JP2011160673A - Method for producing hydrogen gas and microorganism therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing hydrogen gas, and to provide a microorganism usable therefor. <P>SOLUTION: The method for producing the hydrogen gas includes culturing the microorganisms producing ferredoxin/flavodoxin-dependent hydrogenase and ferredoxin/flavodoxin, and gene-manipulated so that the production of a protein having the enzymatic activities of pyruvic acid:flavodoxin/ferredoxin oxidation-reduction enzyme may be increased at least in one kind of a culture medium containing a carbohydrate capable of being absorbed by the microorganisms and a nitrogen source capable of being absorbed by the microorganisms. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a method for producing hydrogen gas and a microorganism used therefor.

Hydrogen gas (H ₂ ) is a promising next-generation energy medium for both mobile and stationary applications, especially because its environmental impact due to the conversion of H ₂ to energy is minimal. Worldwide market of the current H ₂ is estimated to worth to 160 billion US dollars. H ₂ is for mobile applications (e.g., automobile, aircraft) when it is employed on a large scale as a fuel, is expected to present the market is greater. H ₂ production and their use, for commercial maturity as petroleum substitutes in sufficient scale to affect the environment, problems of a large number of outstanding compared to petroleum substitute ethanol, further studies There is still a need for development. Production costs are a major issue as well as the cost effectiveness of travel distance compared to other alternative fuels. H ₂ can potentially be obtained from a wide variety of non-renewable and renewable resources. Plant-derived biomass is one of the potential renewable energy resources. Biomass through fermentation by microorganisms can be converted to H _2. However, the yield relative to the initial substrate (sugar) is very poor compared to ethanol. Since biomass production is a significant economic and environmental cost in biomass-derived fuel production (Hill et al., 2006), the yield of product per substrate is economically and environmentally sustainable H ₂ production Is an important variable factor that enables Therefore, improvement of H ₂ production by microorganisms is necessary for industrial production of H ₂ .

Numerous microorganisms have the ability to produce and consume H ₂ in a variety of ways in a variety of metabolic pathways. Most microorganisms that produce hydrogen have pyruvate-dependent H ₂ production capacity. Typically, it is done by two very different pathway types, depending on the protist or genus. Typically, in some species of Clostridium and protozoa (Wahl et al., 1987; Pieulle et al., 1997; Ma et al., 1999), obtained by oxidation of pyruvate The electrons are transferred to ferredoxin and then used to reduce ferredoxin-dependent hydrogenase.
(Genus Clostridium) pyruvate-> ferredoxin + acetyl CoA (PFOR), then ferredoxin-> H ₂ (hydrogenase HYDA)

In E. coli and other Enterobacter species, the major pyruvate-dependent H ₂ synthesis pathway is first catalyzed by pyruvate: hydrogen formate lyase (PFL), which is formate-dependent. Together with hydrogen lyase (FHL), it efficiently catalyzes the next electron transfer (Sawers et al., 2005).
(Enterobacter) pyruvate -> formic acid + acetyl CoA (PFL, pyruvate formate lyase), then formic acid _-> H 2 (FDH)

Formic acid extracellular also, for example, with methane production species in symbiotic relationship can be used directly in H ₂ production or interspecies electron transfer.

Pyruvate is a key intermediate in the metabolism of most if not all microorganisms. The source and fate of pyruvate depends on the metabolism of the species and its particular species under its prevailing conditions. In particular, the presence or absence of oxygen affects the fate of pyruvate in facultative anaerobes such as E. coli (Causey et al., 2004). In Escherichia coli K-12, pyruvate production under anaerobic fermentation conditions is limited by a process called “mixed fermentation” in which the role of NAD ⁺ -regeneration is dispersed in reducing excretion metabolites with various electron numbers. Is done. Thus, when grown on glucose, not only ethanol but also succinic acid and lactic acid are produced (Alam and Clark, 1989). However, the formation of the latter two compounds diminishes the formation of potential pyruvate because it branches off prior to pyruvate formation.

Only ethanol production is located downstream of the pyruvate branch point and formate-dependent H ₂ synthesis is redox neutral with respect to NAD ⁺ -regeneration. Thus, the presence or absence of an active PFL / FHL pathway will affect the formation of acetyl-CoA but not NAD ⁺ regeneration (Hasona et al., 2004). Alam and Clark (1989) show that deletion of the genes ldhA and frd effectively removed the two prepyruvic acid product branches, resulting in lactic acid (a reaction catalyzed by the protein encoded by ldhA) and succinic acid ( It was shown to remove the reaction catalyzed by the protein encoded by frdABCD. However, the amount of pyruvic acid, ethanol and formic acid excreted did not increase and acetic acid excretion increased instead. However, Causey et al. (2003, 2004), using the same method, also deleted the gene responsible for acetic acid formation under similar conditions and used the recombinant E. coli strain (these strains were aerobic in their process). Although further engineered to take place under conditions), it effectively enhanced pyruvic acid production. Thus, deletion of ldhA and frd has been established and is an important process necessary to increase the flow of glucose to pyruvate under anaerobic conditions in E. coli.

Yield and rate of synthesis of formic acid-dependent H ₂ production from glucose, increasing the pyruvate production, already the same deletion as being characterized, i.e., be enhanced by deletion of the gene frd and ldhA, in recent years, see (Yoshida et al., 2006).

The major problem in using existing strains for H ₂ production is that the most promising H ₂ producing microorganisms are (1) producing less than 33% (mole H ₂ per mole of hydrogen atoms in glucose), (2) not easily genetically treatment, or a gene not easy operation, and (3) expressing of H ₂ routes with fixed, limited substrate specificity. For example, to the best of our knowledge, E. coli K-12 is only capable of formic acid-dependent H ₂ synthesis, with a potential H ₂ production of only 16% (mole H ₂ per mole of hydrogen in glucose). Fully constrained. Moreover, as described in Sawers (2005) and Yoshida et al. (2007), induction of the PFL and FHL pathways in E. coli K-12 is subject to highly complex control targets depending on specific environmental conditions. It has become. Thus, by replacing the PFL / FHL pathway in E. coli with a pyruvate-dependent H ₂ synthesis pathway that is fully controlled by the user, such as that present in many Clostridium spp. Is expected to decrease and increase the overall process speed of biohydrogen production by E. coli.

