the method for identifying a cell surface antigen according to the present invention, a fraction containing an antigen obtained from a cell can be used as the cell surface antigen. For example, a soluble fraction of a cell membrane surface antigen that can be obtained using various surfactants as described later is preferable as the fraction of cells in the present invention. In such cell fractions, many cell surface antigens maintain their structure. Therefore, it is useful for isolation of cell surface antigens.

On the other hand, as the antibody, any antibody that maintains the binding activity to the antigen can be used. That is, the antibody may be a fragment containing an antigen-binding region. The fragment containing the antigen-binding region may be a heavy chain and a light chain linked by -SS-bonding, or may be a single-chain polypeptide such as scFv. Furthermore, an immunoglobulin or a fragment thereof without a light chain, such as a camel antibody, can also be used.
When the antibody is selected from the rgdp library, the necessary antibody or fragment thereof can be reconstituted by obtaining the gene of the antibody packaged in the rgdp library and expressing it.

  In the present invention, the antibody and the cell surface antigen are brought into contact under conditions that allow an antigen-antibody reaction. For example, they can be brought into contact with each other in physiological saline or various buffer solutions. The antigen bound to the antibody is then recovered.

  In order to recover the antigen, it is convenient to previously bind the antibody to a solid phase or use an antibody having a label that binds to the solid phase. For example, an antibody or a fragment thereof can be chemically bound to cellulose beads activated with cyanogen bromide. Alternatively, an antibody that recognizes the antibody can be used to immunologically capture on the solid phase. For example, when the antibody that binds to the antigen is IgG, it can also be captured on a solid phase using a solid-phased anti-IgG antibody.

  An antibody having a label capable of binding to a solid phase can be an antibody having a binding tag. The binding tag refers to a substance having binding affinity with other molecules. Specifically, protein A, protein G, histidine tag, biotinylated sequence, chitin binding domain, mannose binding domain and the like can be shown as binding tags. These tags can be expressed as fusion proteins with antibodies or fragments thereof. That is, first, a gene encoding an antibody selected from the rgdp library is obtained. Subsequently, this gene is linked to a gene encoding these tags and expressed, whereby a fusion protein having a binding tag can be obtained. An antibody or antibody fragment having a binding tag is captured on a solid phase having a binding partner corresponding to the binding tag. As a result, the antigen to be identified is captured on the solid phase via the antibody. If the solid phase is washed and recovered as necessary, the target antigen can be recovered as a solid phase.

  The recovered antigen can be identified by any method. Various methods for identifying cell-derived substances are known. Using these methods, the substance is identified. For example, in the case of a protein antigen, the protein can be identified by determining the amino acid sequence. Any method can be used for determining the amino acid sequence. As a preferred method for identifying an amino acid sequence in the present invention, a method applying mass spectrometry can be shown. The principle will be briefly described below.

  After mild ionization such as “Matrix-Assisted Laser Desorption / Ionization” (MALDI) and “Electrospray Ionization” (ESI) is realized, mass spectrometry is also used for mass measurement of biological substances such as proteins, sugars, and nucleic acids. The meter (MS) has been applied. Both MALDI and ESI can use time-of-flight mass spectrometer (TOF-MS) quadrupole, ion trap, and magnetic field mass spectrometers.

  The principle of TOF-MS is as follows. When a substance is ionized and accelerated to fly through a vacuum, its time of flight varies with the charge and mass of the substance. By utilizing this phenomenon and measuring the time of flight of the ionized substance, its mass can be revealed. This is the measurement principle of TOF-MS mass spectrometry.

The feature of ESI method is that peptides in solution can be directly ionized, and HPLC separated peptides can be directly mass analyzed. (LC-MS) In this case, HPLC can be developed in a multidimensional manner.
It is possible to determine amino acid sequences by performing tandem mass spectrometry (MS / MS) with two mass spectrometers, and to perform peptide mass fingerprinting using MALDI-TOF. Aside from tandem MS, the amino acid sequence can be determined by using the PSD method (post source decay method), the protein ladder sequencing method, or the like. In addition, MALDI-TOF can be used not only for determining the size of a protease digested fragment but also for determining the amino acid sequence.

  In these analyses, the protein to be identified is usually fragmented prior to analysis. There are an enzymatic method and a chemical method for fragmenting a protein. As an enzymatic method, an enzyme belonging to serine protease is used. For example, trypsin, chymotrypsin, or V8 protease can also be used for protein digestion. These proteases recognize and cleave specific amino acid residues in the amino acid sequence constituting the protein. As a method for chemically digesting proteins, for example, digestion with cyanogen bromide (CNBr) is known. Cyanogen bromide cleaves the C-terminal side of the Met residue. The size of a fragment generated by protein digestion is information unique to the protein.

  The fragment size can be predicted based on the amino acid sequence. Therefore, for a protein having a known amino acid sequence, what kind of fragment is generated by digestion with each protease can be stored in a database in advance. On the other hand, for the protein to be identified, the size of the fragment produced by protease digestion can be comprehensively determined by, for example, MALDI-TOF. The obtained combination of fragment sizes is collated with information on a known protein, and if it has the same pattern as the known protein, the protein can be identified. On the other hand, if it does not match the fragment pattern predicted from the amino acid sequence of a known protein, the amino acid sequence of the protein may be unknown.

  For example, an amino acid sequencing method by tandem mass spectrometry (MS / MS) is known. In determining the amino acid sequence by tandem mass spectrometry (MS / MS), normal mass spectrometry is performed with MS-1 (the mass spectrometer of Brother 1). In protein analysis, digested fragments of protease are analyzed by MS-1. In MS-2 (second mass spectrometer), the specific molecule (fragment) analyzed by MS-1 is further analyzed. At this time, in tandem MS, peptide ions separated by MS-1 are decomposed by colliding with inert gas particles or the like in the MS device, and the amino acid sequence is directly determined from the mass difference of the generated daughter ions.

  From the mass spectrum of MS-2, the mass difference between the daughter ions produced can be clarified. As a result, the deviation of the peak of the mass spectrum obtained by MS-2 corresponds to one amino acid. Since the peak deviation means the molecular weight of each amino acid, the amino acid sequence of a certain fragment can be uniquely determined from the mass spectrum.

  Alternatively, the amino acid sequence of the protein can be determined by Edman degradation method or the like. The Edman degradation method is a method in which an amino acid sequence is determined one by one by decomposing a protein from its end and analyzing the cut out amino acids or the remaining fragments. Amino acids or fragments can be analyzed by liquid chromatography or MALDI-TOF.

  According to the present invention, an antibody that recognizes an antigen other than a protein antigen can also be obtained. Many substances other than proteins that act as antigens are known. For example, carbohydrate antibodies, lipid antigens, or low molecular weight compounds such as drugs and non-peptide hormones are also recognized by antibodies. In addition, an antibody that specifically recognizes the modified structure binds to a protein modified by phosphorylation or acetylation. These antigens can also be obtained and identified using antibodies.

  These antigen molecules can be clarified by, for example, detection methods unique to each molecular species such as protein, nucleic acid, sugar, lipid, and the like. Specifically, detection methods such as the ninhydrin reaction and the burette reaction are known for proteins, and the orthotoluidine / boric acid (OTB) method is known for sugars. Alternatively, molecular species can be predicted by spectroscopic techniques. As a spectroscopic technique, an identification method by observing an intrinsic absorption wavelength band using an ultraviolet absorption spectrum is known. Subsequently, antigen molecules can be identified by searching for the molecular weight obtained by mass spectrometry with respect to registered data in the molecular weight database corresponding to the type of molecule.

  Thus, the antigen recognized by the antibody selected according to the present invention can be identified. If the structure of the identified antigen is novel, it means that a novel cell surface antigen has been successfully isolated. That is, the present invention provides an antigen identified by the present invention.

In the antibody screening method or antigen identification method of the present invention, a soluble fraction of a cell surface antigen is used. Many cell surface antigens maintain their structure by immobilizing the transmembrane domain on the cell membrane. In addition, some substances become insoluble as a result of exposure of hydrophobic domains by separation from the cell membrane. It is often difficult to recover such substances as soluble fractions while maintaining immunological properties. However, the present inventors have succeeded in preparing a soluble antigen fraction for antibody screening and cell surface antigen isolation. That is, this invention provides the manufacturing method of the soluble fraction of a cell surface antigen including the following processes.
(1) a step of disrupting cells expressing the target cell surface antigen,
(2) a step of recovering a cell membrane fraction from the crushed material in step (1),
(3) a step of solubilizing the cell membrane fraction with a surfactant mixture, and
(4) Step of recovering the supernatant of step (3) as a soluble fraction of cell surface antigen

  In the method of the present invention, as the surfactant constituting the surfactant mixture, either a nonionic surfactant or an amphoteric surfactant, or both can be used. For example, nonionic surfactants include NP-40, Triton X100, n-Dodecyl β-D-maltoside, n-Octyl β-D-glucoside, n-Octyl β-D-maltopyranoside, and n-Decyl β- At least one compound selected from the group consisting of D-maltoside can be used. Furthermore, deoxycholic acid is useful as an amphoteric surfactant. The concentration of each of these surfactants can be, for example, 0.01 to 5% w / v, usually 0.1 to 1% w / v, preferably 0.2 to 0.5% w / v. .

  In the present invention, a soluble fraction of cell surface antigens can also be obtained by enzymatic digestion. That is, this invention provides the manufacturing method of the soluble fraction of a cell surface antigen including the process of incompletely digesting a cell surface antigen, and the process of collect | recovering the cell surface antigen cut | disconnected from the cell by incomplete digestion. Incomplete digestion of cells can be performed by allowing a protease to act on the cells. As a proteolytic enzyme, serine protease or the like can be used. A preferred serine protease is trypsin.

  When proteolytic enzymes are used, regardless of whether chemicals are used, digestion / degradation cuts parts (bonds) that meet specific conditions, but all parts satisfying the conditions are simultaneously cut (simultaneously) It doesn't go on. That is, the start time of the cleavage reaction is the start time (time t = 0, the cut location n = 0), and the end time (t = T, n = N) ), The states from n = 0 to N continuously exist at each instant from t = 0 to T. Incomplete digestion is a state of 0 <n <N, and in order to obtain this state, the reaction may be stopped by some method at a time of 0 <t <T.

The value of T varies greatly depending on the substrate, the type of enzyme / chemical used, and the reaction conditions. However, since the substrate cannot be changed, the type of enzyme / chemical and the reaction conditions will be examined. Furthermore, the types of enzymes / chemicals to be used are limited depending on the purpose (where you want to cut), so changing the reaction conditions such as temperature and enzyme / chemical concentration will make it suitable for the purpose. Consideration to get is done.
The product obtained when digestion is complete can be theoretically inferred. If a molecular species is obtained that is larger than the fully degraded product (but smaller than the undegraded substrate), digestion has not progressed completely. This can be confirmed by electrophoresis or mass spectrometry as long as the molecular weight is examined.

  Not only trypsin but also enzymes have optimal reaction temperature, pH, and salt concentration conditions. As described above, in order to obtain an incomplete digest, it is sufficient to stop the reaction between t = 0 and T. However, under optimal reaction conditions, the value of T may be too small to stop the reaction between t = 0 and T. Therefore, it is possible to stop the reaction before complete digestion occurs by deliberately shifting the optimal reaction conditions to slow the reaction rate (delaying the T value).

  Trypsin is neutral (around pH 8) and the body temperature (37 ° C) is the optimal condition, so reaction conditions that shift these conditions, for example, pH 4 and reaction temperature 4 ° C, are set. As a starting point, check the cutting state by sampling over time, and adjust the pH, reaction temperature, and reaction time accordingly. Alternatively, by adjusting the amount of enzyme added to the reaction system (enzyme concentration at the time of reaction), reaction conditions suitable for the purpose may be examined.

  Depending on the size (molecular weight) of the digested product, the recovery method differs. For the recovery of molecules that are hardly degraded (molecular weight of 10,000 or more), column chromatography and electrophoresis are used in the same way as ordinary proteins. When recovering lower molecules than that, a recovery method using binding to silica beads is used. HPLC using silica beads such as C4 (representing the degree of crosslinking of silica polymer, the higher this number, the higher the hydrophobicity) for relatively high polymers, C8, and C18 for low molecules (Reverse Phase Liquid Chromatography) is used, but recently, products that can be processed more easily, such as silica beads on the tip of the chip (Millipore ZipTip), are available as products.

  According to the method of the present invention, a soluble fraction of any cell can be prepared. Preferred cells are animal-derived cells. Of these, cancer cells are preferred.

The soluble fraction of cell surface antigens obtainable by the method of the present invention can be used for antibody screening methods and antigen isolation methods. That is, this invention relates to the method of isolating the cell surface antigen which an antibody recognizes including the following processes.
(1) contacting a soluble fraction of a cell surface antigen obtainable by the method for producing a cell surface antigen according to the present invention with an antibody; and
(2) Isolating the antigen bound to the antibody

  As the antibody used in this method, an antibody selected based on the method of the present invention can also be used. In isolating the antigen, the antibody can be bound to a solid phase or have a label that can bind to the solid phase. The method for binding the antibody to the solid phase has already been described.

  In the method for isolating an antigen according to the present invention, the soluble fraction of the cell surface antigen and the antibody are contacted under conditions that allow an immunological reaction. Such conditions are as described above. Preferably, in the step of contacting the soluble fraction of the cell surface antigen with the antibody, the concentration of the surfactant in the reaction solution can be adjusted to 0.01% w / v-5% w / v. By adjusting the concentration of the surfactant within this range at the time of reaction with the antibody, the inhibitory effect on the immunological reaction can be eliminated.

  The antigen thus isolated can be identified by the method as described above. That is, the present invention provides a method for identifying a cell surface antigen comprising the steps of isolating and identifying an antigen that binds to an antibody from the soluble fraction of the cell surface antigen. For the identification of an antigen, for example, in the case of a protein antigen, the size of the fragment or the amino acid sequence constituting the fragment can be analyzed by digesting the antigen. These analysis methods are also as described above. The present invention relates to antigens isolated in this way or to further identified antigens.

Various surfactants useful for the production of the soluble fraction of the cell surface antigen according to the present invention can be blended in advance to form a surfactant mixture for solubilizing the cell surface antigen. That is, this invention relates to the surfactant liquid mixture for solubilization of a cell surface antigen containing the following compositions. The amount of each surfactant used may be adjusted to be, for example, 0.01 to 5% w / v, usually 0.5 to 5% w / v, preferably 1 to 2.5% w / v. it can.
NP-40,
Triton X100,
n-Dodecyl β-D-maltoside,
n-Octyl β-D-glucoside,
n-Octyl β-D-maltopyranoside
n-Decyl β-D-maltoside, and
Deoxycholic acid

  In the antibody screening method of the present invention, cells retained on a solid phase carrier can also be used as cells. If cells retained on a solid phase carrier are used, antibodies bound to the cells or rgdp clones can be recovered by recovering the carrier. As a carrier for holding cells, for example, glass beads can be used. For example, by culturing cells with glass beads coated with a cytophilic substance, the cells adhere to the glass bead surface. Glass beads with attached cells are useful for the screening of the present invention. For example, collagen can be used as the cell affinity substance that assists cell attachment. If the glass beads are immersed in a collagen solution and incubated, the glass beads can be treated with collagen.

  According to the present invention, an antibody that recognizes a cell surface antigen can be obtained. The antibody obtained by the present invention can be used for identification, isolation, detection and the like of cells or cell surface antigens. Furthermore, an antibody that recognizes a cell surface antigen isolated by the present invention can also be used for the treatment of a disease that targets the cell surface antigen. For example, antibodies that recognize cell surface antigens specific for cancer cells are useful for the treatment of cancer. For example, targeted therapy for cancer can be performed by administering an antibody labeled with a cytotoxic substance. Such a therapeutic strategy can be said to be applied to an antibody drug delivery system.

  Furthermore, when the antibody isolated by the present invention has cytotoxic activity, the antibody itself can be used for immunological treatment of cancer. For example, some IgG antibodies have ADCC (Antibody-Dependent Cell-mediated Cytotoxicity) activity. Such an antibody itself has a damaging effect on cells expressing the antigen. It can be confirmed in vitro that the antibody has ADCC activity. For example, the cytotoxic effect of the antibody can be detected by contacting the cultured cell with the antibody and observing the effect on the cell. When the antibody isolated by screening lacks a constant region such as scFv, the cytotoxic effect can be confirmed after conjugation with an appropriate constant region. Alternatively, ADCC activity can also be confirmed by binding an antibody (secondary antibody) against a protein fused to scFv. It is a new finding found by the present inventors that a cytotoxic action dependent on an antibody fragment comprising an antigen-binding site can be detected with the aid of a secondary antibody. Hereinafter, in the present invention, when an antibody fragment exhibits a cytotoxic effect with the aid of a secondary antibody, the antibody fragment is said to have a cytotoxic effect.

  The cytotoxicity of antibodies, whether ADCC or complement-dependent cytotoxicity (CDC), was thought to require immunoglobulin constant regions. Therefore, for example, an antibody fragment without a constant region, such as scFv, cannot be confirmed to have a cytotoxic effect as it is. Therefore, it was necessary to reconstitute the molecule joined to the constant region by genetic recombination or the like to confirm the cytotoxic effect. On the other hand, according to the present invention, even an antibody fragment that does not have a constant region, such as scFv, can be confirmed for its cytotoxic effect using a secondary antibody. That is, according to the present invention, the cytotoxic effect can be confirmed without joining scFv to the constant region. The present invention is useful for confirming the cytotoxic effect of scFv selected from a phage library.

