JP2011223993A - Method for inducing differentiation of stem cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for differentiating to pancreas β cells from stem cells such as ES cells or iPS cells without using a virus or a gene.SOLUTION: The method for introducing differentiation from stem cells to pancreas cells comprises introducing Pdx-1 protein once or more times between the 5th day and the 7th day after starting cultivation of the stem cells derived from a mammal, introducing NeuroD protein once or more times between the 9th day and the 11th day and introducing MafA protein once or more times between the 13th day and the 15th day.

Description

The present invention relates to a method for inducing differentiation of stem cells such as ES cells or iPS cells. More specifically,
The present invention relates to a method of inducing differentiation into pancreatic β cells by introducing recombinant proteins of three types of transcriptional regulatory factors into stem cells.

It has been reported that cells similar to pancreatic β cells can be induced by introducing the Pdx-1 gene, Ngn3 gene and MafA gene into the mouse pancreas with a viral vector (Nature 455,
627, 2008). However, gene transfer using a viral vector has problems such as tumorigenesis due to integration into a chromosome, and is not suitable for clinical application. In addition, it has been reported that differentiation into pancreatic endocrine cells was promoted by introducing Ngn3 protein with TAT peptide added into embryonic pancreatic tissue (Diabetes, 54, 720, 2005). However, pancreatic β cell differentiation induction technology using embryonic pancreatic tissue is difficult to apply clinically.

Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of a blastocyst. ES cells can be cultured without restriction in an undifferentiated state, and can be differentiated into various cell types when stimulated, such as nerve cells,
Induction into hematopoietic cells and endoderm cells such as pancreas and liver is possible. IPS cells (
An induced pluripotent stem cell) is a pluripotent cell obtained by reprogramming somatic cells. However, there have been no reports of successful induction of differentiation from ES cells to pancreatic β cells by introducing proteins.

Nature 455, 627, 2008 Diabetes, 54, 720, 2005

An object of the present invention is to provide a method for differentiating stem cells such as ES cells or iPS cells into pancreatic β cells without using viruses or genes.

As a result of intensive studies to solve the above problems, the present inventors have obtained three types of transcription factor recombination proteins (Pdx-1 protein, NeuroD protein, and MafA protein added with polyarginine).
Was successfully induced to differentiate into pancreatic β-cells by introduction of ES into ES cells, and the present invention was completed.

That is, according to the present invention, P5 is observed between the fifth day and the seventh day after the start of the culture of the stem cells derived from mammals.
Introducing dx-1 protein one or more times, introducing NeuroD protein one or more times from day 9 to day 11, and introducing MafA protein one or more times from day 13 to day 15. A method for inducing differentiation from a stem cell to a pancreatic cell is provided.
Preferably, the stem cell derived from a mammal is a stem cell derived from mouse, monkey or human.
Preferably, the stem cell is an ES cell or iPS cell.
Preferably, the pancreatic cell is an insulin producing cell.

Preferably, the MafA protein is a MafA protein to which polyarginine is added.
Preferably, Pdx-1 protein, NeuroD protein, and MafA protein are introduced into stem cells derived from mammals cultured on an extracellular matrix derived from rat bladder cancer-derived 804G cells.

According to the present invention, pancreatic cells obtained by the above-described method of the present invention and induced to differentiate from ES cells are provided.
According to the present invention, the pancreatic system induced to differentiate from ES cells, further comprising the step of inducing differentiation from stem cells to pancreatic cells by the above-described method of the present invention, and the step of separating the differentiation-induced pancreatic cells. A method of obtaining cells is provided.

According to the present invention, stem cells such as ES cells or iPS cells can be differentiated into pancreatic β cells without using viruses or genes. The method of the present invention is useful as a method for producing pancreatic β cells used for pancreatic β cell transplantation therapy for diabetic patients.

