JP2011182759A - Gene increasing oil and fat productivity of plant and use method thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To much improve oil and fat productivity in plants. <P>SOLUTION: An At3g19990 gene or a gene functionally equivalent thereto is introduced, or the intrinsic expression control domain of the gene is modified. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a plant in which a predetermined gene has been introduced or a modified expression control region of the endogenous gene, and an oil / fat productivity by introducing the predetermined gene or by modifying the endogenous expression control region of the gene. The present invention relates to a method for increasing the amount of oil and fat, and a method for producing a plant having increased productivity.

  Plants are cultivated for the purpose of producing a part of the tissue itself (seed, root, leaf stem, etc.) or for the purpose of producing various substances such as fats and oils. For example, as fats and oils produced by plants, soybean oil, sesame oil, olive oil, coconut oil, rice oil, cottonseed oil, sunflower oil, corn oil, bean flower oil, palm oil, rapeseed oil, etc. have been known since ancient times. Widely used in industrial applications. In addition, oils and fats produced by plants are also used as raw materials for biodiesel fuel and bioplastics, and their applicability is expanding as petroleum alternative energy.

  Non-patent document 1 reports that a triacylglycerol (TAG) synthesis gene (DGAT1 gene) overexpression strain in Arabidopsis thaliana leads to an increase in oil content and seed weight in seeds. The DGAT1 gene is a rate-limiting enzyme gene in the final step of TAG synthesis. If a transcription factor that activates the expression of the DGAT1 gene can be identified, it is expected that the amount of oil storage in seeds can be increased and the productivity of oils can be improved. Moreover, if this technology is applied, it is expected that the productivity of fats and oils can be improved even in practical plants such as rapeseed.

Jako, C. et al, 2001 Plant Physiol., 126: 861-874

  However, no technology that activates the expression of the DGAT1 gene has been developed so far, and no technology for improving fat productivity based on enhanced expression of the DGAT1 gene has been known. Then, in view of the above situation, it aims at searching the gene which has a novel function which improves the fats and oils productivity in a plant significantly, and providing the technique which can increase fats and oils productivity in a plant significantly.

  As a result of intensive studies by the present inventors to achieve the above-mentioned object, by introducing a predetermined gene although its function is unknown, or by altering the expression control region of the gene concerned, oil and fat productivity in plants As a result, the present inventors have completed the present invention.

  That is, the plant body according to the present invention is one obtained by introducing the At3g19990 gene or a gene functionally equivalent to the gene, or by modifying the expression control region of the gene concerned.

  In addition, the method for increasing fat and oil productivity according to the present invention is a method for introducing an At3g19990 gene or a gene functionally equivalent to the gene, or modifying an expression control region of the gene concerned.

  Furthermore, the method for producing a plant according to the present invention includes a step of preparing a transformed plant into which an At3g19990 gene or a gene functionally equivalent to the gene is introduced, or in which an expression control region of the gene is modified, Measuring the fat and oil productivity of a progeny plant of the transformed plant, and selecting a line having significantly improved fat and oil productivity.

  In the present invention, the gene preferably encodes any of the following proteins (a) to (c).

(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) containing an amino acid sequence in which one or more amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2 and specific for seeds A protein that has a function involved in seed synthesis in seeds (c) a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1 Is a protein that has a function of being specifically expressed in seeds and involved in seed synthesis in seeds.

  In the present invention, the functionally equivalent gene is a gene derived from an organism other than Arabidopsis thaliana, which expresses specifically in the seed and encodes a protein having a function related to seed synthesis in the seed. be able to.

  Examples of plants to be used in the present invention include dicotyledonous plants such as Arabidopsis plants and Brassicaceae plants. On the other hand, the target plant in the present invention includes monocotyledonous plants such as rice and sugar cane among grasses and gramineous plants.

  The plant according to the present invention has a characteristic that the fat content per seed and the seed size are significantly increased as compared to the wild type, and therefore the fat productivity is remarkably improved. Moreover, the method for increasing the fat productivity according to the present invention can greatly increase the fat content and seed size per seed grain as compared to the wild type of the target plant. Furthermore, the manufacturing method of the plant body which concerns on this invention can manufacture the plant body which fat and oil productivity improved significantly compared with the wild type. Therefore, by applying the present invention, it is possible to achieve an improvement in productivity when, for example, oils and fats contained in plants are used as products and / or seeds are used as products.

