JP2011125296A - Gene associated with arteriosclerotic disease, and use thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene associated with arteriosclerotic diseases and its use to utilize characteristic features of the gene. <P>SOLUTION: There are provided a method for examining the presence or absence of an arteriosclerotic disease risk factor by using polymorphism mutation found on two kinds of genes identified to be associated with arteriosclerotic diseases such as cerebral infarction as an index based on a large-scale case-control correlation investigation using atherothrombotic cerebral infarction as a target; a method for screening a therapeutic agent for arteriosclerotic diseases by using expression or function of the gene as an index; and a therapeutic and preventing agent for arteriosclerotic diseases to suppress the expression of the gene. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a method for examining the presence or absence of a risk predisposition to an arteriosclerosis-related disease using an ARHGEF10 gene or GABBR1 gene polymorphism as an index, and a method for screening a therapeutic agent for arteriosclerosis using the gene.

  Stroke is one of the common causes of death all over the world and is a major cause of dysfunction (Non-Patent Document 1). In particular, in countries where the elderly population is increasing, there is concern over a more rapid increase. Therefore, primary prevention of stroke is a serious problem, and the development of new preventive measures is urgently needed. Twin and family studies have shown that the risk of ischemic stroke depends on genetic and environmental factors (Non-Patent Document 2). Identification of susceptibility genes for ischemic stroke is expected to elucidate new pathophysiological mechanisms of this disease and lead to the development of new preventive measures. Although several susceptibility genes have been reported by conventional genome-wide correlation studies (Non-Patent Document 3), the general form of genetic elements in ischemic stroke remains largely unknown.

  Ischemic stroke is usually classified into several subtypes. From the viewpoint of pathophysiological mechanisms and preventive measures, ischemic stroke is classified into atherothrombotic cerebral infarction and cardiogenic cerebral infarction (Non-patent Documents 3, 4, and 5). Atherothrombotic cerebral infarction is mainly caused by atherosclerosis in arteries of various sizes, and the main preventive measure is to control cardiovascular risk factors such as hypertension, diabetes, hyperlipidemia, and smoking. is there. On the other hand, cardiogenic cerebral infarction is mainly caused by heart diseases such as atrial fibrillation and valvular heart disease, and the main preventive measure is the use of anticoagulants. Regarding the genetic characteristics of these two subtypes, Jerrard-Dunne et al. Show that the genetic elements of atherothrombotic cerebral infarction are stronger than those of cardiogenic cerebral infarction, and genetic studies It was suggested that focusing on thrombotic cerebral infarction can be more efficient (Non-patent Document 6).

  As for the GABBR1 gene, a review on GABA B receptors (Non-patent Documents 7 and 8) and a report on GABBR1 isoform e (Non-patent Document 9) are known.

Lopez AD, et al., `` Global and regional burden of disease and risk factors, 2001: systematic analysis of population health data. '', Lancet, 2006, Vol. 367, p.1747-1757. Flossmann E, et al., `` Systematic review of methods and results of studies of the genetic epidemiology of ischemic stroke. '', Stroke, 2004, Vol. 35, p.212-227. Ikram MA, et al., `` Genomewide Association Studies of Stroke. '', N Engl J Med, 2009, Vol. 360, p.1718-1728. Rosamond WD, et al., “Stroke incidence and survival among middle-aged adults: 9-year follow-up of the Atherosclerosis Risk in Communities (ARIC) cohort.”, Stroke, 1999, Vol. 30, p.736-743 . Sacco RL, et al., `` American Heart Association / American Stroke Association Council on Stroke; Council on Cardiovascular Radiology and Intervention; American Academy of Neurology. Guidelines for prevention of stroke in patients with ischemic stroke or transient ischemic attack: a statement for healthcare professionals from the American Heart Association / American Stroke Association Council on Stroke: co-sponsored by the Council on Cardiovascular Radiology and Intervention: the American Academy of Neurology affirms the value of this guideline. '', Circulation, 2006, Vol. 113, e409- e449. Jerrard-Dunne P, et al., `` Evaluating the genetic component of ischemic stroke subtypes: a family history study. '', Stroke, 2003, Vol. 34, p.1364-1369. Piers C. Emson et al., "GABA (B) receptors: structure and function.", Prog Brain Res., 2007, Vol. 160, p.43-57 BERNHARD BETTLER et al., `` Molecular Structure and Physiological Functions of GABAB Receptors '', Physiol Rev, 2004 Jul, Vol.84, p.835-867 David A. Schwarz et al., “Characterization of g-Aminobutyric Acid Receptor GABAB (1e), a GABAB (1) Splice Variant Encoding a Truncated Receptor”, Biol. Chem., 2000 October 13, Vol. 275, Issue 41, p. 32174-32181

  It is an object of the present invention to provide an arteriosclerosis-related gene and a use utilizing the characteristics of the gene. More specifically, the present invention relates to a method for examining whether or not there is a risk predisposition to arteriosclerotic disease using an arteriosclerosis-related gene and a polymorphism on the gene, and treatment or prevention of arteriosclerotic disease It is an object of the present invention to provide a screening method for drugs.

  We focused on atherothrombotic cerebral infarction and conducted a large-scale case-control correlation study in the Japanese population (Kubo M, et al., “A nonsynonymous SNP in PRKCH (protein kinase C eta) ”increases the risk of cerebral infarction.”, Nat Genet, 2007, Vol.36, p.233-239 .; Hata J, et al., “Functional SNP in an Sp1-binding site of AGTRL1 gene is associated with susceptibility to ischemic. ”Hum Mol Genet, 2007, Vol. 16, p. 630-639.), a gene encoding guanine nucleotide exchange factor 10 (ARHGEF10) on chromosome 8p23, a novel susceptibility gene for atherothrombotic cerebral infarction Successfully identified as And it discovered newly that the polymorphism on the ARHGEF10 gene was related to arteriosclerotic diseases such as cerebral infarction.

  We also found that the functional haplotype of this gene affects its transcriptional activity by altering Sp1 binding affinity. Furthermore, a low molecular weight GTPase activity assay showed that guanine nucleotide exchange factor 10 (GEF10), a gene product of ARHGEF10, specifically activates RhoA. Since the RhoA-Rho kinase pathway has an important role in the pathogenesis of cardiovascular disease and atherosclerosis, the ARHGEF10 haplotype may be involved in susceptibility to the development of ischemic stroke.

The inventors have also newly found that a polymorphism on the GABBR1 gene is associated with arteriosclerotic diseases such as cerebral infarction.
As described above, the present inventors succeeded in identifying two genes related to arteriosclerotic diseases such as cerebral infarction and polymorphisms related to arteriosclerotic diseases, and completed the present invention.

The present invention relates to a gene associated with an arteriosclerotic disease such as cerebral infarction, a method for examining the presence or absence of a risk predisposition to an arteriosclerotic disease using a polymorphism of the gene, and the treatment of an arteriosclerotic disease More specifically, the screening method for drugs of
[1] A method for testing whether or not there is a risk predisposition to arteriosclerotic disease, characterized by using the expression of ARHGEF10 gene in a subject as an index,
[2] A test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, characterized by detecting a DNA mutation in the ARHGEF10 gene;
[3] The testing method according to [2], wherein the mutation is a mutation that changes binding to an Sp1 transcription factor,
[4] A test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, comprising detecting a DNA mutation in the GABBR1 gene,
[5] The testing method according to any one of [2] to [4], wherein the mutation is a polymorphic mutation,
[6] A test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, comprising determining the base type of the polymorphic site in the GABBR1 gene,
[7] The polymorphic site is a site on the GABBR1 gene, and (1a) position 1, (2a) position 4572, (3a) position 7333, (4a) position 7599 in the nucleotide sequence set forth in SEQ ID NO: 1. (5a) 7775, (6a) 8114, (7a) 8479, (8a) 10188, (9a) 13327, (10a) 13371, or (11a) 15463. [6] the inspection method according to
[8] When the base type at the polymorphic site according to (1a) to (11a) of [7] is the following (1b) to (11b), respectively, the subject is at risk for arteriosclerotic disease. The inspection method according to [7], which is determined to have a predisposition,
(1b) a site on the GABBR1 gene, wherein the base species at position 1 of the base sequence set forth in SEQ ID NO: 1 is T
(2b) a site on the GABBR1 gene, wherein the base type at position 4572 of the base sequence set forth in SEQ ID NO: 1 is A
(3b) a site on the GABBR1 gene and the base type at position 7333 of the base sequence set forth in SEQ ID NO: 1 is G
(4b) a site on the GABBR1 gene, the base type at position 7599 of the base sequence set forth in SEQ ID NO: 1 is C
(5b) a site on GABBR1 gene, the base type at position 7775 of the base sequence set forth in SEQ ID NO: 1 is A
(6b) a site on the GABBR1 gene, the base type at position 8114 of the base sequence set forth in SEQ ID NO: 1 is G
(7b) A site on the GABBR1 gene, the base type at position 8479 of the base sequence set forth in SEQ ID NO: 1 is A
(8b) a site on the GABBR1 gene and the base type at position 10188 of the base sequence set forth in SEQ ID NO: 1 is G
(9b) A site on the GABBR1 gene, the base type at position 13327 of the base sequence set forth in SEQ ID NO: 1 is A
(10b) a site on the GABBR1 gene, wherein the nucleotide type at position 13371 of the nucleotide sequence set forth in SEQ ID NO: 1 is T
(11b) A site on the GABBR1 gene, the base type at position 15463 of the base sequence set forth in SEQ ID NO: 1 is C
[9] A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, wherein a DNA block indicating a haplotype according to any one of the following (A) to (C) is detected: A method that is determined to have a risk predisposition to atherosclerotic disease
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype [10] A method for examining whether or not a subject has a risk predisposition to arteriosclerotic disease, comprising the following (A) to (C A test method comprising a step of determining a base type of a polymorphic site that is present in a DNA block showing a haplotype according to any one of the above and linked to each other,
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype [11] Whether or not the subject has a risk predisposition to arteriosclerotic disease, including the following steps (a) and (b) Inspection method,
(A) Step (b) for determining the base type for the polymorphic site on the GABBR1 gene in the subject, the base type determined in (a) is described in any of the following (A) to (C) When the base type of the polymorphic site in the GABBR1 gene showing the haplotype is determined to have a risk predisposition to arteriosclerotic disease (A), the polymorphic site on the GABBR1 gene, The base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are A, A, G, A, A, and C, respectively. Is a polymorphic site on the haplotype (B) GABBR1 gene in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the nucleotide sequence set forth in SEQ ID NO: 1. Haplotype (C) GABBR1 inheritance whose base species are G, G, A, G, G, and G, respectively The above polymorphic sites, wherein the base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are G, G , G, G, A, and C haplotypes [12] The polymorphic site of (a) above is a site on the GABBR1 gene, which is position 1 in the base sequence described in SEQ ID NO: 1, position 4572, 7333, 7599, 7775, 8114, 8114, 10479, 10188, 13327, 13371, or 15463 polymorphic site of any of the polymorphic site, the inspection method according to [11],
[13] A test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, comprising determining the base type of the polymorphic site in the ARHGEF10 gene,
[14] The testing method according to [13], wherein the polymorphic site is a site on the ARHGEF10 gene, and is the polymorphic site at position (1a) 2225 in the base sequence described in SEQ ID NO: 2.
[15] When the base type at the polymorphic site described in (1a) of [14] is the following (1b), the subject is determined to have a risk predisposition to arteriosclerotic disease [ 14],
(1b) A site on the ARHGEF10 gene, the base species at position 2225 of the base sequence shown in SEQ ID NO: 2 is G
[16] A method for examining whether or not a subject has a risk predisposition to arteriosclerotic disease, and when a DNA block showing a haplotype described in (A) below is detected, the arteriosclerotic disease A method that is determined to have a risk predisposition of
(A) A haplotype [17] that is a polymorphic site on the ARHGEF10 gene, wherein the base types in the polymorphic sites at positions 2222 and 2225 of the nucleotide sequence set forth in SEQ ID NO: 2 are C and G, respectively. A method for examining whether or not the examiner has a risk predisposition to arteriosclerotic disease, wherein the polymorphic site is present in a DNA block showing a haplotype described in (A) below and linked to each other An inspection method including a step of determining a base type of
(A) A haplotype [18] which is a polymorphic site on the ARHGEF10 gene, and the base species at the polymorphic sites at positions 2222 and 2225 of the nucleotide sequence set forth in SEQ ID NO: 2 are C and G, respectively. A method for examining whether or not the subject has a risk predisposition to atherosclerotic disease, comprising the following steps (a) and (b):
(A) Steps (b) and (a) for determining the base type for the polymorphic site on the ARHGEF10 gene in the subject, the base type determined in the ARHGEF10 gene showing the haplotype described in (A) below (A) a polymorphic site on the ARHGEF10 gene that is determined to have a risk predisposition to arteriosclerotic disease when it is the same as the base type of the polymorphic site, and is described in SEQ ID NO: 2 Haplotypes wherein the base types in the polymorphic sites at positions 2222 and 2225 of the base sequence are C and G, respectively [19] The polymorphic site of (a) is a site on the ARHGEF10 gene, and SEQ ID NO: : The testing method according to [18], which is a polymorphic site at position 2222 or position 2225 in the base sequence described in 2.
[20] The inspection method according to any one of [1] to [19], wherein a biological sample derived from a subject is used as a test sample.
[21] A chain length of at least 15 nucleotides which hybridizes to the polymorphic site described in (1a) to (11a) of [7] or the DNA containing the polymorphic site described in (1a) of [14] A reagent for examining whether or not there is a risk predisposition to atherosclerotic disease, comprising an oligonucleotide having
[22] A solid probe to which a nucleotide probe that hybridizes with the polymorphic site described in (1a) to (11a) of [7] or the DNA containing the polymorphic site described in (1a) of [14] is fixed. A reagent for testing whether it has a risk predisposition to atherosclerotic disease,
[23] A primer oligonucleotide for amplifying a DNA containing the polymorphic site according to (1a) to (11a) of [7] or the polymorphic site according to (1a) of [14], A reagent for testing whether there is a risk predisposition to atherosclerotic disease,
[24] A reagent for testing whether to have a risk predisposition to arteriosclerotic disease, comprising the following (a) or (b) as an active ingredient:
(A) an oligonucleotide that hybridizes to the transcript of the ARHGEF10 gene (b) an antibody that recognizes a protein encoded by the ARHGEF10 gene [25] an arteriosclerosis containing the following (a) or (b) as an active ingredient Reagents for screening drugs for the treatment or prevention of diseases,
(A) an oligonucleotide that hybridizes to the transcript of the ARHGEF10 gene (b) an antibody that recognizes the protein encoded by the ARHGEF10 gene [26] a substance that suppresses the expression of the ARHGEF10 gene or the function of the protein encoded by the gene A drug for the treatment or prevention of arteriosclerotic diseases, comprising as an active ingredient,
[27] The agent for treating or preventing arteriosclerotic disease according to [26], wherein the ARHGEF10 gene expression inhibitor is a compound selected from the group consisting of the following (a) to (c):
(A) An antisense nucleic acid for the transcript of the ARHGEF10 gene or a part thereof (b) A nucleic acid having a ribozyme activity that specifically cleaves the transcript of the ARHGEF10 gene (c) It has an inhibitory action by the RNAi effect The agent for treating or preventing arteriosclerotic disease according to [26], wherein the function inhibitor of the protein encoded by the nucleic acid [28] ARHGEF10 gene is the following compound (a) or (b):
(A) An antibody that binds to a protein encoded by the ARHGEF10 gene (b) A low molecular compound that binds to a protein encoded by the ARHGEF10 gene [29] An artery containing the following (a) or (b) as an active ingredient Drugs for the treatment or prevention of sclerotic diseases,
(A) GABA B receptor ligand formed by GABBR1 deficient in exon 15 (b) RhoA inhibitor [30] Selecting a compound that decreases the expression level of the ARHGEF10 gene or the activity of the protein encoded by the gene A screening method for drugs for the treatment or prevention of arteriosclerotic diseases, characterized by
[31] A method for screening a drug for treatment or prevention of arteriosclerotic disease, comprising the following steps (a) to (c):
(A) a step of bringing a test compound into contact with a cell expressing the ARHGEF10 gene (b) a step of measuring the expression level of the ARHGEF10 gene (c) as compared with the case where the test compound is measured in the absence of the test compound, A step of selecting a compound that reduces the expression level [32] a method for screening a drug for the treatment or prevention of arteriosclerotic disease, comprising the following steps (a) to (c):
(A) a step of bringing a test compound into contact with a cell or cell extract containing DNA having a structure in which a transcriptional regulatory region of the ARHGEF10 gene and a reporter gene are functionally linked, and (b) measuring the expression level of the reporter gene (C) selecting a compound that reduces the expression level as compared to the case of measuring in the absence of the test compound;
Is to provide.