FIG. 1 shows a schematic diagram of a recombinant protein to which a full length or 11 arginines have been added. FIG. 2 shows the purification of the recombinant protein. FIG. 3 shows the introduction of proteins into HeLa cells. FIG. 4 shows a procedure for inducing insulin-producing cells from mouse ES cells by introducing a protein. FIG. 5 shows immunofluorescence analysis of insulin in mouse ES cells. FIG. 6 shows real-time RT-PCR analysis of insulin 1 gene expression. FIG. 7 shows that from day 9, insulin gene expression does not increase due to protein introduction. FIG. 8 shows the differentiation of mouse ES cells into insulin-producing cells by introduction of a three-factor protein using an extracellular matrix derived from 804G cells.

Hereinafter, embodiments of the present invention will be described in more detail.
The method for inducing differentiation from a stem cell to a pancreatic cell according to the present invention is applied to a stem cell derived from a mammal.
A method comprising introducing a Pdx-1 protein, a NeuroD protein, and a MafA protein.

In the process of pancreatic β cell differentiation, it is important that transcription factors including the above-mentioned three factors are expressed transiently. In the protein introduction method used in the present invention, the added protein migrates into cells in a short time. Further, it can be completely decomposed and disappeared 1 to 2 days after introduction, and transient expression can be expected. Furthermore, the protein expressed as in the case of introduction using an expression plasmid or a viral vector does not affect cells for a long time, and no foreign gene is integrated into the chromosome. The method according to the present invention clears the safety aspect essential for clinical application.

Regenerative medicine for transplanting insulin-producing cells is expected for type 1 and type 2 diabetes. In order to clinically apply this treatment method, a technique for safely differentiating pancreatic β cells from ES cells or iPS cells is essential. The technique used in the present invention is safe without using a viral vector, and can be used as a method for producing pancreatic β cells necessary for transplantation.

The ES cell used in the present invention is not particularly limited as long as it is a mammal-derived ES cell, and for example, a mouse, monkey or human-derived ES cell can be used.
As the ES cell, for example, a cell having a reporter gene introduced in the vicinity of the Pdx1 gene can be used in order to facilitate confirmation of the degree of differentiation. For example, a 129 / Sv-derived ES cell line R1, J1 incorporating the lacZ gene at the Pdx1 locus, or an ES cell SK7 line having a GFP reporter transgene under the control of the Pdx1 promoter can be used. Alternatively, an ES cell PH3 strain having an mRFP1 reporter transgene under the control of a Hnf3β endoderm-specific enhancer fragment and a GFP reporter transgene under the control of a Pdx1 promoter can also be used.

Mammal-derived ES cells can be cultured by a conventional method. For example, in the presence of mitomycin C-treated mouse embryo fibroblasts (MEF) as feeder cells, leukemia inhibitory factor (LIF, ESGRO 1000 Dulbecco's Modified Eagle Medium (DMEM, Sigma) supplemented with differentiation medium (10% fetal bovine serum (FBS), 0.1 mM 2-mercaptoethanol, 100 μM non-essential amino acids, 2 mM L-glutamine, unit / ml, Chemicon) )) Can be maintained.

An iPS cell (induced pluripotent stem cell) is a pluripotent cell obtained by reprogramming somatic cells. Artificial pluripotent stem cells are produced by a group of Prof. Shinya Yamanaka from Kyoto University and Rudolf Janish from Massachusetts Institute of Technology (
Rudolf Jaenisch) group James Thomson (James T) of University of Wisconsin
homson et al., Konrad Hoch from Harvard University
Several groups have been successful, including edlinger's group. Artificial pluripotent stem cells are highly expected as ideal pluripotent cells without rejection and ethical problems. For example, International Publication No. WO 2007/069666 discloses somatic cell nuclear reprogramming factors including Oct family genes, Klf family genes, and Myc family gene gene products, as well as Oct family genes, Klf family genes, Sox family genes and A somatic cell nuclear reprogramming factor containing a gene product of a Myc family gene is described, and further, a pluripotent stem cell induced by somatic cell nuclear reprogramming, comprising a step of contacting the nuclear reprogramming factor with the somatic cell. A method of manufacturing is described.