That is, the present invention relates to a method for detecting the cytotoxic effect of an antibody fragment comprising an antigen-binding site comprising the following steps.
(1) contacting the antibody fragment, a secondary antibody recognizing the antibody fragment, and a cell expressing an antigen recognized by the antibody fragment; and
(2) A step of detecting a cytotoxic effect Alternatively, the present invention provides a method of imparting a cytotoxic effect to an antibody fragment by binding a secondary antibody that recognizes the antibody fragment to an antibody fragment containing an antigen-binding site. About. In the present invention, an antibody fragment (antibody fragment) containing an antigen-binding site refers to a fragment that maintains the binding activity of an antibody to an antigen. For example, fragments lacking the constant region necessary for the cytotoxic action of the antibody are included in the antibody fragments of the present invention. Specifically, scFv, Fab, Fab′2, etc. can be shown as antibody fragments. The antibody fragment may be fused with other proteins as long as the binding activity to the antigen is maintained. For example, scFv is fused with a phage protein when expressed as a phage antibody, but maintains the binding activity to the antigen. That is, the phage antibody is included in the antibody fragment of the present invention. For example, a fragment containing an antigen-binding site of an antibody obtained by the method of the present invention as described above, or an rgdp clone is preferable as an antibody fragment (antibody fragment) containing an antigen-binding site in the present invention.

  On the other hand, as the secondary antibody in the present invention, any antibody capable of recognizing and binding to the antibody fragment can be used. A preferred secondary antibody is an antibody retaining a constant region having a cytotoxic effect. For example, IgG antibody is preferable as the secondary antibody in the present invention. IgG that recognizes scFv, Fab, Fab′2, etc. can be obtained by immunizing any immunized animal with these antibody fragments. Furthermore, when the antibody fragment is fused with another protein, an antibody that recognizes the fusion protein can be used as a secondary antibody. Therefore, for example, the cytotoxic effect of scFv fused with a phage protein can also be detected by using an antibody that recognizes the phage protein as a secondary antibody. Generally, phage antibodies are fused with CpIII, which is a phage protein. Therefore, IgG antibodies that recognize CpIII are preferred as secondary antibodies in the present invention. The secondary antibody may be an immunoglobulin derived from any animal as long as the antibody retains a constant region having a cytotoxic effect. Alternatively, an antibody modified by genetic engineering can be used as a secondary antibody as long as the cytotoxic effect is maintained. An example of such an antibody is a chimeric antibody in which a human constant region is joined to a mouse variable region.

  In the present invention, examples of the cytotoxic activity to be detected include antibody-dependent cellular cytotoxicity (ADCC). The cytotoxic effect can be detected using as an index an intracellular component that elutes due to cellular damage. For example, when an enzyme present in the cell elutes in the reaction solution, the enzyme activity in the reaction solution is detected. Therefore, if the enzyme activity is detected after adding the secondary antibody, it can be confirmed that the antibody fragment is a fragment of an antibody having a disorder activity. As an enzyme that can be used as an indicator of cell damage, for example, lactate dehydrogenase (LDH) can be shown. Methods for detecting lactate dehydrogenase activity are known. Lactate dehydrogenase oxidizes lactic acid through electron acceptor (NAD) to produce pyruvic acid. NADH accumulated with this reaction can be enzymatically detected with a coloring dye or a fluorescent dye. Specifically, NADH can be detected using a dye produced by reducing a tetrazolium salt by the action of diaphorase or the like as an index.

  Using the method of the present invention, an antibody fragment having a cytotoxic effect can be selected. That is, the present invention includes a step of detecting a cytotoxic activity by the method for detecting a cytotoxic effect of the antibody fragment, and selecting an antibody fragment in which the cytotoxic activity is detected. The present invention relates to a method for selecting a fragment containing a site. The antibody fragment selected according to the present invention can be used as an antibody having cytotoxic activity by combining with a secondary antibody or by reconstituting an antibody having a constant region. In particular, an antibody fragment reconstituted by conjugation with a human constant region is useful as an antibody drug having a cytotoxic effect.

The elements used in the method for detecting the cytotoxic effect of an antibody fragment or the method for selecting an antibody fragment having a cytotoxic effect based on the present invention can be combined in advance to form a kit. That is, the present invention provides a kit for detecting the cytotoxic effect of an antibody fragment, and a kit for selecting an antibody fragment having a cytotoxic effect, comprising the following elements.
i) Secondary antibody that recognizes antibody fragments
ii) Cells expressing an antigen to which an antibody fragment binds In the kit of the present invention, an antibody fragment that is clearly shown to have a cytotoxic effect or an antibody fragment that is clearly not found to have a cytotoxic effect can be combined as a control sample. Furthermore, a reagent for detecting cell damage can be combined with the kit. Examples of the reagent for detecting cell damage include a reagent for measuring lactate dehydrogenase activity. Examples of the reagent for detecting lactate dehydrogenase include diaphorase, tetrazolium compounds, and NAD.

Based on the present invention, antibodies that actually bind specifically to hepatoma cells were selected by screening a phage library displaying scFv using the soluble fraction of the surface antigen of hepatoma cells. All of these antibodies were confirmed to be useful for the diagnosis of liver cancer. That is, the present invention relates to a polynucleotide obtained from clone 049-023 or 050-051 derived from an antibody variable region-displaying phage library, or a polypeptide encoded thereby, and use thereof.
The nucleotide sequences of the polynucleotides encoding the antibody variable regions possessed by these phage clones are shown in the following SEQ ID NOs.
049-023 VH: SEQ ID NO: 82 049-023 VL: SEQ ID NO: 84
050-051 VH: SEQ ID NO: 86 050-051 VL: SEQ ID NO: 88
The present invention includes polypeptides comprising the following amino acid sequences encoded by these polynucleotides: The polypeptide of the present invention is useful for producing an antibody that recognizes a cell surface antigen of liver cancer.
049-023 VH: SEQ ID NO: 83 049-023 VL: SEQ ID NO: 85
050-051 VH: SEQ ID NO: 87 050-051 VL: SEQ ID NO: 88
The present invention also relates to a polynucleotide comprising a base sequence capable of encoding these amino acid sequences. The polynucleotide of the present invention is useful for producing an antibody that recognizes a cell surface antigen of liver cancer.

  A person skilled in the art can obtain a variable region of an antibody that recognizes a specific antigen based on the amino acid sequence of the variable region or the base sequence encoding it. For example, the polynucleotide of the present invention can be chemically synthesized. Alternatively, a polynucleotide encoding a variable region of another antibody that has already been obtained can be modified based on the base sequence disclosed by the present invention to obtain a polynucleotide having the target base sequence. .

  For example, the amino acid sequence of the above polypeptide can be analyzed, and the amino acid sequence of CDR occupying the variable region can be identified. The base sequence encoding the identified amino acid sequence can be selected from the base sequence of the polynucleotide. By replacing the nucleotide sequence encoding the CDR of the polypeptide of the present invention thus selected with the CDR of another antibody, an antibody having the same binding activity as the antibody of the present invention can be reconstructed with high probability. it can. That is, the present invention provides a method for producing an immunoglobulin that binds to a cell surface antigen of liver cancer, comprising the step of transplanting an amino acid sequence of a CDR region selected from the amino acid sequence of the polynucleotide to a CDR of another immunoglobulin. To do. Alternatively, the present invention provides an immunoglobulin H chain having a CDR consisting of the following amino acid sequences, an L chain, and an immunoglobulin containing both, or a fragment containing a variable region thereof.

049-023H CDR1 SGYTLTGLSIH (SEQ ID NO: 90)
CDR2 GFDPEDGETTYSQKFQG (SEQ ID NO: 91)
CDR3 AGGYYYFGLDV (SEQ ID NO: 92)
049-023L CDR1 RASQSVSSSYLA (SEQ ID NO: 93)
CDR2 GASSRAT (SEQ ID NO: 94)
CDR3 QQYGSSPWT (SEQ ID NO: 95)
050-001H CDR1 SGYTFTSYGIS (SEQ ID NO: 96)
CDR2 WISAYNGNTNYAQKLQG (SEQ ID NO: 97)
CDR3 DFSNYAPFDY (SEQ ID NO: 98)
050-001L CDR1 QGDSLRSYYAS (SEQ ID NO: 99)
CDR2 GKNNRPS (SEQ ID NO: 100)
CDR3 NSRDSSGNHVV (SEQ ID NO: 101)

  A polynucleotide encoding the variable region of an antibody can be used as an antibody expression vector by inserting it into an appropriate expression vector. The antibody can be a variable region alone or can be expressed as an intact antibody by fusing the constant regions. That is, the present invention provides a vector retaining the polynucleotide so that it can be expressed. A vector that can be expressed as a variable region or a chimeric antibody having a constant region by incorporating a gene encoding the isolated variable region is known. As a vector for expressing an antibody, a vector that incorporates both VH and VL and has a structure that can be expressed as a variable region of a heterodimeric structure is also known.

  The vector of the present invention can express an antibody or an antibody variable region by transformation into an appropriate host. That is, the present invention provides an antibody that binds to a cell surface antigen of liver cancer, or a transformed cell that can express its variable region. From this transformed cell culture, an antibody that binds to a cell surface antigen of liver cancer or a variable region thereof can be obtained. That is, the present invention provides a method for producing an antibody that binds to a cell surface antigen of liver cancer, or a variable region thereof, comprising the steps of culturing the transformed cell of the present invention and recovering the expression product.

  The antibody that binds to the cell surface antigen of liver cancer obtained by the present invention, or a variable region thereof, is useful for treatment or diagnosis of liver cancer. That is, the present invention provides a pharmaceutical composition for treating or diagnosing liver cancer, comprising an immunoglobulin molecule containing the amino acid sequence as a variable region, or at least one fragment containing the variable region and a pharmaceutically acceptable carrier. I will provide a. The immunoglobulin or the fragment containing the variable region constituting the pharmaceutical composition of the present invention can be modified with various molecules useful for treatment or diagnosis.

For example, radioisotopes are useful for imaging and treating cancer lesions. For example, a method for labeling immunoglobulin with Tc99m or the like is known. Alternatively, various magnetic metals and chelates coordinated with metals are useful for imaging cancer lesions by MRI. Furthermore, a drug for cancer treatment itself or a microcapsule encapsulating the drug can be bound to the immunoglobulin of the present invention, and the drug can be administered intensively to the cancer lesion. In addition, an immunoglobulin to which a molecule that generates a signal such as a fluorescent dye, a luminescent dye, or an enzyme is bound is useful as a probe for detecting cancer tissue in vitro or in vivo.
Alternatively, the present invention includes an immunoglobulin molecule that binds to a sample by contacting either or both of the immunoglobulin molecule containing the amino acid sequence as a variable region, or a fragment containing the variable region, or the variable region thereof. The present invention relates to a method for examining liver cancer, comprising a step of detecting a fragment.

The present invention also provides a liver cancer test kit comprising the following elements. If the kit of the present invention immunostains a pathological tissue suspected of having liver cancer and detects cells to which an immunoglobulin molecule or a fragment containing a variable region thereof is bound, liver cancer is present in the test sample. Can be confirmed.
i) either an immunoglobulin molecule comprising the amino acid sequence as a variable region, or a fragment comprising the variable region, or both,
ii) normal hepatocyte tissue, and
iii) Cancer cell tissue of liver cancer

  Of the above elements, ii) normal hepatocyte tissue, and iii) cancer cell tissue of liver cancer are used as negative and positive controls in the test. By using the control sample, it is possible to prevent erroneous determination caused by an operation error. In addition, the inspection of the control sample is useful for standardizing the determination of the inspection result.

Additional components necessary for performing immunostaining can be combined with the reagent or kit of the present invention. For example, a label can be bound in advance to a fragment containing an immunoglobulin molecule or a variable region thereof. As the label, a fluorescent dye or an enzyme can be used. As the fluorescent dye, fluorescein isothiocyanate (FITC) or the like is used. Alternatively, peroxidase or alkaline phosphatase is used as the enzyme. The label can be directly attached to an immunoglobulin molecule or a fragment containing the variable region thereof. A bifunctional linker can be used for binding the label. Alternatively, a technique for indirectly binding a label using an avidin-biotin bond is also known.
Hereinafter, based on an Example, this invention is demonstrated further more concretely.

1. Preparation of vector for constructing scFv antibody gene library
1-1 Preparation of vector for constructing scFv antibody gene library As shown conceptually in FIG. 1, pTZ19R phagemid vector (Pharmacia) has pelB (signal sequence) of M13 phage, His6 tag sequence, cp3 of M13 phage. A vector pFCAH9-E8d was constructed by incorporating a protein (Δcp3 (198aa-406aa) N-terminal deletion capsid protein 3) sequence and proteinA protein sequence at appropriate restriction enzyme sites (Iba Y. et al., Gene 194: 35-46). , 1997.). A vector pscFvCA9-E8VHdVLd for scFv antibody library was further prepared from this pFCAH9-E8d.

An actual antibody protein expression vector is completed by inserting the heavy chain and light chain genes into predetermined positions of the vector. The shape of the antibody expressed by the completed vector is scFv type, the light chain constant region CL gene is linked to the aforementioned cp3 gene, and as a result, the expressed protein has the shape of scFv-CL-cp3.
Specifically, the following operation was performed.
Primers used:
527 Reverse (SEQ ID NO: 1):
5'-CAGGAAACAGCTATGAC-3 '
599 E8VHf-PstR: (SEQ ID NO: 2)
3'-CGGCTCCAAGTCGACGTCGTCA-5 '
544 E8VHf-PstF: (SEQ ID NO: 3)
5'-CAGCTGCAGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAACATTAA-3 '
545 E8VHf-XbaR: (SEQ ID NO: 4)
3'-AGACCGAAGTTGTAATTTCTGTGGATATACGTGACCCACTTCGTCTCCGGACTTTTCCCAGATCTCACCTAACCTTCCTAA-5 '
546 E8VHf-XbaF: (SEQ ID NO: 5)
5'-AAGGGTCTAGAGTGGATTGGAAGGATTGATCCTGCGAGTGGTAATACTAAATATGACCCGAAGGACAAGGCCACTATAACAGCA-3 '
547 E8VHf-EcoR (SEQ ID NO: 6)
3'-TTCCTGTTCCGGTGATATTGTCGTCTGTGTAGGAGGTTGTGTCGGATGGATGTCGACTTAAGGGAC-5 '
548 E8VHf-EcoF (SEQ ID NO: 7)
5'-CAGCTGAATTCCCTGACATCTGAGGACACTGCCGTCTATTACTGTGCTGGT-3 '
549 E8VHf-BstR (SEQ ID NO: 8):
3'-CAGATAATGACACGACCAATACTAATGCCGTTGAAACTGATGACCCCGGTTCCGTGGTGCCAGTGGCACAAGG-5 '
590 His6-SmaR (SEQ ID NO: 9):
3'-GGTTCTCTAACAGTAGTGGTAGTAGTGGTAATTATTCTCGATAGGGCCCTCGAA-5 '
542 E8VLf-SacF (SEQ ID NO: 10):
5'-GACATCGAGCTCACCCAGTCTCCAGCCTCCCTTTCTGCGTCTGTGGGAGAAACTGTCACCATCACATGT-3 '
539 E8VLf-KpnR (SEQ ID NO: 11):
3'-TGACAGTGGTAGTGTACAGCTCGTTCACCCTTATAAGTGTTAATAAATCGTACCATGGTCGTC-5 '
542 E8VLf-KpnF (SEQ ID NO: 12):
5'-GCATGGTACCAGCAGAAACCAGGGAAATCTCCTCAGCTCCTGGTCTAT-3 '
543 E8VLf-BamR (SEQ ID NO: 13):
3'-GGAGTCGAGGACCAGATATTACGTTTTTGGAATCGTCTACCACACGGTAGTTCCAAGTCACCGTCACCTAGGCCTTGTGTT-5 '
562 E8VLf-XhoR (SEQ ID NO: 14):
3'-TCATGAGGCACCTGCAAGCCACCTCCGTGGTTCGAGCTCTAGTTT-5 '
563 E8VLf-XhoF (SEQ ID NO: 15):
5'-AGTACTCCGTGGACGTTCGGTGGAGGCACCAAGCTCGAGATCAAA-3 '
613 NheR (SEQ ID NO: 16):
3'-ATCGACAGCT-5 '
600 E8VLKpnXhoR (SEQ ID NO: 17):
3'-AAGCCACCTCCATGGTTCGAGCTCTAGTTT-5 '
LCP3ASC (SEQ ID NO: 18):
3'-TCGAAGTTGTCCTTACTCACAAGCCGCGCGGTCAGCTGAGGTAA-5 '
hCH1Bst (SEQ ID NO: 19):
5'-ACCCTGGTCACCGTCTCCTCAGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGG-3 '
hCH1midAS (SEQ ID NO: 20):
3'-GGGAGTCGTCGCAGCACTGGCACGGGAGGTCGTCGAA-5 '
hCH1midS (SEQ ID NO: 21):
5'-GGACTCTACTCCCTCAGCAGCGTCGTGACCGTGCCC-3 '
hCH1H6 (SEQ ID NO: 22):
3'-GGGTCGTTGTGGTTCCACCTGTTCTTTCAACTCGGGTTTAGAACAGTAGTGGTAGTAGTGGTA-5 '
hCH1H6Sma (SEQ ID NO: 23):
3'-GGGTTTAGAACAGTAGTGGTAGTAGTGGTAATTATTCTCGATAGGGCCCTCGAACG-5 '
702 BstXhoF (SEQ ID NO: 24):
5'-GGCACCACGGTCACCGTCTCGAGCGCCTCCACC-3 '

<Preparation of pFCAH3-E8T H chain part>
1) Using pAALFab as a template, PCR using 527-599 and PCR using 547-590 were performed to prepare DNA fragments.
2) PCR was performed at 544-545, 546-547, 548-549 to prepare DNA fragments.
3) 1) 2) was mixed and PCR was performed using 527,590, and this was cloned into the HindIII-SmaI site of pAALFab.