It is a photograph which shows the result of having measured the fluorescence based on the LUC gene of a DGAT1p :: LUC introduction plant about a leaf, a root, a flower, and a fruit. It is a characteristic view which shows the result of having measured the amount of TGA contained in the seed extract | collected from Arabidopsis thaliana which enhanced the expression of AOTA1 gene (At3g19990). It is a characteristic view which shows the result of having measured the size of the seed extract | collected from Arabidopsis thaliana which enhanced the expression of AOTA1 gene (At3g19990).

  Hereinafter, the present invention will be described in detail.

  The plant according to the present invention is an Arabidopsis thaliana At3g19990 gene or a gene functionally equivalent to the gene introduced into the plant, or a modified expression control region of the gene of interest, compared to the wild type. Therefore, the oil productivity is significantly increased. Significantly increase the expression level of the target gene compared to the wild-type expression level by introducing the target gene exogenously into the plant or modifying the expression control region of the endogenous gene be able to. The plant according to the present invention may be one in which the At3g19990 gene is expressed throughout the plant tissue, or may be expressed in at least a part of the plant tissue. Here, the plant tissue is meant to include plant organs such as leaves, stems, seeds, roots and flowers. In particular, it is preferable to specifically express the At3g19990 gene in seeds.

  The expression control region means a promoter region to which RNA polymerase binds and a region to which other transcription factors bind. As a modification of the transcription control region, it is preferable to replace, for example, the promoter region in the endogenous transcription control region with a promoter region capable of higher expression.

  Here, the increase in fat and oil productivity can be paraphrased as an increase in the amount of fat and oil contained per seed. Moreover, it can be paraphrased that oil-and-oil productivity increases that the magnitude | size of a seed increases. That is, the plant according to the present invention is a product obtained by introducing the At3g19990 gene or a gene functionally equivalent to the gene into the plant, or a modified expression control region of the endogenous gene, compared with the wild type. In other words, it can be said that the amount of fats and oils and the size of seeds contained per seed are significantly increased.

At3g19990 gene In the present invention, an Arabidopsis At3g19990 gene is introduced into a plant. Here, the base sequence of the coding region in the At3g19990 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the At3g19990 gene is shown in SEQ ID NO: 2. In the present invention, a gene functionally equivalent to the At3g19990 gene may be introduced into the plant body. Here, the functionally equivalent gene means, for example, a gene derived from an organism other than Arabidopsis thaliana and corresponding to the At3g19990 gene.

  A gene functionally equivalent to the At3g19990 gene derived from organisms other than the above Arabidopsis thaliana is not particularly limited, and can be identified by searching a database storing gene sequences relating to various organisms. That is, using the base sequence shown in SEQ ID NO: 1 or the base sequence shown in SEQ ID NO: 2 as a query sequence, for example, search the DDBJ / EMBL / GenBank international base sequence database or SWISS-PROT database, and easily search from known databases -Can be identified.

  In the present invention, the At3g19990 gene is not limited to the gene consisting of the base sequence and amino acid sequence specified by the sequence numbers as described above. That is, the At3g19990 gene includes an amino acid sequence in which one or a plurality of amino acid sequences are deleted, substituted, added or inserted in the amino acid sequence specified by SEQ ID NO: 2, and is expressed specifically in seeds. It may be a protein having a function involved in seed synthesis. Here, as the plurality of amino acids, for example, 1 to 40, preferably 1 to 20, more preferably 1 to 10, still more preferably 1 to 5, particularly preferably 1 to 3 means. Amino acid deletion, substitution or addition can be performed by modifying the above At3g19990 gene by a technique known in the art. Mutation can be introduced into a base sequence by a known method such as Kunkel method or Gapped duplex method or a method according thereto, for example, a mutation introduction kit (for example, Mutant-) using site-directed mutagenesis. Mutations are introduced using K, Mutant-G (both trade names, manufactured by TAKARA Bio) or the like, or using LA PCR in vitro Mutagenesis series kits (trade name, manufactured by TAKARA Bio). In addition, as a method for introducing mutations, EMS (ethyl methanesulfonic acid), 5-bromouracil, 2-aminopurine, hydroxylamine, N-methyl-N'-nitro-N nitrosoguanidine, and other carcinogenic compounds are representative. A method using a chemical mutagen such as that described above may be used, or a method using radiation treatment or ultraviolet treatment represented by X-rays, alpha rays, beta rays, gamma rays and ion beams may be used.