IPS cells used in the present invention can be produced by reprogramming somatic cells. The type of somatic cell used here is not particularly limited, and any somatic cell can be used. That is,
The somatic cell referred to in the present invention includes all cells other than the internal germ cells of the cells constituting the living body,
Differentiated somatic cells or undifferentiated stem cells may be used. The origin of the somatic cell may be any of mammals, birds, fishes, reptiles and amphibians, but is not particularly limited, but is preferably a mammal (for example, a rodent such as a mouse or a primate such as a human). A mouse or a human is preferable. In addition, when human somatic cells are used, any fetal, neonatal or adult somatic cells may be used.

The iPS cells referred to in the present invention have a self-replicating ability over a long period of time under predetermined culture conditions (for example, conditions under which ES cells are cultured), and are also ectoderm, mesoderm and endoderm under predetermined differentiation-inducing conditions. This refers to stem cells that have pluripotency. The induced pluripotent stem cell in the present invention may be a stem cell capable of forming a teratoma when transplanted to a test animal such as a mouse.

In order to produce iPS cells from somatic cells, first, at least one reprogramming gene is introduced into the somatic cells. The reprogramming gene is a gene encoding a reprogramming factor that has the action of reprogramming somatic cells into iPS cells. Specific examples of combinations of reprogramming genes include
The following combinations can be mentioned, but are not limited to these.
(I) Oct gene, Klf gene, Sox gene, Myc gene (ii) Oct gene, Sox gene, NANOG gene, LIN28 gene (iii) Oct gene, Klf gene, Sox gene, Myc gene, hTERT gene, SV40 large T gene (Iv) Oct gene, Klf gene, Sox gene

In the present invention, Pdx-1 protein, NeuroD protein, and MafA protein are introduced into stem cells derived from mammals. The procedure for introducing the above three types of proteins into stem cells is not particularly limited, and may be introduced simultaneously or sequentially in order. Preferably, each protein can be introduced in the order of Pdx-1 protein, NeuroD protein, and MafA protein. Particularly preferably, the Pdx-1 protein is introduced at least once during the 5th to 7th days after the start of the stem cell culture,
The NeuroD protein can be introduced one or more times during the first day, and the MafA protein can be introduced one or more times during the 13th to 15th days.

The origin of the Pdx-1 protein, NeuroD protein, and MafA protein used in the present invention is not particularly limited, and it is the same or close to the kind of mammal from which the stem cells (such as ES cells or iPS cells) to be introduced are derived. Pdx-1 protein, NeuroD protein, and MafA protein can be used.
For example, when introduced into mouse-derived stem cells, recombinant rat or mouse Pdx-1 protein, NeuroD protein and MafA protein can be used. For introduction into human-derived stem cells, human recombinant Pdx-1 protein, NeuroD protein and MafA protein can be used. In addition, it is preferable to use recombinant proteins as the Pdx-1 protein, NeuroD protein, and MafA protein. That is, expression vectors encoding the Pdx-1 gene, NeuroD gene, and MafA gene are constructed, introduced into an appropriate host (such as E. coli), and the resulting transformant expresses the introduced gene. The desired recombinant protein can be produced by culturing under appropriate conditions. Further, as the MafA protein used in the present invention, it is preferable to use a MafA protein to which polyarginine is added.

The base sequences and amino acid sequences of the Pdx-1 protein, NeuroD protein, and MafA protein that can be used in the present invention are known, and are also described in the sequence listing as follows.

The method for culturing mammalian stem cells (such as ES cells or iPS cells) is not particularly limited,
(For example, Nobuaki Shiraki and Shogo Tsuji "Induction of differentiation of endoderm cells from ES cells" Experimental Medicine separate volume, Cultured Cell Experiment Handbook 297-301, 2008;
And Nature protocols, 2, 3081, 2007).

According to the present invention, differentiation can be induced from stem cells to pancreatic cells. The differentiation-induced pancreatic cell is preferably an insulin-producing cell.