US 2004/0152159 A

Alam et al., J Bacteriol. 1989 November; 171 (11): 6213-6217 Axley et al, 1990, J Biol Chem. 1990 Oct 25; 265 (30): 18213-8 Blaschkowski et al. (1982) Eur. J. Biochem. 123, 563-569 Causey et al., Proc Natl Acad Sci USA. February 4, 2003, vol. 100, no. 3, 825-832 Causey et al., Proc Natl Acad Sci USA. February 24, 2004 vol. 101 no. 8 2235-2240 Hasona et al., JOURNAL OF BACTERIOLOGY Vol. 186, No. 22, Nov. 2004, p. 7593-7600 Ma et al (1997) Ma et al., Proc Natl Acad Sci USA. 1997 Sep 2; 94 (18): 9608-13 Pieulle et al., JOURNAL OF BACTERIOLOGY, Oct. 1997, p. 5684-5692 Sawers, Biochemical Society Transactions (2005) Volume 33, part 1, 42-46 Wagner et al, 1992; Proc Natl Acad Sci U S A. 1992 Feb 1; 89 (3): 996-1000. Wahl et al., J Biol Chem. 1987 Aug 5; 262 (22): 10489-96 Yoshida et al. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2005, p. 6762-6768 Yoshida et al., Appl Microbiol Biotechnol (2006) 73: 67-72 Yoshida et al., Appl. Microbiol. Biotechnol. (2007) 74; 754-760 Akhtar, M. K., and Jones, P. R. (In Press) Engineering of a synthetic hydF-hydE-hydG-hydA operon for biohydrogen production, Anal Biochem. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection, Mol Syst Biol 2: 2006 0008. Datsenko, K. A., and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Proc Natl Acad Sci U S A 97: 6640-6645. Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

Accordingly, an object of the present invention is to provide a method for increased production of H ₂ by microorganisms. Another object of the present invention is to provide a microorganism having an increased production of H _2.

The present invention intensively studied, H ₂ produced by microorganisms to produce ferredoxin / flavodoxin dependent hydrogenase and ferredoxin / flavodoxin, pyruvate: introducing a foreign gene encoding a flavodoxin / ferredoxin oxidoreductase As a result, the present invention was completed.

  That is, the present invention is a step of culturing at least one microorganism in a culture medium containing an absorbable carbohydrate and an absorbable nitrogen source, thereby generating hydrogen gas, wherein the microorganism is ferredoxin / flavodoxin Producing a dependent hydrogenase and ferredoxin / flavodoxin, wherein the microorganism is genetically engineered to increase production of a protein having the enzymatic activity of pyruvate: flavodoxin / ferredoxin oxidoreductase, the microorganism being the carbohydrate in the culture medium A method of producing hydrogen gas, comprising: a step of absorbing hydrogen and simultaneously producing hydrogen gas; and a step of recovering the produced hydrogen gas.

  The present invention also provides a microorganism that produces ferredoxin / flavodoxin-dependent hydrogenase and ferredoxin / flavodoxin, wherein the microorganism is genetically engineered to increase production of proteins having the enzyme activity of pyruvate: flavodoxin / ferredoxin oxidoreductase. The microorganism provides a microorganism capable of absorbing hydrogen in the culture medium and simultaneously generating hydrogen gas.

The present invention, a novel method of H ₂ production by microorganisms to allow for increased production of H _2, and a novel microorganism used for the is provided. Since the method of the present invention enhances H ₂ production, the present invention contributes to the production of H ₂ , a promising next-generation energy medium in both mobile and stationary applications, with minimal environmental impact. Will do.

FIG. 1 shows the structure of the relevant portion of the pCDF-FEGAFdx vector used in the Examples, along with the metabolic pathway through which hydrogen is produced. FIG. 2 shows the control transformation of H ₂ production over time converted to H ₂ concentration (v / v%) in the upper space of the culture medium by the E. coli BL21 (DE3) transformant prepared in the example. Shown with H ₂ production by the body. FIG. 3 shows the amount of H ₂ produced by various microorganisms, including those lacking the iscR gene.

  It should be noted that in this specification and the appended claims, the singular forms “a” and “an”, and “the” include plural referents unless the context clearly dictates otherwise. is there. Thus, for example, “a microorganism” includes a plurality of such microorganisms. Also, “a nitrogen source” includes one or more nitrogen sources.

The present invention, ferredoxin / flavodoxin dependent hydrogenase and H ₂ produced by microorganisms to produce ferredoxin / flavodoxin, pyruvate: by increasing the production of proteins with flavodoxin / ferredoxin oxidoreductase enzyme activity, of increasing Based on knowledge.

Therefore, the microorganism used in the method of the present invention is characterized in that it is genetically engineered to increase production of a protein having the enzyme activity of pyruvate: flavodoxin / ferredoxin oxidoreductase. The protein preferably has an enzyme activity of pyruvate: ferredoxin oxidoreductase, defined by pyruvate oxidation concomitant with the reduction of ferredoxin or flavodoxin. The inventors have naturally produced ferredoxin / flavodoxin-dependent hydrogenase and ferredoxin / flavodoxin, which absorbs carbohydrates in the culture medium and at the same time produces hydrogen gas, such as H. of Escherichia coli. ₂ It has been found that production can be enhanced by increasing the production of pyruvate: flavodoxin / ferredoxin oxidoreductase (hereinafter also referred to as “YBDK” for short). “Increasing the production of a protein having the enzymatic activity of YBDK” means that the protein is produced before the microorganism performs genetic manipulation, and before the microorganism performs genetic manipulation, This includes cases where production increases after genetic manipulation.

  The genetic manipulation for increasing the production of the protein having the enzyme activity of YBDK may be any genetic manipulation for increasing the production of the protein. Preferably, the genetic manipulation is performed by introducing one or more copies of a recombinant vector containing a gene encoding the protein (foreign gene) into a cell and expressing the exogenous gene. Since the amino acid sequence of YBDK and the base sequence encoding YBDK are well known, such genetic manipulation can be easily performed by those skilled in the art.