  Further, the At3g19990 gene may be a homologous gene of the At3g19990 gene consisting of the base sequence and amino acid sequence specified by the sequence numbers as described above. Here, the homologous gene generally means a gene that has evolved and branched from a common ancestral gene, and is generated by two kinds of homologous genes (ortholog) and duplicated branching within the same species. It means to include homologous genes (paralog). In other words, the above-mentioned “functionally equivalent gene” includes homologous genes such as orthologs and paralogs. However, the above-mentioned “functionally equivalent genes” include genes that do not evolve from a common gene but simply have similar functions.

  As a gene similar to the At3g19990 gene specified by the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 as described above, the similarity (Similarity) to these amino acid sequences is, for example, 70% or more, preferably 80% or more And a gene encoding a protein having an amino acid sequence of 90% or more, most preferably 95% or more, expressed in a seed-specific manner, and having a function involved in seed synthesis in the seed. . Here, the value of similarity means a value obtained by default setting using a computer program in which a BLAST (Basic Local Alignment Search Tool) program is installed and a database storing gene sequence information.

  If the gene similar to the At3g19990 gene specified by the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 is not known, is the genome extracted from the target plant? Alternatively, by constructing a cDNA library of the target plant and isolating a genomic region or cDNA that hybridizes under stringent conditions to at least a part of the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1. Can be identified. Here, stringent conditions refer to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. For example, hybridization at 45 ° C. and 6 × SSC (sodium chloride / sodium citrate), followed by washing at 50 to 65 ° C., 0.2 to 1 × SSC, 0.1% SDS, or such conditions And hybridization at 65 to 70 ° C. and 1 × SSC, and subsequent washing at 65 to 70 ° C. and 0.3 × SSC. Hybridization can be performed by a conventionally known method such as the method described in J. Sambrook et al. Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory (1989).

  The plant body according to the present invention introduces the At3g19990 gene or a gene functionally equivalent to the gene into the plant body, or modifies the expression control region of the gene concerned, thereby improving the oil productivity (per seed grain). Oil content and seed size) are significantly improved compared to the wild type. As a method for introducing the At3g19990 gene into a plant, a method for introducing an expression vector in which an exogenous At3g19990 gene is arranged under the control of a promoter capable of expression in the plant can be mentioned. Examples of the technique for modifying the expression control region of the gene of interest include a technique for modifying the promoter of the endogenous At3g19990 gene in the target plant body.

  As an example, a method of introducing an expression vector in which the above-described At3g19990 gene is placed under the control of a promoter that enables expression in a plant is preferable.

The expression vector expression vector is constructed so as to contain a promoter that enables expression in a plant and the above-described At3g19990 gene. Various vectors known in the art can be used as the base vector for the expression vector. For example, a plasmid, phage, cosmid or the like can be used, and can be appropriately selected according to the plant cell to be introduced and the introduction method. Specific examples include pBR322, pBR325, pUC19, pUC119, pBluescript, pBluescriptSK, and pBI vectors. In particular, when the method for introducing a vector into a plant is a method using Agrobacterium, it is preferable to use a pBI binary vector. Specific examples of the pBI binary vector include pBIG, pBIN19, pBI101, pBI121, pBI221, and the like.

  The promoter is not particularly limited as long as it can express the At3g19990 gene in plants, and a known promoter can be preferably used. Examples of such promoters include cauliflower mosaic virus 35S promoter (CaMV35S), various actin gene promoters, various ubiquitin gene promoters, nopaline synthase gene promoters, tobacco PR1a gene promoter, napin gene promoter, oleosin gene promoter and the like. Can do. Among these, cauliflower mosaic virus 35S promoter, actin gene promoter, or ubiquitin gene promoter can be more preferably used. When each of the above promoters is used, any gene can be strongly expressed when introduced into a plant cell.

  In addition, a promoter having a function of expressing in a site-specific manner in a plant can also be used. As such a promoter, any conventionally known promoter can be used. By using such a promoter and expressing the At3g19990 gene in a site-specific manner, the expressed plant organ can be increased compared to the wild type. In particular, by using a seed-specific promoter, the At3g19990 gene can be expressed in seeds, and the oil content and seed size contained in seeds can be increased.

  The expression vector may further contain other DNA segments in addition to the promoter and the At3g19990 gene. The other DNA segment is not particularly limited, and examples thereof include a terminator, a selection marker, an enhancer, and a base sequence for improving translation efficiency. The recombinant expression vector may further have a T-DNA region. The T-DNA region can increase the efficiency of gene transfer particularly when Agrobacterium is used to introduce the recombinant expression vector into a plant body.