Further, according to the present invention, when differentiation induction from stem cells such as ES cells or iPS cells into pancreatic cells, the stem cells are cultured in the presence of the test substance, and the stem cells are cultured in the absence of the test substance. Promotes differentiation induction from stem cells to pancreatic cells by comparing the degree of differentiation induction into pancreatic cells in rats and the degree of differentiation induction into pancreatic cells when cultured in the presence of a test substance Alternatively, a method of screening for an inhibitory substance is provided. As a test substance, a growth factor or a low molecular weight compound can be used. At this time, it is possible to measure the degree of differentiation induction into pancreatic cells using the expression level of insulin as an index.

The following examples further illustrate the present invention, but the present invention is not limited to the examples.

Example 1: Expression and purification in Escherichia coli of rat recombinant Pdx-1 protein, rat recombinant NeuroD protein, and mouse recombinant MafA protein added with polyarginine (FIGS. 1 and 2)
Rat Pdx-1 gene, rat NeuroD gene and mouse MafA gene were provided by Dr. Hirofumi Noguchi of Baylor Institute, USA (Diabetes, 52, 1732, 2003; Diabetes,
54, 2859, 2005). Using a primer with a restriction enzyme site and PCR, Pdx-1
And NeuroD genes were incorporated into the pET21a (+) vector. MafA was incorporated into the pGEX-6p-1 vector to which polyarginine had been added in advance. The above plasmid is introduced into E. coli BL21 (DE3) strain by transformation and cultured at 37 ° C. Add IPTG to cells in logarithmic growth phase and incubate at 24 ° C for 12 hours. The cells recovered by centrifugation are lysed with a cell lysate, and P
dx-1 and NeuroD were purified by TALON resin. MafA was purified with Glutathione Sepharose 4B, and then the GST tag was cleaved with PreScission Protease. The purified protein is SDS-
After PAGE, expression was confirmed by Coomassie staining and Western blotting.

The results are shown in FIG. As shown in FIG. 2, rat recombinant Pdx-1 protein, rat recombinant Neu
Expression of roD protein and mouse recombinant MafA protein added with polyarginine in E. coli was confirmed.

Example 2: Introduction of recombinant protein into HeLa cells (Fig. 3)
It was confirmed using Hela cells that the recombinant protein purified in Example 1 was introduced into the cells. Each protein was added to Hela cells to a final concentration of 1 μM. Cells were harvested with SDS sample buffer 6 hours after protein addition. The introduction was confirmed by Western blotting using an antibody that recognizes each protein.

The results are shown in FIG. Pdx-1 and NeuroD are themselves PTD (Protein transduction domain)
It has already been reported that it is introduced into cells, but it has been demonstrated for the first time in this experiment that MafA is introduced into cells by adding polyarginine.

Example 3: Induction of differentiation from mouse ES cells to pancreatic β cells (FIGS. 4-7)
The method of inducing differentiation from mouse ES cells to pancreatic β cells was according to the method of theirs (upper part of FIG. 4). Our method proposes that insulin-producing cells increase when ES cells are cultured under three types of medium conditions for 17 days. Specifically, differentiation from mouse ES cells into insulin-producing cells was performed for 17 days as shown in FIG. Medium 1 is DMEM medium containing Activin A, basic FGF, Medium 2 is RPMI medium containing B27 additive, retinoic acid, KAAD-Cyclopamine, FGF10, M
edium 3 is a DMEM medium containing Nicotinamide and GLP-1, and the differentiation was induced by gradually changing the medium as shown in the figure.