  In the present invention, data from a large case-control correlation study targeting atherothrombotic cerebral infarction was analyzed. A novel candidate locus rs2280887 located in intron 17 of ARHGEF10 was found. This SNP was significantly correlated with atherothrombotic cerebral infarction even after correction for multiple tests, and this correlation was reproduced in other case-control samples. Fine mapping of the ARHGFE10 gene showed that four highly related SNPs (rs2280887, rs35234164, rs4480162, and rs4376531) are candidates with functional significance. Functional analysis of these four SNPs showed that haplotypes including rs4480162 and rs4376531 could modify the binding affinity of Sp1 transcription factors and enhance ARHGEF10 transcriptional activity in sensitive haplotypes.

  It was also found that GEF10 specifically activates RhoA, which has an important role in various processes of atherosclerosis. These findings suggest that subjects with a sensitive haplotype of ARHGEF10 can express the transcript higher and have higher RhoA activity. Since the RhoA-Rho kinase pathway is associated with the pathogenesis of atherosclerosis, a functional haplotype of ARHGEF10 may lead to the development of atherothrombotic cerebral infarction. This finding was reinforced by a population-based cohort study.

  Guanine nucleotide exchange factor (GEF) activates low molecular weight GTPases in response to a variety of extracellular stimuli and ultimately regulates many cellular responses (Rossman KL, et al., Nature Rev Mol Cell Biol, 2005; 6: 167-180.). Low molecular weight GTPases identified as master regulators of the actin cytoskeleton control a wide variety of cellular functions including contraction, migration, proliferation, and apoptosis. Low molecular weight GTPases act as molecular switches that circulate between inactive and active GTP-bound forms (Loirand G, et al., Curr Opin Pharmacol, 2008; 2: 174-180.). Rho GEF mediates the activation of low molecular weight GTPases by promoting the release of GDP in exchange for GTP (Bos JL, et al., Cell, 2007; 129: 865-877.). ARHGEF10, a member of Rho GEF, was identified by sequencing cDNA clones derived from human brain (Nagase T, et al., DNA Res, 2000; 31: 347-355.) It was found to be expressed in various tissues (Yoshizawa M, et al., Gene Expr Patterns, 2003; 3: 375-381.). ARHGEF10 point mutation (T109I) has been reported to co-segregate in families with reduced motor and sensory nerve conduction velocities in peripheral nerves due to autosomal dominant inheritance (Verhoeven K, et al., Am J Hum Genet, 2003; 73: 926-932.). However, the function of ARHGEF10 is largely unknown.

  The present inventors have found that GEF10 can specifically activate RhoA and contribute to the development of atherothrombotic cerebral infarction through modulation of RhoA-Rho kinase activity. Recent association studies have shown that some Rho GEFs may be related to the pathogenesis of atherosclerosis. A type II diabetes linkage scan confirmed that non-synonymous SNPs of LARG and PDZ-Rho GEF correlated with insulin sensitivity or insulin resistance (Kovacs P, et al., Diabetes, 2006; 55: 1497- 1503., Fu M, et al., Diabetes, 2007; 56: 1454-1459.). Another association study found the kalirin gene as a candidate gene for early-onset coronary artery disease (Wang L, et al., Am J Hum Genet, 2007; 80: 650-663.). These results suggest that the Rho GEF polymorphism affects the low molecular weight GTPase signaling pathway, resulting in the pathogenesis of human atherosclerosis.

  RhoA (Etienne-Manneville S, Hall A. Nature, 2002; 420: 629-935.), The best-characterized low molecular weight GTPase, and one of its effectors, Rho-kinase It has been reported to play an important role in various processes of atherosclerosis including failure, inflammation, and proliferation of vascular smooth muscle cells (Loirand G, et al., Circ Res, 2006; 98: 322-334. , Ming XF, et al., Circulation, 2004; 110: 3708-3714., Stamatovic SM, et al., J. Cell Sci, 2003; 116: 4615-4628., Sauzeau V, et al., Circ Res, 2001; 88: 1102-1104., Rikitake Y, Liao JK. Circ Res, 2005; 97: 1232-1235.). From these circumstances, drugs that inhibit the RhoA-Rho kinase pathway, such as Rho kinase inhibitors (Loirand G, et al., Circ Res, 2006; 98: 322-334.) Or statins (Rikitake Y, Liao JK. Circ Res , 2005; 97: 1232-1235.) Is already useful in clinical settings. From the findings found by the present inventors, it can be expected that a RhoA-Rho kinase pathway inhibitor will be used for subjects having a sensitive haplotype of ARHGEF10 for more effective prevention of atherothrombotic cerebral infarction.

  In conclusion, haplotypes containing rs4480162 and rs4376531 located in intron 17 of ARHGEF10 were significantly correlated with atherothrombotic cerebral infarction. Individuals with sensitive haplotypes may express GEF10 transcripts higher due to Sp1 binding and have higher RhoA-Rho kinase activity. This higher activity ultimately results in an increased prevalence of atherothrombotic cerebral infarction in the general population. Our findings may shed light on the elucidation of a novel etiology of atherosclerosis and the development of preventive therapy for ischemic stroke.

FIG. 7 shows exon-intron structure, results of case-control study, and linkage disequilibrium map in ARHGEF10. (I) All exon-intron structures of ARHGEF10. (II) Exon-intron structure around marker SNP rs2280887. (III) Results of case-control correlation study. P values converted to -log ₁₀ for the dominant model are plotted on the y-axis. FIG. 1B is a continuation of FIG. 1A. (IV) Linkage disequilibrium map between SNP-SNP pairs measured at D ′. Bright red represents an area where the pair D ′ is high, and white represents an area where the pair D ′ is low. (V) was measured by r ^2, linkage disequilibrium map between SNP-SNP pair. Black represents a region where the pair r ² is high, and white represents a region where the pair r ² is low. FIG. 2 is a photograph and figure showing that a functional haplotype alters the binding affinity of Sp1 and affects the transcriptional activity of ARHGEF10. (A) Gel shift assay using two SNPs of ARHGEF10 (right panel and left panel) and a 5 ′ end-labeled 50 bp probe around each allele of one haplotype (middle panel). The solid arrows indicate a shift band indicating tighter binding of nuclear factors to sensitive haplotypes (C-G) including rs4480162 and rs43765331 than to insensitive haplotypes (G-C). (B) Competition assay using unlabeled or non-self oligonucleotide. DNA-protein complexes (solid arrows) were more efficiently competed by unlabeled oligonucleotides with the C-G allele than with the G-C allele. (C) Competition assay using unlabeled Sp1-binding consensus oligonucleotide and supershift assay using anti-Sp1 antibody. A longer shift band could be observed more clearly (dotted arrow) by increasing the electrophoresis time. (D) Luciferase assay. The 50 bp fragment around each haplotype allele was inserted into the pGL3 promoter vector. Each sample was examined in triplicate and data presented as mean ± SD. * Indicates P <0.05 by Student's t-test. FIG. 2 is a diagram and a photograph showing that GEF10 specifically activates RhoA. (A) RhoA activity assay. As indicated above, plasmids were transfected into 293FT cells. Cell lysates were pulled down with GST-rotekin and subjected to immunoblotting with anti-Myc antibody. The entire cell lysate was analyzed by immunoblotting with anti-Myc and anti-FLAG antibodies to detect total RhoA and ARHGEF10, respectively. GTP-bound RhoA and total RhoA were quantified by band intensity using the Multi Gauge software of the LAS-3000 system (bottom). RhoA activity was calculated as the relative ratio of the strength of GTP-bound RhoA to the strength of total RhoA. The relative intensity in the control (transfected with empty vector) was expressed as 1 unit. (B) Rac1 activity assay. (C) Cdc42 activity assay. (B) and (C) were analyzed by pull-down assay using GST-PAK-1 instead of GST-rotekin as in panel (A). The experiment was repeated at least 3 times. FIG. 5 shows Kaplan-Meier estimates of prevalence of ischemic stroke due to functional haplotypes during the 14-year follow-up period of the Hisayama study. The upper part of FIG. 5 plots the lowest p-value logarithmically converted from the allele frequency, dominant or recessive model for each SNP near the GABBR1 gene on the y-axis and the position on the chromosome on the x-axis. Yes. The lower part shows linkage disequilibrium between SNPs measured by Δ using Haploview ver3.32. It is the photograph which confirmed the presence or absence of exon 15 by PCR method. The origin of cDNA is shown below. 1: human fetal brain, 2: human thoracic aortic vascular smooth muscle cell, 3: human coronary vascular smooth muscle cell, 4: human thoracic aortic vascular endothelial cell, 5: human coronary vascular endothelial cell, 6: human cerebral vascular endothelium cell It is a photograph which shows the detection in the protein level by Western Blotting method. It is a graph which shows the relative mRNA expression level with GAPDH of GABBR1, GABBR2, or α-actin in human thoracic aortic vascular smooth muscle cells and coronary vascular smooth muscle cells when the culture period is varied. It is a graph which shows the relative mRNA expression level with respect to GAPDH of GABBR1 and GABBR2 in a human coronary artery vascular smooth muscle cell at the time of changing a culture medium.

  The present inventors identified the ARHGEF10 gene and the GABBR1 gene as genes associated with arteriosclerotic diseases such as cerebral infarction, and further identified a polymorphic mutation (SNP) on the gene. Further, it has been found that the expression of the ARHGEF10 gene or the enhancement of the function of the protein encoded by the gene is deeply related to the onset of arteriosclerotic diseases. If the expression of the ARHGEF10 gene is increased (increased) in the subject, it can be determined that the subject has a risk predisposition to arteriosclerotic disease (a predisposition to suffer from arteriosclerotic disease). .

  In the present invention, “arteriosclerotic disease” usually refers to a disease caused by arteriosclerosis. Specifically, cerebral infarction (eg, lacunar infarction, including atherothrombotic infarction), myocardial infarction, arteriosclerosis (eg, including atherosclerosis), obstructive arteriosclerosis, aortic aneurysm, kidney An example of arterial stenosis can be given. The lacunar infarction is a disease caused by arteriole sclerosis. For example, cerebrovascular dementia (especially Binswanger's disease), asymptomatic cerebral infarction, micromyocardial infarction and the like are also arteriosclerotic diseases of the present invention. included.

  For the first time by the present inventors, it is possible to examine the presence or absence of a risk predisposition to arteriosclerotic disease by using polymorphic mutations in the ARHGEF10 gene or GABBR1 gene or expression of the ARHGEF10 gene as an index. It was found.

  The present invention first provides a method for examining whether or not the subject has a risk predisposition to arteriosclerotic disease, characterized by using the expression of the ARHGEF10 gene in a subject (biological sample derived from the subject) as an index. To do.

  Therefore, by using the expression of the ARHGEF10 gene or the activity (function) of the protein encoded by the gene as an index, it is possible to examine whether the subject has a risk predisposition to arteriosclerotic disease. .

  Information regarding the base sequence of the ARHGEF10 gene and the amino acid sequence of the protein encoded by the gene in the present invention can be obtained from a public database with reference to the gene name, for example.

  The base sequences of the GABBR1 gene and the ARHGEF10 gene in the present invention (these genes may be collectively referred to as “the gene of the present invention” in the present specification) are shown in SEQ ID NOs: 1 and 2, respectively. For the GABBR1 gene, the sequence listing lists the plus strand.

  In the present invention, the “subject” is usually a human, but the test method of the present invention is not necessarily limited to a method that uses only human subjects. When organisms other than humans (preferably vertebrates, more preferably mammals such as mice, rats, monkeys, dogs, cats, etc.) are examined, endogenous ARHGEF10 possessed by the organism to be examined A gene corresponding to a gene is examined using the expression level as an index. Therefore, “ARHGEF10 gene” in the present invention includes, for example, endogenous DNA (ARHGEF10 gene homologue, etc.) in other organisms corresponding to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2.

  Moreover, the endogenous DNA of other organisms corresponding to the DNA consisting of the base sequence described in SEQ ID NO: 2 generally has high homology with the DNA described in SEQ ID NO: 2. High homology means 50% or more, preferably 70% or more, more preferably 80% or more, more preferably 90% or more (for example, 95% or more, or 96%, 97%, 98% or 99% or more). ) Homology. This homology is determined by the mBLAST algorithm (Altschul et al. (1990) Proc. Natl. Acad. Sci. USA 87: 2264-8; Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-7 ) Can be determined. Further, when the DNA is isolated from the living body, it is considered to hybridize with the DNA of SEQ ID NO: 2 under stringent conditions. Here, as “stringent conditions”, for example, “2 × SSC, 0.1% SDS, 50 ° C.”, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.” More stringent conditions include “2 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 42 ° C.” and “0.2 × SSC, 0.1% SDS, 65 ° C.” Can do. Those skilled in the art can appropriately obtain an endogenous gene corresponding to the ARHGEF10 gene in other organisms based on the base sequence of the ARHGEF10 gene.

  The present invention also relates to an arteriosclerotic disease, wherein the subject is determined to have a risk predisposition to arteriosclerotic disease when the expression level of the ARHGEF10 gene in the subject is increased compared to the control. Provide a test method for the presence or absence of risk predisposition.

  In the above method, a biological sample derived from a subject is usually used as a test sample. Measurement of the expression level of the ARHGEF10 gene in the test sample can be appropriately performed by those skilled in the art using known techniques.

  The “expression” of the gene includes “transcription” from the gene or “translation” into a polypeptide.

  When measuring the expression level of a gene using the amount of translation product (protein) of the gene as an index, for example, a protein sample is prepared from a test sample, and the amount of ARHGEF10 contained in the protein sample is measured. Such methods include methods well known to those skilled in the art, such as enzyme-linked immunoassay (ELISA), double monoclonal antibody sandwich immunoassay, monoclonal polyclonal antibody sandwich assay, immunofluorescence, western blotting, dot blotting. Method, immunoprecipitation, protein chip analysis (protein nucleic acid enzyme Vol.47 No.5 (2002), protein nucleic acid enzyme Vol.47 No.8 (2002)), two-dimensional electrophoresis, SDS polyacrylamide electrophoresis Law, but not limited to.

  When measuring the gene expression level using the gene transcription product (mRNA) production amount as an index, for example, an RNA sample is prepared from a test sample, and the amount of RNA encoding ARHGEF10 contained in the RNA sample is determined. taking measurement. It is also possible to evaluate the expression level by preparing a cDNA sample from the test sample and measuring the amount of cDNA encoding ARHGEF10 contained in the cDNA sample. An RNA sample or cDNA sample from a test sample can be prepared from a biological sample derived from the subject by a method well known to those skilled in the art. Examples of such methods include methods well known to those skilled in the art, such as Northern blotting, RT-PCR, and DNA array.

  The “control” usually refers to the expression level of the ARHGEF10 gene in a biological sample derived from a healthy person. The expression of the ARHGEF10 gene in the present invention means both the expression of mRNA transcribed from the ARHGEF10 gene and the expression of the protein encoded by the ARHGEF10 gene.

  The present invention also provides a method for examining whether a subject has a risk predisposition to arteriosclerotic disease, which comprises detecting a polymorphic mutation in the ARHGEF10 or GABBR1 gene.

  In the present invention, “inspection of whether or not there is a risk predisposition to arteriosclerotic disease” includes examination of whether or not the subject has a non-risk predisposition to arteriosclerotic disease, or arteriosclerosis of the subject. Tests to determine if there is a high or low likelihood of having a sexually transmitted disease are included.

  In the method of the present invention, when a mutation is detected in the ARHGEF10 gene, the subject has a risk predisposition to arteriosclerotic disease, or has no non-risk predisposition to arteriosclerotic disease, or arteriosclerosis. It is determined to have a constitution that is susceptible to sexually transmitted diseases.

  On the other hand, when no mutation is detected in the ARHGEF10 gene, it is determined that the subject has a non-risk predisposition for arteriosclerotic disease or no risk predisposition for arteriosclerotic disease.