<PFCAH3-E8T L chain part>
4) PCR was performed using 542-562 and 561-613 to prepare DNA fragments.
5) PCR was performed at 538-539 and 542-543 to prepare DNA fragments.
6) 4) 5) was mixed and PCR was performed by 538,562, and this was cloned into the SacI-NheI site of pAALFab.

<PFCAH9-E8d>
7) Production of VH stuffer part
pFCAH3-E8T was digested with XbaI and EcoRI, and klenow fragment was allowed to act to change it to a blunt end, followed by self ligation to produce a VH stuffer.
8) Production of VH stuffer part
PCR at 527-600 using pFCAH3-E8T as a template. It was cloned into the HindIII-XhoI site of 7).
9) This was digested with KpnI and self-ligated to prepare a stuffer for the VL part.
10) Introduction of SfiI, NcoI, SpeI site
PCR with 527-663 using pFCAH3-E8T as a template. It was cloned into the HindIII-SacI site of 1).
11) Introduction of AscI site
Using pFCAH3-E8T as a template, PCR was performed with 527-LCP3ASC, which was then cloned into 2) which had been completely digested with SacI and partially digested with SalI.
12) Conversion of the gammaCH1 part into a human gene Cloning was performed with a design that eliminates the BstPI site in the human gammaCH1 part because it has a BstPI site. PCR was carried out with hCH1Bst-hCH1midS and hCH1midAS-hCH1H6 using Gentou gland cDNA as a template, then mixed and PCRed with hCH1Bst-hCH16Sma, and the DNA fragment was cloned into the BstPI-Sma site in 3) 13) Xho PCR was performed at 702-663 using site introduction 12) as a template, and this was cloned into the BstPI-SacI site of 12).

<Preparation of pscFvCA9-E8VHdVLd>
pFCAH9-E8d 3 μg (3 μL) (see FIG. 1D) was mixed with BstPI (3 U / μL) 3 μL, 10 × H buffer 5 μL, DW 39 μL, and subjected to restriction enzyme treatment at 37 ° C. for 2 hours. After the treatment, the precipitate obtained by ethanol precipitation was dissolved in 10 μL of TE buffer. This was mixed with 1 μL of SacI (10 U / μL), 5 μL of 10 × L buffer, and 34 μL of DW, treated with restriction enzyme at 37 ° C. for 2 hours, and then subjected to agarose gel electrophoresis to recover a 4.7 kb fragment. The recovered product was ethanol precipitated to 10 μL (pFCAH9-E8d BstPI-SacI fragment).

On the other hand, 5 μL of primer linF (100 pmol / μL) and 5 μL of primer linR (100 pmol / μL) were mixed, heated at 94 ° C. for 5 minutes, and then annealed at 80 ° C. for 5 minutes, 70 ° C. for 5 minutes, and left at room temperature for 30 minutes . Of these, 2 μL and 1 μL of the pFCAH9-E8d BstPI-SacI fragment obtained above, 10 × ligation buffer 1.5 μL, DW 9.5 μL, and T4 DNAligase 1 μL were mixed and reacted at 16 ° C. for 16 hours. After the reaction, ethanol precipitation and concentration to 3 μL were performed, and 1.5 μL was used to transform 20 μL of E. coli DH12S competent cells by electroporation. The plasmid of the obtained clone was extracted, the base sequence was confirmed, and it was named pscFvCA9-E8VHdVLd. FIG. 2 schematically shows the structure of pscFvCA9-E8VHdVLd. FIGS. 3-1 to 3-2 show the base sequence (SEQ ID NO: 25) of the insert part of pscFvCA9-E8VHdVLd and the amino acid sequence encoded by it (SEQ ID NO: 26).
Primer linF (SEQ ID NO: 27)
GTCACCGTCTCGAGAGGCGGTGGCGGATCAGGTGGCGGTGGAAGTGGCGGTGGTGGGTCCATGGCCGACATCGAGCT
Primer linR (SEQ ID NO: 28)
CGATGTCGGCCATGGACCCACCACCGCCACTTCCACCGCCACCTGATCCGCCACCGCCTCTCGAGACG

1-2 Construction of a vector for temporary cloning of the heavy chain variable region (VH) According to a known method (see Iba Y. et al., Gene 194: 35-46, 1997.), the pAALFab vector (Fig. 1A) was produced. The region between XbaI and EcoRI of pAALFab vector is deleted, restriction enzyme cleavage sites Kpn I, Sfi I, Nco I, and Spe I are newly added, via pFCAH3-E8T (Fig. 1B), VH (heavy chain variable region) A vector pscFvCA-E8VHd (FIG. 1C) that can be cloned, and used as a vector for temporarily cloning the heavy chain variable region. FIGS. 4-1 to 4-2 show the base sequence (SEQ ID NO: 29) of the insert of pscFvCA-E8VHd and the amino acid sequence (SEQ ID NO: 30) encoded by the restriction enzyme site and the base sequence.

Specifically, primer 610 and primer 611 were annealed and cloned into the BstPI-SacI site of pFCAH3-E8T to produce a single chain. Furthermore, PCR was performed with primer 527 and primer 619, which was further cloned into the HindIII-PstI site, and SfiI and NcoI sites were introduced. The primer sequences used for preparing the vectors are shown below.
610 scBstSpeSacF (SEQ ID NO: 31):
5'-CACCACGGTCACCGTCTCCTCAGGCGGTGGCGGATCAGGTGGCGGTGGAAGTGGCGGTGGTGGGTCTACTAGTGACATCGAGCTCACCCAG-3 '
611 scBstSpeSacR (SEQ ID NO: 32):
3'-GTGGTGCCAGTGGCAGAGGAGTCCGCCACCGCCTAGTCCACCGCCACCTTCACCGCCACCACCCAGATGATCACTGTAGCTCGAGTGGGTC-5 '
527 Reverse (SEQ ID NO: 33):
5'-CAGGAAACAGCTATGAC-3 '
619 E8VHf-SfiNcoPstR (SEQ ID NO: 34):
3'-GACGCCGGGTCGGCCGGTACCGGCTCCAAGTCGACGTCGTCA-5 '

2. Construction of immunoglobulin light chain library
2-1 Isolation of immunoglobulin light chain gene using PCR Bone marrow cells (specimen No. 59) 4 × 10 ⁷ cells and lymphocytes from umbilical cord blood and peripheral blood, commercially available kit (QuickPrep Micro manufactured by Pharmacia Biotech) Using mRNA Purification Kit), 2.6 μg of mRNA was obtained. CDNA was prepared from this mRNA. cDNA was prepared by GibcoBRL SuperScript Preamplification System. Oligo dT was used as a primer. Using the obtained cDNA as a template, PCR was performed using a 5 ′ primer (κ1 to κ6, λ1 to λ6) for obtaining a light chain gene and a 3 ′ primer (hCKASC primer or hCLASC primer). The PCR product was treated with phenol, ethanol precipitated and suspended in 10 μL of TE buffer. The base sequences of the primers used and the PCR conditions are as follows. In the base sequence of the light chain gene acquisition primer, the underlined portion indicates the NcoI site and AscI site.

5'-primer κ1 to κ6
hVK1a (SEQ ID NO: 35):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GACATCCAGATGACCCAGTCTCC
hVK2a (SEQ ID NO: 36):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GATGTTGTGATGACTCAGTCTCC
hVK3a (SEQ ID NO: 37):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GAAATTGTGTTGACGCAGTCTCC
hVK4a (SEQ ID NO: 38):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GACATCGTGATGACCCAGTCTCC
hVK5a (SEQ ID NO: 39):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GAAACGACACTCACGCAGTCTCC
hVK6a (SEQ ID NO: 40):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC GAAATTGTGCTGACTCAGTCTCC
5'-Primer λ1 ~ λ6
hVL1 (SEQ ID NO: 41):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC CAGTCTGTGTTGACGCAGCCGCC
hVL2 (SEQ ID NO: 42):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC CAGTCTGCCCTGACTCAGCCTGC
hVK3a (SEQ ID NO: 43):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC TCCTATGTGCTGACTCAGCCACC
hVL3b (SEQ ID NO: 44):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC TCTTCTGAGCTGACTCAGGACCC
hVL4 (SEQ ID NO: 45):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC CACGTTATACTGACTCAACCGCC
hVL5 (SEQ ID NO: 46):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC CAGGCTGTGCTCACTCAGCCGCC
hVL6 (SEQ ID NO: 47):
GTCCTCGCAACTGCGGCCCAGCCGG CCATGG CC AATTTTATGCTGACTCAGCCCCA
3'-primer hCKASC (SEQ ID NO: 48):
TCGACT GGCGCGCC GAACACTCTCCCCTGTTGAAGCTCTTTGTG
3'-Primer HCLASC (SEQ ID NO: 49):
TCGACT GGCGCGCC GAACATTCTGTAGGGGCCACTGTCTTCTC

PCR conditions
cDNA 2μL
10 × buffer # 1 (attached to KOD) 10μL
dNTP mix (2.0mM) 10μL
25 mM MgCl ₂ 4 μL
5 'primer (100pmol / μL) 1μL
3 'primer (100pmol / μL) 1μL
Sterilized MilliQ 71μL
KOD DNA polymerase (Toyobo 2.5U / μL) 1μL
94 ° C 1 minute, 55 ° C 2 minutes, 74 ° C 1 minute 35 cycles

2-2-1 Incorporation of light chain gene into phagemid The PCR product obtained in 1 was treated with a restriction enzyme under the following conditions.
PCR product 10 μL
10 x NEB4 (attached to AscI) 5μL
Sterilized MilliQ 33μL
AscI (NEB 10 U / μL) 1 μL
NcoI (Takara Shuzo 10 U / μL) 1μL

After reacting at 37 ° C. for 1 hour and at 50 ° C. for 1 hour, 10 μL of the mixture was subjected to agarose electrophoresis, and a band around 600 bp was cut out and purified with Gene Clean II Kit (Funakoshi Co., Ltd.). The pscFvCA9-E8VHdVLd treated with the restriction enzyme in the same manner as the PCR product was purified with the Gene Clean II kit and ligated by reacting with the PCR product treated with the restriction enzyme at 16 ° C. for 4 hours to overnight.
PSCFvCA9-E8VHdVLd 2μL treated with restriction enzymes
1 μL of PCR product treated with restriction enzymes
10 × ligation buffer 1.5μL
(Attached to T4 DNA ligase)
10 mM ATP 1.5 μL
Sterilized MilliQ 8μL
T4 DNA ligase (Takara Shuzo 10 U / μL) 1 μL

2-2-2 Introduction of phagemid into Escherichia coli The obtained ligated DNA was used to transform Escherichia coli DH12S as follows. That is, the ligated DNA was once ethanol precipitated and dissolved in 3 μL of 1/5 TE (TE diluted 5 times with sterilized MilliQ). Among them, 1.5 μL was suspended in 20 μL of competent cell DH12S (manufactured by GIBCO BRL), and electroporation was performed under the following conditions.
Electroporator
BRL Cell-Porator (Cat.series 1600)
Setting condition: voltage booster 4kΩ
capacitance 330μF
DC volts LowΩ
charge rate Fast

  The transformed E. coli is planted in 2 mL of transformation medium (SOB), cultured at 37 ° C for 1 hour with shaking, and then a portion is sprinkled on an agar medium (Amp plate). The rest is 0.1% glucose, 100 µg / mL It was cultured in ampicillin-containing 2 × TY medium and glycerin stocked. The agar medium was incubated at 30 ° C., and colonies that had grown were picked up with a toothpick to prepare a plasmid, and the nucleotide sequence of the light chain gene was examined.

SOB medium: The following components were added to 950 mL of purified water, shaken, and completely dissolved. Then, 10 mL of 250 mM KCl solution was added, and the pH was adjusted to 7.0 with 5N NaOH. After adding purified water to adjust to 1000 mL, the mixture was sterilized with an autoclave for 20 minutes, and 5 mL of 2M MgCl ₂ sterilized just before use was added.
bacto-tryptone 20g
bacto-yeast extract 5g
NaCl 0.5g
2 × YT medium: The following components were added to 900 mL of purified water and shaken. After complete dissolution, the pH was adjusted to 7.0 with 5N NaOH, and purified water was added to 1000 mL. Sterilized in an autoclave for 20 minutes before use.
bacto-tryptone 16g
bacto-yeast extract 10g
NaCl 5g
Other reagents were purchased from the following.
Manufacturer Product Name Sigma Ampicillin Sodium Wako Pure Chemicals Phenolic Sigma BSA
DIFCO 2 × YT medium Wako Pure Chemicals Kanamycin sulfate Nacalai Tesque polyethylene glycol 6000
Nacalai Tesque Tween20
Katayama Chemical NaCl
Wako Pure Chemicals IPTG
Wako Pure Chemicals Skim Milk Wako Pure Chemicals Sodium Azide Wako Pure Chemicals Triethylamine Wako Pure Chemicals Hydrogen Peroxide Wako Pure Chemicals OPD Tablets Wako Pure Chemicals Ethanol

  Perform the above operations for κ1, κ2, κ3, κ4, κ5, and κ6, and λ1, λ2, λ3a, λ3b, λ4, λ5, λ6, λ7, λ8, λ9, and λ10 to obtain the target clone. I confirmed whether it was. Subsequently, clones of each group such as κ1 and κ2 were mixed so that the ratio was close to the in vivo use frequency. It is already known at what ratio each group of these light chains is expressed in the actual living body. These gene clones amplified by the PCR method and incorporated into the vector were mixed at a ratio close to the frequency of use in vivo to obtain a VL library. The composition ratio of each family in the VL library is shown below.

3. Creation of light chain gene library and heavy chain gene library combination library (scFv antibody gene library)
3-1-1 Isolation of immunoglobulin heavy chain gene using PCR
Using the same procedure as in 2-1, cDNA was prepared from umbilical cord blood, bone marrow fluid, peripheral blood lymphocytes, and tonsils using human μ primer (primer 634 shown below) or random hexamer. 5 'primers (VH1 to VH7) for obtaining human antibody heavy chain genes shown below and 3' primers (equal amounts of 4 types of human JH primers) mixed with cDNA as a template, primers 697 to 700 shown below ) Or human μ primer (primer 634 shown below) was used for PCR. In the table, the underlined portion indicates the SfiI site. Since hVH2a does not correspond to germ line VH2 family, VH2a-2 was newly designed. Since hVH4a does not support the entire VH4 family, hVH4a-2 was newly designed. Since VH5a was not compatible with germ line VH5 subfamily, VH5a-2 was newly designed. Moreover, hVH7 was designed as a primer corresponding to VH7. These genes were also amplified and incorporated into pscFvCA-E8VHd to determine what kind of gene was taken. Since the sequence of hVH5a-2 is very similar to that of hVH1a, a gene product similar to that amplified with hVH1a is expected, so this was not used. The PCR product was treated with phenol, ethanol precipitated and suspended in 10 μL of TE buffer.