As shown in the lower table of FIG. 4, the introduction of the protein into the ES cells was directly added to the medium at Day 5, 7, 9, 11, 13, and 15 so that the final protein concentration was 1 μM. At Day 17, the cells were fixed and immunostained with anti-insulin antibody (upper figure 5). The number of insulin positive cells was counted with a counter and compared between the groups shown in the lower table of FIG. 4 (lower of FIG. 5). Furthermore, RNA was extracted from the differentiated cells of Day 17, and cDNA was synthesized by RT-PCR. Insulin 1 gene expression was measured by quantitative RT-PCR using the following primers (FIGS. 6 and 7).
Sense: CAGCCCTTAGTGACCAGCTA (SEQ ID NO: 19)
Antisense: ATGCTGGTGCAGCACTGATC (SEQ ID NO: 20)

In this example, the type of protein to be introduced was examined between Day 5 and Day 13, as shown in the lower part of FIG. As a result, Pdx-1 on Day 5 and 7 and NeuroD on Day 9 and 11 and Ma on Day 13 and 15
Among the cells into which fA was introduced, the number of insulin-positive cells was the largest (FIG. 5). On the other hand, the treatment with each of the three factors alone showed no difference from the control group.

Furthermore, the introduction of 3 factors markedly increased the expression of the insulin gene (FIG. 6). In addition, FIG.
As shown in FIG. 4, since the protein expression from Day 9 does not increase the expression of the insulin gene, it was suggested that introduction of the three factors at a specific time is important for differentiation induction.

Example 4: Differentiation of mouse ES cells into insulin-producing cells by introduction of a three-factor protein using an extracellular matrix derived from 804G cells The rat bladder cancer-derived cell line 804G is an extracellular matrix containing laminin-5 and fibronectin. Produce. This matrix improves pancreatic β-cell growth and glucose-responsive insulin secretion (Diabetes, 49, 233, 2000; Diabetes, 53, 2034, 2004).

The culture plate was previously coated with a culture supernatant of 804G cells overnight and seeded with ES cells. In this experiment, ES cells derived from Ins-GFP transgenic mice (mouse ES cell line ING112) were used, and fluorescence of GFP was used as an index for differentiation into insulin-producing cells. The differentiation induction method and the protein introduction method were performed in the same manner as described above, and the number of Ins-GFP positive cells was counted with a counter on the 17th day of the culture, and the 804G matrix treatment group and the three factor introduction group were compared (a, FIG. 8). b). FIG.
As shown in a and b, in the mouse ES cell line ING112, the extracellular matrix derived from 804G cells significantly increased the number of Ins-GFP positive cells, and the group in which three factors were further introduced was introduced. The number of Ins-GFP positive cells was increased compared to the group without.

The result of comparing the expression of Insulin 1 gene is shown in FIG.
On the 17th day of culture, RNA was extracted from the differentiated cells, and cDNA was synthesized by RT-PCR. Insulin 1 gene expression was measured by the quantitative RT-PCR method using the following primers, and the control group, the 804G matrix-treated group, and the 3-factor introduction group were compared.
Sense: CAGCCCTTAGTGACCAGCTA (SEQ ID NO: 19)
Antisense: ATGCTGGTGCAGCACTGATC (SEQ ID NO: 20)
As shown in FIG. 8c, the expression of Insulin 1 gene was increased by 804G extracellular matrix and protein introduction.