  In the method of the present invention, when a mutation is not detected in the GABBR1 gene (in the case of wild type), the subject has a risk predisposition for arteriosclerotic disease or a non-risk predisposition for arteriosclerotic disease. It is determined that the patient has no constitution or is susceptible to arteriosclerotic disease.

  On the other hand, if a mutation is detected in the GABBR1 gene (non-wild type), the subject is determined to have a non-risk predisposition for arteriosclerotic disease or no risk predisposition for arteriosclerosis Is done.

  Further, according to the method of the present invention, even a subject who does not suffer from arteriosclerotic disease can determine whether the possibility of suffering from arteriosclerotic disease is high or low.

  As used herein, “treatment” generally means obtaining pharmacological and / or physiological effects. The effect may be preventive in that the disease or symptom is completely or partially prevented, or may be therapeutic in that the symptom of the disease is completely or partially treated. “Treatment” as used herein includes all treatment of diseases in mammals, particularly humans. And furthermore, prevention of the onset of subjects who have a risk predisposition to the disease but have not yet been diagnosed, suppress the progression of the disease, reduce the disease, delay the onset, Included in this “treatment”.

  The test method of the present invention determines whether or not there is a risk predisposition to arteriosclerotic disease, and a patient who is determined to have a risk predisposition to arteriosclerotic disease selects an appropriate treatment before onset. It is thought that the onset of arteriosclerotic diseases can be prevented in advance.

  Specific examples of the DNA sequence of the ARHGEF10 or GABBR1 gene of the present invention include the nucleotide sequences set forth in SEQ ID NO: 2 and 1, respectively.

  The position of “mutation” in the test method of the present invention is usually present in the ORF of the ARHGEF10 or GABBR1 gene, or in a region that controls the expression of the gene (eg, promoter region, enhancer region, intron, etc.). However, it is not limited to these. In the ARHGEF10 gene, this “mutation” usually means a mutation that increases the expression level of the ARHGEF10 gene, improves the stability of mRNA, or increases the activity of the protein encoded by the ARHGEF10 gene. It is preferable that Examples of the type of mutation of the present invention include base addition, deletion, substitution, insertion mutation and the like.

  The present invention relates to a test method for determining whether or not a subject has a risk factor for arteriosclerotic disease, which comprises detecting a DNA mutation in the ARHGEF10 gene or GABBR1 gene in a subject. In the present invention, the terms “in the ARHGEF10 gene (on the ARHGEF10 gene)” or “in the GABBR1 gene (on the GABBR1 gene)” do not necessarily refer only to the sequences in these genes, but in the vicinity of these genes. It is understood to encompass sequences.

  The ARHGEF10 gene is preferably a “mutation” that changes the binding activity of the Sp1 transcription factor. As a preferable example of the mutation, rs4480162 (in the base sequence described in SEQ ID NO: 1, the base type of the polymorphic position at position 2222 is C or rs4376531 (base sequence described in SEQ ID NO: 1) shown in the Examples described later. In the above, G can be mentioned as the base type of the polymorphic site at position 2225.

  The present inventors succeeded in finding a polymorphic mutation significantly related to arteriosclerotic disease in the ARHGEF10 or GABBR1 gene in a subject. Therefore, it is possible to test whether or not there is a risk predisposition to arteriosclerotic disease by using the presence or absence of mutation at the polymorphic site on the ARHGEF10 or GABBR1 gene as an index (determining the base type). .

  In a preferred embodiment of the present invention, there is provided a method for examining whether or not there is a risk predisposition to arteriosclerotic disease, which comprises detecting a polymorphic mutation in the ARHGEF10 or GABBR1 gene of the present invention.

  A polymorphism is generally defined genetically as a change in a base in one gene that is present at a frequency of 1% or more in the population. Not limited to. Examples of the polymorphism in the present invention include a single nucleotide polymorphism and a polymorphism in which one to several tens of bases (sometimes several thousand bases) are deleted or inserted. Furthermore, the number of polymorphic sites is not limited to one, and may be a plurality of polymorphs.

  The present invention also provides a method for examining whether a subject has a risk predisposition to arteriosclerotic disease, characterized by determining the base type of the polymorphic site in the ARHGEF10 or GABBR1 gene of the present invention. provide.

  `` Polymorphic site '' in the method for examining whether or not there is a risk predisposition to arteriosclerotic disease of the present invention, particularly if it is a polymorphism present on the ARHGEF10 or GABBR1 gene of the present invention or its peripheral region, Not limited. Information on polymorphic sites found on GABBR1 is shown in Table 1-1 to Table 1-2, and information on polymorphic sites found on the ARHGEF10 gene is shown in Table 2, respectively. In the table, “+” in the “strand” column represents a plus strand, and “−” represents a minus strand. In the “polymorphism type” column, “SNP” represents a single nucleotide polymorphism mutation, and “in / del” represents an insertion / deletion mutation. In the table, “Allyl 1” is the risk type.

Table 1-2 is a continuation table of Table 1-1.

  That is, in a preferred embodiment of the present invention, the method comprises determining the base species for the polymorphic sites described in the above table.

  Polymorphic sites that can be used in the method for examining whether or not there is a risk predisposition to arteriosclerotic disease of the present invention include the ARHGEF10 or GABBR1 gene or a site on the peripheral region of the gene among the polymorphic sites. Preferably there is.

  For example, it is a site on the GABBR1 gene, and the 1st, 4572, 6889, 7196, 7221, 7250, 7250, 7266, 7333, 7599, 7599, 7775 positions in the base sequence described in SEQ ID NO: 1. , 8114, 8479, 8543, 10188, 11410, 11529, 11565, 11937, 13274, 13327, 13371, 13524, 13526, 14127, 15463, 17199, 17370 The polymorphic sites at position 1, 17945, 17975, 18044, 18047, 18691, 26058, 26600, 29365, or 30722 are preferred.

  Moreover, it is a site on the ARHGEF10 gene, and a polymorphic site at position 828, 2222, 2225, or 3171 in the base sequence described in SEQ ID NO: 2 is preferred.

  In the present specification, the polymorphic site is sometimes referred to as “polymorphic site of the present invention”.

  In addition, those skilled in the art can appropriately acquire information on the base type for the site based on the rs number and the like in the published dbSNP database. In addition, SNP IDs that have rs at the beginning are IDs that are uniquely determined by NCBI among the registered IDs in the dbSNP database. The dbSNP database is published on the website (http://www.ncbi.nlm.nih.gov/SNP/index.html), and the registration ID number described in the SNP ID is used on the website. By searching, detailed information on SNPs in the base sequence (for example, the position on the chromosome, the type of base at the polymorphic site, the sequence before and after, etc.) can be obtained.

  The person skilled in the art usually uses the registration ID number assigned to the polymorphism disclosed in the present specification, for example, the rs number in the dbSNP database to determine the actual genomic position of the polymorphic site of the present invention and the sequence before and after it. Can be easily known. Thus, even if it is impossible to know, the person skilled in the art can appropriately determine the actual genome corresponding to the polymorphic site from the information on the base sequence shown in SEQ ID NO: 1 or 2 and the polymorphic site. Knowing the top position is easy. For example, the position of the polymorphic site of the present invention on the genome can be known by making an inquiry with a publicly available genome database or the like. That is, even if a slight base sequence difference is observed between the base sequence described in the sequence listing and the actual base sequence on the genome, By performing a homology search or the like, it is possible to accurately know the actual genomic position of the polymorphic site of the present invention. Even when the position on the genome cannot be identified, it is easy to carry out the test method of the present invention based on the sequence listing and polymorphic site information described in this specification.

  Genomic DNA usually has double-stranded DNA structures complementary to each other. Therefore, in the present specification, even when a DNA sequence in one strand is shown for convenience, it is understood that a sequence complementary to the sequence (base) is also disclosed as a matter of course. For those skilled in the art, if one DNA sequence (base) is known, a sequence (base) complementary to the sequence (base) is obvious.

  In the test method for determining whether or not there is a risk predisposition to arteriosclerotic disease of the present invention, it is preferable to test the polymorphic site described below.

  In a further preferred aspect of the present invention, in the test method for determining whether or not there is a risk predisposition to arteriosclerotic disease, a region between the polymorphic site (1a) and the polymorphic site (11a) below: (1a) position 1, (2a) position 4572, (3a) position 7333, (4a) in the base sequence set forth in SEQ ID NO: 1. Polymorphic sites at positions 7599, (5a) 7775, (6a) 8114, (7a) 8479, (8a) 10188, (9a) 13327, (10a) 13371, or (11a) 15463 Perform an inspection.

In a preferred embodiment of the present invention, when the base types at the polymorphic sites described in (1a) to (11a) are the following (1b) to (11b), the subject is atherosclerotic disease. It is determined to have a risk predisposition. Regardless of whether or not the subject is suffering from arteriosclerotic disease, it can be determined whether or not there is a risk predisposition to arteriosclerotic disease.
(1b) a site on the GABBR1 gene, wherein the base species at position 1 of the base sequence set forth in SEQ ID NO: 1 is T
(2b) a site on the GABBR1 gene, wherein the base type at position 4572 of the base sequence set forth in SEQ ID NO: 1 is A
(3b) a site on the GABBR1 gene and the base type at position 7333 of the base sequence set forth in SEQ ID NO: 1 is G
(4b) a site on the GABBR1 gene, the base type at position 7599 of the base sequence set forth in SEQ ID NO: 1 is C
(5b) a site on GABBR1 gene, the base type at position 7775 of the base sequence set forth in SEQ ID NO: 1 is A
(6b) a site on the GABBR1 gene, the base type at position 8114 of the base sequence set forth in SEQ ID NO: 1 is G
(7b) A site on the GABBR1 gene, the base type at position 8479 of the base sequence set forth in SEQ ID NO: 1 is A
(8b) a site on the GABBR1 gene and the base type at position 10188 of the base sequence set forth in SEQ ID NO: 1 is G
(9b) A site on the GABBR1 gene, the base type at position 13327 of the base sequence set forth in SEQ ID NO: 1 is A
(10b) a site on the GABBR1 gene, wherein the nucleotide type at position 13371 of the nucleotide sequence set forth in SEQ ID NO: 1 is T
(11b) A site on the GABBR1 gene, the base type at position 15463 of the base sequence set forth in SEQ ID NO: 1 is C

  In addition, said base type represents the base type in either the + strand or the-strand of the base sequence of the gene of the present invention. A person skilled in the art appropriately determines the type of base to be detected at the polymorphic site based on the information disclosed in this specification (particularly Table 1-1 to Table 1-2, Table 2, etc.). be able to.

  In another embodiment, in the method for testing whether or not there is a risk predisposition to arteriosclerotic disease, it is a site on the ARHGEF10 gene, and (1a) a large number of positions 2225 in the base sequence set forth in SEQ ID NO: 2. The mold site is examined.

In a preferred embodiment of the present invention, when the base type at the polymorphic site described in (1a) is (1b) below, the subject is determined to have a risk predisposition to arteriosclerotic disease. The Regardless of whether or not the subject is suffering from arteriosclerotic disease, it can be determined whether or not there is a risk predisposition to arteriosclerotic disease.
(1b) A site on the ARHGEF10 gene, the base species at position 2225 of the base sequence shown in SEQ ID NO: 2 is G

  In the method of the present invention, the polymorphic mutation described above may be detected for one genome (hetero), but is not particularly limited, but is preferably detected for both genomes (homo).

  For example, if the genotype at position 2225 in the base sequence set forth in SEQ ID NO: 2 is GG (homo) in the ARHGEF10 gene, the subject has a risk factor for arteriosclerotic disease Is suitably determined.

  In the present invention, even if it is other than the polymorphic site, the polymorphic site and the surrounding DNA region are considered to be strongly linked, and therefore exist on this strongly linked DNA block. It is also possible to carry out the test method of the present invention by detecting a polymorphic mutation.

  For example, with respect to the GABBR1 gene, this “neighboring polymorphism” is obtained for a small population of humans including patients with arteriosclerotic diseases in which the base type of the polymorphic site is the base type of (1b) to (11b) above. The base species in “site” (for example, the polymorphic sites described in Table 1-1 to Table 1-2 above) is determined in advance.

  As for the ARHGEF10 gene, for example, this “neighboring polymorphic site” for a small population of humans including patients with arteriosclerotic diseases in which the base type of the polymorphic site is the base type of (1b) above. The base species in (for example, the polymorphic site described in Table 2 above) is determined in advance.

  Next, a base type in the subject is determined for this “neighboring polymorphic site” and compared with the predetermined base type to test whether or not there is a risk predisposition to arteriosclerotic disease. be able to. When the base type is the same as the predetermined base type, the subject is determined to have a risk predisposition to arteriosclerotic disease. The test method of the present invention can determine whether or not the subject has a risk predisposition to arteriosclerotic disease, and can be used for determination of a treatment policy, determination of a drug dose, and the like.

  For example, for a small population of humans including those suffering from arteriosclerotic disease whose base type of the polymorphic site at position 7775 in the base sequence set forth in SEQ ID NO: 1 on the GABBR1 gene is A, The base type of the type site, for example, the polymorphic site at position 7599 is determined. If the base type of this site is C in a person suffering from the above-mentioned arteriosclerotic disease is higher than that in the person who does not develop the above-mentioned arteriosclerotic disease, the number of the subject is about 7599. When the base type of the type site is examined and the base type of this site is also C, the subject is determined to have a risk predisposition to arteriosclerotic disease.

  As described above, according to the present invention, the presence of a risk predisposition to the above-mentioned arteriosclerotic disease without imposing an excessive burden on a person skilled in the art by clarifying a region on a gene related to the arteriosclerotic disease. Inspection can be performed.

  In addition, the analysis of the human genome has progressed, and polymorphism information such as full nucleotide sequences, SNPs, microsatellite, VNTR, and RFLPs has been enhanced. As details of the nucleotide sequence of the genome are becoming clear, the greatest concern is to analyze the relationship between a gene or a specific sequence and a function (phenotype such as disease / disease progression). One of the promising methods for solving this is genetic statistical analysis using haplotypes.

  Human chromosomes exist in pairs, each from a father and mother. A haplotype refers to a combination of individual genotypes related to one of them, and indicates how loci are arranged on one chromosome derived from each parent. Since the chromosomes are inherited from the parents one by one, if recombination does not occur during gametogenesis, the genes on one chromosome are always transmitted to the child together, that is, linked. However, since recombination actually occurs during meiosis, even a gene on a single chromosome is not necessarily linked. Conversely, even when genetic recombination occurs, loci that are close to each other on the same chromosome are strongly linked.

When such a phenomenon is observed in a group and the independence of allyl is recognized, it is called linkage disequilibrium. For example, when observing a three loci, when there is no linkage disequilibrium between these haplotypes present is expected ways 2 ^3, each frequency is a value predicted from the frequency of each locus However, when there is linkage disequilibrium, there are fewer than 2 ³ haplotypes, and the frequency is also different from the predicted value.

  In recent years, it has been shown that haplotypes are useful for linkage disequilibrium analysis (Genetic Epidemiology 23: 221-233), but there are sites on the genome that are likely to recombine and those that are unlikely to occur. Yes, it has been clarified that the part (area specified by haplotype) transmitted from ancestors to descendants as one area is common across races (Science 226, 5576: 2225-2229). That is, there is a strongly linked DNA region, and this region is generally called a DNA block. In the present invention, it is also possible to test whether or not there is a risk predisposition to arteriosclerotic disease by detecting the presence or absence of a DNA block containing the polymorphic site of the present invention.

That is, in a preferred embodiment of the present invention, when the presence of a DNA block exhibiting the haplotype described in any of the following (A) to (C) is detected, it is determined to have a risk predisposition to arteriosclerotic disease. A method for testing whether or not the patient has a risk predisposition to arteriosclerotic disease is provided.
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype

In a preferred embodiment of the present invention, when the presence of a DNA block exhibiting the haplotype described in (A) below is detected, it is determined to have a risk predisposition to arteriosclerotic disease. A method for examining whether or not there is a risk predisposition to arteriosclerotic disease is provided.
(A) A haplotype that is a polymorphic site on the ARHGEF10 gene, and whose base types in the polymorphic sites at positions 2222 and 2225 of the nucleotide sequence set forth in SEQ ID NO: 2 are C and G, respectively.