634 humμCH1R (SEQ ID NO: 50):
ATGGAGTCGGGAAGGAAGTC
Primer used to amplify each VH family
The Human VH primer SfiI site is underlined.
628 hVH1a (SEQ ID NO: 51):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTGCAGCTGGTGCAGTCTGG
629 hVH2a (SEQ ID NO: 52):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTCAACTTAAGGGAGTCTGG
630 hVH3a (SEQ ID NO: 53):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC GAGGTGCAGCTGGTGGAGTCTGG
631 hVH4a (SEQ ID NO: 54):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTGCAGCTGCAGGAGTCGGG
632 hVH5a (SEQ ID NO: 55):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTGCAGCTGTTGCAGTCTGC
633 hVH6a (SEQ ID NO: 56):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTACAGCTGCAGCAGTCAGG
629-2 hVH2a-2 (SEQ ID NO: 57):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGRTCACCTTGAAGGAGTCTGGTCC
631-2 hVH4a-2 (SEQ ID NO: 58):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTGCAGCTACAGCAGTGGGG
632-2 hVH5a-2 (SEQ ID NO: 59):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC GAGGTGCAGCTGGTGCAGTCTGG
712 hVH7 (SEQ ID NO: 60):
GTCCTCGCAACTGC GGCC CAGCC GGCC ATGGCC CAGGTGCAGCTGGTGCAATCTGGGTCTGAGT
Human JH primer BstPI and XhoI site are underlined.
697 hJH1-2 (SEQ ID NO: 61):
GGTGGAGGCA CTCGAG AC GGTGACC AGGGTGC
698 hJH3 (SEQ ID NO: 62):
GGTGGAGGCA CTCGAG AC GGTGACC ATTGTCC
699 hJH4-5 (SEQ ID NO: 63):
GGTGGAGGCA CTCGAG AC GGTGACC AGGGTTC
700 hJH6 (SEQ ID NO: 64):
GGTGGAGGCA CTCGAG AC GGTGACC GTGGTCC
cDNA 2μL
10 × buffer # 1 (attached to KOD) 10μL
dNTP mix (2.0mM) 10μL
25 mM MgCl ₂ 4 μL
5 'primer (100pmol / μL) 1μL
3 'primer (100pmol / μL) 1μL
Sterilized MilliQ 71μL
KOD DNA polymerase (Toyobo 2.5U / μL) 1μL
PCR conditions: 94 ° C 1 minute, 55 ° C 2 minutes, 74 ° C 1 minute 35 cycles

3-1-2 Construction of heavy chain gene library
The PCR product obtained in 3-1-1 was treated with a restriction enzyme under the following conditions.
PCR product 10 μL
10 × K buffer (Takara Shuzo) 5μL
Sterilized MilliQ 33μL
SfiI (NEB 10 U / μL) 1 μL
XhoI (Takara Shuzo 12 U / μL) 1μL
After reacting at 37 ° C. for 2 hours, 10 μL of the mixture was subjected to agarose electrophoresis, and a band around 400 bp was cut out and purified with Gene Clean II Kit (Funakoshi Co., Ltd.). The pscFvCA-E8VHd treated with the restriction enzyme in the same manner as the PCR product was purified with Gene Clean II kit, and ligated by reacting with the PCR product treated with the restriction enzyme at 16 ° C. for 4 hours to overnight under the following conditions.
PscFvCA-E8VHd 2μL treated with restriction enzymes
1 μL of PCR product treated with restriction enzymes
10 × ligation buffer 1.5μL
(Attached to T4 DNA ligase)
10 mM ATP 1.5 μL
Sterilized MilliQ 8μL
T4 DNA ligase (Takara Shuzo 10 U / μL) 1 μL

3-1-3 Introduction of phagemid into E. coli The obtained DNA was transformed into E. coli DH12S. Specifically, DNA is once ethanol precipitated and dissolved in 3 μL of 1/5 TE (TE diluted 5 times with sterilized MilliQ). Of these, 1.5 μL was suspended in 20 μL of competent cells DH12S (GIBCO BRL) and transformed by electroporation.
Electroporator
BRL Cell-Porator (Cat.series 1600)
Setting condition: voltage booster 4kΩ
capacitance 330μF
DC volts LowΩ
charge rate Fast

  Transformed Escherichia coli after completion of the above operation was planted in 2 mL of transformation medium (SOB), cultured at 37 ° C. for 1 hour with shaking, and a portion was spread on an agar medium (Amp plate), the rest being 0.1% glucose, 100 μg The cells were cultured in 2 × YT medium containing / mL ampicillin and glycerin stocked. The agar medium was incubated at 30 ° C., and the colonies that had grown were picked up with a toothpick, separated from each other, plasmids were prepared, and the base sequence of the heavy chain gene was examined. These were performed for all of VH1 to VH7, and it was confirmed whether or not the target clone was obtained. These clones of each group (family) were mixed at a ratio close to the frequency of use in vivo to obtain a VH library. The composition ratio of each family in the VH library is shown below.

3-2 Preparation of combinatorial gene library
200 μg of VH library was digested with HindIII and XhoI under the following conditions, the heavy chain gene was excised and purified with Gene Clean II kit.
VH library 200μg 100μL
10 × K buffer (Takara Shuzo) 40μL
Sterilized MilliQ 205μL
HindIII (Takara Shuzo 40 U / μL) 30μL
XhoI (Takara Shuzo 50 U / μL) 25μL
The vector pscFvCA9-E8VHdVLd in which the VL library was inserted was also digested with HindIII and XhoI under the following conditions, and the fragment containing the light chain gene was purified with Gene Clean II kit.
PscFvCA9-E8VHdVLd with VL library inserted 100μg 100μL
10 × K buffer (Takara Shuzo) 40μL
Sterilized Milli-Q 230μL
HindIII (Takara Shuzo 40 U / μL) 15μL
XhoI (Takara Shuzo 50 U / μL) 15μL

Next, the pscFvCA9-E8VHdVLd vector into which the VH gene library fragment and the light chain gene were inserted was ligated by reacting at 16 ° C. overnight under the following conditions.
Treated with restriction enzymes
VH library fragment 10μg 50μL
Treated with restriction enzymes
PscFvCA9-E8VHdVLd 40μg 50μL containing fragment of VL library
10 × ligation buffer
(Attached to T4 DNA ligase) 100μL
10 mM ATP 100 μL
Sterilized MilliQ 670μL
T4 DNA ligase (Takara Shuzo 10 U / μL) 30 μL
Escherichia coli DH12S was transformed with the completed DNA. Specifically, DNA was once ethanol precipitated and dissolved in 30 μL of 1/5 TE (TE diluted 5 times with sterilized MilliQ). This was suspended in 500 μL of competent cell DH12S (GIBCO BRL) and electroporated.

Electroporator
BRL Cell-Porator (Cat.series 1600)
Setting condition: voltage booster 4kΩ
capacitance 330μF
DC volts LowΩ
charge rate Fast

E. coli after completion of the above operation is planted in 12 mL of transformation medium (SOB), shaken and cultured at 37 ° C for 1 hour, a portion is spread on an agar medium (Amp plate), and the rest is 0.1% glucose, 100 µg / mL It was cultured in 500 mL of ampicillin-containing 2 × YT medium and glycerin stocked. The agar medium was incubated at 30 ° C., and the number of clones obtained was estimated from the number of colonies that had grown. 8.5 × 10 ¹⁰ clones were obtained.

4). Preparation of scFv-CL antibody phage library from scFv-CL antibody gene library AIMS-5 suspension in 16 5-liter flasks containing 300 mL of 2 × YT medium supplemented with 1% glucose and 100 μg / mL ampicillin 2.5 mL was added, and cultured with shaking at 37 ° C., and grown until the absorbance reached 1.0 while measuring absorbance at a wavelength of 600 nm every hour. To the culture solution, 12 mL of helper phage solution (M13KO7) was added per flask to infect the helper phage, and cultured at 37 ° C. for 2 hours to obtain helper phage-infected DH12S.
24 mL of 5 L flasks were mixed with 600 mL of 2 × YT medium, 0.6 mL of 100 μg / mL ampicillin, 0.8 mL of 50 μg / mL kanamycin, and 200 mL of helper phage-infected DH12S, and cultured with shaking at 37 ° C. for 20 hours.

The cells were centrifuged at 4 ° C. and 8000 rpm for 10 minutes, and the supernatant was collected. After adding 20% polyethylene glycol / 2.5M NaCl 4L to the supernatant and stirring gently for about 20 minutes, centrifuge at 8000rpm for 20 minutes at 4 ° C, dissolve the precipitate in 1L PBS, 20% polyethylene glycol / 2.5M After adding 200 mL of NaCl and gently stirring for about 20 minutes, the mixture was centrifuged at 4 ° C. and 8000 rpm for 20 minutes. The supernatant was discarded and the precipitate was further collected by centrifugation at 4 ° C. and 8000 rpm for 3 minutes. The precipitate was dissolved in PBS to which 0.05% NaN3 was added, centrifuged at 1000 rpm for 15 minutes at 4 ° C., and the supernatant was collected.
The titer of the recovered phage solution was checked as follows. That is, the phage solution was diluted 10 ⁶ , 10 ⁷ , 10 ⁸ with PBS, 10 μL thereof was infected with 990 μL of DH12S, and cultured at 37 ° C. for 1 hour. 100 μL of this was plated on an LBGA plate and cultured at 30 ° C. for 18 hours. The titer of the undiluted stock solution was calculated by counting the number of colonies. The stock solution of the phage solution was suspended in PBS containing 0.05% NaN3 at 2 × 10 ¹⁴ / mL.

5). Screening using cultured cells, screening using cancer tissue
5-1 Screening using cultured cells First, cultured cells were cultured in a 15 cm dish, and then dissociated from the dish with 2 mg / ml collagenase I (Gibco BRL) / cell dissociation buffer (Gibco BRL). It was washed with cold PBS and 4 × 10 ⁷ was used. This was mixed with a 2 × 10 ¹³ cfu human antibody phage library, the final concentration of the reaction solution was 1% BSA-0.1% NaN ₃ / MEM, volume 1.6 ml, and the reaction was performed by slowly rotating at 4 ° C. for 4 hours. After completion of the reaction, the reaction solution was divided into two, each layer was layered on 0.6 ml organic solution (dibutyl phtalate: cyclohexane = 9: 1), and a centrifugal force of 3000 rpm was applied for 2 minutes in a microcentrifuge, Cells were allowed to settle to the bottom of the tube. For each tube, the solution was discarded and the cells were suspended in 0.7 ml of 1% BSA / MEM, layered on 0.7 ml of low polarity solvent and centrifuged. After repeating this operation once more, the solution was discarded, and the cells were suspended in 0.3 ml of PBS, frozen in liquid nitrogen, and thawed at 37 ° C.

This was infected with 20 ml of OD0.5 E. coli DH12S for 1 hour and cultured overnight at 30 ° C. in 600 ml of 2 × YTGA medium (2 × YT, 200 μg / ml ampicillin sulfate, 1% glucose). 10 ml of this overnight culture was mixed with 200 ml of 2 × YTA medium (2 × YT, 200 μg / ml ampicillin sulfate), cultured at 37 ° C. for 1.5 hours, added with 1 × 10 ¹¹ helper phage KO7, cultured at 37 ° C. for 1 hour, and then 800 ml of 2 × YTGAK ( 2xYT, 200 μg / ml ampicillin sulfate, 0.05% glucose, 50 μg / ml kanamycin) was added and cultured at 30 ° C. overnight. This was centrifuged at 8000 rpm for 10 minutes to prepare 1 l of supernatant, and 200 ml of PEG solution (20% polyetyleneglycol 6000, 2.5M NaCl) was mixed with it and stirred well, followed by centrifugation at 8000 rpm for 10 minutes to precipitate phages. . This was suspended in 10 ml of PBS, and a part thereof was used to examine the number of E. coli infections. This is the 1st screening phage.
For the 2nd screening, cultured cells 2 × 10 ⁷ and 1st phage 1 × ^{10 10} were used, and the volume of the reaction solution was 0.8 ml. The reaction solution was 1% BSA-0.1% NaN ₃ / MEM, and the entire scale was half of the 1st screening. The 3rd screening was performed under the same conditions as the 2nd screening except that 2nd phage 1 × 10 ⁹ was used.

5-2 Screening using surgical tissue After removing the tissue used for tissue staining, first perfused with MEM containing 5 mM HEPES, perfused with disperse collagenase solution, and then perfused with collagenase solution. did. The composition of the dispersee collagenase solution and the collagenase solution is shown below.
Despersee collagenase solution: 8 mg / ml NaCl, 0.4 mg / ml KCl, 0.56 mg / ml CaCl ₂ , 0.078 mg / ml NaH ₂ PO ₄ -2H ₂ O, 0.151 mg / ml Na ₂ HPO ₄ -12H ₂ O, 2.38 mg / ml HEPES, 0.5 mg / ml collagenase I (SIGMA), 0.05 mg / ml Tripsin inhibitor (WAKO), 0.35 mg / ml NaHCl ₃ , 112 mg / ml Dispase (GIBCO)
Collagenase solution: 8 mg / ml NaCl, 0.4 mg / ml KCl, 0.56 mg / ml CaCl ₂ , 0.078 mg / ml NaH ₂ PO ₄ -2H ₂ O, 0.151 mg / ml Na ₂ HPO ₄ -12H ₂ O, 2.38 mg / ml HEPES, 0.5mg / ml collagenase I (SIGMA), 0.05mg / ml Tripsin inhibitor (SIGMA), 0.35mg / ml NaHCl ₃

Tissue that has been refluxed with collagenase solution is divided into cancerous and non-cancerous parts, chopped into collagenase solution, suspended in 10,000u DNaseI (Takara Shuzo), inhaled, and oxygenated at 37 ° C for approximately 20 minutes Shake slowly. This was centrifuged at 4 ° C. and 600 rpm for 2 minutes to recover parenchymal cells (cancer cells, normal liver cells). The cells were suspended 3 × 10 ⁷ in a cell banker and stored in liquid nitrogen. Since cells isolated from the tissue had a slightly weak membrane, skim milk was added to the phage reaction solution to a final concentration of 2%. The subsequent operation is the same as the screening using cultured cells.

6). Sequencing of antibody clones, antibody expression check, cell ELISA, tissue staining Dilute E. coli obtained by screening, spread on normal agar medium containing 100 μg / ml ampicillin, pick up the resulting colonies, and 2xYTGA medium Incubated at 30 ° C overnight, extracted DNA with Kurabo Industries PI-50, and determined the base sequence by dideoxy method. In addition, 0.05 ml of this overnight culture was planted in 1.2 ml of 2xYTAI (2xYT, 200 μg / ml ampicillin sulfate, 0.5 mM IPTG), cultured overnight at 30 ° C, and centrifuged at 15000 rpm for 5 minutes in a microcentrifuge to collect the supernatant. .

  Since the antibody was expressed as a cp3 fusion protein, it was detected using it. That is, first, the obtained supernatant was reacted with Maxisorp (NUNC) at 37 ° C. for 2 hours, and then the liquid was discarded, followed by blocking with 5% BSA at 37 ° C. for 2 hours. The solution was discarded, and a rabbit anti-cp3 antibody (manufactured by MBL) diluted 2000 times with 0.05% Tween / PBS was reacted at room temperature for 1 hour, washed with PBS, and diluted 2000 times with 0.05% Tween / PBS. Anti-rabbit IgG antibody (MBL) was reacted at room temperature for 1 hour, then washed with PBS, reacted with 100 μl OPD solution at room temperature for 15 minutes, stopped with 2M ammonium sulfate, and SPECTRAmax 340PC (Molecular Devices) The absorbance at 492 nm was measured.

The operation of the cell ELISA is as follows. First, 1x10 ⁵ cultured cells are seeded on a 96-well plate and cultured for 1 day. After replacing with 200 μl of 5% skim milk / PBS and placed on ice for 3 hours, the solution is discarded and 100 μl of supernatant and 100 μl of 10% skim milk are added. Placed on ice overnight. After washing 5 times with ice-cold PBS, 100 μl of 5 μg / ml mouse anti-cp3 monoclonal antibody-5% skimmilk / PBS was reacted at 4 ° C. for 2 hours. After washing 5 times with ice-cold PBS, a mixture of 25 μl of peroxidase-labeled ENVISION + polymer reagent and 75 μl of 5% skimmilk / PBS was prepared and reacted at 4 ° C. for 2 hours. After washing with ice-cooled PBS 5 times, 100 μl of OPD solution was reacted at room temperature for 15 minutes, stopped with 2M ammonium sulfate, and absorbance at 492 nm was measured with SPECTRAmax 340PC (Molecular Devices).
Tissue staining was performed as follows.

(A). Section preparation First, the extracted tissue was sized to about 5 mm × 5 mm × 10 mm. Put it in 2 ml of 4% PFA / 0.1% glutaraldehyde / 0.1M cacodylic acid buffer (PFA is Wako Pure Chemical, glutaraldehyde is Kanto Chemical, cacodylic acid is SIGMA), microwave oven Using (SHARP), microwave irradiation was performed for 14 seconds and fixed. Then, transfer to 30 ml of PLP (2% PFA / 0.075M Lysine / 0.01M NaIO ₄ /0.0375PB), re-fixed at 4 ° C for 1 hour, and then placed in 10% sucrose / PBS for 4 hours at 4 ° C. After soaking, replace with 15% sucrose / PBS and soak at 4 ° C for 4 hours, then replace with 20% / sucrose / PBS and soak at 4 ° C overnight, then embed with OTC compound and rapidly Frozen. This was sliced to 5 μm with a cryostat (Reichert-Jung 2800 FRIGCUT E), attached to a silane-coated slide glass (MATSUNAMI), and air-dried with a cold air dryer for 30 minutes. Each slide glass was wrapped in Kimwipe one by one, and further wrapped with aluminum foil, placed in a container containing silica gel, and stored at -80 ° C.

(B). Tissue staining The slide glass was slowly warmed to room temperature so as not to form frost, and was soaked with PBS three times for 5 minutes to make it hydrophilic. Next, 50 μl of 0.3% H ₂ O ₂ /0.1% NaN ₃ was added dropwise and reacted at room temperature for 10 minutes to block endogenous peroxidase. Thereafter, the plate was washed 3 times for 5 minutes each with PBS, and reacted in 2% BSA / PBS for 10 minutes at room temperature to block nonspecific reaction. Then, 50 μl of a sample antibody concentrated 5 times using ammonium sulfate was dropped and reacted at room temperature for 1 hour, followed by washing with 2% BSA / PBS three times for 5 minutes. Next, 50 μl of anti-CP3 rabbit antibody 5 μg / ml was added, and a secondary antibody reaction was performed at room temperature for 45 minutes. After washing with 2% BSA / PBS three times for 5 minutes, 50 μl of peroxidase-labeled dextran-conjugated anti-rabbit immunoglobulin / goat polyclonal antibody (DAKO) was added dropwise to this, followed by a tertiary antibody reaction at room temperature for 30 minutes. Went. This was washed with 2% BSA / PBS three times for 5 minutes, 50 μl of DAB · H ₂ O ₂ coloring solution was added, and the mixture was reacted at room temperature for 5 minutes to develop color. After washing with water for 10 minutes, after nuclear staining with hematoxylin, it was dehydrated and transparent, sealed with marinol, and microscopically examined.