  The transcription terminator is not particularly limited as long as it has a function as a transcription termination site, and may be a known one. For example, specifically, the transcription termination region (Nos terminator) of the nopaline synthase gene, the transcription termination region of the cauliflower mosaic virus 35S (CaMV35S terminator) and the like can be preferably used. Of these, the Nos terminator can be more preferably used. In the above recombinant vector, the transcription terminator is placed at an appropriate position, and after being introduced into a plant cell, an unnecessarily long transcript is synthesized, and a strong promoter reduces the copy number of the plasmid. Can be prevented.

  As a transformant selection marker, for example, a drug resistance gene can be used. Specific examples of such drug resistance genes include drug resistance genes for hygromycin, bleomycin, kanamycin, gentamicin, chloramphenicol and the like. Thereby, the transformed plant body can be easily selected by selecting the plant body growing in the medium containing the antibiotic.

  Examples of the base sequence for increasing the translation efficiency include an omega sequence derived from tobacco mosaic virus. By placing this omega sequence in the untranslated region (5′UTR) of the promoter, the translation efficiency of the fusion gene can be increased. As described above, the recombinant expression vector can contain various DNA segments depending on the purpose.

  The method for constructing the recombinant expression vector is not particularly limited, and the promoter, the At3g19990 gene, the transcriptional repression conversion polynucleotide, and other DNAs as necessary may be selected as appropriate base vectors. What is necessary is just to introduce a segment so that it may become a predetermined order. For example, an expression cassette may be constructed by linking the above At3g19990 gene and a promoter (such as a transcription terminator if necessary) and introduced into a vector. In the construction of the expression cassette, for example, the order of the DNA segments can be defined by setting the cleavage sites of each DNA segment as complementary protruding ends and reacting with a ligation enzyme. When the terminator is included in the expression cassette, the promoter, the above At3g19990 gene, and the terminator may be in order from the upstream. Further, the types of reagents for constructing the expression vector, that is, the types of restriction enzymes and ligation enzymes are not particularly limited, and commercially available ones may be appropriately selected and used.

  Further, the method for propagating the above expression vector (production method) is not particularly limited, and a conventionally known method can be used. In general, Escherichia coli may be used as a host and propagated in the E. coli. At this time, a preferred E. coli type may be selected according to the type of vector.

Transformation The expression vector described above is introduced into a target plant by a general transformation method. The method (transformation method) for introducing the expression vector into the plant cell is not particularly limited, and any conventionally known method suitable for the plant cell can be used. Specifically, for example, a method using Agrobacterium or a method of directly introducing into plant cells can be used. Examples of methods using Agrobacterium include Bechtold, E., Ellis, J. and Pelletier, G. (1993) In Planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis plants. CR Acad. Sci. Paris Sci. Vie, 316, 1194-1199. Or Zyprian E, Kado Cl, Agrobacterium-mediated plant transformation by novel mini-T vectors in conjunction with a high-copy vir region helper plasmid.Plant Molecular Biology, 1990, 15 (2), The method described in 245-256 can be used.

  As a method for directly introducing an expression vector into a plant cell, for example, a microinjection method, an electroporation method (electroporation method), a polyethylene glycol method, a particle gun method, a protoplast fusion method, a calcium phosphate method, or the like can be used.

  In addition, if a method of directly introducing DNA into a plant cell is adopted, a transcription unit necessary for expression of the target gene, such as a promoter or transcription terminator, and DNA containing the target gene is sufficient, and a vector Function is not essential. Furthermore, even if it is DNA which contains only the protein coding region of the gene of interest which does not have a transcription unit, it can be integrated into the transcription unit of the host to express the gene of interest.

  Examples of the plant cell into which the expression vector or the expression cassette containing the gene of interest without the expression vector is introduced include, for example, cells of each tissue in plant organs such as flowers, leaves, roots, callus, suspension culture, etc. A cell etc. can be mentioned. Here, the expression vector may be appropriately constructed according to the type of plant to be produced, but a general-purpose expression vector is constructed in advance and introduced into plant cells. Also good.

  There are no particular limitations on the plant to which the expression vector is to be introduced, in other words, the plant on which the oil / fat productivity (fat content / seed size and seed size) is increased. That is, by expressing the above-mentioned At3g19990, it is possible to expect an effect of increasing the oil productivity (oil content and seed size per seed) for all plants. Examples of the target plant include dicotyledonous plants and monocotyledonous plants, for example, plants belonging to the family Brassicaceae, Gramineae, Eggplant, Legume, Willow, etc. (see below), but are limited to these plants. Is not to be done.