  In the present invention, the DNA block refers to a site (region) showing strong linkage disequilibrium between each locus. If a DNA block associated with an arteriosclerotic disease is found, it is possible to test whether or not it has a risk predisposition to the arteriosclerotic disease by detecting the DNA block.

  If a haplotype (indicating DNA block) associated with an arteriosclerotic disease is found, the haplotype can be detected to determine whether or not it has a risk predisposition to the arteriosclerotic disease. The present inventors have succeeded in finding haplotypes associated with susceptibility to arteriosclerotic diseases through intensive studies.

  Therefore, the present invention has a risk predisposition to atherosclerotic disease, characterized by detecting a haplotype (a DNA block indicating) associated with atherosclerotic disease, which is present on the GABBR1 gene or ARHGEF10 gene. Provide inspection methods.

  In this method, it is possible to determine whether or not the subject has a risk predisposition to arteriosclerotic disease by detecting “a haplotype associated with arteriosclerotic disease”. These determinations can be used, for example, for determining a treatment policy.

Specific examples of the “haplotype (indicating DNA block) associated with arteriosclerotic disease present on the GABBR1 gene” include the following haplotype (indicating DNA block).
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype

The three haplotypes of the GABBR1 gene described in (A) to (C) above are shown in Tables 3-1 and 3-2.

Table 3-2 is a continuation table of Table 3-1.

  In each of the haplotypes described in Table 3-1 and Table 3-2 above, when the presence of a DNA block indicating a haplotype described as “Hap-1” is detected, the risk predisposition to arteriosclerotic disease is “high”. It is judged as a degree. When the presence of a DNA block indicating a haplotype described as “Hap-2” is detected, the risk predisposition to arteriosclerotic disease is determined to be “medium”. When the presence of a DNA block indicating a haplotype described as “Hap-3” is detected, the risk predisposition for arteriosclerotic disease is determined to be “low”.

Specific examples of the “haplotype (indicating DNA block) associated with arteriosclerotic disease present on the ARHGEF10 gene” include the following haplotypes (indicating DNA blocks).
(A) A haplotype that is a polymorphic site on the ARHGEF10 gene and whose base types at the 2222 and 2225 polymorphic sites of the base sequence shown in SEQ ID NO: 2 are C and G, respectively.

In a preferred embodiment of the above method of the present invention, the subject is a test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, and the haplotype according to any one of the following (A) to (C): Is a test method comprising a step of determining a base type of a polymorphic site characterized by being present in a DNA block indicating
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype

Further, in a preferred embodiment of the above method of the present invention, there is provided a method for examining whether or not a subject has a risk predisposition to arteriosclerotic disease, the DNA comprising a haplotype described in (A) below: It is an inspection method including a step of determining a base type of a polymorphic site characterized by being present in linkage with each other.
(A) A haplotype that is a polymorphic site on the ARHGEF10 gene and whose base types at the 2222 and 2225 polymorphic sites of the base sequence shown in SEQ ID NO: 2 are C and G, respectively.

  That is, even if it is a polymorphic site other than the site specifically described in this specification, it is a polymorphism contained on the DNA block and is linked to the polymorphic site of the present invention. Any part can be used in the inspection method of the present invention.

In a preferred embodiment of the above method, the test method comprises the following steps (a) and (b): whether or not the subject has a risk predisposition to arteriosclerotic disease.
(A) Step (b) for determining the base type for the polymorphic site on the GABBR1 gene in the subject, the base type determined in (a) is described in any of the following (A) to (C) When the base type of the polymorphic site in the GABBR1 gene showing the haplotype is determined to have a risk predisposition to arteriosclerotic disease (A), the polymorphic site on the GABBR1 gene, The base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are A, A, G, A, A, and C, respectively. Is a polymorphic site on the haplotype (B) GABBR1 gene in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the nucleotide sequence set forth in SEQ ID NO: 1. Haplotype (C) GABBR1 inheritance whose base species are G, G, A, G, G, and G, respectively The above polymorphic sites, wherein the base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are G, G Haplotypes that are G, G, A, and C

  Examples of the polymorphic site in the above step (a) include the polymorphic sites described in Tables 1-1 to 1-2. Preferably, the polymorphic site is a site on the GABBR1 gene. , Any one of polymorphisms at position 1, 4572, 7333, 7599, 7775, 8114, 8479, 10188, 13327, 13371, or 15463 in the nucleotide sequence set forth in SEQ ID NO: 1. A site can be indicated.

Moreover, in the preferable aspect of the said method, it is a test | inspection method of whether a subject has the risk predisposition of an arteriosclerotic disease including the following process (a) and (b).
(A) Step (b) for determining the base type for the polymorphic site on the ARHGEF10 gene in the subject, the base type determined in (a) is the ARHGEF10 gene indicating the haplotype described in (A) below. (A) a polymorphic site on the ARHGEF10 gene that is determined to have a risk predisposition to arteriosclerotic disease when it is the same as the base type of the polymorphic site, and is described in SEQ ID NO: 2 Haplotypes whose base types in the polymorphic sites at positions 2222 and 2225 are C and G, respectively.

  In addition, examples of the polymorphic site in the step (a) include the polymorphic sites described in Table 2 above. Preferably, the site is on the ARHGEF10 gene, and is represented by SEQ ID NO: 2. A polymorphic site at position 2225 in the described base sequence can be shown.

  A person skilled in the art can determine the base species in the polymorphic site of the present invention by various methods. For example, it can be performed by directly determining the base sequence of DNA containing the polymorphic site of the present invention.

  In general, the test sample used in the test method of the present invention is preferably a biological sample obtained in advance from a subject. Examples of the biological sample include a DNA sample. In the present invention, the DNA sample is based on, for example, a subject's blood, skin, oral mucosa, tissue or cells collected or excised by surgery, chromosomal DNA extracted from body fluid collected for the purpose of examination, or RNA. Can be prepared.

That is, the present invention is a method in which a biological sample derived from a subject (a biological sample obtained in advance from the subject) is usually used for the examination as a test sample.
A person skilled in the art can appropriately prepare a biological sample using a known technique. For example, a DNA sample can be prepared by PCR using a primer that hybridizes to DNA containing the polymorphic site of the present invention and chromosomal DNA or RNA as a template.

  In this method, the base sequence of the isolated DNA is then determined. Those skilled in the art can easily determine the base sequence of the isolated DNA using a DNA sequencer or the like.

  In the polymorphic site of the present invention, usually the variation of the base type of the site has already been clarified. “Determining the base type” in the present invention does not necessarily mean that the polymorphic site is a base type of A, G, T, or C. For example, if it is known that the variation of the base type is A or G for a certain polymorphic site, it is sufficient that the base type of the site is found to be “not A” or “not G”. .

  Various methods for determining the base type of a polymorphic site whose base variation has been clarified in advance are known. The method for determining the base species of the present invention is not particularly limited. For example, TaqMan PCR method, AcycloPrime method, MALDI-TOF / MS method and the like have been put to practical use as analysis methods applying the PCR method. Invader and RCA methods are known as methods for determining base types that do not depend on PCR. Furthermore, the base species can be determined using a DNA array. These methods are briefly described below. Any of the methods described herein can be applied to the determination of the base type of the polymorphic site in the present invention.

[TaqMan PCR method]
The principle of TaqMan PCR method is as follows. The TaqMan PCR method is an analysis method using a primer set that can amplify an allele-containing region and a TaqMan probe. The TaqMan probe is designed to hybridize to the allele-containing region amplified by this primer set.

  If the target base sequence is hybridized under conditions close to the Tm of the TaqMan probe, the hybridization efficiency of the TaqMan probe is significantly reduced due to the difference of one base. When PCR is performed in the presence of the TaqMan probe, the extension reaction from the primer eventually reaches the hybridized TaqMan probe. At this time, the TaqMan probe is degraded from its 5 ′ end by the 5′-3 ′ exonuclease activity of DNA polymerase. If the TaqMan probe is labeled with a reporter dye and a quencher, the degradation of the TaqMan probe can be followed as a change in fluorescence signal. In other words, when the TaqMan probe is decomposed, the reporter dye is released and the distance from the quencher is increased to generate a fluorescent signal. If the hybridization of the TaqMan probe decreases due to a difference in one base, the TaqMan probe does not decompose and a fluorescent signal is not generated.

  If a TaqMan probe corresponding to a polymorphism is designed and a different signal is generated by the decomposition of each probe, the base species can be determined at the same time. For example, as a reporter dye, 6-carboxy-fluorescein (FAM) is used for an allyl A TaqMan probe of an allyl and VIC is used for an allyl B probe. In a state where the probe is not decomposed, generation of a fluorescent signal of the reporter dye is suppressed by the quencher. If each probe hybridizes to the corresponding allele, a fluorescence signal corresponding to the hybridization is observed. That is, when either FAM or VIC signal is stronger than the other, it turns out that allyl A or allyl B is homozygous. On the other hand, when allyl is hetero, both signals are detected at almost the same level. By using the TaqMan PCR method, PCR and base type determination can be performed simultaneously on a genome as an analysis target without a time-consuming step such as separation on a gel. Therefore, the TaqMan PCR method is useful as a method that can determine the base species for many subjects.

[AcycloPrime method]
The AcycloPrime method has also been put into practical use as a method for determining the base species using the PCR method. In the AcycloPrime method, one set of primers for genome amplification and one set of primers for polymorphism detection are used. First, a region containing a polymorphic site in the genome is amplified by PCR. This process is the same as normal genomic PCR. Next, the obtained PCR product is annealed with a primer for detecting SNPs, and an extension reaction is performed. The primer for detecting SNPs is designed to anneal to a region adjacent to the polymorphic site to be detected.

  At this time, a nucleotide derivative (terminator) labeled with a fluorescent polarizing dye and blocked with 3′-OH is used as a nucleotide substrate for the extension reaction. As a result, only one base complementary to the base at the position corresponding to the polymorphic site is incorporated, and the extension reaction stops. Incorporation of a nucleotide derivative into a primer can be detected by an increase in fluorescence polarization (FP) due to an increase in molecular weight. If two types of labels having different wavelengths are used for the fluorescent polarizing dye, it is possible to specify which of the two types of bases the specific SNPs are. Since the level of fluorescence polarization can be quantified, it is also possible to determine whether allyl is homo or hetero in one analysis.

[MALDI-TOF / MS method]
The base species can also be determined by analyzing the PCR product with MALDI-TOF / MS. MALDI-TOF / MS can be used in various fields as an analytical method that can clearly identify slight differences in amino acid sequences of proteins and DNA base sequences because it can know the molecular weight with great accuracy. Yes. In order to determine the base species by MALDI-TOF / MS, first, the region containing allyl to be analyzed is amplified by PCR. The amplification product is then isolated and its molecular weight is measured by MALDI-TOF / MS. Since the base sequence of allyl is known in advance, the base sequence of the amplification product is uniquely determined based on the molecular weight.

  In order to determine the base species using MALDI-TOF / MS, a PCR product separation step is required. However, accurate base species determination can be expected without using labeled primers or labeled probes. It can also be applied to simultaneous detection of polymorphisms at multiple locations.

[SNPs-specific labeling method using type IIs restriction enzyme]
A method that can determine the base species at higher speed using the PCR method has also been reported. For example, the base type of a polymorphic site is determined using a type IIs restriction enzyme. In this method, a primer having a recognition sequence for type IIs restriction enzyme is used for PCR. A general restriction enzyme (type II) used for gene recombination recognizes a specific base sequence and cleaves a specific site in the base sequence. In contrast, type IIs restriction enzymes recognize specific base sequences and cleave sites away from the recognized base sequences. The number of bases between the recognition sequence and the cleavage site is determined by the enzyme. Therefore, if the primer containing the recognition sequence of the type IIs restriction enzyme is annealed at a position separated by the number of bases, the amplified product can be cleaved at the polymorphic site by the type IIs restriction enzyme.

  A cohesive end containing the base of SNPs is formed at the end of the amplification product cleaved with the type IIs restriction enzyme. Here, an adapter having a base sequence corresponding to the sticky end of the amplification product is ligated. The adapter has different base sequences including bases corresponding to polymorphic mutations, and can be labeled with different fluorescent dyes. Finally, the amplification product is labeled with a fluorescent dye corresponding to the base at the polymorphic site.

  When PCR is performed by combining a primer containing the IIs type restriction enzyme recognition sequence with a capture primer, the amplification product is fluorescently labeled and can be immobilized using the capture primer. For example, if a biotin-labeled primer is used as a capture primer, the amplification product can be captured on avidin-bound beads. By tracking the fluorescent dye of the amplification product thus captured, the base species can be determined.

[Determination of base species at polymorphic sites using magnetic fluorescent beads]
A technique capable of analyzing a plurality of alleles in parallel in a single reaction system is also known. Analyzing a plurality of alleles in parallel is called multiplexing. In general, a typing method using a fluorescent signal requires fluorescent components having different fluorescent wavelengths for multiplexing. However, there are not so many fluorescent components that can be used for actual analysis. On the other hand, when a plurality of types of fluorescent components are mixed in a resin or the like, a variety of fluorescent signals that can be distinguished from each other can be obtained even with limited types of fluorescent components. Furthermore, if a component that is magnetically adsorbed in the resin is added, it is possible to obtain beads that emit fluorescence and can be separated magnetically. Multiplex polymorphic typing using such magnetic fluorescent beads has been devised (Bioscience and Bioindustry, Vol. 60 No. 12, 821-824).

  In multiplexed polymorphic typing using magnetic fluorescent beads, a probe having a terminal complementary to the polymorphic site of each allele is immobilized on the magnetic fluorescent beads. Both are combined so that each allele corresponds to a magnetic fluorescent bead having a unique fluorescent signal. On the other hand, when the probe fixed to the magnetic fluorescent bead is hybridized to the complementary sequence, a fluorescently labeled oligo DNA having a base sequence complementary to the adjacent region on the allele is prepared.

  The allyl-containing region is amplified by asymmetric PCR, the above-described magnetic fluorescent bead-immobilized probe and a fluorescently labeled oligo DNA are hybridized, and both are further ligated. When the end of the magnetic fluorescent bead-immobilized probe has a base sequence complementary to the base of the polymorphic site, ligation is efficiently performed. On the other hand, if the terminal bases are different due to polymorphism, the ligation efficiency of the two decreases. As a result, the fluorescent labeled oligo DNA is bound to each magnetic fluorescent bead only when the sample is a base species complementary to the magnetic fluorescent bead.

  The base species is determined by collecting the magnetic fluorescent beads by magnetism and further detecting the presence of fluorescently labeled oligo DNA on each magnetic fluorescent bead. Since magnetic fluorescent beads can analyze the fluorescence signal for each bead using a flow cytometer, the signal can be easily separated even if various types of magnetic fluorescent beads are mixed. That is, “multiplexing” in which multiple types of polymorphic sites are analyzed in parallel in a single reaction vessel is achieved.

[Invader method]
A method for genotyping independent of the PCR method has also been put into practical use. For example, in the Invader method, determination of a base type is realized by only three kinds of oligonucleotides, an allele probe, an invader probe, and a FRET probe, and a special nuclease called cleavase. Of these probes, only the FRET probe requires labeling.

  The allele probe is designed to hybridize to a region adjacent to the allele to be detected. A flap consisting of a base sequence unrelated to hybridization is linked to the 5 ′ side of the allyl probe. The allyl probe has a structure that hybridizes to the 3 ′ side of the polymorphic site and is linked to a flap on the polymorphic site.

  On the other hand, the invader probe has a base sequence that hybridizes to the 5 ′ side of the polymorphic site. The base sequence of the invader probe is designed so that the 3 ′ end corresponds to the polymorphic site by hybridization. The base at the position corresponding to the polymorphic site in the invader probe may be arbitrary. That is, both base sequences are designed so that the invader probe and the allyl probe hybridize adjacently across the polymorphic site.

  If the polymorphic site is complementary to the base sequence of the allele probe, both the invader probe and the allele probe hybridize to allele, and the invader probe enters the base corresponding to the allele probe polymorphic site. An (invasion) structure is formed. The cleavase cleaves the invading strand of the oligonucleotide that has formed the invading structure thus formed. Since the cleavage occurs on the intrusion structure, the result is that the allyl probe flap is severed. On the other hand, if the base at the polymorphic site is not complementary to the base of the allyl probe, there is no competition between the invader probe and the allyl probe at the polymorphic site, and no invasion structure is formed. Therefore, the flap is not cut by cleavase.