7). Screening for CEA, TRAIL-R2
CEA (Lee Biosolutions) and TRAIL-R2 / Fc chimera (Zenezyme) 0.1 ml prepared to a concentration of 0.1 mg / ml in PBS were sensitized to F8 maxisorp loose, left overnight at room temperature, and the liquid was discarded. put 2% skimmilk / PBS, shaking at room temperature for 2 hours, removing the solution, the phage 1x10 ⁶ obtained in screening 2-hour reaction at room temperature, then was washed 20 times with 0.1% Tween / PBS, the PBS Washed 5 times, eluted the phage with 0.1 ml of 50 mM Glycine pH 2.5, neutralized with 1 M Tris-HCl pH 9.0, infected with 1 ml of E. coli DH12S, cultured at 37 ° C. for 1 hour, The cells were plated on LBGA agar and cultured overnight at 30 ° C. to obtain E. coli colonies. From this, a culture supernatant was obtained, DNA was prepared and the nucleotide sequence was read.

ELISA for antigens
CEA (Lee Biosolutions) and TRAIL-R2 / Fc chimera (Zenezyme) 0.1 ml prepared to a concentration of 0.1 mg / ml in PBS were sensitized to F8 maxisorp loose, left overnight at room temperature, and the liquid was discarded. Place 0.2 ml of 5% BSA / PBS, leave at 37 ° C for 2 hours, discard the solution, add 0.1 ml of E. coli culture supernatant, leave at 37 ° C for 2 hours, wash with PBS, 6 μg / ml PBS-0.05% Tween20 concentration 0.1 ml of rabbit anti cp3 IgG was added and left at 37 ° C for 1 hour, washed with PBS, 0.1 ml of goat anti rabbit IgG (MBL) diluted 2000-fold with PBS-0.05% Tween20 was added, and left at 37 ° C for 1 hour. Then, the plate was washed with PBS, developed with OPD, and the absorbance at 492 nm was measured with SPECTRAmax 340PC (Molecular Devices).

8). Protein solubilization, binding to magnetic beads, recovery experiments, screening
8-1 Solubilization of membrane proteins from cultured cells was performed as follows.
Cells 2 × 10 ⁸ were detached from the culture dish with collagenase I / cell dissociation buffer, suspended, washed with ice-cold PBS, suspended in 3 ml of 0.25 M sucrose, and then homogenized with a Dounce homogenizer. This was mixed with an equal volume of 2.5M sucrose and placed in two Hitachi 13PA tubes, 3 ml each. 4ml of 1.25M sucrose and 3ml of 0.25M sucrose were layered on this, and centrifuged at 4 ° C, 24000rpm for 16 hours in swing rotor RPS40T (Hitachi). I'm thrilled. This was diluted with 10 times the amount of PBS, centrifuged at 12,000 rpm for 20 minutes at 4 ° C, and the sediment was taken out, and this was mixed with a surfactant mixture (NP-40 (OIERCE), Triton X-100 (PIERCE), n- Dodecyl β-D-maltoside (DOJINDO), n-Octyl β-D-glucoside (SIGMA), n-Octyl β-D-maltopyranoside (CALBIOCHEM), n-Decyl β-D-maltoside (, CALBIOCHEM), Deoxycholic acid ( SIGMA) was suspended while being gently mixed at 4 ° C for 6 hours at 0.25% each, and then centrifuged at 4 ° C and 15000 rpm for 20 minutes in a microcentrifuge to collect the supernatant. This is the soluble fraction of membrane proteins.

8-2 Extraction of membrane protein from the surgical tissue was performed as follows.
The weight of liver cancer and normal liver tissue was measured, and about 4 g was used. This was mixed with 20 ml of 0.25 M sucrose, suspended with a potter type homogenizer, homogenized with a Dounce homogenizer, and equal volume of 2.5 M sucrose was mixed and dispensed in 3 ml aliquots into 13 PA tubes. Subsequent operations are the same as the cultured cell method.

8-3 Quantification of Extracted Membrane Protein 10 μl of extracted membrane protein was mixed with 90 μl of PIERCE MICRO BCA and allowed to react at room temperature for 10 minutes. As a control, a dilution series of BSA was prepared and reacted with MICRO BCA, and a calibration curve based on this was prepared. The value of the calibration curve corresponding to the absorbance of the sample is the protein concentration of the membrane protein.

8-4 Binding of membrane protein to magnet beads The extracted membrane protein equivalent to 0.5 mg and Dynabead washed with PBS were mixed, ammonium sulfate was added to a final concentration of 0.3 M, and the total volume was adjusted to 1 ml with PBS. After slowly rotating this at 24 ° C. for 24 hours, the beads were captured with a magnet and separated from the reaction solution. The magnetic beads were washed with 5% BSA and 0.1% azide, suspended in the same solution and stored at 4 ° C.
A part of the reaction solution after reacting for 24 hours was taken and reacted with MICRO BCA. This was matched with a calibration curve using BSA, and the amount of unreacted membrane protein was calculated. The amount of membrane protein bound to the beads is obtained by subtracting this amount from the amount of protein used.

8-5 Phage recovery experiment using membrane protein, membrane protein coexistence experiment, antibody coexistence experiment Magnet beads equivalent to 10 μg of membrane protein and phage 1 × 10 ⁸ were mixed with a surfactant mixture to make a total volume of 200 μl, and kept at 4 ° C. After 4 hours of reaction, wash 4 times with LysisT buffer (50 mM Tris-HCl pH 7.5, 5 mM EDTA, 1% NP40, 0.5% Triton X-100, complete), mix with 1 ml DH12S Cultivation was carried out at 1 ° C. for 1 hour to form colonies on an ampicillin agar plate, and the number was counted.
In the membrane protein coexistence experiment, 400 μg of membrane protein was added and the reaction between membrane protein-bound beads and phage was performed.

8-6 Screening for liver cancer membrane protein in the presence of normal membrane protein Using magnetic beads equivalent to 20 μg liver cancer membrane protein, 200 μg normal membrane protein equivalent, human antibody phage library 1x10 ¹³ in the surfactant mixture Bring the total volume to 1 ml, react at 4 ° C for 4 hours, trap the beads with a magnet and replace the solution with LysisT buffer. After suspension, trap the beads with a magnet and replace the solution. After two rounds, it was washed with PBS and infected with 5 ml of DH12S. The rest is the same as the cell screening procedure. After four rounds of screening, antibody clones were isolated and analyzed.

9. Elimination of identical clones due to antibody coexistence
Antibody clone 3 or pAALSC phage 1x10 ⁷ obtained by screening SKOv-3 and ovarian cancer cell SKOv-3 2x10 ⁶ , clone 3 antibody 0, 0.2 μg, 20 μg are mixed and suspended in 1% BSA / MEM. The total amount was 0.3 ml, and the reaction was performed by slowly rotating at 4 ° C. for 4 hours. This was layered on 0.5 ml of a low polarity solvent solution and centrifuged at 3000 rpm for 2 minutes at 4 ° C. in a microcentrifuge to precipitate the cells. The solution was discarded, and the cells were suspended in 0.3 ml of 1% BSA / MEM, overlaid with 0.5 ml of low-polarity solvent, and centrifuged in the same manner. After performing the same operation again, the solution was discarded, the cells were suspended in 0.2 ml of PBS, frozen in liquid nitrogen, thawed at 37 ° C, and infected with 1 ml of DH12S at 37 ° C. Cultured for 1 hour, spread on ampicillin agar medium to form E. coli colonies, and the number of recovered phages was calculated.

  The clone 3 pp type antibody was purified as follows. The clone 3 antibody clone obtained by screening of SKOv-3 cells is a cp3 fusion type. This DNA can be converted into FvCLPP type in which FvCL of antibody and ProteinA-ProteinA are fused (protein A fusion type) by digesting with restriction enzyme SalI and self-rebinding. E. coli DH12S was transformed with it, cultured in 1 l of 2XYTAI medium at 30 ° C. for 18 hours, centrifuged at 4 ° C. at 8000 rpm for 10 minutes, the culture supernatant was recovered, 291 g of ammonium sulfate was slowly mixed, and then at 4 ° C. Centrifugation at 8000 rpm for 10 minutes was performed to collect the sediment, which was suspended in 20 ml of PBS. The suspension was centrifuged at 12,000 rpm for 20 minutes at 4 ° C., and the supernatant was collected and reacted with 1 ml of IgG Sepharose (Pharmacia) equilibrated with PBS at 4 ° C. for 2 hours. Sepharose was packed in a column and washed with 20 ml of PBST (0.1% Tween20 / PBS) and 50 ml of PBS. This was eluted with 10 ml of 50 mM glycine pH 2.3, pH was adjusted to 7.0 with 3 M Tris, dialyzed with PBS, and the absorbance at 280 nm was measured with an absorptiometer to calculate the protein A fusion antibody protein concentration. did. When protein concentration was necessary, it was rotated by Amicon Ultra (Millipore) at 4 ° C. and 6000 rpm for concentration.

The pAALSC3-D1.3HL (hereinafter referred to as pAALSC) antibody gene was provided by Dr. Yoshitaka Iba (GENE 194 (1997) 35-46) (FIGS. 5-1 to 5-2). : 65, the amino acid sequence is shown in SEQ ID NO: 66). The PP fusion antibody was produced by the same operation as described above.
Preparation of clone 3 and pAALSC phages was performed as follows. Escherichia coli transformed with a plasmid containing the antibody gene of cp3 fusion type was cultured in 2 ml of 2xYTGA overnight at 30 ° C, 1 ml of which was mixed with 20 ml of 2xYTA, cultured at 37 ° C for 1.5 hours, and infected with KO7 1x10 ¹⁰ Further culture at 37 ° C for 1 hour, put 80 ml of 2xYTGAK in this, culture at 30 ° C for 16 hours, centrifuge at 4 ° C for 10000 rpm for 10 minutes, take the supernatant, and add 20 ml of PEG solution And stirred at room temperature for 30 minutes. Centrifugation was performed at room temperature at 10000 rpm for 10 minutes to remove the sediment, and this was suspended in 2 ml of 0.1% NaN ₃ / PBS. The measurement of the titer of the phage is as described above.

10. Antibody protein preparation for the antibody population Screening for hepatocellular carcinoma HepG2 was performed and 240 clones were picked up. As a result of examining the expression of cp3-type antibodies for them, it was found that 162 were positive for expression. Using this, DH12S was transformed and cultured overnight at 30 ° C. in 500 ml of 2 × YTGA. Mix 250 ml of this culture with 5 l of 2xYTA and incubate for 1.5 hours, add 2.5 ml of 1M IPTG, incubate at 30 ° C for 16 hours, centrifuge at 4 ° C at 800 rpm for 10 minutes, take the supernatant, and slowly add 1528 g of ammonium sulfate to it. The mixture was stirred at room temperature for 1 hour, centrifuged at 4 ° C. and 800 rpm for 10 minutes to obtain a precipitate, and suspended in 100 ml of PBS. The supernatant was obtained by centrifugation at 12,000 rpm for 20 minutes at 4 ° C., and this was reacted with 3 ml of IgG sepharose (Pharmacia) at 4 ° C. for 2 hours. Sepharose was packed in a column and washed with 50 ml of PBST (0.1% Tween20 / PBS) and 100 ml of PBS. This was eluted with 10 ml of 50 mM glycine pH 2.3, adjusted to pH 7.0 with 3M Tris, dialyzed with PBS, rotated at 4 ° C. and 6000 rpm with Amicon Ultra (Millipore), and concentrated. The absorbance at 280 nm was measured with an absorptiometer, and the protein concentration was calculated.

11. Collective exclusion due to coexistence of antibody population First, mix HepG2 cells 4x10 ⁷ with 2 mg of the above antibody population, then add human antibody library 2x10 ¹³ to a total volume of 1.6 ml with 1% BSA / MEM at 4 ° C. The reaction was allowed to rotate slowly for 4 hours. Subsequent operations are as described in 5. above. Same as. The antibody population 1 mg was also co-reacted during the 2nd and 3rd screening.

12 Immunoprecipitation, mass spectral analysis
12-1 Conversion of clones into Avi and PPAvi forms Antibody clones derived from human antibody phage libraries can be excised with Sfi-Asc and recombined into BirA-Avi and BirA-PPAvi vectors. As a result, an antibody PPAvi fusion type or antibody Avi fusion type molecule is formed, which is biotinylated by a secreted biotin ligase molecule expressed by the BirA gene on the vector. Accordingly, biotinylated antibody molecules are formed.

12-2 Construction of pAviBirA vector and pPPAviBirA vector First, a camel antibody clone pscFvCA-cam167 (FIGS. 6-1 to 6-2 / base sequence shown in SEQ ID NO: 67, amino acid sequence shown in SEQ ID NO: 68) as a template. PCR was performed with Reverse primer and 658 primer, and digested with HindIII and EcoRI to prepare a DNA fragment. A plasmid pBlue-cam167 was prepared by incorporating this into pBluscriptKS + digested with HindIII and EcoRI. Next, after PCR was performed with primers 677 and 678 using AVB99 purchased from INVITROGEN as a template, PCR was further performed with primers 676 and 678, and this was incorporated into the above KpnI and HindIII sites of pBlue-cam167, The plasmid pBlueBirA-cam167 was obtained.

  On the other hand, after pTZ19R was digested with HindIII and BamHI, Klenow enzyme was allowed to act to produce a blunt end, which was self-ligated to produce plasmid pTZdel. This plasmid pTZdel was digested with KpnI and EcoRI to obtain a vector, and a DNA fragment obtained by digesting pBlueBirA-cam167 with KpnI and EcoRI was incorporated therein to prepare pBirAAvi-cam167 expressing an Avi-tag fusion antibody. The antibody 15-3 was digested with SfiI and AscI to cut out a DNA fragment, which was digested with SfiI and AscI, pAviBirA-cam167 (FIGS. 7-1 to 7-2 / SEQ ID NO: 69, nucleotide sequence: SEQ ID NO: 69) PBirAAvi-15003 is obtained by rearranging the sequence into SEQ ID NO: 70).

  A plasmid pPPAviBirA-15003 is obtained by performing PCR with a reverse primer and primer 697 using a 15-3 pp-type plasmid as a template, digesting it with HindIII and EcoRI, and incorporating it into the HindIII and EcoRI sites of pBirAAvi-15-3. pPPAviBirA-15003 was cleaved with SfiI and AscI to obtain a vector, and an insert prepared by cleaving pAviBirA-cam167 with SfiI and AscI was incorporated therein to obtain pPPAviBirA-cam167 (FIGS. 8-1 to 8-). 2 / The nucleotide sequence is shown in SEQ ID NO: 71, and the amino acid sequence is shown in SEQ ID NO: 72).

12-3 Immunoprecipitation using Avi-tag form antibody Biotinylated antibody molecules are tightly trapped in sepharose bound to streptavidin. After mixing streptavidin-conjugated sepharose with about 50 μg of sample antibody molecules bound to 100 μg of membrane protein of cultured cells, react with 4 μC for 4 hours in a reaction solution made up to 300 μl of surfactant mixture, After washing 4 times with lysisT, elute with 40 μl of acetate-lysisT (mixture of 50 mM acetate pH2.3 and lysisT at a ratio of 3: 1), then neutralize with 3M Tris to obtain 7.5 % SDS-PAGE was performed and silver staining was performed. This was compared with that performed without cell membrane protein to determine the location of the antigen and cut it out.
The immunoprecipitation reaction can be inhibited by the presence of an excess of surfactant. Therefore, the inventors also examined the immunoprecipitation reaction under the condition where the surfactant was diluted. After diluting the membrane protein solution with PBS, it was concentrated by ultrafiltration to see if membrane protein loss occurred. As a result of the experiment, no loss occurred even at a 40-fold dilution. Therefore, immunoprecipitation was carried out under the condition that the surfactant concentration was reduced to 1/40 using this, and examined by SDS-PAGE electrophoresis and silver staining MS kit (WAKO).

12-4 Immunoprecipitation reaction using cyanogen bromide activated Sepharose binding antibody The PP-fused antibody purified by the method shown in (1) was bound to cyanogen bromide-activated sepharose, and an immunoprecipitation reaction was carried out by the method of 12-3. Preparation of cyanogen bromide activated Sepharose and binding of PP fusion antibody thereto were performed as follows. First, the PP-fused antibody was dialyzed overnight at 4 ° C. against a coupling buffer (0.1 M NaHCO ₃ -NaOH pH 9). After suspending 0.2 g of cyanogen bromide activated Sepharose powder (Amersham Biosciences) in 1 mM HCl, the solution was replaced with a coupling buffer while aspirating, and the cyanogen bromide group on Sepharose was activated. This was mixed with the PP fusion antibody after dialysis, and stirred at room temperature for 4 hours while rotating slowly. Thereafter, this was packed in a column, washed with a coupling buffer, and unbound PP-fused antibody was removed. The solution was replaced with 0.2 M Glycine-NaOH (pH 8) and allowed to stand at room temperature for 2 hours to inactivate the unreacted cyanogen bromide group. The solution was replaced with 0.2 M Glycine-NaOH (pH 3), allowed to stand at room temperature for 5 minutes, and then the solution was replaced with PBS.