Brassicaceae: Arabidopsis thaliana, cabbage (Brassica oleracea var. Capitata), rapeseed (Brassica rapa, Brassica napus), Chinese cabbage (Brassica rapa var. Pekinensis), Chingen rhinoceros (Brassica rapa var. Chinensis), turnip rapa), Nozawana (Brassica rapa var. hakabura), Mizuna (Brassica rapa var. lancinifolia), Komatsuna (Brassica rapa var. peruviridis), Pakchoi (Brassica rapa var. chinensis), Japanese radish (Raphanus sativus), Wasabi (Wasa p )Such.

Eggplant family: tobacco (Nicotiana tabacum), eggplant (Solanum melongena), potato (Solanum tuberosum), tomato (Lycopersicon lycopersicum), capsicum (Capsicum annuum), petunia (Petunia) and the like.

Legumes: Soybean (Glycine max), pea (Pisum sativum), broad bean (Vicia faba), wisteria (Wisteria floribunda), groundnut (Arachis. Hypogaea), Lotus corniculatus var. Japonicus, common bean (Phaseolus vulgaris) (Vigna angularis), Acacia, etc.

Asteraceae: Chrysanthemum morifolium, sunflower (Helianthus annuus), etc.
Palms: oil palm (Elaeis guineensis, Elaeis oleifera), coconut (Cocos nucifera), date palm (Phoenix dactylifera), wax palm (Copernicia)
Ursiaceae: Rhis succedanea, Cashew nutcrest (Anacardium occidentale), Urushi (Toxicodendron vernicifluum), mango (Mangifera indica), pistachio (Pistacia vera)

Cucurbitaceae: pumpkins (Cucurbita maxima, Cucurbita moschata, Cucurbita pepo), cucumbers (Cucumis sativus), callas (Trichosanthes cucumeroides), gourds (Lagenaria siceraria var. Gourda)

Rosaceae: Almond (Amygdalus communis), Rose (Rosa), Strawberry (Fragaria), Sakura (Prunus), Apple (Malus pumila var. Domestica), etc.
Dianthus: Carnation (Dianthus caryophyllus).
Willow: Poplar (Populus trichocarpa, Populus nigra, Populus tremula)
Gramineae: corn (Zea mays), rice (Oryza sativa), barley (Hordeum vulgare), wheat (Triticum aestivum), bamboo (Phyllostachys), sugar cane (Saccharum officinarum), napiergrass (Pennisetum pupureum), elian raven (Erian) ), Miscanthus virgatum, Sorghum switch glass (Panicum), etc.
Lily family: Tulip (Tulipa), Lily (Lilium), etc.

  Among these, it is preferable to target crops that can be used as raw materials for oil production such as rapeseed. This is because the cost reduction of plant-derived seed production can be realized.

  In addition, as described above, the At3g19990 gene that can be used in the present invention can be isolated from various plants and used, but increases fat production (fat content and seed size per seed). Depending on the type of plant to be used, it can be appropriately selected and used. That is, if the target plant to increase the production of fats and oils (fat content and seed size per seed) is a monocotyledonous plant, the one isolated from the monocotyledonous plant should be expressed as the At3g19990 gene. Is preferred.

  In the present invention, the At3g19990 gene derived from a dicotyledonous plant is introduced even if the target plant for increasing the fat productivity (oil content and seed size per seed) is a monocotyledonous plant. May be. That is, for example, the At3g19990 gene (SEQ ID NO: 1) derived from Arabidopsis thaliana may be introduced so as to be expressed not only in dicotyledonous plants but also in plants widely classified as monocotyledonous plants.

Other Steps and Other Methods After the transformation treatment described above, a selection step for selecting an appropriate transformant from among plant bodies can be performed by a conventionally known method. The selection method is not particularly limited. For example, the selection may be performed on the basis of drug resistance such as hygromycin resistance, and after growing the transformant, the plant itself, or any organ or tissue You may select the thing which measured weight and has increased significantly compared with the wild type.

  In addition, a progeny plant can be obtained from a transformed plant obtained by the transformation treatment according to a conventional method. Based on the fat productivity (oil content and seed size per seed) of a progeny plant that retains the trait introduced with the above At3g19990 gene or the trait in which the expression control region of the underlying At3g19990 gene is modified By selecting as above, it is possible to produce a stable plant line having the above characteristics and having increased oil productivity (oil content and seed size per seed). It should be noted that plant cells, seeds, fruits, strains, callus, tubers, cuttings, clumps, and other propagation materials are obtained from the transformed plants and their progeny, and by having the above traits based on these, fat and oil productivity (seed It is also possible to mass-produce stable plant lines with increased fat content and seed size per grain).