  More specifically, the amino acid sequence of pyruvate: flavodoxin oxidoreductase of E. coli and the base sequence of the gene are shown in GenBank accession No. AAC74460. The amino acid sequence and base sequence are also shown in SEQ ID NO: 1 in the sequence listing. Clostridium acetobutylicum, Klebsiella pneumoniae, Thermotoga maritima, Desulfovibrio africanus pyruvate: Flavodoxine and ferredoxin oxidoreductase The base sequences are shown in Genbank accession numbers CAC2499 and CAC2229 (also C. acetobutylicum), X13109, X85171, and Y09702, respectively.

  It is preferred to introduce a gene encoding YBDK that is native to the species of the host microorganism. Therefore, for example, when the host microorganism is Escherichia coli, it is preferable to introduce a gene encoding YBDK of Escherichia coli, that is, a gene having the base sequence shown in SEQ ID NO: 1. However, it encodes a protein having the enzymatic activity of YBDK (such protein is hereinafter also referred to as “modified YBDK” for convenience), that is, it reduces either ferredoxin or flavodoxin and simultaneously catalyzes the oxidation of pyruvate Any gene encoding any protein that can be used may be used. Such a protein preferably has an amino acid sequence having 90% or more homology with the amino acid sequence of YBDK, more preferably 95% or more, and even more preferably 98% or more. The one with is good. Therefore, when the host microorganism is Escherichia coli, a gene encoding an amino acid sequence having a homology of 90% or more, preferably 95% or more, more preferably 98% or more to the amino acid sequence shown in SEQ ID NO: 2 was encoded. As long as the protein has the enzyme activity of YBDK, it can be preferably introduced into E. coli cells. Here, the term “homology” of amino acid sequences means that two amino acid sequences are aligned so that the number of matching amino acid residues is maximized (a gap is inserted if necessary). It means a value obtained by dividing the number by the number of amino acid residues of the full-length sequence (the longer amino acid residue when the total number of amino acid residues differs between the two sequences). Such homology calculations can be readily obtained by well-known software such as BLAST.

Whether the protein has pyruvate: flavodoxin oxidoreductase enzymatic activity is, for example, pyruvate: ferredoxin / flavodoxin oxidoreductase, pyruvate, CoA, MgCl ₂ , thiamine pyrophosphate, appropriate ferredoxin or flavodoxin, identical A hydrogenase with specificity for an electron acceptor / donor (ie, ferredoxin or flavodoxin) can be determined by an enzyme assay in a suitable buffer under fully anaerobic conditions. Through the space above the final reaction mixture are monitored for H ₂ production. Alternatively, with the exception of hydrogenase, the same reaction mixture as described above was used to determine the ratio of reduced electron acceptor / donor to oxidized electron acceptor / donor (as determined by each protein). The ability to reduce the reporter molecule metronidazole (absorbance 320 nm), or reduced oxidized methylviologen or oxidized benzylviologen in the absence of ferredoxin and flavodoxin (Absorbance 604 nm) may be monitored. More specific conditions for this enzyme assay can be, for example, as follows. (Each crude lysate of BL21 (DE3) with 1-5 μg of pCDOPFEGA (described below), a plasmid expressing the protein to be tested, a plasmid capable of expressing recombinant ferredoxin or flavodoxin, 100 mM Tris-HCl (pH 7.5) ), 20 mM pyruvate, 0.5 mM CoA, 0.5 mM Chiaminpiro phosphate, a reaction mixture containing 0.5 mM MgCl _2, serum bottle was sealed with a butyl rubber stopper, a fully anaerobic conditions, collected. the reaction, 37 ^o Incubate at C (150 rpm) for 1-4 hours and analyze the upper space for H _{2 as} described below.

  It is known that the 20 amino acids that make up a natural protein can be grouped into groups with the same properties. That is, for example, neutral amino acids having a low polarity side chain (glycine (Gly), isoleucine (Ile), valine (Val), leucine (Leu), alanine (Ala), methionine (Met), proline (Pro)) , Neutral amino acids having a hydrophilic side chain (asparagine (Asn), glutamine (Gln), threonine (Thr), serine (Ser), tyrosi (Tyr), cysteine (Cys)), acidic amino acids (aspartic acid (Asp) ), Glutamic acid (Glu)), basic amino acids (arginine (Arg), lysine (Lys), histidine (His)) and aromatic amino acids (phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp)). When replacing an amino acid with another amino acid, the properties of the protein often do not change much if the amino acid replaces an amino acid within the same group. Therefore, when introducing a gene encoding a modified YBDK into a microorganism, the modified YBDK preferably has one or more amino acid substitutions, each substitution made within the same group. .

  Since the base sequence of the ybdK gene is known, the source of the ybdKk gene is known and available, and expression vectors for introducing foreign genes into microorganisms are well known and commercially available. For convenience, a recombinant vector containing a gene encoding a modified YBDK can be easily carried out by those skilled in the art. More specifically, a recombinant vector can be constructed by preparing a ybdk gene and inserting the ybdk gene into the multicloning site of the expression vector. The ybdK gene can be isolated from the genome of a microorganism having the ybdK gene. If necessary, the ybdK gene can be amplified by PCR or the like using the genome of the microorganism having the ybdK gene as a template, and the amplified product can be inserted into an expression vector. In this case, since the base sequence of the ybdK gene is known, PCR primers can be easily prepared.

  The recombinant vector containing the constructed ybdK gene can be introduced into a microbial cell by a method well known in the art, such as the calcium chloride method. After selection using the selection marker of the expression vector, a microbial cell into which the recombinant vector has been introduced is obtained. From the transformants thus obtained, those that produce YBDK are selected and cloned. Thereafter, the cloned microbial cells are cultured and the amplified cells can be used in the method of the present invention.

The aforementioned genetic manipulation increases the production of YBDK or modified YBDK by the host microorganism, and then improves H ₂ production by the host microorganism.