The result of examining the expression of the pancreas-specific gene by RT-PCR is shown in FIG.
On day 17 of culture, RNA was extracted from the differentiated cells, cDNA was synthesized by RT-PCR, and expression of pancreas-specific genes was analyzed using the following primers.
Act,
Sense: CCTCATGAAGATCCTGACCGA (SEQ ID NO: 21)
Antisense: TTGCCAATAGTGATGACCTGG (SEQ ID NO: 22)
Ins1,
Sense: CAGCCCTTAGTGACCAGCTA (SEQ ID NO: 19)
Antisense: ATGCTGGTGCAGCACTGATC (SEQ ID NO: 20)
Ins2,
Sense: TCCGCAACAATCAAAAACCAT (SEQ ID NO: 23)
Antisense: GCTGGGTAGTGGTGGGTCTA (SEQ ID NO: 24)
Pdx-1,
Sense: CCAAAACCGTCGCATGAAGTG (SEQ ID NO: 25)
Antisense: CTCTCGTGCCCTCAAGAATTTTC (SEQ ID NO: 26)
NeuroD,
Sense: CTTGGCCAAGAACTACATCTGG (SEQ ID NO: 27)
Antisense: GGAGTAGGGATGCACCGGGAA (SEQ ID NO: 28)
MafA,
Sense: ACACTGCCCACCATCATCACTC (SEQ ID NO: 29)
Antisense: CTTCTCGCTCTCCAGAATGTGC (SEQ ID NO: 30)
Glut2,
Sense: ACAGAGCTACAATGCAACGTGG (SEQ ID NO: 31)
Antisense: CAACCAGAATGCCAATGACGAT (SEQ ID NO: 32)
Kir6.2,
Sense: GGCTCCTAGTGACCTGCACCA (SEQ ID NO: 33)
Antisense: CCACAGCCACACTGCGCTTGCG (SEQ ID NO: 34)
SUR1,
Sense: CCAGACCAAGGGAAGATTCA (SEQ ID NO: 35)
Antisense: GTCCTGTAGGATGATGGACA (SEQ ID NO: 36)
IAPP,
Sense: TGATATTGCTGCCTCGGACC (SEQ ID NO: 37)
Antisense: GGAGGACTGGACCAAGGTTG (SEQ ID NO: 38)
CACNA1A,
Sense: GGTCACACCTCACAAGTCCAC (SEQ ID NO: 39)
Antisense: CCAGTCTTCTGGAACATCTCTTG (SEQ ID NO: 40)
CACNA1C,
Sense: ATGCAAGACGCTATGGGCTAT (SEQ ID NO: 41)
Antisense: CAGGTAGCCTTTGAGATCTTCTTC (SEQ ID NO: 42)
CACNA1D,
Sense: ACATTCTGAACATGGTCTTCACAG (SEQ ID NO: 43)
Antisense: AGGACTTGATGAAGGTCCACAG (SEQ ID NO: 44)
As shown in FIG. 8d, expression of all the examined genes was observed by introduction of 804G extracellular matrix and protein.

The result of examining the expression of the insulin gene in cells induced to differentiate from human iPS cells is shown in FIG. The introduction of protein into human iPS cells was carried out on Day 15, 17, 19, 21, 23, 25 with a final protein concentration of 1μ.
Each was added directly to the medium so as to be M.
On the 28th day of culture, RNA was extracted from the differentiated cells, cDNA was synthesized by RT-PCR, and the expression of the insulin gene was analyzed using the following primers.
Sense: GAGGCCATCAAGCAGATCAC (SEQ ID NO: 45)
Antisense: GGCTGCGTCTAGTTGCAGTA (SEQ ID NO: 46)
As shown in e of FIG. 8, the expression of the insulin gene was also observed in the human iPS cells by introducing the 804G extracellular matrix and protein.

Claims (8)

Pdx-1 protein is introduced at least once during the 5th to 7th days after the start of the culture of mammalian stem cells, and the NeuroD protein is introduced at least once during the 9th to 11th days. A method for inducing differentiation from a stem cell to a pancreatic cell, comprising introducing MafA protein one or more times between day 1 and day 15. The method according to claim 1, wherein the mammal-derived stem cell is a mouse, monkey or human-derived stem cell. The method according to claim 1 or 2, wherein the stem cells are ES cells or iPS cells. The method according to any one of claims 1 to 3, wherein the pancreatic cell is an insulin-producing cell. The method according to any one of claims 1 to 4, wherein the MafA protein is a MafA protein to which polyarginine is added. The Pdx-1 protein, NeuroD protein, and MafA protein are introduced into stem cells derived from mammals cultured on an extracellular matrix derived from rat bladder cancer-derived 804G cells, according to any one of claims 1 to 5. The method described. A pancreatic cell obtained by the method according to any one of claims 1 to 6 and induced to differentiate from an ES cell. A pancreas induced to differentiate from an ES cell, comprising a step of inducing differentiation from a stem cell to a pancreatic cell by the method according to any one of claims 1 to 6, and a step of isolating the pancreatic cell induced to differentiate. A method of obtaining cell lines.