  The FRET probe is a probe for detecting the flap thus separated. The FRET probe constitutes a hairpin loop having a self-complementary sequence on the 5 ′ end side and a single-stranded portion arranged on the 3 ′ end side. The single-stranded portion arranged on the 3 ′ end side of the FRET probe has a base sequence complementary to the flap, and the flap can hybridize there. Both base sequences are designed so that when the flap hybridizes to the FRET probe, a structure is formed in which the 3 ′ end of the flap enters the 5 ′ end of the self-complementary sequence of the FRET probe. A cleavase recognizes and cleaves an invasion structure. If the FRET probe is cleaved by a cleavase and labeled with a reporter dye and quencher similar to TaqMan PCR, the FRET probe cleavage can be detected as a change in fluorescence signal.

  Theoretically, the flap should hybridize to the FRET probe even in the uncut state. However, in reality, there is a large difference in the binding efficiency to FRET between the cleaved flap and the flap present in the form of an allyl probe. Therefore, it is possible to specifically detect the cleaved flap using the FRET probe.

  In order to determine the base species based on the Invader method, two types of allyl probes including base sequences complementary to allyl A and allyl B may be prepared. At this time, the base sequences of the flaps are different base sequences. If two types of FRET probes for detecting flaps are prepared and each reporter dye can be identified, the base species can be determined based on the same concept as the TacMan PCR method.

  The advantage of the Invader method is that the FRET probe is the only oligonucleotide that needs to be labeled. The FRET probe can use the same oligonucleotide regardless of the base sequence to be detected. Therefore, mass production is possible. On the other hand, since the allyl probe and the invader probe do not need to be labeled, a reagent for genotyping can be manufactured at low cost.

[RCA method]
The RCA method can be mentioned as a method for determining the base species independent of the PCR method. A method for amplifying DNA based on a reaction in which a DNA polymerase having a strand displacement action synthesizes a long complementary strand using a circular single-stranded DNA as a template is the Rolling Circle Amplification (RCA) method (Lizardri PM et al., Nature Genetics 19, 225, 1998). In the RCA method, an amplification reaction is configured using a primer that anneals to a circular DNA and initiates complementary strand synthesis and a second primer that anneals to a long complementary strand generated by this primer.

  In the RCA method, a DNA polymerase having a strand displacement action is used. Therefore, the portion that has become double-stranded by complementary strand synthesis is replaced by a complementary strand synthesis reaction started from another primer annealed to the 5 ′ side. For example, the complementary strand synthesis reaction using circular DNA as a template does not end in one round. The complementary strand synthesis continues while replacing the previously synthesized complementary strand, and a long single-stranded DNA is produced. On the other hand, the second primer anneals to the long single-stranded DNA generated using the circular DNA as a template, and complementary strand synthesis starts. Since single-stranded DNA generated by the RCA method uses circular DNA as a template, its base sequence is a repetition of the same base sequence. Thus, continuous production of long single strands results in continuous annealing of the second primer. As a result, single-stranded portions that can be annealed by the primer are continuously generated without going through a denaturing step. Thus, DNA amplification is achieved.

  If the circular single-stranded DNA necessary for the RCA method is generated according to the base type of the polymorphic site, the base type can be determined using the RCA method. For this purpose, a linear single-stranded padlock probe is used. The padlock probe has complementary base sequences on both sides of the polymorphic site to be detected at the 5 ′ end and 3 ′ end. These base sequences are linked at a portion consisting of a special base sequence called a backbone. If the polymorphic site is a base sequence complementary to the end of the padlock probe, the end of the padlock probe hybridized to the allele can be ligated by DNA ligase. As a result, the linear padlock probe is circularized and the reaction of the RCA method is triggered. The reaction of DNA ligase is significantly reduced in efficiency when the terminal portion to be ligated is not completely complementary. Therefore, the base type of the polymorphic site can be determined by confirming the presence or absence of ligation by the RCA method.

  The RCA method can amplify DNA but does not generate a signal as it is. Moreover, if only the presence or absence of amplification is used as an index, the base species cannot usually be determined unless the reaction is performed for each allele. Methods are known in which these points are improved for the determination of base species. For example, using a molecular beacon, the base type can be determined in one tube based on the RCA method. A molecular beacon is a signal generation probe using a fluorescent dye and a quencher, as in the TaqMan method. The molecular beacons are composed of complementary base sequences at the 5 ′ end and 3 ′ end, and form a hairpin structure alone. If both ends are labeled with a fluorescent dye and a quencher, a fluorescent signal cannot be detected in a state where a hairpin structure is formed. If a part of the molecular beacon is set as a base sequence complementary to the amplification product of the RCA method, the molecular beacon hybridizes to the amplification product of the RCA method. Since the hairpin structure is eliminated by hybridization, a fluorescent signal is generated.

  The advantage of the molecular beacon is that the base sequence of the molecular beacon can be made common regardless of the detection target by using the base sequence of the backbone portion of the padlock probe. If the base sequence of the backbone is changed for each allele and two types of molecular beacons having different fluorescence wavelengths are combined, the base type can be determined in one tube. Since the cost of synthesis of fluorescently labeled probes is high, the ability to use a common probe regardless of the measurement target is an economic advantage.

  All of these methods have been developed for genotyping a large amount of samples at high speed. With the exception of MALDI-TOF / MS, it is usually necessary to prepare a labeled probe or the like in any way for either method. On the other hand, a method for determining a base type that does not rely on a labeled probe has been performed for a long time. As one of such methods, for example, a method using restriction fragment length polymorphism (RFLP), a PCR-RFLP method and the like can be mentioned.

  RFLP utilizes the fact that a restriction enzyme recognition site mutation or a base insertion or deletion in a DNA fragment caused by restriction enzyme treatment can be detected as a change in the size of the fragment produced after the restriction enzyme treatment. If there is a restriction enzyme that recognizes the base sequence containing the polymorphism to be detected, the base of the polymorphic site can be known by the principle of RFLP.

  As a method that does not require a labeled probe, a method for detecting a difference in base using a change in the secondary structure of DNA as an index is also known. PCR-SSCP utilizes the fact that the secondary structure of single-stranded DNA reflects the difference in its nucleotide sequence (Cloning and polymerase chain reaction-single-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics 1992 Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991 Aug 1; 6 (8): 1313- 1318., Multiple fluorescence-based PCR-SSCP analysis with postlabeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). The PCR-SSCP method is performed by dissociating the PCR product into single-stranded DNA and separating it on a non-denaturing gel. Since the mobility on the gel varies depending on the secondary structure of the single-stranded DNA, if there is a difference in base at the polymorphic site, it can be detected as a difference in mobility.

  Other examples of methods that do not require a labeled probe include denaturant gradient gel electrophoresis (DGGE method). The DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel having a concentration gradient of a denaturing agent, and the DNA fragments are separated depending on the instability of each. When a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to its instability. The mobility of a partially dissociated DNA fragment becomes very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated portion.

  Specifically, first, a region containing a polymorphic site is amplified by PCR or the like. The amplification product is hybridized with a probe DNA whose base sequence is known to make a double strand. This is electrophoresed in a polyacrylamide gel that gradually increases as the concentration of denaturing agents such as urea moves, and is compared with a control. In a DNA fragment that has mismatched by hybridization with the probe DNA, the DNA fragment becomes single-stranded at a lower denaturant concentration position, and the moving speed becomes extremely slow. The presence or absence of mismatch can be detected by detecting the difference in mobility generated in this way.

  In addition, the DNA species can be used to determine the base species (Cell engineering separate volume “DNA microarray and the latest PCR method”, Shujunsha, published 2000.4 / 20, pp97-103 “SNP analysis using oligo DNA chip”, Sabae. Shinichi). In the DNA array, sample DNA (or RNA) is hybridized to a large number of probes arranged on the same plane, and the hybridization to each probe is detected by scanning the plane. Since responses to many probes can be observed simultaneously, for example, a DNA array is useful for analyzing a large number of polymorphic sites simultaneously.

  In general, a DNA array is composed of thousands of nucleotides printed on a substrate at high density. Usually, these DNAs are printed on the surface of a non-porous substrate. The surface layer of the substrate is generally glass, but a porous membrane such as a nitrocellulose membrane can also be used.

  In the present invention, examples of the nucleotide immobilization (array) method include an oligonucleotide-based array developed by Affymetrix. In an oligonucleotide array, oligonucleotides are usually synthesized in vitro. For example, in-situ synthesis methods of oligonucleotides using photolithographic technology (Affymetrix) and inkjet (Rosetta Inpharmatics) technology for immobilizing chemical substances are already known. Can be used.

  The oligonucleotide is composed of a base sequence complementary to a region containing the SNPs to be detected. The length of the nucleotide probe to be bound to the substrate is usually 10 to 100 bases, preferably 10 to 50 bases, more preferably 15 to 25 bases when the oligonucleotide is immobilized. Furthermore, in general, mismatch (MM) probes are used in the DNA array method in order to avoid errors due to cross hybridization (non-specific hybridization). The mismatch probe constitutes a pair with an oligonucleotide having a base sequence completely complementary to the target base sequence. An oligonucleotide consisting of a base sequence that is completely complementary to a mismatch probe is called a perfect match (PM) probe. In the process of data analysis, the influence of cross-hybridization can be reduced by eliminating the signal observed with the mismatch probe.

  A sample for genotyping by the DNA array method can be prepared by a method well known to those skilled in the art based on a biological sample collected from a subject. The biological sample is not particularly limited. For example, a DNA sample can be prepared from chromosomal DNA extracted from a subject's blood, tissue or cells such as peripheral blood leukocytes, skin, oral mucosa, tears, saliva, urine, feces or hair. A specific region of chromosomal DNA is amplified using a primer for amplifying a region containing a polymorphic site to be determined. At this time, a plurality of regions can be simultaneously amplified by the multiplex PCR method. The multiplex PCR method is a PCR method using a plurality of primer sets in the same reaction solution. When analyzing multiple polymorphic sites, the multiplex PCR method is useful.

  In general, in the DNA array method, a DNA sample is amplified by a PCR method and an amplification product is labeled. A labeled primer is used for labeling the amplification product. For example, genomic DNA is first amplified by PCR using a primer set specific to the region containing the polymorphic site. Next, biotin-labeled DNA is synthesized by a labeling PCR method using a biotin-labeled primer. The biotin-labeled DNA synthesized in this way is hybridized to the oligonucleotide probe on the chip. The hybridization reaction solution and reaction conditions can be appropriately adjusted according to conditions such as the length of the nucleotide probe immobilized on the substrate and the reaction temperature. One skilled in the art can design appropriate hybridization conditions. In order to detect the hybridized DNA, avidin labeled with a fluorescent dye is added. The array is analyzed with a scanner, and the presence or absence of hybridization is confirmed using fluorescence as an index.

  More specifically, after obtaining the DNA comprising the polymorphic site of the present invention prepared from the subject and the solid phase on which the nucleotide probe is immobilized, the DNA and the solid phase are then obtained. Make contact. Furthermore, the base type of the polymorphic site of the present invention is determined by detecting DNA hybridized to the nucleotide probe immobilized on the solid phase.

  In the present invention, “solid phase” means a material capable of fixing nucleotides. The solid phase of the present invention is not particularly limited as long as nucleotides can be immobilized. Specifically, solid phases including microplate wells, plastic beads, magnetic particles, substrates and the like may be exemplified. it can. As the “solid phase” of the present invention, a substrate generally used in DNA array technology can be preferably used. In the present invention, the “substrate” means a plate-like material capable of fixing nucleotides. In the present invention, the nucleotide includes oligonucleotides and polynucleotides.

  In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used to detect a base at a specific site. An allyl-specific oligonucleotide (ASO) is composed of a base sequence that hybridizes to a region where a polymorphic site to be detected is present. When ASO is hybridized to sample DNA, the hybridization efficiency decreases if a mismatch occurs at the polymorphic site due to the polymorphism. Mismatches can be detected by Southern blotting or a method that uses the property of quenching by intercalating a special fluorescent reagent into the hybrid gap. Mismatches can also be detected by the ribonuclease A mismatch cleavage method.

  Oligonucleotides that hybridize to DNA containing the polymorphic site of the present invention and have a chain length of at least 15 nucleotides are used as reagents (test agents) for testing whether they have a risk predisposition to atherosclerotic disease it can. This is used for a test using gene expression as an index or a test using gene polymorphism as an index.

  More specifically, a reagent for examining whether or not an oligonucleotide having a chain length of at least 15 nucleotides that hybridizes to DNA containing the polymorphic site of the present invention has a risk predisposition to arteriosclerotic disease It can be used as (test drug).

  The oligonucleotide specifically hybridizes to DNA containing the polymorphic site of the present invention. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If specific hybridization is possible, the oligonucleotide does not have to be completely complementary to the nucleotide sequence containing the polymorphic site of the present invention in the gene to be detected or the DNA region in the vicinity of the gene.

  As hybridization conditions in the present invention, for example, “2 × SSC, 0.1% SDS, 50 ° C.”, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.” More stringent conditions include “2 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 42 ° C.” and “0.2 × SSC, 0.1% SDS, 65 ° C.” Can do. More specifically, as a method using Rapid-hyb buffer (Amersham Life Science), prehybridization is performed at 68 ° C for 30 minutes or more, and then a probe is added and kept at 68 ° C for 1 hour or more for hybridization. Then wash 3 times for 20 minutes at room temperature in 2 x SSC, 0.1% SDS, then 3 times for 20 minutes at 37 ° C in 1 x SSC, 0.1% SDS, and finally 1 x SSC Washing can be performed twice in 0.1% SDS at 50 ° C for 20 minutes. In addition, for example, prehybridization in Expresshyb Hybridization Solution (CLONTECH) for 30 minutes or more at 55 ° C, add labeled probe, and incubate at 37-55 ° C for 1 hour or more, in 2 × SSC, 0.1% SDS In addition, washing for 20 minutes at room temperature can be performed three times, and washing for 20 minutes at 37 ° C. in 1 × SSC and 0.1% SDS can be performed once. Here, for example, by setting the temperature at the time of pre-hybridization, hybridization, or the second washing higher, the conditions can be made more stringent. For example, the prehybridization and hybridization temperatures can be 60 ° C., and the stringent conditions can be 68 ° C. Those skilled in the art can set conditions by considering other conditions such as probe concentration, probe length, probe base sequence configuration, reaction time, etc. in addition to such conditions as buffer salt concentration and temperature. can do.

  The oligonucleotide can be used as a probe or primer in the test method of the present invention. When the oligonucleotide is used as a primer, its length is usually 15 bp to 100 bp, preferably 17 bp to 30 bp. The primer is not particularly limited as long as it can amplify at least a part of the DNA containing the polymorphic site of the present invention.

  The present invention provides a primer for amplifying a region containing the polymorphic site of the present invention, and a probe that hybridizes to a DNA region containing the polymorphic site.

  In the present invention, the primer for amplifying a region containing a polymorphic site also includes a primer that can initiate complementary strand synthesis toward the polymorphic site using DNA containing the polymorphic site as a template. The primer can also be expressed as a primer for providing a replication origin on the 3 ′ side of the polymorphic site in DNA containing the polymorphic site. The interval between the region where the primer hybridizes and the polymorphic site is arbitrary. For the interval between the two, a suitable number of bases can be selected according to the analysis method of the base at the polymorphic site. For example, in the case of a primer for analysis using a DNA chip, the primer can be designed so that an amplification product having a length of 20 to 500, usually 50 to 200 bases can be obtained as a region containing a polymorphic site. A person skilled in the art can design a primer according to the analysis method based on the base sequence information about the surrounding DNA region including the polymorphic site. The base sequence constituting the primer of the present invention can be appropriately modified as well as a base sequence completely complementary to the genomic base sequence.

  In addition to the base sequence complementary to the genomic base sequence, an arbitrary base sequence can be added to the primer of the present invention. For example, in a primer for a polymorphism analysis method using a type IIs restriction enzyme, a primer to which a recognition sequence for a type IIs restriction enzyme is added is used. Such a primer with a modified base sequence is included in the primer of the present invention. Furthermore, the primer of the present invention can be modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin is used in various genotyping methods. Primers having these modifications are also included in the present invention.