  The microorganism used in the method of the present invention is also one that produces ferredoxin / flavodoxin-dependent hydrogenase and ferredoxin / flavodoxin. The term “ferredoxin / flavodoxin” means ferredoxin and / or flavodoxin. Thus, the term “ferredoxin / flavodoxin-dependent hydrogenase” means “ferredoxin-dependent hydrogenase and / or flavodoxin-dependent hydrogenase”.

  Ferredoxin and flavodoxin are well-known proteins that act as electron donors, and their amino acid sequences and the base sequences of genes encoding the proteins are known. For example, the amino acid sequence of Clostridium pasteurianum, Clostridium acetobutylicum, and E. coli ferredoxin and the nucleotide sequence of the gene encoding ferredoxin are Genbank accession numbers M11214, CAC0075, CAC3621, CAC0303, CAC0303, respectively. CAC3527 (all accession numbers prefixed by CAC are from Clostridium acetobutylicum), yfhL (NP — 417057), fdx (ECK2522). The amino acid sequence of Clostridium acetobutylicum and the flavodoxin amino acid sequence of Escherichia coli and the nucleotide sequence of the gene encoding flavodoxin are Genbank accession numbers CAC0203, CAC0587, CAC2452, CAC3417 (all accession numbers preceded by CAC are from Clostridium acetobutylicum. Yes), fldA (B0684), fldB (B2895) (all accession numbers preceding fld are from E. coli).

  Ferredoxin-dependent hydrogenases and flavodoxin-dependent hydrogenases are hydrogenases that receive electrons from ferredoxin and / or flavodoxin when acting as hydrogenases. Ferredoxin-dependent hydrogenases and flavodoxin-dependent hydrogenases are also well known. For example, the ferredoxin / flavodoxin-dependent amino acid-dependent hydroferdoxin-dependent amino acid and ferrododoxin-dependent amino acid sequences of Clostridium acetobutylicum, Clostridium pasturianum, Methanosarcina barkeri and Thermoanaerobacter tengcongensis The nucleotide sequences are shown in Genbank accession number U15277 (CAC3230), AAA23248, Y16191, and all genes between TTE0123 and TTE0134, respectively.

  Ferredoxin / flavodoxin may be either natural ferredoxin / flavodoxin or recombinant ferredoxin / flavodoxin. When using genetically engineered microorganisms that produce recombinant ferredoxin / flavodoxin, such microorganisms can be readily prepared by those skilled in the art by conventional genetic engineering techniques that are themselves well known in the art. it can. As described above, since the base sequence of ferredoxin / flavodoxin gene and microorganisms naturally containing the gene are known and many expression vectors for expressing foreign genes in microbial host cells are commercially available, recombinant ferredoxin / Flavodoxin can be produced by inserting ferredoxin / flavodoxin into an expression vector and introducing the resulting recombinant vector into a microbial host cell.

  The ferredoxin / flavodoxin-dependent hydrogenase may also be a natural ferredoxin / flavodoxin-dependent hydrogenase or a recombinant ferredoxin / flavodoxin-dependent hydrogenase. When using genetically engineered microorganisms that produce recombinant ferredoxin / flavodoxin-dependent hydrogenases, such microorganisms are readily prepared by one of ordinary skill in the art by conventional genetic engineering techniques that are well known in the art. can do. As described above, the base sequence of the ferredoxin / flavodoxin-dependent hydrogenase gene and the microorganism naturally containing the gene are well known, and many expression vectors for expressing foreign genes in microbial host cells are commercially available. Thus, recombinant ferredoxin / flavodoxin-dependent hydrogenase can be produced by inserting the ferredoxin / flavodoxin-dependent hydrogenase into an expression vector and introducing the resulting recombinant vector into a microbial host cell.

  With respect to ferredoxin / flavodoxin and ferredoxin / flavodoxin-dependent hydrogenase, similar to YBDK described above, genes encoding ferredoxin, flavodoxin, ferredoxin-dependent hydrogenase and modified proteins having flavodoxin-dependent hydrogenase activity can be used, respectively. Such modified proteins preferably have an amino acid sequence that has 90% or more, more preferably 95% or more, and even more preferably 98% or more homology to the amino acid sequence of the corresponding natural protein. The definition of the term “homology” is similar to that described above in the section describing modified YBDK. Similarly, the descriptions of amino acid groupings and amino acid substitutions described above in the section describing modified YBDK apply equally to modified proteins of ferredoxin / flavodoxin and ferredoxin / flavodoxin-dependent hydrogenases.

Whether a protein has the expected functionality of ferredoxin can be determined, for example, by a hydrogenase activity assay. In this assay, a reaction mixture containing purified ferredoxin-dependent hydrogenase, sodium dithionite, a test protein with the expected functionality of ferredoxin is reacted in an appropriate buffer under anaerobic conditions, and a closed reaction vessel The gas head space is monitored by gas chromatography for H ₂ production. However, the reduction of dithionite and ferredoxin-dependent hydrogenase shall be equivalent to or greater than the direct reduction of hydrogenase by dithionite. In the above assay, the presence or absence of ferredoxin in the final reaction mixture should result in a statistically significant difference in H ₂ accumulation. Whether a protein has flavodoxin functionality can be determined by the same method as ferredoxin, for example, except that a hydrogenase specific for flavodoxin is used.

More specific conditions for this hydrogenase activity assay are, for example, as follows. Recombinant histidine-tagged HydA is expressed as follows. An overnight starter culture is used to inoculate TB medium supplemented with antibiotics at 2% (v / v). BL21 (DE3) with pCDOPFEGHisA (described below) is batch cultured aerobically (37 ^° C., 190-200 rpm) until OD ₆₀₀ reaches 0.5-1. The cultured cells are transferred to loosely capped centrifuge tubes and closed-topped serum bottles, respectively. Removal of O ₂ for anaerobic expression was achieved by diffusing 99.9995% (v / v) N ₂ into the cell culture. Recombinant protein expression is initiated by the addition of IPTG (0.5 mM). Cell culture was performed at 30 ^° C / 190-200 rpm for 17-21 hours. Expression of HydA and its mature protein was stained with 10-14% (v / v) denatured SDS-PAGE (Tefco, Japan) with SYPRO® Orange (Invitrogen, Japan) according to the manufacturer's instructions. Later, protein bands were visualized and confirmed using a Fujifilm FLA-3000 scanner.