  The plant body in the present invention includes at least one of a grown plant individual, a plant cell, a plant tissue, a callus, and a seed. That is, in this invention, if it is a state which can be made to grow finally to a plant individual, all will be considered as a plant body. The plant cells include various forms of plant cells. Such plant cells include, for example, suspension culture cells, protoplasts, leaf sections and the like. Plants can be obtained by growing and differentiating these plant cells. In addition, the reproduction | regeneration of the plant body from a plant cell can be performed using a conventionally well-known method according to the kind of plant cell.

  As described above, according to the present invention, by introducing the At3g19990 gene into the plant body, or by modifying the expression control region of the endogenous At3g19990 gene, compared with the wild-type plant body, oil productivity It is possible to provide a plant having significantly increased (oil content and seed size per seed grain). Here, a significant increase in the amount of oil means that the total weight of fats and oils produced per individual or the total weight of fats and oils contained in one seed grain is statistically significantly larger than that of the wild type. Means that In addition, that the seed size is significantly increased means that the surface area of one seed is statistically significantly larger than that of the wild type.

  According to the present invention, the oil and fat productivity of the plant body (oil content and seed size per seed) is increased. For example, when the oil and fat contained in the seed is intended for production, it is recovered per planted area. The amount of fats and oils that can be produced can be greatly improved. Here, the fats and oils are not particularly limited. For example, oils derived from plants such as soybean oil, sesame oil, olive oil, coconut oil, rice oil, cottonseed oil, sunflower oil, corn oil, benflower oil and rapeseed oil (triacylglycerol, medium Sexual fat). Moreover, the manufactured fats and oils can be widely used for household use and industrial use, and can also be used as a raw material for biodiesel fuel. That is, according to the present invention, by using the plant body into which the At3g19990 gene is introduced or the expression control region of the underlying At3g19990 gene is modified, the above-mentioned fats and oils for home use or industrial use, and biodiesel Fuel etc. can be manufactured at low cost.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, the technical scope of this invention is not limited to these Examples.

[Example 1]
Production of DGAT1p :: LUC-introduced plants Of the four TAG synthase genes DGAT1, DGAT2, PDAT1, and PDAT2-like predicted in Arabidopsis We searched for factors that activate transcription. A DGAT1p :: LUC-introduced plant was prepared in order to perform screening using bioluminescence that can be observed while alive. By using a DGAT1p :: LUC-introduced plant, it is possible to follow the behavior of the mRNA of the endogenous DGAT1 gene at the LUC luminescence level.

  First, the promoter region of the DGAT1 gene was PCR amplified using PrimeSTAR (manufactured by TAKARA Bio) using the Col-0 genome as a template so as to include +2076 upstream of the translation start point of the DGAT1 gene (At2g19450). For PCR amplification, TAG1p (Xba) attB1 (ggggACAAGTTTGTACAAAAAAGCAGGCTctagattaatattccacttactacttcc: SEQ ID NO: 3) and TAG1p-attab2 (ggggACCACTTTGTACAAGAAAGCTGGGTtcgccatttcgaaaagggttg: SEQ ID NO: 4) were used as primers.

  Entry clones were obtained using the amplified DNA fragment and Invitorogen's GATEWAY system. Reaction was performed with a binary vector pGWB435 (GenBank AB294498) (see Nakagawa, T. et al., (2007) Biosci. Biotechnol. Biochem. 71, 2095-2100) to prepare a DGAT1p :: LUC binary plasmid. DGAT11p :: LUC binary plasmid was introduced into Agrobacterium C58C1 strain by electroporation, and Arabidopsis thaliana Col-0 was transformed with DGAT11p :: LUC by the Floral dip method.

  Seeds taken from plants with DGAT1p :: LUC (T1: T-DNA insertion hetero) selected for resistance to the antibiotic kanamycin (Km), grown and T2 seeds (T-DNA insertion homo, hetero, none) Obtained). T2 seeds were germinated in Km medium, and several more individuals were grown from a line having an antibiotic resistance ratio of approximately 3: 1 to obtain T3 seeds. A line in which all T3 seeds showed Km resistance was used as a T-DNA insertion homoline, DGAT1p :: LUC-introduced plant. The result of measuring the fluorescence based on the LUC gene of the obtained DGAT1p :: LUC-introduced plant is shown in FIG.