12-5 Cell surface protein excision by protease treatment and immunoprecipitation using it In the presence of excess surfactant, antigen-antibody reaction may be inhibited. Therefore, an experiment was conducted to examine whether or not immunoprecipitation using the protein component obtained by cutting out the membrane protein with a protease was possible.
First, 1x10 ⁷ cells were suspended in 300 μl of STN (150 mM Tris-HCl pH 7.4, 1.25% NP-40, 150 mM NaCl), and then trypsin (final concentrations of 67 ng / ml, 1000 ng / ml, 33 μg / ml). The reaction time was 30 minutes and 4 hours at a reaction temperature of 25 ° C. After the reaction under the conditions, the reaction was stopped by placing on ice, and complete (final amount 1 tablet / 50 ml) and PMSF (final amount 20 mM) were added. Take 5 μl from the tube, add 3 μl of sample buffer containing β-mercapt Ethanol, boil for 5 minutes, and see what happens to the protein obtained with 10% SDS-PAGE and silver dye MS kit (WAKO). investigated. As a result, it was observed that sufficient membrane protein excision occurred in the reaction at a trypsin concentration of 67 ng / ml and a reaction time of 30 minutes.
Therefore, an immunoprecipitation reaction was performed using this. The antibodies and streptavidin beads used are the same as those in 3. above. Same as. Mix with 10 μl of trypsinized membrane, add PBS to a final volume of 300 μl, react at room temperature for 4 hours, wash with PBS 4 times, elute with 500 μl of 50 mM Glycine pH2.5, 1 Tris- After neutralizing with HCl pH 9.0, concentration with Amicon Ultra (Millipore), adding sample buffer containing β-mercapt Ethanol, boiling for 5 minutes, 10% SDS-PAGE, silver dye MS kit ( The protein obtained by WAKO) was examined.

12-6 Mass spectral analysis of cut out bands
12-6-1 In-gel trypsin digestion SDS polyacrylamide gel electrophoresis was performed according to a conventional method, and the band obtained by staining with Coomassie brilliant blue was excised. This was immersed in a 200 mM ammonium bicarbonate-50% acetonitrile solution, shaken at 37 ° C. for 45 minutes, discarded, and the same operation was repeated twice to remove Coomassie brilliant blue. The gel was dried under reduced pressure, and 4 μl of trypsin (20 μg / ml) dissolved in 40 mM ammonium bicarbonate (pH 8.1) -10% acetonitrile was added per unit area (mm ² ) of the gel slice and left at room temperature for 1 hour. Fully infiltrated. To this, 2.5 times the amount of trypsin solution added earlier was added and allowed to stand at 37 ° C. for 18 hours. This was filtered through a tube with a filter having a pore size of 0.22 μm, and the peptide produced by cleaving the antigen with trypsin was recovered.

12-6-2 Identification of antigens by mass spectrometry Samples obtained by in-gel trypsin digestion were subjected to HPLC connected to an electrospray ionization ion trap quadrupole mass spectrometer. From the HPLC reversed-phase chromatography column, each peptide sequentially eluted by the difference in hydrophobicity is ionized by electrospray method by changing the linear concentration gradient of acetonitrile from 0% to 80% containing 0.1% TFA. Mass was analyzed.

  At the same time, the mass of the limited degradation products of each peptide generated by collision with helium atoms placed in the flight path of those ions was analyzed. When one amino acid is removed by limited decomposition, ions that are smaller by the mass of the deviated amino acid are observed, so that the deviated amino acid type can be identified by the mass difference. When another amino acid is removed, ions that are smaller by the mass of the deviated amino acid are observed, and the deviated amino acid type can be similarly identified by the mass difference. By proceeding with similar experimental data analysis, the internal amino acid sequence can be determined. Antigens were identified by searching the set of amino acid internal sequences obtained using a publicly available amino acid sequence database. The identification result was confirmed by the fact that the total mass deduced from the amino acid sequence of the identified protein is consistent with the experimental data of molecular weight obtained from the results of SDS polyacrylamide electrophoresis of the antigen before trypsin degradation. .

13-1. Effect of Cell Surface Antigen Antibody Screening Method Using Low Polarity Solvent The effect of the low polarity solvent washing method used in the present invention was confirmed. Clone 3 and clone 126 as positive antibody phage are antibody phages against SKOv-3 cells, and pAALSC as a negative antibody phage is an anti-HEL (hen egg lysozyme) antibody phage. SKOv-3 cells and phages of each clone were mixed in 1% BSA-0.1% NaN ₃ / MEM, reacted at 4 ° C for 4 hours, and overlaid on an organic solution (dibutyl phtalate: cyclohexane = 9: 1). Then, a centrifugal force of 3000 rpm was applied for 2 minutes in a microcentrifuge, and the cells were allowed to settle at the bottom of the tube. Similarly, the number of phages to be mixed according to the description in 5-1 above is fixed to 1 × 10 ⁷ phage, and the titers of the phages collected by repeated washing with 1st, 2nd, 3rd, 4th, 5th and low polarity solvents are shown in Table 4A. Described.

It can be seen that there are more phage recovered than the conventional method (centrifugation in 1% BSA-0.1% NaN ₃ / MEM as it is, sediment the cells, collect the phages, and measure the titer of the phages (Table 4B)). . In the three washings, this method has about twice as much recovery as the conventional method, and nonspecific recovery is suppressed to the same extent. This is considered to be performed by shortening the time during which the dissociation reaction takes place by using a low polarity solvent, and by enhancing specific hydrogen bonding in the antigen-antibody reaction by the presence of the low polarity solvent. By this action, it was suggested that the method of the present invention increased the comprehensiveness of the obtained antibody.

13-2. Examination of recovery rate of antibody phage clone when using low polarity solvent
pAALSC is an antibody against chicken lysozyme and does not react to SKOv-3 cells. On the other hand, clone3 is an antibody clone isolated by screening for SKOv-3 cells and reacts with SKOv-3 cells.
The whole was suspended reacted slowly rotating those with 0.4ml at 4 hours 4 ° C. at two different phage 1x10 ⁷ and SKOV-3 cells 1x10 ⁷ of pAALSC and _{clone3 1% BSA 0.05% NaN 3} MEM It was. This suspension was layered on 0.6 ml of the following solution (1), (2), or (3) and centrifuged at 3000 rpm for 2 minutes.
(1) 1% BSA-MEM
(2) Diphenyl Ether: 1.1.1-Trichloroethane: Hexane = 44: 27: 33
(3) Isopropyl Ether: 1.1.1-Trichloroethane: Hexane = 20: 50: 30 After sucking the solution, the recovered cells were suspended again in 0.3 ml of 1% BSA-MEM (1), (2 ) Or (3) The solution was overlaid on 0.6 ml of the solution and centrifuged at 3000 rpm for 2 minutes. After sucking out the liquid, it is suspended again in 0.3 ml of 1% BSA-MEM, layered on (1), (2), or (3) 0.6 ml of liquid and centrifuged at 3000 rpm for 2 minutes. Sucked up.

The liquid inside the tube was wiped with Kimwipe, the lid was opened, left at 37 ° C. for 30 minutes, suspended in 0.2 ml of PBS, frozen in liquid nitrogen, and thawed at 37 ° C. This was infected with 2 ml of DH12S cultured at 37 ° C., cultured at 37 ° C. for 1 hour, a part was spread on an ampicillin plate and cultured overnight at 37 ° C., and the number of colonies was counted. The number of phages recovered when washing was repeated with the solution (1), (2), or (3) was as follows.
(1) Liquid (2) Liquid (3) Liquid
Recovery of pAALSC 308 176 198
Recovery of clone3 8.36x10 ⁵ 1.13x10 ⁶ 1.16x10 ⁶
(X2714) (x6420) (x5858)
In the low polar solvent (2) or (3), the recovery of the negative control (pAALSC) decreased and the recovery of the positive control increased. As a result, it was possible to obtain a cleaning effect more than twice as compared with the case of cleaning with the aqueous medium (1).

Examination of the recovery rate of antibody phage clones when using an aqueous solvent that forms a 13-3.2 phase
The whole was suspended reacted slowly rotating those with 0.4ml at 4 hours 4 ° C. at two different phage 1x10 ⁷ and SKOV-3 cells 1x10 ⁷ of pAALSC and _{clone3 1% BSA 0.05% NaN 3} MEM It was. The phage suspension after the reaction was overlaid on 0.6 ml of the following solution (1) or (2), and centrifuged at 3000 rpm for 2 minutes.
(1) 1% BSA-MEM
(2) Ficoll-Paque (Phalmacia Biotech) diluted 4-fold with PBS
After centrifuging, after sucking out the solution, the recovered cells are suspended again in 0.3 ml of 1% BSA-MEM (1) or (2) and overlaid on 0.6 ml of the solution, and centrifuged at 3000 rpm for 2 minutes. did. After sucking out the liquid, it was suspended again in 0.3 ml of 1% BSA-MEM and overlaid on 0.6 ml of the liquid (1) or (2) and centrifuged at 3000 rpm for 2 minutes to suck the liquid.

The liquid inside the tube was wiped with Kimwipe, suspended in 0.2 ml of PBS, frozen with liquid nitrogen, and thawed at 37 ° C. This was infected with 1 ml of DH12S cultured at 37 ° C., cultured at 37 ° C. for 1 hour, a part was spread on an ampicillin plate and cultured overnight at 37 ° C., and the number of colonies was counted. The number of phages recovered when the washing with the (1) solution or (2) solution was repeated was as follows.
(1) Liquid (2) Liquid
Recovery of pAALSC 1044 1044
Clone3 recovery 2.17x10 ⁶ 1.51x10 ⁶
(X2078) (x1443)
pAALSC is an antibody that binds to chicken lysozyme and does not react to SKOv-3 cells. It is therefore an antibody to be removed by washing. However, a considerable number of phages are recovered as described above. This result shows that no cleaning effect was observed in the aqueous solvent forming two phases. It was confirmed that the cleaning effect confirmed in Table 4 was an effect of a low polarity solvent.

14 Screening of ovarian cancer cell line SKOv-3 cell surface antigen binding antibody-identification of tissue specific antibody and anti-HER2 antibody-
Table 5 shows the progress of screening of the ovarian cancer cell line SKOv-3, which was carried out using the human antibody phage library using this low polarity solvent washing method. As described in 5-1, the screening was repeated with 1st, 2nd, and 3rd, and the recovery rate increased as a result of 3 screenings. Therefore, it was judged that the antibody against SKOv-3 cells was concentrated. Therefore, the E. coli culture obtained from the 3rd screening was spread on an LBGA agar medium and cultured overnight at 30 ° C. to obtain E. coli colonies. From this, 528 clones were picked up, culture supernatant and DNA were prepared, first cp3 expression ELISA and cell ELISA against SKOv-3 cells were performed, and the nucleotide sequence of those judged to be positive was analyzed. went. The results are shown in Table 6. As a result of examining 528 clones, 240 types of cell ELISA positive antibody clones were obtained, and it was found that exhaustive antibodies could be obtained from 98 types.

  122 types of clones obtained from SKOv-3 were subjected to cell ELISA against SKOv-3 and HeLa for the purpose of examining tissue specificity, and those that differed were picked up (FIG. 9). Since there was a difference between the three clones, the supernatants were collected, reacted with rabbit anti-cp3 antibody-conjugated sepharose, washed, immunoprecipitated with the addition of SKOv-3 membrane protein, and SDS-PAGE. Thereafter, Western blotting was performed in which a rabbit anti-HER2 antibody was reacted. As a result, 126 was found to immunoprecipitate HER2 (FIG. 10). For the other two clones, no HER2 band was detected.

15. Cell surface antigen antibody screening of gastric cancer cell line MKN-45 and identification of anti-CEA antibody The course of screening performed on gastric cancer cell line MKN-45 using human antibody phage library using this low polarity solvent washing method (Table 4B). ). As described in 5-1, in order to examine how many types of anti-CEA antibodies can be obtained by screening 1st, 2nd, 3rd and repeated screening, maxisorp loose (NUNC The phage recovery experiment using 3rd phage was performed on CEA solid-phased on). As a result of analysis of 48 ELISA positive ones, it was found that there were 6 types of anti-CEA antibodies (FIG. 11).

16. Cell Surface Antigen Antibody Screening of Hepatocellular Carcinoma Strain HepG2 and Identification of Anti-TRAIL-R2 Antibody Table 5C shows the progress of screening performed for hepatocellular carcinoma HepG2 using human antibody phage library using this low polarity solvent washing method. Shown in After repeating the 1st, 2nd, and 3rd screening as described in 5-1, 240 clones were picked up from the 3rd screening and analyzed in the same manner as SKOv-3. There were 162 clones positive for both cell ELISA and cp3 expression ELISA, and they were classified into 83 types (Table 7). As a result of tissue staining of these antibody clones as described in 6 (B), it was shown that 035-112 recognized cytoplasm-specific recognition of cancer cells (FIG. 12).

For the purpose of investigating how many types of anti-TRAIL-R2 antibodies can be obtained by HepG2 screening, follow the method described in the phage recovery experiment using antigens. The phage recovery experiment used was performed. As a result of analyzing 20 ELISA positive samples, it was found that there were three types of anti-TRAIL-R2 antibodies (FIG. 13, Hep2,5,6 clones).

17. Cell surface antigen antibody screening of hepatoma cell line Nuk-1 Using this low-polarity solvent washing method, human antibody phage library was used to test against Nuk-1 (hepatoma cell line from adults infected with hepatitis C). Table 8 shows the number of types of antibodies obtained as a result of cell surface antigen antibody screening as described in 1. It was found that when liver cancer cells of different origins were used, the type of antibody obtained was greatly different. HepG2 is a cell line derived from fetal hepatocellular carcinoma, and it is thought that when hepatocarcinoma cells of different origins are used, the surface antigen composition differs greatly.

18. Cell surface antigen antibody antibody screening using cells isolated from liver cancer tissue and identification of anti-TRAIL-R2 antibody For cells isolated from liver cancer tissue using human antibody phage library using this low polarity solvent washing method Table 9 shows the progress of the screening conducted as described in 5-2. Since these cells are easily ruptured at the time of reaction with phage, skim milk was added to the reaction solution to a final concentration of 5%. Since the recovery rate increased in 5 screenings, 480 clones were picked up from the 5th screening and analyzed in the same manner as SKOv-3. There were 87 positive clones for both cell ELISA and cp3 expression ELISA, and they were classified into 68 types (Table 10). According to the method shown in 6 (B) for these antibody clones, tissue staining of cancerous and non-cancerous parts was performed. As a result, it was shown that 3172-120 was an antibody clone that performed cancer tissue-specific staining. (FIG. 14).

  Phage recovery experiment for TRAIL-R2 was performed using 5th phage obtained by screening of liver cancer tissue, and 16 clones were picked up, and two types of anti-TRAIL-R2 antibody clones were obtained (FIG. 13 tumor43, 53 Among them, the tumor53 clone was consistent with the Hep5 clone obtained by a phage recovery experiment using an antigen against HepG2 (Table 10). This means that the repertoire of antibody clones obtained by screening cancer cell lines such as HepG2 overlaps with the repertoire of antibody clones obtained by screening the actual cancer. This suggests that it can be obtained from strain screening.

19. Masking effect by the acquired antibody clone Clone 3 antibody is 14. An antibody against a cell surface antigen isolated by 9. As described in, phage recovery is performed when clone phage and SKOv-3 cells are reacted in the presence of clone 3 antibody (clone protein A fusion type) and phage is recovered compared to when clone antibody is not present. Decreased significantly (Table 11). On the other hand, when pAALSC antibody (anti-chicken lysozyme antibody, confirmed not to bind to SKOv-3 cells) coexisted, recovery of cloned phage did not change. Phage recovery performed using pAALSC phage on SKOv-3 cells was low, and was similar even when cloned antibodies were present. Therefore, it was shown that recovery of the same clone antibody phage was specifically inhibited by the coexistence of the antibody. That is, it was confirmed that an antibody that is not desired to be obtained is useful as an antigen masking agent for obtaining an antibody having a binding specificity different from that of the antibody.

20. Antigen masking effect by the obtained antibody clone 2
In screening against SKOv-3, many of the same antibodies have been taken for three types (clone1, clone3, and clone11) (Table 6), indicating that the acquired clones are biased. Therefore, 9. According to the description, each of these three types of antibody clones was digested with SalI and self-recombined to secrete protein A fusion type antibody molecules, which were purified, and 100 μg each was added to add SKOv-3 Were screened against. 48 clones were isolated from the 3rd screening and analyzed according to the above procedure. As a result, 45 were positive and they were classified into 37 types, but these 3 clones were not included in this. . Of these 37, 5 were identical to the clones obtained in the initial screening. Therefore, it was shown that the coexisting antibody clone was selectively removed. That is, it was confirmed that the previously obtained antibody is useful as an antigen masking agent for obtaining more diverse antibodies.

21. Antigen masking effect by multiple types of antibody population clones Masking by antibody clones can be performed by multiple types of antibody populations.
After mixing the DNAs of 162 positive clones obtained from the HepG2 screening obtained in step 16, According to the description, it was converted into a protein A fusion type, expressed as a protein A fusion type antibody, and purified with an IgG sepharose column to obtain about 5 mg of a protein A fusion type antibody. Of these, 1 mg was coexisted and screening for HepG2 was performed again in the same manner as in 16 and the clone obtained from the 3rd screening was analyzed. As a result, one of 96 clones (one of 128 ELISA-positive clones) was obtained. ) Only matched, others were different clones.

  In the screening in which no antibody was allowed to coexist, 8 out of 44 clones (21 out of 62 ELISA positive clones) were found to match, indicating that the antibody coexistence was very effective (Table 12). Therefore, it was shown that it is possible to improve the completeness of the clones that have been taken later by coexisting the clones that have been taken once. That is, it was confirmed that the previously obtained antibody is useful as an antigen masking agent for obtaining more diverse antibodies. In addition, it was confirmed that the effect can be maintained even when plural kinds of antibodies are mixed.

22. Solubilization of membrane protein, binding to beads
As described in 8-1 to 8-4, SKOv-3 and liver cancer tissue were solubilized with membrane protein and bound to Dynabeads. In SKOv-3, 1 mg was reacted and 300 μg Reacted with 1 mg and 350 μg bound to Dynabeads.