  On the other hand, in the present invention, a probe that hybridizes to a region containing a polymorphic site refers to a probe that can hybridize to a polynucleotide having a base sequence of a region containing a polymorphic site. More specifically, a probe containing a polymorphic site in the base sequence of the probe is preferable as the probe of the present invention. Alternatively, depending on the base analysis method at the polymorphic site, the probe may be designed so that the end of the probe corresponds to a base adjacent to the polymorphic site. Therefore, although the polymorphic site is not included in the base sequence of the probe itself, a probe including a base sequence complementary to the region adjacent to the polymorphic site can also be shown as a desirable probe in the present invention.

  In other words, a probe capable of hybridizing to the polymorphic site of the present invention on genomic DNA or a site adjacent to the polymorphic site is preferred as the probe of the present invention. In the probe of the present invention, modification of the base sequence, addition of the base sequence, or modification is allowed in the same manner as the primer. For example, a probe used for the Invader method is added with a base sequence unrelated to the genome constituting the flap. Such a probe is also included in the probe of the present invention as long as it hybridizes to a region containing a polymorphic site. The base sequence constituting the probe of the present invention can be designed according to the analysis method based on the base sequence of the DNA region surrounding the polymorphic site of the present invention in the genome.

  The primer or probe of the present invention can be synthesized by any method based on the base sequence constituting it. The length of the base sequence complementary to the genomic DNA of the primer or probe of the present invention is usually 15 to 100, generally 15 to 50, usually 15 to 30. A technique for synthesizing an oligonucleotide having the base sequence based on the given base sequence is known. Furthermore, in the synthesis of the oligonucleotide, any modification can be introduced into the oligonucleotide using a nucleotide derivative modified with a fluorescent dye or biotin. Alternatively, a method of binding a fluorescent dye or the like to a synthesized oligonucleotide is also known.

  When the oligonucleotide of the present invention is used as a probe, it is appropriately labeled with a radioisotope or a non-radioactive compound. When used as a primer, for example, the 3 ′ end region of the oligonucleotide is complementary to the target sequence, and a restriction enzyme recognition sequence, tag, etc. are added to the 5 ′ end side. Can be designed to Such a polynucleotide comprising a base sequence containing at least 15 consecutive bases can hybridize to mRNA of ARHGEF10 or GABBR1 gene.

  Oligonucleotides of the present invention are non-natural bases such as 4-acetylcytidine, 5- (carboxyhydroxymethyl) uridine, 2′-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxyl. Methylaminomethyluridine, dihydrouridine, 2'-O-methyl pseudouridine, β-D-galactosyl cueosine, 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1- Methyl pseudouridine, 1-methyl guanosine, 1-methyl inosine, 2,2-dimethyl guanosine, 2-methyl adenosine, 2-methyl guanosine, 3-methyl cytidine, 5-methyl cytidine, N6-methyl adenosine, 7-methyl Guanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, β-D-mannosylqueosin, 5-metho Cycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-β-D-ribofuranosyl-2-methylliopurine-6- Yl) carbamoyl) threonine, N-((9-β-D-ribofuranosylpurin-6-yl) N-methylcarbamoyl) threonine, uridine-5-oxyacetic acid-methyl ester, uridine-5-oxyacetic acid, wybutoxocin , Pseudouridine, cueosin, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-β-D-ribofuranosylpurin-6-yl) carbamoyl ) Threonine, 2′-O-methyl-5-methyluridine, 2′-O-methyluridine, wybutosine, 3- (3-amino-3-carboxypropyl) uridine and the like may be contained as necessary.

  The present invention also provides a reagent (test agent) for use in a test method for the presence or absence of a risk predisposition to arteriosclerotic disease. The reagent of the present invention includes the primer and / or probe of the present invention. In testing whether or not there is a risk predisposition to arteriosclerotic disease, a primer and / or probe for amplifying DNA containing the polymorphic site of the present invention is used.

  Various reagents, enzyme substrates, buffers and the like can be combined with the reagent of the present invention according to the method for determining the base species. Examples of the enzyme include enzymes necessary for various analysis methods exemplified as the above-described base species determination method, such as DNA polymerase, DNA ligase, or IIs restriction enzyme. As the buffer solution, a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected. Furthermore, as the enzyme substrate, for example, a substrate for complementary strand synthesis is used.

  Furthermore, the reagent of the present invention can be accompanied by a control in which the base at the polymorphic site is clear. As a control, a genome or a genomic fragment in which the base type of the polymorphic site is known in advance can be used. The genome may be extracted from cells, or cells or cell fractions may be used. If a cell is used as a control, the result of the control can prove that the genomic DNA extraction operation was performed correctly. Alternatively, DNA comprising a base sequence containing a polymorphic site can be used as a control. Specifically, a YAC vector or a BAC vector containing a genome-derived DNA whose base species at the polymorphic site of the present invention has been clarified is useful as a control. Alternatively, a vector in which only several hundred bases corresponding to the polymorphic site are cut out and inserted can be used as a control.

Furthermore, another aspect of the reagent of the present invention is to examine whether or not it has a risk predisposition to arteriosclerotic disease comprising a solid phase to which a nucleotide probe that hybridizes with DNA containing the polymorphic site of the present invention is immobilized It is a reagent to do.
These are used for examinations using the polymorphic site of the present invention as an index. These preparation methods are as described above.

  In a preferred embodiment of the present invention, the present invention also relates to a test method for determining whether or not there is a risk predisposition to arteriosclerotic disease, comprising the step of detecting a transcription product or translation product of ARHGEF10 gene.

  Therefore, for example, an oligonucleotide that can be used as a probe when detecting the transcript of the ARHGEF10 gene in the test method, for example, an oligonucleotide that hybridizes to the transcript of the ARHGEF10 gene is an example of the test reagent of the present invention.

  In addition, an antibody that recognizes the ARHGEF10 protein (anti-ARHGEF10 protein antibody) that can be used when detecting the translation product of the ARHGEF10 gene in the test method is also a preferred specific example of the test reagent of the present invention.

  The oligonucleotide that hybridizes to the transcription product of the ARHGEF10 gene or the antibody that recognizes the ARHGEF10 protein (anti-ARHGEF10 protein antibody) can also be used as a reagent for screening drugs for the treatment or prevention of arteriosclerotic diseases.

  The present inventors have revealed that increased expression (increase) of the ARHGEF10 gene is associated with arteriosclerotic diseases. Therefore, a substance that suppresses the expression of the ARHGEF10 gene or the function (activity) of the protein encoded by the gene is considered to be a therapeutic or prophylactic agent for arteriosclerotic diseases.

  The present invention relates to a drug for the treatment or prevention of arteriosclerotic diseases, comprising as an active ingredient a substance that suppresses the expression of the ARHGEF10 gene or the function (activity) of a protein encoded by the gene (ARHGEF10 protein) I will provide a.

  In a preferred embodiment of the present invention, firstly, a therapeutic agent for arteriosclerotic disease (pharmaceutical / pharmaceutical composition for treating or preventing arteriosclerotic disease) comprising an ARHGEF10 gene expression inhibitor as an active ingredient is provided. .

In the present invention, the ARHGEF10 gene expression-suppressing substance includes, for example, a substance that suppresses ARHGEF10 transcription or translation from the transcription product. As a preferable aspect of the said expression inhibitory substance of this invention, the compound (nucleic acid) selected from the group which consists of the following (a)-(c) can be mentioned, for example.
(A) An antisense nucleic acid for the transcript of the ARHGEF10 gene or a part thereof (b) A nucleic acid having a ribozyme activity that specifically cleaves the transcript of the ARHGEF10 gene (c) An action of suppressing the expression of the ARHGEF10 gene by the RNAi effect Nucleic acid

  The “nucleic acid” in the present invention means RNA or DNA. Further, chemically synthesized nucleic acid analogs such as so-called PNA (peptide nucleic acid) are also included in the nucleic acid of the present invention. PNA is obtained by replacing the pentose / phosphate skeleton, which is the basic skeleton structure of nucleic acids, with a polyamide skeleton having glycine as a unit, and has a three-dimensional structure very similar to nucleic acids.

  As a method for suppressing the expression of a specific endogenous gene, a method using an antisense technique is well known to those skilled in the art. There are several factors as described below for the action of an antisense nucleic acid to suppress the expression of a target gene. Inhibition of transcription initiation by triplex formation, inhibition of transcription by hybridization with a site where an open loop structure was locally created by RNA polymerase, inhibition of transcription by hybridization with RNA undergoing synthesis, intron and exon Splicing inhibition by hybridization at splice point, splicing inhibition by hybridization with spliceosome formation site, inhibition of translocation from nucleus to cytoplasm by hybridization with mRNA, hybridization with capping site and poly (A) addition site Inhibition of splicing by RNA, inhibition of translation initiation by hybridization with a translation initiation factor binding site, translation inhibition by hybridization with a ribosome binding site near the initiation codon, peptide by hybridization with an mRNA translation region or polysome binding site Elongation inhibition, and the like inhibiting gene expression by hybrid formation with the site of interaction between nucleic acids and proteins. In this way, antisense nucleic acids inhibit the expression of target genes by inhibiting various processes such as transcription, splicing or translation (Hirashima and Inoue, Shinsei Kagaku Kenkyu 2 Lecture and Expression of Nucleic Acid IV Gene, Japan Biochemical) (Academic Society, Tokyo Chemical Doujin, 1993, 319-347).

  The antisense nucleic acid used in the present invention may suppress the expression of the ARHGEF10 gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the ARHGEF10 gene is designed, it is considered effective for inhibiting the translation of the gene. In addition, a sequence complementary to the coding region or the 3 ′ untranslated region can also be used. Thus, the nucleic acid containing the antisense sequence of the sequence of the untranslated region as well as the translated region of the ARHGEF10 gene is also included in the antisense nucleic acid used in the present invention. The antisense nucleic acid used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side. The nucleic acid thus prepared can be transformed into a desired animal by using a known method. The sequence of the antisense nucleic acid is preferably a sequence complementary to the endogenous ARHGEF10 gene or a part thereof possessed by the animal to be transformed, but it is completely complementary as long as the gene expression can be effectively suppressed. It does not have to be. The transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcript of the target gene. In order to effectively suppress the expression of a target gene (ARHGEF10 gene) using an antisense nucleic acid, the length of the antisense nucleic acid is preferably at least 15 bases and less than 25 bases, but the antisense nucleic acid of the present invention Is not necessarily limited to this length.

  The antisense of the present invention is not particularly limited, but can be prepared based on the base sequence described in SEQ ID NO: 2, for example.

  In addition, the suppression of the ARHGEF10 gene expression can be performed using a ribozyme or a DNA encoding the ribozyme. A ribozyme refers to an RNA molecule having catalytic activity. Some ribozymes have a variety of activities, but research focusing on ribozymes as enzymes that cleave RNA has made it possible to design ribozymes that cleave RNA in a site-specific manner. Some ribozymes have a size of 400 nucleotides or more, such as group I intron type and M1 RNA contained in RNase P, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type. (Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzymes, 1990, 35, 2191.)

  For example, the self-cleaving domain of the hammerhead ribozyme cleaves 3 ′ of C15 in the sequence G13U14C15, but base pairing between U14 and A9 is important for its activity, and instead of C15, A15 or U15 However, it has been shown that it can be cleaved (Koizumi, M. et al., FEBS Lett, 1988, 228, 228.). By designing a ribozyme whose substrate binding site is complementary to the RNA sequence in the vicinity of the target site, it is possible to create a restriction RNA-cleaving ribozyme that recognizes the sequence UC, UU or UA in the target RNA (Koizumi, M. et al., FEBS Lett, 1988, 239, 285., Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzymes, 1990, 35, 2191., Koizumi, M. et al., Nucl Acids Res, 1989, 17, 7059 .).

  Hairpin ribozymes are also useful for the purposes of the present invention. This ribozyme is found, for example, in the minus strand of tobacco ring spot virus satellite RNA (Buzayan, JM., Nature, 1986, 323, 349.). It has been shown that hairpin ribozymes can also produce target-specific RNA-cleaving ribozymes (Kikuchi, Y. & Sasaki, N., Nucl Acids Res, 1991, 19, 6751., Hiroshi Kikuchi, Chemistry and Biology, 1992, 30, 112.). Thus, the expression of the gene can be suppressed by specifically cleaving the transcript of the ARHGEF10 gene in the present invention using a ribozyme.

  Inhibition of endogenous gene expression can also be carried out by RNA interference (RNAi) using double-stranded RNA having the same or similar sequence as the target gene sequence. The nucleic acid having an inhibitory action by the RNAi effect of the present invention is generally also referred to as siRNA. RNAi induces destruction of target gene mRNA by introducing double-stranded RNA consisting of a sense RNA consisting of a sequence homologous to the mRNA of the target gene and an antisense RNA consisting of a complementary sequence into the cell. This is a phenomenon that can suppress the expression of the target gene. As described above, RNAi can suppress the expression of a target gene, so that it can be used as a simple gene knockout method instead of the conventional complicated and low-efficiency gene disruption method by homologous recombination, or as a method applicable to gene therapy. It attracts attention. The RNA used for RNAi is not necessarily completely identical to the ARHGEF10 gene or a partial region of the gene, but preferably has complete homology.

  As a preferred embodiment of the nucleic acid (c) of the present invention, there can be mentioned double-stranded RNA (siRNA) having RNAi (RNA interference) effect on the ARHGEF10 gene. More specifically, a double-stranded RNA (siRNA) composed of a sense RNA and an antisense RNA for the partial sequence of the base sequence described in SEQ ID NO: 2 can be mentioned.

  The details of the RNAi mechanism are still unknown, but an enzyme called DICER (a member of the RNase III nuclease family) contacts double-stranded RNA, and the double-stranded RNA is called a small interfering RNA or siRNA. It is thought to be broken down into pieces. The double-stranded RNA having the RNAi effect in the present invention includes a double-stranded RNA before being degraded by DICER as described above. That is, it is expected that even a long-chain RNA that does not have an RNAi effect with the same length is decomposed into siRNA having an RNAi effect in a cell. The length is not particularly limited.

  For example, a long double-stranded RNA corresponding to the full-length or almost full-length region of the ARHGEF10 gene mRNA of the present invention can be preliminarily degraded with DICER and the degradation product can be used as a therapeutic agent for arteriosclerotic diseases. Is possible. This degradation product is expected to contain a double-stranded RNA molecule (siRNA) having an RNAi effect. According to this method, a region on mRNA that is expected to have an RNAi effect need not be selected. That is, the region on the mRNA of the ARHGEF10 gene of the present invention having an RNAi effect does not necessarily have to be accurately defined.

  In addition, a molecule having one end closed in the above RNA molecule, for example, a siRNA (shRNA) having a hairpin structure is also included in the present invention. That is, a single-stranded RNA molecule capable of forming a double-stranded RNA structure within the molecule is also included in the present invention.

  The above-mentioned “double-stranded RNA that can be suppressed by the RNAi effect” of the present invention can be appropriately prepared by those skilled in the art based on the base sequence of the ARHGEF10 gene of the present invention that is the target of the double-stranded RNA. . For example, the double-stranded RNA of the present invention can be prepared based on the base sequence shown in SEQ ID NO: 2. That is, based on the base sequence described in SEQ ID NO: 2, selecting any continuous RNA region of mRNA that is a transcription product of the sequence, and preparing a double-stranded RNA corresponding to this region, For those skilled in the art, it can be appropriately performed within the range of normal trials. In addition, selection of siRNA sequences having a stronger RNAi effect from mRNA sequences that are transcripts of the sequences can also be appropriately performed by those skilled in the art by known methods. If one strand (for example, the base sequence described in SEQ ID NO: 2) is known, those skilled in the art can easily know the base sequence of the other strand (complementary strand). The siRNA can be appropriately prepared by those skilled in the art using a commercially available nucleic acid synthesizer. In addition, for synthesis of a desired RNA, a general synthesis contract service can be used.

  Furthermore, a DNA (vector) capable of expressing the RNA of the present invention is also included in a preferred embodiment of the compound capable of suppressing the expression of the ARHGEF10 gene of the present invention. For example, the DNA (vector) capable of expressing the double-stranded RNA of the present invention is a DNA encoding one strand of the double-stranded RNA and a DNA encoding the other strand of the double-stranded RNA, Each DNA has a structure linked to a promoter so that it can be expressed. Those skilled in the art can appropriately prepare the above DNA of the present invention by general genetic engineering techniques. More specifically, the expression vector of the present invention can be prepared by appropriately inserting DNA encoding the RNA of the present invention into various known expression vectors.