The histidine-tagged HydA is purified as follows. Anoxia, all preparations are performed in an anaerobic chamber (5% H ₂ (v / v), 5% CO ₂ (v / v), 90% (v / v) N ₂ ), or Maintained by using a closed serum bottle outside the chamber. The collected cells were lysed using an Easylyse kit (Epicentre). The resulting lysate was centrifuged (10,000 g, 7 min, 25 ^° C.) and the lysate obtained from 150-300 ml cultured cells was used for purification of the recombinant protein. For HydA purification, the crude solubilized fraction was added to a 1 ml minicolumn containing 0.2 ml Ni Sepharose ™ 6 Fast Flow (GE Healthcare, Japan). 0.5 ml wash buffer (0.7 cm x 2 cm) (20 mM imidazole, 50 mM potassium phosphate buffer (pH 7.5) was washed three times. The resin was centrifuged for a short time (3500 rpm, 10 seconds, 4 ^° C) and washed with buffer. HydA was eluted with 500 μL of elution buffer (0.4 M imidazole, 50 mM potassium phosphate buffer (pH 7.5). The amount of purified HydA was determined by denaturation 10% (v / v) SDS-PAGE analysis. The hydrogenase assay is performed as follows: N ₂ is diffused into a serum tube containing 50 mM potassium phosphate buffer and sealed with a butyl rubber septum HydA (0.1-2.8 μg purified histidine tag) ), Ferredoxin or flavodoxin (test protein) and methyl Orogen (final concentration 2 mM) was added to the gas diffused buffer and the solution previously equilibrated to 37 ° C. After the reaction was initiated by the addition of sodium dithionite (final concentration 25 mM), the gas composition in the vessel headspace Were analyzed as described below at each selected time point.

  Whether a protein has ferredoxin-dependent hydrogenase activity can be determined in the same manner as used to determine the functionality of ferredoxin, for example, except that the presence or absence of hydrogenase is also tested. . Whether or not a protein has the activity of a flavodoxin-dependent hydrogenase can be determined in the same manner as a ferredoxin-dependent hydrogenase except that, for example, a hydrogenase having specificity for flavodoxin is used.

  The genes encoding the ybdk gene and ferredoxin / flavodoxin and / or ferredoxin / flavodoxin-dependent hydrogenase may be included in the same recombinant vector, or they may be included in separate recombinant vectors and separated into host microorganisms. A recombinant vector may be co-transfected. In the latter case, the combination of genes to be contained in the same vector is not particularly limited as long as 3 or more genes are introduced into the host. Three or more vectors can also be used.

  Examples of microorganisms that can be used in the method of the present invention belong to a genus selected from the group consisting of Escherichia, Enterobacter, Saccharomyces, Thermotoga, Clostridium, and Corynebacterium. Things. Species belonging to one of these genera include Escherichia coli, Enterobacter cloacae, Saccharomyces cerevisiae, Thermotoga neapolitana, Clostridium thermocellum, Corynebacterium glutamine glutamicum).

In order to further improve H ₂ production, further genetic manipulations may be performed on the microorganism, such as deletion or disruption of one or more genes. Any microorganism that is subjected to further genetic manipulation is within the scope of the present invention so long as the genetic manipulation is performed on the microorganism to increase the production of YBDK.

For example, the present inventors, deletion of iscR genes were found to increase of H ₂ production by microorganisms of the present invention. Therefore, deletion of the above microbial iscR gene is preferred. The iscR gene is well known and its gene in E. coli is shown in Genbank accession number ECK2528 (SEQ ID NOs: 3 and 4). The construction of a deletion mutant of the iscR gene is performed by a conventional method such as the protocol described by Datsenko and Wanner (Datsenko, KA, and Wanner, BL (2000) One-step inactivation of chromosomal gene in Escherichia coli K-12. using PCR products, Proc Natl Acad Sci USA 97: 6640-6645.). Details of the construction of deletion mutants of the iscR gene are described in the examples below. Needless to say, the same effect as deletion of the iscR gene can be obtained by disrupting the iscR gene, for example by inserting a sequence or nonsense codon that prevents the functioning protein from being produced. Alternatively, the promoter region of iscR may be modified to suppress or reduce the expression of that gene. That is, it is preferable here to obtain a state in which the functional protein encoded by the iscR gene is not substantially produced. “Substantially not produced” means that no functional protein is produced or produced to a reduced extent so that H ₂ production is increased compared to when the microorganism has a normal iscR gene. Means that.

H ₂ production according to the present invention can be achieved by gene ldhA (eg SEQ ID NO: 5), any of the genes encoding structural members of the pyruvate: formate lyase complex of E. coli, eg pflB (eg SEQ ID NO: 7), and E. coli Any of the genes encoding structural members of the fumarate reductase complex of, eg, frdA (eg, SEQ ID NO: 9) or frdB (eg, SEQ ID NO: 11) may also be deleted or destroyed and further enhanced There is sex. The rationale is based on the fact that deletion of these genes has already been shown to increase pyruvate production in E. coli by a reduction reaction that converts pyruvate to other metabolites (Causey et al., 2004). ing. Also, the effect of deletion of ldhA and frdB on the fermentation balance of E. coli has already been shown by Alam et al. (Alam et al., 1989). Thus, such a reaction can compete for the same initial substrate as YDBK, namely pyruvate. By reducing pyruvate competition, more streams are expected to go through the YDBK-dependent H ₂ production pathway, allowing for a higher yield of H ₂ per starting substrate (sugar). Further iscR deletion may also increase H ₂ production rate and / or H ₂ production yield, as described above. Therefore, it is preferable to delete this gene as well. In the method for producing H ₂ of the present invention, the microbial cells thus prepared are cultured in a culture medium containing an absorbable carbohydrate and an absorbable nitrogen source. As an absorbable carbohydrate, glucose, maltose, fructose, xylose and glycerol are preferable, and glucose is most preferable. When the carbohydrate is glucose, the concentration of glucose in the culture medium is usually 0.1 w / v% to 2.0 w / v%, preferably 0.5 w / v% to 1.0 w / v%. It can be. As the nitrogen source, yeast extract is preferable, but the nitrogen source is not limited to this, and other nitrogen sources absorbed by microorganisms may be used. When using yeast extract, the concentration of yeast extract in the culture medium is usually 0.05 w / v% to 1.0 w / v%, preferably 0.1 w / v% to 0.3 w / v%. It can be. The culture medium further contains trace elements and vitamins that are commonly included in conventional culture media for each microorganism at concentrations conventionally used. The specific composition of a preferable culture medium used for E. coli culture will be described later in Examples.