23. Screening system evaluation using membrane protein-immobilized beads and masking effect due to antigen coexistence For ovarian cancer SKOv-3, a recovery experiment was conducted using clone 126 isolated by the screening. When dynabeads corresponding to 10 μg of membrane protein were reacted with 126 phage 1 × 10 ⁸ cfu (cfu; colony forming unit), 8.7 × 10 ⁴ cfu was recovered. On the other hand, in experiments conducted using the same number of pAALSC phages that did not react with SKOv-3, recovery was only 11 cfu. Therefore, it was judged that screening using membrane protein was sufficiently possible. In the former experiment, the recovery was 2.2x10 ³ cfu (about 1/40) when the equivalent of 400 µg of SKOv-3 derived membrane protein was present, but the recovery when the equivalent of 400 µg of HeLa derived membrane protein was present was 5.0. It was almost unchanged at x10 ⁴ cfu. These are thought to be due to the fact that antigens recognized by 126 phage derived from SKOv-3 were present in a large amount in an aqueous solution, thereby preventing recovery of 126 phages by beads. That is, it was confirmed that an antigen recognized by an antibody that is not desired to be acquired is useful as an antibody masking agent for acquiring the target antibody.

24. Antibody screening using membrane protein-immobilized beads and tissue staining with isolated antibody
Referring to [Example 11], 8. As described above, screening was performed using Dynabeads bound with liver cancer tissue membrane protein in the presence of normal liver membrane protein. The progress is as shown in Table 13. Since the recovery rate increased at 4th, 336 clones were picked up from this and analyzed to obtain 74 types of clones. As a result of tissue staining as described in 5-2 and 6 (B), 049-023 recognized cytoplasm-specific recognition of cancer cells, and 050-001 partially recognized cancer tissues. (FIG. 15).

Based on these results, clones 049-023 and 050-001 were selected as antibodies that recognize antigens specifically expressed in liver cancer tissues, and their base sequences were determined. The determined base sequence and the amino acid sequence encoded thereby are shown in the following SEQ ID NOs.
Base sequence:
049-023 VH: SEQ ID NO: 82 049-023 VL: SEQ ID NO: 84
050-051 VH: SEQ ID NO: 86 050-051 VL: SEQ ID NO: 88
Amino acid sequence:
049-023 VH: SEQ ID NO: 83 049-023 VL: SEQ ID NO: 85
050-051 VH: SEQ ID NO: 87 050-051 VL: SEQ ID NO: 89

25. Identification of the recognition antigen of the isolated antibody As described above, it was prepared by converting to a PPAvi type antibody and bound to streptavidin sepharose. This is 8. As a result of reacting with the SKOv-3 membrane protein fraction obtained according to the above and immunoprecipitating as described in 12-3 to 12-6, a band of about 130 kDa was obtained as shown in FIG. With respect to this band, the band was cut out as described in 12-3 to 12-6 and subjected to mass spectrum analysis, and the obtained peptide sequence is shown in FIG. As a result of associating these with the human genome database, Integrin alpha-3 was found to be the most probable antigen gene candidate.

26. Antigen identification by surfactant-diluted immunoprecipitation reaction
035-003 antibody obtained by screening in HepG2 cell line, immunoprecipitation, mass spectral analysis Conversion to Avi and PPAvi form of clone Converted to PPAvi type antibody as described and reacted with PPAvi against HepG2 membrane protein In immunoprecipitation, only a very thin band was observed in the vicinity of 28 kDa, but when the surfactant concentration during membrane protein and 035-003 antibody PPAvi form reaction was reduced to 1/40, the band was as dense as 28 kDa. Was observed (FIG. 17 lane 8).

27. Identification of antigens by digestion with membrane protein trypsin
SKOv-3 cells and HepG2 cells were treated with trypsin to prepare soluble membrane protein components, which were reacted with streptavidin sepharose to which the above antibodies were bound and immunoprecipitated. Is obtained. About immunoprecipitation of SKOv-3 cell trypsin-treated component and cloned antibody, which was immunoprecipitated to about 130 kDa (Fig. 18, lane 5) Each had a specific band at 75 kDa (FIG. 18, lane 1). 3172-120 is an antibody obtained by screening for liver cancer, and the results of cell ELISA showed that the antigen is also present in HepG2.

28. Determination of the surfactant to be used In order to conduct an immunoprecipitation experiment on a membrane protein, it is necessary to solubilize the membrane protein and to allow the antigen-antibody reaction in the solution to purify the antigen.
First, 1 × 10 ⁸ cells were collected according to the method described in the screening using cultured cells to prepare a membrane fraction. Dispense it into 20 pieces, suspend it in a solution of 300 μl 0.5% surfactant, 20 mM Tris HCl pH 8.0, 140 mM NaCl, complete at 4 ° C. for 6 hours, centrifuge at 4 ° C. and 15000 rpm for 10 minutes, Transfer the supernatant to the next tube, place 30 μl wet volume of clone 3 PPAvi-bound Sepharose, gently shake for 6 hours at 4 ° C, wash according to the method described in Immunoprecipitation, perform SDS-PAGE, and perform silver Staining was carried out to determine which surfactant could detect the antigen band. The surfactant used is shown below.
Tween20 (PIERCE)
Tween80 (PIERCE)
TritonX-100 (PIERCE)
TritonX-114 (PIERCE)
NP-40 (PIERCE)
Brij-35 (PIERCE)
Brij-58 (PIERCE)
n-Octyl β-D-glucoside (SIGMA)
n-Octyl β-D-Thioglucopyranoside (PIERCE)
CHAPS (SIGMA)
CHAPSO (DOJINDO)
n-Dodecyl β-D-maltoside (DOJINDO)
n-Dodecyl β-D-glucopyranoside (CALBIOCHEM)
SDS (WAKO)
Cholic acid (DOJINDO)
Deoxycholic acid (SIGMA)
sucrose monolaurate (DOJINDO)
n-Octyl β-D-maltopyranoside (CALBIOCHEM)
n-Decyl β-D-maltoside (, CALBIOCHEM)
MEGA-10 (DOJINDO)

  As a result, NP-40 (PIERCE), Triton X-100 (PIERCE), n-Dodecyl β-D-maltoside (DOJINDO), n-Octyl β-D-glucoside (SIGMA), n-Octyl β-D-maltopyranoside Clear antigen bands were detected for 6 types (CALBIOCHEM), n-Decyl β-D-maltoside (CALBIOCHEM), and Deoxycholic acid (SIGMA). For these six types, bands corresponding to clone 3 were obtained in the same manner with respect to a solution obtained by mixing 0.25% of each.

29. ADCC (Antibody-Dependent Cell-mediated Cytotoxicity) Test To confirm whether the phage antibody clones isolated by the present invention have antitumor activity, ADCC (Antibody-Dependent Cell-mediated) mediated Cytotoxicity (antibody-dependent cellular cytotoxicity) test. The following materials were used for the test.
BT-474: Human breast cancer-derived cultured cell HER2 overexpressing strain Human lymphocyte: (French peripheral blood mononuclear cell fraction)
Herceptin: Commercial breast cancer drug (human IgG antibody)
015-126: Anti-HER2 antibody (human IgG antibody, antibody in which Fab derived from clone 126 obtained in Example 14 is joined to the constant region of human IgG to form a fully human type)
HR1-007: Anti-hub toxin HR1 antibody (human IgG antibody)
015-126 pIII: anti-HER2 antibody (phage pIII fusion scFv type antibody, clone 126 obtained in Example 14)
YA14 pIII: Anti-influenza virus antibody (phage pIII fusion scFv type antibody)
Anti-pIII rabbit antibody: Rabbit polyclonal antibody that specifically binds to the pIII domain of phage antibody
CTM medium (Cytotoxic Medium: RPMI-1640 medium, 1% fetal bovine serum, 1% penicillin, streptomycin mixture, 10 mM HEPES)
The amino acid sequences of 015-126 VH and VL used in the experiment and the base sequence of the DNA encoding them were described in the following SEQ ID NOs.
Heavy chain variable region (VH) Light chain variable region (VL)
Base sequence SEQ ID NO: 102 SEQ ID NO: 104
Amino acid sequence SEQ ID NO: 103 SEQ ID NO: 105

<ADCC test>
1) Breast cancer-derived BT-474 cells were collected by collagenase treatment.
2) Cells were pelleted by centrifugation (250 xg, 3 minutes).
3) The supernatant was removed and suspended in CTM.
4) Dilute to CTM to 1 × 10 ⁵ cells / ml and dispense 100 μl each into a V-bottom 96-well plate (1 × 10 ⁴ cells per well).
5) Human IgG antibody or phage antibody was added to a concentration of 1 μg / ml, the volume was 200 μl, and the mixture was reacted on ice for 30 minutes.
6) Cells were pelleted by centrifugation (350 xg, 2 minutes).
7) The supernatant was removed, suspended in CTM, and immediately dispensed into a new U-bottom 96-well plate. Anti-pIII rabbit antibody was added to 5 μg / ml only in the system using phage antibody.
8) 100 μl of human lymphocyte suspension was added per well (4 × 10 ⁶ cells / ml, 4 × 10 ⁵ cells per well, Effector / Target ratio = 40).
9) Cells were sedimented to the bottom by centrifugation (60 xg, 5 minutes).
10) The reaction was carried out for 4 hours at 37 ° C. and 5% CO ₂ .
11) The cells were pelleted by centrifugation (200 xg, 2 minutes).
12) 100 μl of the supernatant was collected and transferred to a flat-bottom 96-well plate.
13) 100 μl of a lactate dehydrogenase activity measurement solution was added and reacted at room temperature for 30 minutes.
14) The absorbance at OD ₄₉₂ nm was measured with an absorptiometer. The absorbance of OD ₄₉₂ is proportional to the activity of lactate dehydrogenase released from damaged cells and is an indicator of how much of the cells have been damaged.

  Herceptin and anti-HER2 antibody 015-126 showed ADCC activity against HER2-overexpressing strain BT-474. Cytotoxicity is not seen when anti-hub toxin HR1 antibody and antibody are not added (FIG. 18). In experiments where phage antibodies and anti-pIII rabbit antibodies were combined, ADCC activity was observed with 015-126 and anti-pIII rabbit antibodies, while YA14 (anti-influenza virus antibody) and anti-pIII rabbit antibodies or anti-pIII rabbit antibodies alone Cytotoxicity was not observed (FIG. 19). According to the present invention, it was confirmed that an antibody that recognizes a cell surface antigen can be efficiently obtained. In addition, it was confirmed that scFv derived from 015-126 selected by the present invention is an antibody useful for the treatment of breast cancer targeting HER2.

30. Cell glass bead adhesion culture method <Cell culture on glass beads (confirmation of adhesion)>
Cells used: Human umbilical vein endothelial cells (HUVEC)
1) Glass beads (Sigma, G-8772, 425-600 microns) were washed with PBS and sterilized with an autoclave. The sterilized glass beads were treated overnight at 37 ° C. with a sterile collagen solution (Functional Peptide Institute, IFP01111), and washed again with PBS.
2) The handle of the cell strainer (BD Falcon, 352340) was cut off and placed in a 35 mm petri dish (IWAKI, 1000-035) (FIG. 20A).
3) Dry beads or beads soaked in PBS were placed so as to cover the lower filter of the cell strainer. The latter was equivalent to about 680 μl (about 500 beads), and PBS was completely removed.
4) Gently applied 5 × 10 ⁵ cells / 500 μl of cell suspension. Be careful not to leak under the cell strainer.
5) After culturing for 1 hour in a CO ₂ incubator, it was filled with HEC-C1 medium.
6) After culturing for 24 hours, the cell strainer was washed with PBS flowing (FIG. 20B).
7) Cells were detached with 4.5 ml of trypsin EDTA solution, the solution was collected, and the number of cells was counted.

Dry beads 8.0 x 10 ⁴ 16% recovery
Wet beads 2.2 x 10 ⁵ 44%
When culturing with wet beads, 380 cells / cell of one cell were cultured. Adsorption rate is thought to increase if the cell fluid is well retained on glass beads. Depending on the type of cells, it is possible to increase the number of cells by increasing the subsequent incubation time if some of the cells can adhere. it is conceivable that. Moreover, in the said experiment, although the culture solution is added 1 hour after cell addition, if the bead surface does not become a dry state, it will be thought that the addition is carried out several hours-overnight and a cell can be hold | maintained and efficiency will improve.

31. Phage recovery rate by organic solvent centrifugation The phage recovery rate may fluctuate more than expected depending on the composition of the organic solvent, and when the number of samples is large, that is, when a long time is required, the recovery rate is reduced. The effect of organic solvents on phage was examined.
1) 5 μl of the phage solution was placed in an Eppendorf tube (about 2 × 10 ⁶ ).
2) 200 μl of organic solvent was added.
3) Mix by inversion 4) Room temperature, 10 minutes 5) 1 ml of PBS was added.
6) Invert mixing 7) Centrifugation (10,000rpm, 30 seconds)
8) 150 μl of the aqueous layer (upper layer) was transferred to a new tube.
9) Freeze at -80 ℃ (more than 10 minutes)
10) Incubate at 37 ° C. for 10 minutes and thaw 11) Transfer 20 μl of the solution to a test tube and add 1 ml of E. coli.
12) Cultivation at 37 ° C. for 1 hour 13) 0.1 ml was plated on an LBGA plate, and the culture results at 30 ° C. are shown in Table 14.

When mixed with an organic solvent for 10 minutes, considerable phages are inactivated. The composition A was 5%, and the composition C or E was 13.9-15.2%.

In addition, when collecting phages from cells, PBS was added and frozen at -80 degrees, which was thought to affect the recovery rate. Therefore, the recovery rates of phages by hydrochloric acid recovery and freeze recovery were compared. The results are shown below.
No.1 HUVEC 1st & Freeze recovery
100-fold dilution 570 ==> 570 x 10 x 100 x 10ml = 5700000 = 5.7 x 10 ⁶
1000-fold dilution 62 ==> 62 x 10 x 1000 x 10ml = 6200000 = 6.2 x 10 ⁶
No.2 HUVEC 1st & HCl recovery recovery
100-fold dilution-
1000-fold dilution 453 ==> 453 x 10 x 1000 x 10ml = 45300000 = 4.5 x 10 ⁷
As a result, Freeze: HCl = 1: 7.9, and the recovery rate was extremely poor in the freeze recovery.

  There is no doubt that the desired antibody can be obtained and functioned even in the current screening, but if it takes time during the operation or the number of samples is too long, May inactivate the phage. Although the recovery rate of diphenyl ether was relatively good, it was decided to use a 9: 1 solution with cyclohexane because it was difficult to handle, such as crystallization due to a drop in room temperature when used alone.

32. Screening by glass bead culture and organic solvent centrifugation <Screening 1>
The following phages were used.
No.1 HUVEC Library: 1X10 ¹² phage
No.2 HUVEC Library: 1X10 ¹² phage
1% BSA, 0.1% NaN ₃ , 100μg / ml Collagen in MEM alpha medium (reaction medium)
1) The medium was removed from the petri dish containing the cell strainer, and 4 ml of phage solution was added.
2) Placed on a seesaw type shaker and shaken at 4 ° C. for about 6 hours.
3) The phage solution was removed from the petri dish using Pipetman.
4) The phage solution was removed as much as possible using Kimwipe or the like.
5) 8 ml of the organic solvent mix was previously placed in a 2059 tube, and the tube was further placed in a blue cap tube (FIG. 21).
* Organic solvent mix Diphenyl ether: Cyclohexane = 9: 1
6) A funnel was set in line with the 2059 tube, and the cell strainer mesh was cut with a cutter.
7) PBS was applied from above the beads, and the beads were poured. (The lump of beads falls to the bottom of the tube at once.)
8) The organic solvent mix was added from above so that the aqueous layer was as small as possible.
9) Centrifuge at 2000rpm for 1 minute
10) Remove the water layer with Pipetman as much as possible. The aqueous layer is present in the form of water droplets of about several hundred μl at the top.
11) Wipe the inside of the tube with Kimwipe so that no water layer remains. (Do it as if you were sucking together the organic solvent layer, and never leave the aqueous layer.)
12) Gently tilted the tube and discarded the organic solvent. (Beads may be tightly packed, but may be about to flow.)
13) Wipe the inside of the tube with Kimwipe.
14) The glass beads were wiped as much as possible with a cotton swab.
15) Add 500μl 0.1M HCl (adjusted to pH 2.2 with Glycine) to glass beads and let stand at room temperature for 10 minutes
16) Neutralize with 30 μl of 2M Tris
17) 10 ml of E. coli DH12S for phage infection was added.
18) Shake culture at 37 ° C for 1 hour
19) Transferred to a 15 ml centrifuge tube, centrifuged at 5000 rpm for 5 minutes, and discarded the upper layer.
20) 2xTYGA (1% Glucose, 100ug / ml Amp) Suspend with 10ml
21) Titer check

The results are shown below.
No.1 HUVEC 1st 1.7 x 10 ⁸
No.2 HUVEC 2nd 1.3 x 10 ⁸
Assuming that 1 x 10 ⁸ phage are bound to 1 x 10 ⁶ cells, 100 phages from 1 cell, and about 1/5 of the phage activity by organic solvent treatment and recovery operations It is considered that about 500 phages were bound to one cell. In the screening by the conventional method, only the explanation of the phage recovery phenomenon that only 1 or less per cell was bound could be explained, but it seems to be a reasonable numerical value.
However, when the clones obtained by these screenings were analyzed, it was found that about half was bound to collagen. It is thought that the phage was bound to the collagen on the glass bead surface, and thus blocking was considered insufficient.