Creation of activation tag lines for DGAT1p :: LUC-introduced plants
DGAT1p :: LUC-introduced plants were infected by the floral dip method using Agrobacterium (GV3101 (pMP90RK) strain) carrying the binary vector pPCVICEn4HPT (H. Hayashi et al., Science 258, 1350 (1992)). , The activation tag line of DGAT1p :: LUC-introduced plant was prepared. PPCVICEn4HPT contains a hygromycin (Hyg) resistance gene and 4 copies of an enhancer. As a result, a large number of activation tag lines (transformed plants) in which enhancer T-DNA was randomly inserted into the genome could be produced.

  Among these, candidate inserts having a high LUC activity were subjected to determination of enhancer insertion positions by inverse PCR. Among these mutants, one mutant has a high LUC luminescence level of the next generation, about 3 times higher. As a result of the mRNA analysis of the seedling, activation of the gene near the enhancer and not only DGAT1p :: LUC but also the endogenous DGAT1 The activation of was confirmed. In addition, in the mutant strains, there were seed-specific expressed genes near the enhancer that had been activated.

Production of DGAT1p :: LUC-introduced plants with 35Sp :: AOTA1
Cloning of the full-length cDNA The gene with unknown function (At3g19990), which is identified in the mutant strain and has a seed-specific expression, is referred to as AOTA1 gene (Activator of TAG Synthesis). A full-length cDNA fragment of the AOTA1 gene was amplified with Pyrobest (TAKARA Bio) enzyme using the total RNA of leaves and fruits of Arabidopsis Col-0 plants as a template. In the amplification reaction, AT3g19990-B1 (GGGGACAAGTTTGTACAAAAAAGCAGGCTAAATGGGTTCATCATCATCTCCATCC: SEQ ID NO: 5) and AT3g19990-B2 (GGGGACCACTTTGTACAAGAAAGCTGGGTAGCGCACGAGACCCAAGTT: SEQ ID NO: 6) were used as primers.

  An entry clone was obtained using the amplified DNA fragment, pDONR201 (Invitrogen) and BP Clonase II enzyme (Invitrogen).

Adjustment of 35Sp :: AOTA1 The above entry clone, pGWB502Ω (GATEWAY binary vector having 35S promoter and Ω sequence) and BP Clonase II enzyme (Invitrogen) were reacted to prepare a 35Sp :: AOTA1 binary plasmid.

Introduction to DGAT1 :: LUC introduction plant
A 35Sp :: AOTA1 binary plasmid was introduced into Agrobacterium (C58C1 strain) by electroporation, and a DGAT1p :: LUC-introduced plant was transformed by the Floral dip method.

Production of Overexpression Strains Seeds obtained from the plants after Agrobacterium infection were selected with 1% sucrose, MS, 0.3% Gerlite, and hygromycin 20 mg / L medium. Strains exhibiting drug resistance were grown under vermiculite, 6 cm pots and continuous light conditions to obtain seeds.

Evaluation of TGA amount Twenty Arabidopsis seeds obtained were crushed with a multi-bead shocker (Yasui Kikai Co., Ltd., 2000 rpm 30 seconds x2), dissolved in chloroform: methanol (2: 1) 200 μl, and collected in a 1.5 ml tube. Centrifugation was performed at 15.000 rpm for 5 minutes. 100 μl of the supernatant was collected in a new tube, and the solvent was evaporated using a vacuum pump. After dissolving the pellet in 20 μl ethanol, 80 μl of water was added and 4 μl was used for TAG quantification. Triacylglyceride (TAG) standard uses 1 mg / ml corn oil at 0, 1, 2, 3, 4, 5, 6 μl, and the sample is an enzyme solution of Qualient TG (Daiichi Kagaku) (1) 120 μl was added, reacted at 37 ° C. for 15 minutes, 40 μl of the enzyme solution (2) was dispensed, further reacted at 37 ° C. for 15 minutes, the absorbance at 600 nm was measured, and the amount of TAG per seed was calculated. The seeds derived from one strain were used in quadruplicate.

Measurement of seed volume The obtained Arabidopsis seeds are observed under a microscope, a digital image is obtained, and the image analysis application software Image J is used to convert the photograph of the seed into black and white, and from the shape of 100 seeds, The area was calculated.