The atmosphere in which the culture is performed preferably has an optimal oxygen concentration for H ₂ production. Usually, the atmosphere (air) has an oxygen concentration of 5% (v / v) or less, preferably 3.0 to 3.5% (v / v). Other culture conditions may be the same as those conventionally used. That is, in the case of Escherichia coli, the culture can usually be performed in a temperature range of 18 ^° C. to 47 ^° C., preferably about 30 ^° C. to 37 ^° C. In a batch process, i.e., where the microorganisms are not replaced with fresh cells, the culture can typically be continued for about 2 to 15 days. In a continuous process where all or some of the microbial cells are continuously or intermittently replaced with fresh cells during culture, the culture time is not limited and the culture can be performed continuously. Good. The cell population of the culture medium at the start of the culture is usually 100 to 10,000,000 cells, preferably 10,000 to 1,000,000 cells per ml of culture medium.

By culturing microorganisms, hydrogen gas is produced and released into the culture medium atmosphere. Alternatively, the release is assisted by methods well known to those skilled in the art, which include but do not exclude the mechanical operation of the culture and / or gas diffusion. Hydrogen gas accumulates in the upper space in the culture vessel. It may or may not be assisted by a negative pressure difference between the inside and outside of the fermenter produced by the pump. Carbon dioxide gas (CO ₂ gas) is also produced and accumulates in the upper space. The headspace hydrogen gas can be recovered by methods well known to those skilled in the art, for example, using a well-known hydrogen separation membrane, or through selective chemical bonding of CO ₂ . If necessary, hydrogen gas may be collected in the form of a mixture with one or more other types of gases, for example, a mixture of H ₂ gas and CO ₂ gas.

  The present invention will be described more specifically with reference to the examples. The examples are for illustrative purposes only and are not intended to be limiting in any limiting sense.

1. Construction of recombinant vector containing E. coli ydbk gene An E. coli pyruvate: flavodoxin oxidoreductase gene (SEQ ID NO: 1) was prepared as follows. The open reading frame of gene ydbK (accession # AAC74460) is transferred to pET46-Ek / LIC (Novagen, Merck KGaA, Darmstadt, Germany) from primers 5'-gacgacgacaagatgattactattgacggtaatggcgcgg and 5'-gaggagaagccctct Using DNAeasy kit (Qiagen Sciences, Maryland, USA) and Accuprime PFX Polymerase (Invitrogen, Carlsbad, Calif.), Clone using genomic DNA, DNA polymerase, and plasmid vector extracted according to the manufacturer's instructions for the DNA extraction kit. A recombinant vector pET46-ybdK was constructed. Since the reverse primer contains a stop codon, the pET46-ybdK vector was expected to produce a fusion protein encoding a histidine tag only at the N-terminus.

E. coli BL21 (DE3) cells and E. coli HMS174 (DE3) cells (Novagen) were transformed together with pET46-ybdk thus obtained and the recombinant plasmid vector pCDOPFEGAFdx. The pCDOPFEGAFdx vector contains genes necessary for the synthesis of Clostridium acetobutylicum HydA and Clostridium pasturianum [4Fe4S] -ferredoxin in a commercially available plasmid vector pCDF. More specifically, the pCDOPFEGAFdx vector comprises Clostridium acetobutylicum hydF (encoding hydrogenase maturation factor HydF, Genbank accession number NP_348277), Clostridium acetobutylicum HydE (encoding hydrogenase maturation factor HydE, Genbank accession number NP_348258), Clostridium Acetobutylicum hydG (encoding hydrogenase maturation factor HydG, Genbank accession number NP_347984), Clostridium acetobutylicum hydA (encoding hydrogenase HydA, Genbank accession number U15277) and Clostridium pasturium clofdx ([4Fe4S] -ferredoxin encoding The gene of Genbank accession number M11214) is included in this order from the upstream. The structure of the relevant part of the pCDF-FEGAFdx vector, shown in Figure 1 together with a metabolic _{pathway H 2} is produced. In FIG. 1, “G6P” represents glucose-6-phosphate, “GAP” represents glyceraldehyde-3-phosphate, and “PYR” represents pyruvic acid.

The pCDOPFEGAFdx vector was constructed as follows. The gene encoding CpFd (Crostridium pasturium [4Fe4S] ferredoxin (accession number M11214) is used as primers FEGAFdx-for (ATAGGATCCGA ATTTAAAT AAAATGGCATATAAAATCGCTGATTCATG) and FEGAFdx-rev ( TACGTATTATTCTCCT Plasmid pCDOPFEGAFdx was constructed by adding to pCDOPFEGA, pCDOPFEGA vector and pCDOPFEGHHisA vector were constructed as follows: HydE (Accession number CAC1631), HydF (Accession number CAC1651), HydG (Accession number CAC1356H) The gene encoding the accession number U15277) with or without an N-terminal codon encoding 6 histidines All PCR products generated for the cloning steps (c) to (e) (with the forward and reverse primers shown in square brackets) are internal to the StuI restriction enzyme. A site (AGGCCT) and a 6 base ribosome binding site sequence (AGGAGG) were included at the end of 3. The ribosome binding site overlaps the terminal base pair of the upstream gene stop codon (TAA) as TAAGGAGG, or It was either placed as TAATCAGGAGG 2 base pairs downstream from the stop codon.In addition, the PCR product according to steps (c) to (e) also contains the optional sequence AAAATAAA of 8 base pairs and contains ribosome binding Sufficient space was provided between the site and the first start codon of the inserted gene, each step shown in Figure 1; pCDFDuet-1 vector (Novagen, Carlsbad, USA) was digested with restriction enzymes NcoI (CCATGG) and EcoRV (GATATC, making blunt ends) and (b) ligated with NcoI digested hyFPCR product (5'-aatata ccATGG ATGAACTTAACTCAACACCCAAAGG -3 ′ and 5′-aggcctcctgaTTAGTTCCTACTCGATTGATTAAATATTCTATCAGC-3 ′) to generate plasmid pF. (C) The hyEPCR products (5'-atataat atttaaat aaaATGGATAATATAATAAAGTTAATTAATAAAGC-3 'and 5'-ta cctagg aggcctcctgaTTAACCAATAGATTCTTTGTAGC-3') were digested with SwaI (ATTTAAAT) and AvrII (CCTAGG) and restricted to StuI / AvrII Thus, plasmid pFE is prepared. Similarly, hydG (5'-atataatatttaaataaaATGTATAATGTTAAATCTAAAGTTGCAACTG-3 'and 5'-tacctaggaggcctcctgaTTAGAATCTAAAATCTCTTTGTCCC-3'TG and TT Plasmid and e) pFEGA plasmid were prepared respectively. At each stage, each new insert was confirmed by sequencing.