<Screening 2>
Since screening 1 suggested that blocking was insufficient, the composition of the screening solution was examined. The composition of the screening solution is shown below.
Solution 1 Gelatin + BSA
Eagle MEM medium (Nissui, powder, code06900) 0.94 g
Sodium bicarbonate 2 g
BSA fraction V 1 g
10% gelatin / PBS 5 ml
5% NaN ₃ 2 ml
Solution 2 Gelatin + Skim milk
Eagle MEM medium (Nissui, powder, code06900) 0.94 g
Sodium bicarbonate 2 g
Skim milk 2 g
10% gelatin / PBS 5 ml
5% NaN ₃ 2 ml

A phage solution was prepared using the above solution 1 or 2, and screening was performed in the same manner as in screening 1.
Phage solution:
4 ml of the above solution 1 or 2
3mg / ml Collagen 133μl
1st phage Library 1 X 10 ¹² phage results are shown below.
No.1 HUVEC Gelatin + BSA 2.7 x 10 ⁷
No.2 HUVEC Gelatin + Skim milk 1.6 x 10 ⁷
Blank: No cells (only collagen-coated glass beads)
Gelatin + Skim milk 2.3 x 10 ⁶
Gelatin addition reduced recovery by 1 / 2-1 / 7. Thereafter, solution 2 was used.

<Anticollagen antibody titer of clone expressing antibody>
Twenty-four clones were selected from each of the two screening solutions, and the reactivity to collagen was confirmed.
As a result, most of the color development for 1 hour showed a value of 0.1 or less, confirming that almost no anti-collagen antibody clones were contained.

<Cell ELISA>
FIG. 22 shows the results of cell ELISA. HUVEC and HeLa were arranged alternately. Nos. 14 and 28 show PBS-only lanes. No. 1-24 is derived from solution 1, and No. 25-48 is derived from solution 2. The reaction time was 30 minutes.
About each clone, it measured by duplicate for every cell (HUVEC, HeLa, HUVEC, HeLa order).
Negative target clone
NC1: 035-029
NC2: 035-283
NC3: YA14
Positive target clone
PC1: 048-006
PC2: 051-144
PC4: 052-054
PC5: 35-11
Blank
PC3: PBS

The clones surrounded by ○ were observed with a microscope (FIG. 23).
Of the 57 clones whose antibody expression was confirmed, 16 clones (28%) showed positive in cell ELISA using HUVEC and HeLa cells. In the conventional screening method, at least three screenings were performed and concentrated. The clones are obtained and analyzed. Therefore, it is highly likely that the phage antibody to be concentrated is one in which the target molecule is expressed in a large amount. On the other hand, since the screening method performed here is obtained by a single screening operation and does not include a process of repeatedly concentrating the bound phages, it may contain phages against low-expressing antigens. We can expect (Table 15).

  According to the present invention, an antibody that binds to a cell surface antigen can be screened. An antibody library including all antibodies has already been realized. The next task is to reliably and quickly find the antibody of interest from this antibody library. In known screening methods, antibodies having specific reactivity are preferentially obtained, whereas antibodies having any reactivity can be obtained by using the method of the present invention.

  In general, it is not easy to pick up an antibody having a low binding activity or an antibody recognizing an antigen that is present only slightly on the cell surface from an antibody library. According to the present invention, such a rare antibody can be picked up with higher probability. The screening method of the present invention is particularly useful for screening antibody libraries that maintain a higher degree of diversity.

  Rare antibodies include, for example, antibodies that recognize cell surface antigens that are specifically found on certain cells among similar cells. For example, it is possible to obtain an antibody that recognizes an antigen that is specifically found in any cell by comparing cancer cells derived from the same organ between high-grade cancer and low-grade cancer. If possible, it is useful as an index of cancer malignancy. Furthermore, cell surface antigens recognized by such antibodies may be therapeutic targets for treating highly malignant cancers.

  Similarly, cell surface antigens that are expressed differently between cells with a specific disease and normal cells, cells infected with infectious pathogens such as viruses, and normal cells are all diagnostic markers. Useful as. Therefore, an antibody that recognizes and binds to it can be used as a diagnostic tool. Furthermore, cell surface antigens found in association with disease have potential as therapeutic target molecules, similar to the cancer example described above.

  Thus, according to the present invention, cell surface antigens specific to the target cells can be comprehensively obtained. Currently, a DNA chip is widely used as a tool for identifying a gene whose expression level specifically changes in a certain cell. If a DNA chip is used, for example, it is possible to comprehensively track changes in the expression level of most human genes. However, gene transcripts that can be analyzed by a DNA chip are limited to a range that can be detected by a probe constituting the DNA chip. As a result, there is a possibility that a spliced variant or a translation protein having a structure lacking a part of an exon (truncated protein) cannot be identified.

  On the other hand, according to the method for identifying a cell surface antigen specifically found in a cell based on the present invention, since an antibody can be used as a probe, a splicing variant or a truncated protein can be clearly distinguished as a different protein. . By identifying these proteins, it is possible to provide important information in elucidating diseases and pathologies caused by abnormal gene transcription.

  In addition, the present invention provided a method for producing a soluble fraction of cell surface antigens. By using the soluble fraction of the cell surface antigen provided by the present invention, the antibody screening method as described above can be carried out. Alternatively, soluble fractions of cell surface antigens are particularly useful for isolating antigen molecules recognized by antibodies. The soluble fraction of cell surface antigens obtainable by the present invention maintains a high degree of cell surface antigen diversity and immunological properties. Therefore, it is useful as an antigen library for finding an antigen molecule recognized by a certain antibody.

  Antigen molecules selected by antibodies from the soluble fraction are isolated in a highly pure state because they are soluble. Therefore, analysis of the isolated antigen molecule is easy. For example, the amino acid sequence of the antigen can be easily identified by analysis using mass spectrometry. As described above, the soluble fraction of the cell surface antigen of the present invention is an important tool for assisting research in the analysis of the cell surface antigen.

Claims (59)

A method for obtaining an antibody that binds to a cell surface antigen, comprising the following steps:
(1) contacting a cell expressing a cell surface antigen on a cell membrane, or a fraction thereof and an antibody library in an aqueous medium having a relative dielectric constant of 80 or more at 25 ° C.,
(2) A step of preparing a two-phase system comprising an oily low-polarity solvent having a relative dielectric constant of 20 or less and 1 or more at 25 ° C. that is in contact with the aqueous medium of (1) through an interface
(3) a step of transferring a cell expressing a cell surface antigen on the cell membrane, or a fraction thereof, to a low polarity solvent; and
(4) A step of recovering the cells that have migrated to the low-polarity solvent or the antibody bound to the fraction thereof as antibodies that bind to the cell surface antigen. The method according to claim 1, further comprising the following steps (3-a) to (3-c) between steps (3) and (4):
(3-a) in (3), the step of transferring the cell surface antigen transferred to the low polarity solvent on the cell membrane, or a fraction thereof, to an aqueous medium,
Preparing a two-phase system comprising a low polarity solvent in contact with an aqueous medium of (3-b) (3-a) via an interface; and
(3-c) A step of transferring a cell expressing a cell surface antigen on the cell membrane, or a fraction thereof, to a low polarity solvent. The method according to claim 2, wherein the aqueous medium in the step (3-a) is a step of contacting with an aqueous medium different from the aqueous medium of (1). The method according to claim 2, wherein the low polarity solvent in step (3-b) is the same as the low polarity solvent of (2). The method according to claim 2, wherein the low polarity solvent in the step (3-b) is a different low polarity solvent replaced with the low polarity solvent of (2). In (3-c), the cell surface antigen transferred to the low polarity solvent was expressed on the cell membrane, or a fraction thereof. In (3), the cell surface antigen transferred to the low polarity solvent was expressed on the cell membrane. The method according to claim 2, wherein the steps (3-a) to (3-c) are repeated as a cell or a fraction thereof. The method according to claim 6, wherein the steps (3-a) to (3-c) are repeated 1 to 5 times. The method according to claim 7, wherein the steps (3-a) to (3-c) are repeated 2-3 times. The method according to claim 1, wherein the antibody library is a phage library displaying variable regions of antibodies. The method according to claim 1, comprising a step of repeating steps (1) to (3) using the antibody recovered in step (4) as a new antibody library. The method according to claim 1, wherein the fraction of cells expressing the cell surface antigen on the cell membrane is a soluble fraction of the cell surface antigen. The method according to claim 11, wherein the soluble fraction of the cell surface antigen is obtained by the following steps:
(1) a step of disrupting cells expressing an antigen for which an antibody is to be obtained,
(2) a step of recovering a cell membrane fraction from the crushed material in step (1),
(3) a step of solubilizing the cell membrane fraction with a surfactant mixture, and
(4) A step of recovering the supernatant of step (3) as a soluble fraction of the cell surface antigen. The method according to claim 12, wherein the surfactant constituting the surfactant mixture is either a nonionic surfactant or an amphoteric surfactant, or both. Nonionic surfactants include NP-40, Triton X100, n-Dodecyl β-D-maltoside, n-Octyl β-D-glucoside, n-Octyl β-D-maltopyranoside, and n-Decyl β-D- 14. The method of claim 13, wherein the method is at least one compound selected from the group consisting of maltoside. The method according to claim 13, wherein the amphoteric surfactant is Deoxycholic acid. 12. The method of claim 11, wherein the soluble fraction of cell surface antigen is bound to a solid phase. The method according to claim 16, wherein the solid phase is a magnetic particle. The method according to claim 1, wherein the cell expressing a cell surface antigen on the cell membrane is a cell immobilized on a solid phase. The method of claim 18, wherein the solid phase is glass beads. The method according to claim 19, wherein the glass beads are collagen-treated glass beads. 21. The method according to claim 20, wherein the cells immobilized on the solid phase are cells obtained by culturing the cells with collagen-treated glass beads. The method according to claim 1, wherein the aqueous medium is a cell culture solution or a buffer solution to which an inactive protein is added. The method according to claim 22, wherein the inactive protein is bovine serum albumin. Cell culture media from MEM (Minimum Essential Medium), Basal Medium, Eagle (BME), Eagle's Minimum Essential Medium (EMEM), Dulbecco's Modified Eagle's Medium (DME), RPMI-1640 Medium (RPMI1640), and ES Medium (ES) 23. The method according to claim 22, which is any cell culture medium selected from the group consisting of: The method according to claim 1, wherein the low polarity solvent is a mixed solvent containing cyclohexane and diphenyl ether. The method according to claim 25, wherein the solvent is a 1: 9 mixed solvent of cyclohexane and diphenyl ether. The method according to claim 1, wherein the low-polarity solvent is a mixed solvent containing the solvents described in the following a and b, and has a solvent density (d) of 1.0-1.09,
a: at least one solvent selected from the group consisting of hexane, cyclohexane, isooctane, and diisopropyl ether;
b: At least one solvent selected from the group consisting of dibutyl phthalate, 1,1,1-trichloroethane, and diphenyl ether. 28. The method according to claim 25 or 27, wherein a cell culture solution or a buffer solution to which an inactive protein is added is combined as an aqueous medium. A method for screening a phage clone having an activity of binding to a surface antigen of a target cell from a phage library displaying an antibody variable region, comprising the following steps: The hydrogen bond of the antigen-antibody complex is made to move to an oily low-polarity solvent phase having a relative dielectric constant of 25 or less and 1 or more at 25 ° C. A method comprising the step of stabilizing,
(1) a step of bringing a phage library and a target antigen into contact under conditions capable of antigen-antibody reaction; and
(2) A step of recovering a phage clone bound to the antigen. 30. The method according to claim 29, wherein the cell surface antigen is a solid phase on which a cell or a soluble fraction of the cell surface antigen is immobilized. 30. The method of claim 29, wherein the aqueous medium is a minimum essential medium comprising serum albumin. 30. The method of claim 29, wherein the low polarity solvent is any solvent selected from the group consisting of:
a mixed solvent of diphenyl ether, 1,1,1-trichloroethane and hexane,
b. a mixed solvent of isopropyl ether, 1,1,1-trichloroethane and hexane, and
c. a mixed solvent of dibutyl phthalate and cyclohexane,
d. Mixed solvent of diphenyl ether and cyclohexane. 33. The method of claim 32, wherein a minimum essential medium comprising serum albumin as a polar medium is combined. An antibody that binds to a cell surface antigen, comprising a step of contacting the antibody library with a cell that expresses the cell surface antigen on the cell membrane, or a solid phase retaining the fraction, and recovering the antibody that binds to the cell surface antigen. In the acquisition method, the method includes any one of the following steps a) to c), wherein the antigen masking agent and the antibody masking agent each include components defined below,
Antigen masking agent: includes antibodies that you do not want to obtain,
Antibody masking agent: contains free antigens recognized by antibodies that you do not want to obtain,
a) a cell in which a cell surface antigen is expressed on a cell membrane, or a solid phase retaining the fraction and an antibody library are contacted in the presence of either an antigen masking agent or an antibody masking agent;
b) contacting the antibody library with cells that have expressed cell surface antigens on the cell membrane after contact with the antibody masking agent, or with a solid phase retaining a fraction thereof, or
c) contacting a cell that expresses a cell surface antigen on the cell membrane, or a solid phase retaining the fraction with an antigen masking agent and then contacting an antibody library;
A method for obtaining an antibody, further comprising the following steps:
(1) An aqueous medium having a relative dielectric constant of 80 or more at 25 ° C. containing the cell or a solid phase holding the fraction and an antibody library, and a relative dielectric constant at 25 ° C. in contact with the aqueous medium Preparing a two-phase system composed of 20 or less and 1 or more oily low polarity solvent;
(2) transferring a cell expressing the target antigen on the cell membrane, or a solid phase retaining the fraction thereof to a low polarity solvent phase; and
(3) A step of recovering the cells that have migrated to the low-polarity solvent phase or the antibodies bound to the solid phase retaining the fraction as antibodies that bind to the cell surface antigen. The method according to claim 34, wherein the antigen recognized by the antibody intended for acquisition is a surface antigen of cancer cells, and the antigen recognized by an antibody that is not desired to acquire is a surface antigen of normal cells. 36. The method of claim 35, wherein the tissue from which the normal cells and the cancer cells are derived is common. The antigen recognized by the antibody to be acquired is a surface antigen of a cancer cell at a specific stage, and the antigen recognized by an antibody that is not desired to be acquired is the surface antigen of a cancer cell of the same type at a stage different from the above stage. 35. The method of claim 34. 38. The method according to claim 37, wherein the specific stage and one of stages different from the specific stage is advanced cancer, and the other is early cancer. The antibody that is not desired to be obtained is an antibody that binds to the cell surface antigen, and the target antibody is an antibody that binds to an antigen or antigenic determinant different from the antigen or antigenic determinant recognized by the antibody that is not desired to be obtained. 35. The method of claim 34. 40. The method of claim 39, wherein the antibody that is not desired to be obtained is an antibody that has been previously isolated by a binding activity that binds to the cell surface antigen. A fragment comprising an antibody or a variable region thereof obtainable by the method of any of claims 1 or 34. A polynucleotide encoding the variable region of an antibody obtainable by the method of any of claims 1 or 34. A method for screening an antibody that binds to a surface antigen of a specific cell and does not bind to a similar cell when contacted with the same cell under the same conditions, comprising the following steps:
(1) The antibody selected by the method according to claim 1 or claim 34 is applied to a solid phase holding the specific cell or a fraction thereof, and a solid phase holding the similar cell or a fraction thereof. Contacting under common conditions; and
(2) A step of selecting an antibody that binds to the solid phase holding the specific cell or a fraction thereof and does not bind to the solid phase holding the similar cell or a fraction thereof. 44. The method according to claim 43, wherein the specific cell is a cancer cell, and the similar cell is a normal cell of the same tissue as the cancer cell. 44. The method of claim 43, wherein the particular cell is a stage cancer cell and the similar cell is another stage allogeneic cancer cell. 44. The method of claim 43, wherein step (1) comprises contacting the antibody with a cell fixed sample of the specific cells and the similar cells. The step (1) comprises the step of contacting the antibody with a solid phase holding the antigen fraction of the specific cell and a solid phase holding the antigen fraction of the similar cell. Method. 39. The method according to claim 37 or 38, comprising a step of detecting an antibody bound to the cell or a solid phase retaining a cell antigen fraction with a labeled antibody that recognizes the antibody. The method according to claim 1 or 34, wherein the antibody library is an antibody library comprising at least 10 ⁹ types of antibodies. The method according to claim 49, wherein the antibody library is an antibody library comprising at least 10 ¹⁰ types of antibodies. 51. The method of claim 50, wherein the antibody library is an antibody library comprising at least ¹⁰¹¹ types of antibodies. A method for identifying an antigen to which the antibody of claim 41 binds, comprising the following steps:
(1) contacting the antibody according to claim 41 with a cell surface antigen used for isolation of the antibody,
(2) recovering the antigen bound to the antibody; and
(3) A step of identifying the recovered antigen. 53. The method of claim 52, further comprising the step of determining the amino acid sequence of the antigen identified in step (3). 54. The method of claim 53, comprising digesting the antigen and identifying the amino acids that constitute the digestion product. 55. The method of claim 54, comprising the step of digesting the antigen with a proteolytic enzyme. 56. The method of claim 55, wherein the proteolytic enzyme is a serine protease. 57. The method of claim 56, wherein the serine protease is trypsin. 55. The method of claim 54, comprising identifying the amino acids that make up the digestion product by mass spectrometry. 53. An antigen identified by the method of claim 52.