  In addition, the expression-suppressing substance of the present invention includes, for example, a compound that suppresses the expression of the ARHGEF10 gene by binding to the expression regulatory region (eg, promoter region) of the ARHGEF10 gene. The compound can be obtained, for example, using a promoter DNA fragment of the ARHGEF10 gene by a screening method using the binding activity with the DNA fragment as an index. Moreover, those skilled in the art can appropriately determine whether or not to suppress the expression of the ARHGEF10 gene of the present invention for a desired compound by a known method such as a reporter assay method.

  In addition, the present inventors have enhanced the ARHGEF10 transcriptional activity by modifying the binding affinity of the Sp1 transcription factor with a haplotype (sensitive haplotype) containing polymorphisms “rs4480162” and “rs4376531” present on the ARHGEF10 gene (intron 17). It was possible to do.

  The haplotype is considered to contain a DNA region that binds to Sp1, which is a transcriptional regulator. In addition, haplotypes containing rs4480162 and rs4376531 on the ARHGEF10 gene were significantly correlated with atherothrombotic cerebral infarction. Individuals with a susceptibility haplotype are considered to express ARHGEF10 transcripts higher due to Sp1 binding.

  Therefore, a compound that changes the binding activity between the ARHGEF10 gene DNA region containing the polymorphism (haplotype) and the Sp1 transcription factor is considered to suppress the transcription of the ARHGEF10 gene. This can be said to be one of the preferred embodiments. Examples of the DNA region include a DNA region containing a polymorphic site “rs4480162” or “rs4376531”.

In addition, the polynucleotide comprising the DNA sequence having the polymorphic mutation of the present invention and having a DNA sequence in which the binding activity to the Sp1 transcription factor is changed is, for example, a drug for treating or preventing arteriosclerotic diseases described later It is possible to use suitably for the screening method of, and it is useful. For example, the following polynucleotide (a) or (b) can be used for screening for therapeutic agents for arteriosclerotic diseases.
(A) a partial fragment polynucleotide of the DNA sequence set forth in SEQ ID NO: 2, comprising a polymorphic site at position 2222 or position 2225 (b) one or more in the polynucleotide sequence of (b) above A polynucleotide comprising a nucleotide sequence in which a base of is added, deleted or substituted, wherein the binding ability to the Sp1 transcription factor is altered

  The present invention also provides a therapeutic agent for arteriosclerotic diseases comprising an ARHGEF10 protein function inhibitor as an active ingredient.

Examples of the ARHGEF10 protein function inhibitor in the present invention include the following compounds (a) or (b).
(A) Antibody that binds to ARHGEF10 protein (b) Low molecular weight compound that binds to ARHGEF10 protein

  An antibody that binds to the ARHGEF10 protein (anti-ARHGEF10 protein antibody) can be prepared by methods known to those skilled in the art. If it is a polyclonal antibody, it can obtain as follows, for example. Serum is obtained by immunizing a small animal such as a rabbit with a recombinant ARHGEF10 protein expressed in a microorganism such as Escherichia coli or a partial peptide thereof as a fusion protein with natural ARHGEF10 protein or GST. This is prepared by, for example, purification by ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, affinity column coupled with ARHGEF10 protein or synthetic peptide, or the like. In the case of a monoclonal antibody, for example, the ARHGEF10 protein or a partial peptide thereof is immunized to a small animal such as a mouse, the spleen is removed from the mouse, and this is ground to separate the cells. Are fused using a reagent such as polyethylene glycol, and a clone producing an antibody that binds to the ARHGEF10 protein is selected from the resulting fused cells (hybridoma). Subsequently, the obtained hybridoma is transplanted into the abdominal cavity of the mouse, and ascites is collected from the mouse, and the obtained monoclonal antibody is obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, ARHGEF10 protein, It can be prepared by purification with an affinity column coupled with a synthetic peptide.

  The form of the antibody of the present invention is not particularly limited, so long as it binds to the ARHGEF10 protein of the present invention, in addition to the above polyclonal antibody and monoclonal antibody, human antibodies, humanized antibodies by genetic recombination, antibody fragments thereof, Antibody modifications are also included.

  The ARHGEF10 protein of the present invention used as a sensitizing antigen for obtaining an antibody is not limited with respect to the animal species from which it is derived, but is preferably a protein derived from a mammal such as a mouse or human, and particularly preferably a protein derived from a human. A human-derived protein can be appropriately obtained by those skilled in the art using the gene sequence or amino acid sequence disclosed in the present specification.

  In the present invention, the protein used as the sensitizing antigen may be a complete protein or a partial peptide of the protein. Examples of the partial peptide of the protein include an amino group (N) terminal fragment and a carboxy (C) terminal fragment of the protein, or a kinase active site at the center. As used herein, “antibody” means an antibody that reacts with the full length or fragment of a protein.

  Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies (scFv) (Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-83; The Pharmacology of Monoclonal Antibody, Vol. 113, Rosenburg and Moore ed., Springer Verlag (1994) pp. 269-315), humanized antibody, multispecific antibody (LeDoussal et al. (1992) Int. J. Cancer Suppl. 7: 58 -62; Paulus (1985) Behring Inst. Mitt. 78: 118-32; Millstein and Cuello (1983) Nature 305: 537-9; Zimmermann (1986) Rev. Physiol. Biochem. Pharmacol. 105: 176-260; VanDijk et al. (1989) Int. J. Cancer 43: 944-9), and antibody fragments such as Fab, Fab ′, F (ab ′) 2, Fc, Fv and the like. Such an antibody may be modified with PEG or the like as necessary. It can also be produced as a fusion protein with β-galactosidase, maltose binding protein, GST, green fluorescent protein (GFP), etc. so that it can be detected without using a secondary antibody. Further, by labeling the antibody with biotin or the like, it can be modified so that the antibody can be detected and recovered using avidin, streptavidin or the like.

  In addition to immunizing non-human animals with antigens to obtain the above hybridomas, human lymphocytes such as human lymphocytes infected with EB virus are sensitized with proteins, protein-expressing cells or lysates thereof in vitro. Lymphocytes can be fused with human-derived myeloma cells having permanent mitotic activity, such as U266, to obtain hybridomas that produce desired human antibodies having binding activity to proteins.

  The antibody against the ARHGEF10 protein of the present invention inhibits the function of the protein by binding to the ARHGEF10 protein, and is expected to be effective in treating or improving arteriosclerotic diseases such as cerebral infarction. When the obtained antibody is used for the purpose of administering it to the human body (antibody treatment), a human antibody or a human-type antibody is preferable in order to reduce immunogenicity.

  Furthermore, the present invention also includes a low molecular weight substance (low molecular compound) that binds to the ARHGEF10 protein as a substance that can suppress the function of the ARHGEF10 protein. The low molecular weight substance that binds to the ARHGEF10 protein of the present invention may be a natural or artificial compound. Usually, it is a compound that can be produced or obtained by using methods known to those skilled in the art. The compound of the present invention can also be obtained by the screening method described later.

  Examples of the low molecular weight compound that binds to the ARHGEF10 protein of (b) include compounds having high affinity for ARHGEF10.

  Furthermore, examples of the substance capable of suppressing the function of the ARHGEF10 protein of the present invention include an ARHGEF10 protein mutant having a dominant negative property with respect to the ARHGEF10 protein. “The protein variant having a dominant negative property with respect to the ARHGEF10 protein” refers to a protein having a function of eliminating or reducing the activity of an endogenous wild-type protein by expressing a gene encoding the protein. Point to.

  In addition, substances (compounds) that are already known to inhibit the function of ARHGEF10 protein can be suitably shown as specific examples of the above-mentioned “substances that can suppress the function of ARHGEF10 protein” of the present invention.

The function-suppressing substance of the present invention can be appropriately obtained by a screening method using the activity of ARHGEF10 of the present invention as an index.
The present invention also provides a drug for treating or preventing arteriosclerotic diseases, comprising the following (a) or (b) as an active ingredient.
(A) GABA B receptor ligand formed by GABBR1 deficient in exon 15 (b) RhoA inhibitor The ligand includes GABA B receptor antagonists and the like. Known inhibitors of Rho kinase downstream of RhoA include Y-27632 and fasudil.

  The present invention also provides a drug (candidate compound) for treating or preventing arteriosclerotic disease, wherein the compound reduces the expression level of the ARHGEF10 gene or the activity of the protein encoded by the gene. A screening method is provided.

  One aspect of the screening method of the present invention is a method using the expression level of the ARHGEF10 gene as an index. A compound that decreases the expression level of the ARHGEF10 gene is expected to be a drug for treating or preventing arteriosclerotic diseases.

The above method of the present invention is, for example, a method for screening a drug for the treatment or prevention of arteriosclerotic diseases including the following steps (a) to (c).
(A) a step of bringing a test compound into contact with a cell expressing the ARHGEF10 gene (b) a step of measuring the expression level of the ARHGEF10 gene (c) as compared with the case where the test compound is measured in the absence of the test compound, Selecting a compound that decreases the expression level

  In this method, first, a test compound is brought into contact with cells expressing the ARHGEF10 gene. Examples of the origin of the “cell” used include, but are not limited to, cells derived from humans, mice, cats, dogs, cows, sheep, birds, pets, livestock, and the like. As the “cell expressing the ARHGEF10 gene”, a cell expressing the endogenous ARHGEF10 gene or a cell into which an exogenous ARHGEF10 gene has been introduced and expressing the gene can be used. A cell in which an exogenous ARHGEF10 gene is expressed can usually be prepared by introducing an expression vector into which the ARHGEF10 gene has been inserted into a host cell. The expression vector can be prepared by general genetic engineering techniques.

  There is no restriction | limiting in particular as a test compound used for this method. For example, natural compounds, organic compounds, inorganic compounds, proteins, peptides and other single compounds, as well as compound libraries, gene library expression products, cell extracts, cell culture supernatants, fermented microorganism products, marine organism extracts Products, plant extracts and the like, but are not limited thereto.

  The “contact” of the test compound to the cell expressing the ARHGEF10 gene is usually performed by adding the test compound to the culture medium of the cell expressing the ARHGEF10 gene, but is not limited to this method. When the test compound is a protein or the like, “contact” can be performed by introducing a DNA vector expressing the protein into the cell.

  In this method, the expression level of the ARHGEF10 gene is then measured. Here, “gene expression” includes both transcription and translation. The gene expression level can be measured by methods known to those skilled in the art. For example, mRNA can be extracted from cells expressing the ARHGEF10 gene according to a standard method, and the transcription level of the gene can be measured by performing Northern hybridization or RT-PCR using this mRNA as a template. Further, the translation level of the gene can be measured by recovering the protein fraction from the cell expressing the ARHGEF10 gene and detecting the expression of the ARHGEF10 protein by electrophoresis such as SDS-PAGE. Furthermore, it is also possible to measure the translation level of a gene by detecting the expression of the protein by performing Western blotting using an antibody against the ARHGEF10 protein. The antibody used for detecting the ARHGEF10 protein is not particularly limited as long as it is a detectable antibody. For example, both a monoclonal antibody and a polyclonal antibody can be used.

  In this method, a compound that decreases the expression level is then selected as compared with the case where the test compound is not contacted (control). The compound that lowers becomes a drug for the treatment or prevention of arteriosclerotic diseases.

  Another embodiment of the screening method of the present invention is a method of identifying a compound that decreases the expression level of the ARHGEF10 gene of the present invention using reporter gene expression as an index.

The above method of the present invention is, for example, a method for screening a drug for the treatment or prevention of arteriosclerotic diseases including the following steps (a) to (c).
(A) contacting a cell containing a DNA having a structure in which a transcriptional regulatory region of the ARHGEF10 gene and a reporter gene are functionally linked with a test compound (b) measuring the expression level of the reporter gene (c) ) A step of selecting a compound that reduces the expression level as compared with the case where it is measured in the absence of the test compound.

  In this method, first, a test compound is brought into contact with a cell or a cell extract containing DNA having a structure in which a transcriptional regulatory region of the ARHGEF10 gene and a reporter gene are functionally linked. Here, “functionally linked” means that the transcriptional regulatory region of the ARHGEF10 gene is bound to the reporter gene so that expression of the reporter gene is induced by binding of the transcription factor to the transcriptional regulatory region of the ARHGEF10 gene. It means doing. Therefore, even when the reporter gene is bound to another gene and forms a fusion protein with another gene product, the transcription factor binds to the transcriptional regulatory region of the ARHGEF10 gene, Any expression that is induced is included in the meaning of “functionally linked”. Based on the cDNA base sequence of the ARHGEF10 gene, those skilled in the art can obtain the transcriptional regulatory region of the ARHGEF10 gene present in the genome by a well-known method.

  The reporter gene used in this method is not particularly limited as long as its expression can be detected, and examples thereof include CAT gene, lacZ gene, luciferase gene, and GFP gene. Examples of “cells containing DNA having a structure in which the transcriptional regulatory region of ARHGEF10 gene and a reporter gene are functionally linked” include cells into which a vector having such a structure inserted is introduced. Such vectors can be prepared by methods well known to those skilled in the art. Introduction of the vector into the cells can be performed by a general method such as calcium phosphate precipitation, electric pulse perforation, lipofectamine method, microinjection method and the like. “Cells containing DNA having a structure in which the transcriptional regulatory region of ARHGEF10 gene and a reporter gene are functionally linked” also include cells in which the structure is inserted into the chromosome. The DNA structure can be inserted into the chromosome by a method generally used by those skilled in the art, for example, a gene introduction method using homologous recombination.

  `` A cell extract containing DNA having a structure in which a transcriptional regulatory region of an ARHGEF10 gene and a reporter gene are functionally linked '' refers to, for example, a cell extract contained in a commercially available in vitro transcription translation kit containing the ARHGEF10 gene Examples include those to which DNA having a structure in which a transcriptional regulatory region and a reporter gene are functionally linked is added.

  “Contact” in this method means that the test compound is added to the culture solution of “a cell containing DNA having a structure in which the transcriptional regulatory region of the ARHGEF10 gene and the reporter gene are functionally linked”, or the DNA containing the DNA. The test compound can be added to a commercially available cell extract. When the test compound is a protein, for example, it can be performed by introducing a DNA vector expressing the protein into the cell.

  In this method, the expression level of the reporter gene is then measured. The expression level of the reporter gene can be measured by methods known to those skilled in the art depending on the type of the reporter gene. For example, when the reporter gene is a CAT gene, the expression level of the reporter gene can be measured by detecting acetylation of chloramphenicol by the gene product. When the reporter gene is a lacZ gene, by detecting the color development of the dye compound catalyzed by the gene expression product, and when the reporter gene is a luciferase gene, the fluorescent compound catalyzed by the gene expression product By detecting fluorescence, and in the case of a GFP gene, the expression level of the reporter gene can be measured by detecting fluorescence due to the GFP protein.

  In this method, a compound that lowers (suppresses) the expression level of the measured reporter gene is then selected as compared to the case where the expression level is measured in the absence of the test compound. A compound that decreases (suppresses) becomes a drug for treating or preventing arteriosclerotic diseases.

In addition, as the ARHGEF10 gene in the screening method of the present invention, a wild-type gene can be usually used, but polymorphisms (“rs4480162”, “rs4376531”) associated with the enhanced expression found by the present inventors. It is also possible to suitably use a DNA fragment constituting a haplotype containing).
Since the expression of the ARHGEF10 gene is enhanced, the haplotype can be suitably used for screening for a substance that suppresses (reduces) the expression of the gene.

  Another embodiment of the screening method of the present invention is a method using as an index the interaction activity (binding activity) between the binding DNA region of Sp1 transcription factor on the ARHGEF10 gene and the Sp1 transcription factor.

The above method of the present invention is, for example, a method for screening a drug for the treatment or prevention of arteriosclerotic diseases including the following steps (a) to (c).
(A) a polynucleotide consisting of a DNA region comprising the site of positions 2222 or 2225 in the base sequence of ARHGEF10 gene, SEQ ID NO: 2 and the Sp1 transcription factor, and a test compound Contacting step (b) measuring the binding activity between the polynucleotide and Sp1 transcription factor (c) selecting a compound that reduces the binding activity as compared to the measurement in the absence of the test compound Process

  In this method, first, a polynucleotide consisting of a DNA region containing a site at positions 2222 or 2225 in the base sequence of the ARHGEF10 gene, SEQ ID NO: 2, and the Sp1 transcription factor, Contact the test compound.