  Transformants producing YBDK, Clostridium acetobutylicum HydA and Clostridium pasteurium [4Fe4S] -ferredoxin were selected for antibiotic resistance to the antibiotics ampicillin and spectinomycin (50 μg / mL). The control transformant was also a plasmid pET having the same structure as pET46-ybdk except that the pyruvate: flavodoxin oxidoreductase gene and the pyruvate: ferredoxin oxidoreductase gene were not inserted instead of the plasmid pET46-ybdk. -Prepared in the same manner as described above using Duet.

2. H ₂ production cultures contained 1.5% glucose as the sole carbon source and were supplemented with MOPS minimal medium (Teknova, 50 mg / ml), carbenicillin (50 mg / ml) or spectinomycin (50 mg / ml). Hollister, CA) (5-10 ml). Precultures were seeded from fresh LB plates and grown at 30 ^° C. until OD600 was 0.1-0.5. Next, using a preculture, seeding was performed at an OD600 of about 0.02 and main culture (0.05 mM isopropyl-β-thiogalactopyranoside was added to the same medium) was performed. All cultures were grown for 24-48 hours, capped at 30 ^° C. with a butyl rubber septum, and seeded in 120 mL serum bottles with 99.9995% N ₂ diffused for more than 5 minutes after seeding. The gas samples were analyzed using a 6890N gas chromatography (Agilent Technologies, Palo Alto, Calif.) Fitted with a Carboxen ™ 1010 PLOT capillary column (30 m × 0.32 mm) (Supelco, Bellefonte, USA). A 200 μL gas sample was removed from the upper space of the serum bottle culture using a sample lock syringe (Hamilton, Reno, NV) and injected directly into the split / splitless sample inlet (room temperature, 5: 1 pret ratio). Samples were eluted at a uniform concentration (35 ^° C., 4-5 minutes). The carrier gas was N ₂ (17.6 mL / min), and the sample was detected using a thermal conductivity detector (230 ^° C., 2.0 mL / min). H ₂ eluted at ~ 3.3 minutes and H ₂ partial pressure (pH ₂ ) in the headspace were adjusted to 0.25% and 5% standard H ₂ gas samples (Kamimaru, Yokohama, Japan) and 100% H ₂ (GL Sciences, Tokyo, Japan) was quantified by comparison with a calibration curve created. In order to estimate the yield of H ₂ per glucose, the amount of residual glucose in the liquid medium also needs to be measured at a minimum of two sample points where H ₂ is quantified. The glucose concentration in the culture supernatant was measured using a D-glucose kit from Roche-Biopharm (Darmstadt, Germany) according to the manufacturer's instructions.

The results are shown in FIG. FIG. 2 shows the hydrogen production of E. coli BL21 (DE3) transformant over time converted to% H ₂ (v / v) concentration in the upper space of the culture medium. As can be clearly seen from FIG. 2, H ₂ production by the E. coli BL21 (DE3) transformant containing the exogenous pyruvate: flavodoxin oxidoreductase gene and the pyruvate: ferredoxin oxidoreductase gene is approximately less than that of the control transformant. 15 times more. Similar results were obtained when E. coli HMS174 (DE3) transformants were used. Thus, the method of the present invention, to increase of H ₂ production by microorganisms has been demonstrated.

1. Construction of iscR gene deletion mutant An iscR gene deletion mutant was constructed as follows. Deletion of the iscR gene in E. coli MG1655 was performed according to the method of Datsenko and Wanner (Datsenko and Wanner, 2000). FRT flanking the pKD13 kanamycin resistance cassette was amplified by PCR using primers iscR-for and iscR-rev. After treatment with DpnI and purification, it was transformed into MG1655WT with a deletion cassette pKD46. Kanamycin resistant clones were selected and their deletion was verified using primers iscRDWF (CACTCCGGCCTGATTCTGAATTCTTTTTATTAAGCGCGTAACTTAACGTCATTCCGGGGATCCGTCGACC) and iscRDWR (TACAATAAAAAACCCCGGGCAGGGGCGAGTTTGAGGTGAAGTAAGACATGTGTAGGCTGGAGCTGCTTCG). The obtained strain was designated as MG1655ΔydbK :: kan, BL21 (DE3) (Novagen, Merck KGaA, Darmstadt, Germany), and used as a donor strain that produces BL21 (DE3) ΔydbK by P1 transduction (Miller, JH (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). After P1 transduction, the kanamycin resistance gene was removed using pCP20 (Datsenko and Wanner, 2000) encoding yeast recombinase. Instead, the ΔiscR mutant of BL21 (DE3) was used as P1 transduction (MG1655 ΔiscR strain (University of Wisconsin, USA) and BL21 (DE3) (Novagen, Merck KGaA, Darmstadt, Germany) as donor and acceptor strains, respectively. Miller, 1972).

2. Of H ₂ production by the original microorganism containing H ₂ production thus prepared variants and iscR gene was investigated in the same manner as described above. The results are shown in FIG. As shown in FIG. 3, by deleting the iscR gene from the microorganism prepared in Example 1 of the present invention, H ₂ production was increased about 3-fold. Therefore, it has been proved that deletion of the iscR gene increases H ₂ production by the microorganism of the present invention.