Results The results of measuring the amount of TAG contained in the seeds are shown in FIGS. FIG. 2A shows the amount of TAG contained in 20 seeds collected from each individual for 10 AOTA1 overexpressing strains (# 1 to # 10) (N = 4). FIG. 2B shows the relative TGA content of 10 AOTA1-overexpressing strains when the average of the 2 control individuals is 100%.

  As can be seen from FIGS. 2A and 2B, in Arabidopsis thaliana introduced with the AOTA1 gene (At3g19990) under the control of 35S promoter expression, it is clear that the amount of TGA contained in the seed is significantly increased compared to the control. became.

  Moreover, the result of having measured the size of the seed was shown to FIG. FIG. 3A shows the average area of 100 seeds collected from each individual of 10 AOTA1 overexpressing strains (# 1 to # 10), where the average of the control is 100% (N = 4). FIG. 3B shows the average area of seeds collected from 10 AOTA1-overexpressing strains as a relative value when the average of the two control individuals is 100%.

  As can be seen from FIGS. 3A and B, in Arabidopsis thaliana in which the AOTA1 gene (At3g19990) was introduced under the control of the 35S promoter expression, the seed size was significantly increased compared to the control. .

  Based on the above results, by introducing the AOTA1 gene (At3g19990) or modifying the expression control region of the endogenous AOTA1 gene (At3g19990) to enhance the expression level of the AOTA1 gene (At3g19990), the oil and fat productivity of the plant It was revealed that (oil content and seed size per seed grain) can be significantly increased.

Claims (18)

  A plant body into which an At3g19990 gene or a gene functionally equivalent to the gene is introduced, or in which the expression control region of the gene is modified. The plant according to claim 1, wherein the gene encodes any one of the following proteins (a) to (c).
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) containing an amino acid sequence in which one or more amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2 and specific for seeds A protein that has a function involved in seed synthesis in seeds (c) a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1 Is a protein that has a function of being specifically expressed in seeds and involved in seed synthesis in seeds.   The functionally equivalent gene is a gene that is derived from an organism other than Arabidopsis thaliana, expresses specifically in seeds, and encodes a protein having a function involved in seed synthesis in seeds. The plant according to 1.   The plant according to any one of claims 1 to 3, wherein the plant is a dicotyledonous plant.   The plant body according to any one of claims 1 to 3, which is a cruciferous plant.   The plant according to any one of claims 1 to 3, which is Arabidopsis thaliana or rapeseed.   A method for increasing fat production by introducing an At3g19990 gene or a gene functionally equivalent to the gene, or altering an expression control region of the gene concerned. The method according to claim 7, wherein the gene encodes any one of the following proteins (a) to (c).
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) containing an amino acid sequence in which one or more amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2 and specific for seeds A protein that has a function involved in seed synthesis in seeds (c) a polynucleotide that hybridizes under stringent conditions to a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 1 Is a protein that has a function of being specifically expressed in seeds and involved in seed synthesis in seeds.   The functionally equivalent gene is a gene that is derived from an organism other than Arabidopsis thaliana, expresses specifically in seeds, and encodes a protein having a function involved in seed synthesis in seeds. 7. The method according to 7.   The method according to claim 7, wherein the method is a dicotyledonous plant.   10. The method according to any one of claims 7 to 9, which is a cruciferous plant.   The method according to any one of claims 7 to 9, which is Arabidopsis thaliana or rapeseed. A step of preparing a transformed plant in which an At3g19990 gene or a gene functionally equivalent to the gene is introduced, or in which an expression control region of the gene of interest is modified, and the fat productivity of a progeny plant of the transformed plant is measured. And a step of selecting a line in which the oil and fat productivity is significantly improved. The method according to claim 13, wherein the gene encodes any one of the following proteins (a) to (c).
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) containing an amino acid sequence in which one or more amino acids are deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2 and specific for seeds A protein that has a function of being involved in seed synthesis in seeds (c) and that hybridizes under stringent conditions to a polynucleotide comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 2 Is a protein that has a function of being specifically expressed in seeds and involved in seed synthesis in seeds.   The functionally equivalent gene is a gene that is derived from an organism other than Arabidopsis thaliana, expresses specifically in seeds, and encodes a protein having a function involved in seed synthesis in seeds. 13. The production method according to 13.   The production method according to claim 13, which is a dicotyledonous plant.   The method according to any one of claims 13 to 15, which is a cruciferous plant. The production method according to any one of claims 13 to 15, which is Arabidopsis thaliana or rapeseed.

Images