As mentioned above, H ₂ production by the present invention, the gene ldhA (SEQ ID NO: 5), E. coli pyruvate: any gene encoding a structural member of the formic acid lyase complex, for example, pflB (SEQ ID NO: 7), and If one of the genes encoding the structural members of the fumarate reductase complex of E. coli, such as frdA (SEQ ID NO: 9) or frdB (SEQ ID NO: 11), is also deleted, it may be further increased. Evidence has already been shown that deletion of these genes increases pyruvate production in E. coli by reducing the reaction of converting pyruvate to other metabolites (Causey et al., 2004). Based on. The effect of ldhA and frdB deletion on the fermentation balance of E. coli has also been shown previously by Alam et al. (Alam et al., 1989). Thus, such a reaction can compete with YDBK for the same initial substrate, pyruvate. By reducing competition with YDBK pyruvate, more number of flows are expected to pass through the YDBK dependent H ₂ production route, per starting substrate (sugar), allowing more yield of hydrogen . Further deletion of iscR also, as indicated above, also may increase of H ₂ production rate and / or yield is. Therefore, it is also preferable to delete this gene.

Gene ldhA, pflB, frdAB, and experimental proof of the effect of the deletion of the pyruvate-dependent _{H 2} production iscR may be obtained as follows. First, the genes ldhA, pflB and frdAB are deleted in MG1655. This is because, as described previously ((Baba et al., 2006)) genes ldhA, pflB, and against FrdAB, respectively, primers ldhADWF ctcccctggaatgcaggggagcggcaagattaaaccagttcgttcgggcaattccggggatccgtcgacc, ldhADWR tatttttagtagcttaaatgtgattcaacatcactggagaaagtcttatgtgtaggctggagctgcttcg, pflBDWF ttttactgtacgatttcagtcaaatctaattacatagattgagtgaaggtattccggggatccgtcgacc, pflBDWR cgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttacatgtgtaggctggagctgcttcg, frdBDWF gtttacgtttagtcgtcatgttgcactccttagcgtggtttcagggtcgcattccggggatccgtcgacc, frdADWR accctgaagtacgtggctgtgggataaaaacaatctggaggaatgtcgtgtgtaggctggagctgcttcg, the Except for use, this is done as described above. The deletions are transferred one by one from the P1 transduction as described above to BL21 one by one, and after each successful introduction confirmed by PCR using the genomic DNA extracted as described above, before introducing the next deletion, kanamycin The resistance gene is removed as described above using pCP20. An iscR deficiency is constructed and introduced as described above. Eventually, this will produce the BL21 (DE3) ΔldhAΔpflBΔfrdABΔiscR strain. This strain is transformed with plasmids pCDOPFEGAFdx and pydbK by electroporation and examined for H ₂ production and glucose consumption as described above.

Claims (18)

Culturing at least one microorganism in a culture medium comprising an absorbable carbohydrate and an absorbable nitrogen source, thereby producing hydrogen gas, the microorganism comprising ferredoxin / flavodoxin-dependent hydrogenase and ferredoxin / Producing flavodoxin, the microorganism is genetically engineered to increase the production of protein with the enzyme activity of pyruvate: flavodoxin / ferredoxin oxidoreductase, and the microorganism absorbs the carbohydrate in the culture medium and simultaneously hydrogenates A process capable of generating a gas, and a process of recovering the generated hydrogen gas,
A method for producing hydrogen gas, including:   The method according to claim 1, wherein the protein has an amino acid sequence having 90% or more homology with the amino acid sequence of pyruvate: flavodoxin / ferredoxin oxidoreductase of the microorganism.   3. The method of claim 2, wherein the protein has the amino acid sequence of the microorganism pyruvate: flavodoxin / ferredoxin oxidoreductase.   The method according to any one of claims 1 to 3, wherein the genetic manipulation includes introducing an exogenous gene encoding the protein into the microorganism.   The method according to any one of claims 1 to 3, wherein the microorganism does not substantially produce a functional protein encoded by the iscR gene.   The microorganism is a genus selected from the group consisting of Escherichia, Enterobacter, Saccharomyces, Thermotoga, Clostridium, Corynebacterium The method according to claim 1, wherein the method is at least one belonging to.   The method according to claim 6, wherein the microorganism is Escherichia coli.   The method of claim 1, wherein the carbohydrate is glucose.   The method according to claim 1, wherein the culture is performed under an oxygen-free atmosphere.   A microorganism producing ferredoxin / flavodoxin-dependent hydrogenase and ferredoxin / flavodoxin, wherein the microorganism is genetically engineered to increase production of a protein having the enzyme activity of pyruvate: flavodoxin / ferredoxin oxidoreductase, Is a microorganism that can absorb hydrogen in the culture medium and generate hydrogen gas at the same time.   11. The microorganism according to claim 10, wherein the protein has pyruvate: ferredoxin oxidoreductase enzymatic activity, defined by reducing ferredoxin or flavodoxin and simultaneously oxidizing pyruvate.   The microorganism according to claim 11, wherein the protein has an amino acid sequence having 90% or more homology with the amino acid sequence of pyruvate: flavodoxin / ferredoxin oxidoreductase of the microorganism.   The microorganism according to claim 12, wherein the protein has an amino acid sequence of pyruvate: flavodoxin / ferredoxin oxidoreductase of the microorganism.   The microorganism according to any one of claims 10 to 13, wherein the increased production is obtained by introducing an exogenous gene encoding the protein into the microorganism.   The microorganism according to any one of claims 10 to 13, wherein the microorganism does not substantially produce a functional protein encoded by an iscR gene.   The microorganism according to claim 10, wherein the microorganism belongs to a genus selected from the group consisting of Escherichia coli, Enterobacter, Saccharomyces, Thermotoga, Clostridium, and Corynebacterium.   The microorganism according to claim 16, wherein the microorganism is Escherichia coli.   11. The microorganism according to claim 10, wherein the carbohydrate is glucose.

Images