Next, the interaction activity (binding activity) between the polynucleotide and Sp1 transcription factor is measured. This interaction activity can be evaluated by those skilled in the art using various known methods.
For example, the interaction activity can be evaluated by a shift assay.
In addition, the compounds used in the various screening methods described above are also useful as screening reagents for drugs for the treatment or prevention of arteriosclerotic diseases.

  Furthermore, the present invention provides a kit containing various drugs / reagents used for carrying out the inspection method or screening method of the present invention.

The kit of the present invention can be appropriately selected from, for example, the above-described various reagents of the present invention according to the test method or screening method to be performed. For example, the kit of the present invention can comprise the gene, protein, oligonucleotide, antibody or the like of the present invention as a constituent element. More specifically, (1) the primer oligonucleotide of the present invention and a PCR reaction reagent (Taq polymerase, buffer, etc.), or (2) the probe oligonucleotide of the present invention and a hybridization buffer, (3 ) The anti-ARHGEF10 protein antibody of the present invention, an ELISA reagent, and the like can be exemplified.
Furthermore, the kit of the present invention can appropriately include a control sample, a buffer solution, instructions describing the method of use, and the like.

  The present invention also relates to a method for treating or preventing an arteriosclerotic disease, comprising the step of administering the agent of the present invention to a subject. The necessary amount of the drug of the present invention is administered to mammals including humans within the safe dose range. The dosage of the drug of the present invention can be appropriately determined finally based on the judgment of a doctor or veterinarian in consideration of the type of dosage form, administration method, patient age and weight, patient symptoms, and the like.

  It should be noted that all prior art documents cited in the present specification are incorporated herein by reference.

EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.
The materials and methods are shown below.

<Trial group>
Cases of ischemic stroke in 2004 from seven medical centers in and around Fukuoka were enrolled for a large case-control correlation study. Details of registration and correlation studies have already been described (Kubo M, et al. Nat Genet, 2007; 36: 233-239.). Briefly, all case subjects are detailed clinical features and ancillary laboratory tests (computerized tomography and MRI, brain angiography, echocardiography, and brain images including carotid duplex imaging) The diagnosis was made by a neurologist specializing in stroke. Previous studies (Ikram MA, et al. N Engl J Med, 2009; 360: 1718-1728., Rosamond WD, et al. Stroke, 1999; 30: 736-743., Ohira T, et al. Stroke, 2006; 37: 2493-2498.) Subtypes of ischemic stroke were determined based on the classification. The ischemic stroke subtypes were 860 atherothrombotic, 136 cardiogenic, and 116 unknown subtypes. Control subjects matched in age (within 5 years) and gender were selected from 3,328 participants in the 2002-2003 Hisayama study.

  Case studies were selected from the Biobank Japan Project (Nakamura Y. Clin Adv Hematol Oncol, 2007; 5: 696-697.) For reproducibility studies. We selected 1,925 cases diagnosed as atherothrombotic cerebral infarction by the same brain imaging method as the previous study from subjects with ischemic stroke of Biobank Japan. The remaining 2,068 participants of the Hisayama study that were not enrolled in the previous study were used as controls.

  For the prospective cohort study, a cohort group of Kuyama-machi study (Kubo M, et al. Nat Genet, 2007; 36: 233-239.) Established in 1988 was used. In this cohort, 2,637 Residents of Hisayama who were over 40 years old with no history of stroke or coronary heart disease registered in 1988 were followed for 14 years until they developed or died of cardiovascular disease. Of these, 1,656 subjects who participated in the 2002-2003 trial were used in this study.

  Written informed consent was obtained from all study subjects in both groups. This study was approved by the Ethics Committee of the Graduate School of Medicine of Kyushu University and Yokohama Institute of Physical and Chemical Research.

<SNP selection and genotyping>
Second-stage HapMap JPT data for paired tagging according to criteria of r ² > 0.8, minor allele frequency (MAF)> 5%, and call rate> 75% for fine mapping across ARHGEF10 A tag SNP was selected. In both populations, genomic DNA was extracted from peripheral blood leukocytes by standard methods. ABI3700 capillary sequencer (Third Wave Technologies) as previously described (Third Wave Technologies) (Ohnishi Y, et al. J Hum Genet, 2001; 46: 471-478.) Or according to standard protocols ( SNPs were genotyped by direct sequencing of PCR products using Applied Biosystems). All genotypes were determined visually, and we succeeded in genotyping, with fewer than 10 unidentified samples in the 384-well plate.

<Cell culture>
Human colon cancer LoVo cells were grown in F12-HAM (Invitrogen) containing 10% fetal bovine serum (FBS). Human embryonic kidney fibroblast 293FT cells were grown in Dulbecco's modified Eagle medium (Invitrogen) containing 10% FBS. These cells were incubated in a humidified atmosphere at 37 ° C. containing 5% CO ₂ .

<Electrophoretic mobility shift analysis>
A 5′-biotin labeled single stranded oligonucleotide was obtained from Invitrogen and annealed. The electrophoretic mobility shift analysis (EMSA) probe sequence is as follows:
rs35234164_del the 5'-CAGTGAAGTAAAATATGGCCTACC_TTAAGAAGTTAAGATAG TCATTTAA-3 '(SEQ ID NO: 3), rs35234164_T the 5'-CAGTGAAGTAAAATATGGCCTACC T TTAAGAAG TTAAGATAGTCATTTAA-3 ' ( SEQ ID NO: 4), rs4480162_C / rs4376531_G the 5'-AGTCGGACT CCTTAGTGTGAACT C CA G ATCCACCTTCTCTGAACTCTGAA- 3 '(SEQ ID NO: 5), rs4480162_G / rs4376531_C is 5'-AGTCGGACTCCTTAGTGTGAACT G CA C ATCCACCTTCTCTGAA CTCTGAA-3' (SEQ ID NO: 6), rs2280887_G is 5'-CTTGACTCTTGGGCAGTTTTAAGTA G GTTTAAAA TTC-3 ' Rs2280887_C is 5′-CTTGACTCTTGGGCAGTTTTAAGT A C GTTTAAAATTCTCCCGCTGCCAGA-3 ′ (SEQ ID NO: 8), and the Sp1 consensus sequence is 5′-ATTCGATCGG GGCGGGGCGAGC-3 ′ (SEQ ID NO: 9). 20 fmol EMSA probe in binding buffer (5 mM HEPES, pH 7.9, 0.05 mM EDTA, 0.5 μg poly (dI / dC), 50 mM KCl, 1 mM dithiothreitol, and 10% glycerol) at room temperature And incubated with 10 μg of nucleoprotein for 30 minutes. For the competition assay, a 1 to 20 fold molar excess of unlabeled probe each was added and incubated for an additional 15 minutes at room temperature. For the supershift assay, 160 fmol EMSA probe was used, 2 μg rabbit polyclonal anti-human Sp1 antibody (07-645, Upstate) was added and incubated for an additional 15 minutes at room temperature. The mixture was subjected to electrophoresis at 4 ° C. on a 4% polyacrylamide gel in 0.5 × Tris-Borate-EDTA (TBE) buffer. Nucleic acids were transferred to nylon membrane (Hybond-N +; Amercham Biosciences) at 100 V for 60 minutes. Biotin-labeled probes were detected using a chemiluminescent nucleic acid detection module (PIERCE, 89880) and analyzed using the LAS-3000 system (Fuji Film, Tokyo, Japan).

<Luciferase reporter assay method>
The same DNA sequence as the EMSA probe around rs4480162 and rs4376531 was subcloned into the pGL3 promoter luciferase vector (Promega). LoVo cells were transfected with 500 ng of each reporter construct and 50 ng of pRL-CMV vector (Promega) using FuGENE 6 transfection reagent (Roche). After 48 hours, cells were harvested and luciferase activity was measured using a dual luciferase assay system (Toyo Benet).

<Low molecular weight GTPase activity assay>
By cloning the full-length human ARHGEF10 cDNA into the p3XFLAG-CMV-10 expression vector (SIGMA), a plasmid designed to express full-length ARHGEF10 was obtained. Three low molecular weight GTPase overexpression plasmids were constructed by cloning full length human RhoA, Rac1, or Cdc42 cDNA into pcDNA3.1 / myc-His expression vector (Invitrogen). As already described (Kobayashi S, et al. Biochem J, 2001; 354: 73-78., Reid T, et al. J Biol Chem, 1996; 271: 13556-13560.) Rhotekin's Rho GTPase GTP was loaded using a GST fusion protein containing a binding domain (GST-RBD) (14-383, Upstate) or a GST fusion protein containing a PAK-1 binding domain (GST-PBD) (14-325, Upstate) The cellular levels of RhoA, Rac1, and Cdc42 were determined. Briefly, pcDNA3.1-RhoA-Myc or pcDNA3.1-Rac1-Myc or pcDNA3.1-Cdc42-Myc using FuGENE 6 transfection reagent (Roche), p3XFLAG-CMV-10-ARHGEF10 or 293FT cells seeded in 10 cm dishes with the corresponding empty vector were cotransfected. After 48 hours of culture, cells were lysed in a buffer containing 25 mM HEPES pH7.5,150 mM NaCl, 1 % Igepal CA-630,10 mM MgCl 2, 1 mM EDTA, 10% glycerol, and protease inhibitors The individual fractions were pelleted by centrifugation. Subsequently, the supernatant containing GTPase was incubated with GST fusion protein bound to glutathione-Sepharose beads at 4 ° C. for 45-60 minutes. After washing the beads three times, the bound protein was eluted with sample buffer and separated by SDS-PAGE. Subsequently, GEF10 and low molecular weight GTPase were detected by immunoblotting using specific anti-FLAG antibody (F3165, SIGMA, 1 μg / ml) and anti-Myc antibody (562, MBL, 1 μl / ml), respectively. did. To detect species that matched the secondary antibody, the protein that reacted with the primary antibody was visualized by a sensitive chemiluminescence system (GE Healthcare UK Ltd. Amersham) and analyzed with the LAS-3000 system. Quantitative analysis of immunoblots was performed using Multi Gauge version 2.02 software included with the LAS-3000 system.

<Statistical analysis>
Case-control correlation analysis and Hardy-Weinberg equilibrium shifts were assessed by chi-square test and Fisher's exact test as needed. Synergistic, dominant, and recessive models were used in the correlation analysis. The Mantel-Henzel method was used to integrate the results of two case-control samples. To correct for multiple tests, a random permutation test was performed on 10,000 replicates using the MULTTEST procedure of SAS software version 9.12 (SAS Institute). Linkage disequilibrium was calculated with D 'or r ² and haplotype blocks were defined by Gabriel's criteria (Gabriel SB, et al. Science, 2002; 296: 2225-2229.) Using Haploview version 4.0 (Broad Institute) . Luciferase assay data and low molecular weight GTPase activity assay data were analyzed by Student's t test.

[Example 1] Case-control correlation study Two-step large-scale studies using tag SNPs based on 52,608 genes selected from the JSNP database in 1,112 cases of ischemic stroke and 1,112 age- and sex-matched controls Scale correlation studies were performed (Kubo M, et al. Nat Genet, 2007; 36: 233-239., Hata J, et al. Hum Mol Genet, 2007; 16: 630-639.). To identify susceptibility genes for atherothrombotic cerebral infarction, this data was analyzed focusing on 860 cases of atherothrombotic cerebral infarction and 860 matched age and gender (first set). SNP rs2280887 in intron 17 of ARHGEF10 on chromosome 8p23 was found to be strongly correlated with atherothrombotic cerebral infarction (P = 1.2 × 10 ⁻⁶ for dominant model; Table 4) (4 in ARHGEF10 Association of two SNPs with atherothrombotic cerebral infarction in set 1 and set 2 samples).

  In Table 4 above, OR indicates an odds ratio, CI indicates a confidence interval, and “-” indicates a deletion.

  This correlation was maintained significantly after the permutation test for multiple test correction (P = 0.0006). This SNP showed a relatively weak correlation for overall ischemic stroke and did not correlate with cardiogenic cerebral infarction (Table 5) (association with rs2280887 and ischemic stroke subtype in set 1) .

  In Table 5 above, OR is the odds ratio, CI is the confidence interval, ATS is atherothrombotic cerebral infarction, and CES is cardiogenic cerebral infarction.

  Therefore, it is speculated that a susceptibility locus for atherothrombotic cerebral infarction exists in the region containing ARHGEF10.

Subsequently, 93 tag SNPs covering the entire ARHGEF10 gene were selected from the HapMap JPT data in the second stage, and genotyping of these SNPs was performed using the screening sample. ARHGEF10 intron 17 rs4480162 was completely linkage disequilibrium (D '= 1.0 and R ² = 1.0) with rs2280887 and was significantly correlated with atherothrombotic cerebral infarction (P = 6.9 for the dominant model) × 10 ^-7 , Table 4). None of the other 92 SNPs were significantly correlated. These two SNPs were located within the highly linkage disequilibrium 7.4 kb region located in intron 15 to intron 17 of ARHGEF10. Therefore, mutants in this 7.4 kb region were searched by direct sequencing using 48 affected individuals. This resequencing identified 12 variants and 28 new variants already registered in the dbSNP database. After removing already genotyped variants or variants with MAF <0.05, 14 SNPs were further genotyped. FIG. 1AB shows the result of fine mapping around the candidate area of ARHGEF10. Correlation was limited to block A of ARHGEF10. In block A, two additional SNPs, rs35234164 and rs4376531 were found to have a significant correlation equivalent to rs2280887 (FIG. 1A (III) and Table 4). rs4376531 was only 2 bases away from rs4480162, and these SNPs were completely related to rs2280887 (each SNP pair D ′ = 1.0 and r ² = 1.0). rs35234164 is a single nucleotide insertion / deletion (T / del) polymorphism located in intron 16, strongly associated with the other three SNPs (each SNP pair D '= 1.0 and r ² = 0.95). There was no other SNP in block A that correlated with atherothrombotic cerebral infarction. These four SNPs were also found to correlate with atherothrombotic cerebral infarction in another case-control set of 1,925 cases and 2,068 controls (P = 0.018 for the second set, dominant model) Table 4). Haplotype analysis using these four SNPs showed similar correlation when compared to single locus analysis. The inventors therefore considered that one or a combination of these SNPs had functional significance.

[Example 2] Sensitive haplotypes affect ARHGEF10 transcriptional activity due to differences in Sp1 binding affinity The four SNPs are located in intron 16 or 17 and are approximately 80 kb from the 5'-untranslated region (UTR) Mapped away and 50 kb away from the 3′-UTR. None of the four SNPs were located at the splice donor, splice acceptor, or branch sites of intron 16 or 17. Furthermore, the UCSC Genome Browser database showed no other annotated genes or non-coding RNAs in the block A region. Although these possibilities cannot be completely ruled out, we hypothesized that some of these SNPs can exert their effects on transcription through indirect effects.

  To prove this hypothesis, we prepared six 5'-terminal biotin-labeled oligonucleotide probes derived from the ARHGEF10 genomic sequence and used EMSA with nuclear extracts of LoVo cells that highly expressed ARHGEF10 gene transcripts. Carried out. In the lanes corresponding to the sensitive haplotypes (C-G) rs4480162 and rs4376531, a shift band of DNA-protein complex with strong intensity was found (FIG. 2A). This shift band was weak in the lane corresponding to the insensitive haplotype (G-C). Other shift bands showed no difference in intensity between alleles. Competition assays using unlabeled oligonucleotides showed that self (CG) oligonucleotides inhibited DNA-protein complex formation in a dose-dependent manner, but non-self oligonucleotides (GC) did not. (FIG. 2B), which suggests that some nuclear proteins bind specifically to DNA fragments corresponding to CG haplotypes. To identify which transcription factors bind to this sensitive haplotype, an excess of unlabeled oligonucleotides corresponding to the various transcription factor consensus sequences were added as competitors. Unlabeled Sp1-binding consensus oligonucleotides were found to efficiently inhibit the formation of DNA-protein complexes (FIG. 2C). Furthermore, when anti-Sp1 antibody was added to this mixture, the band shifted to a higher molecular weight position, indicating that the Sp1 protein specifically binds to the sensitive haplotype.

  To test whether the haplotype affects the transcriptional activity of ARHGEF10, a luciferase assay was performed using LoVo cells. The same sequence used in EMSA was subcloned into the pGL3 promoter vector. Luciferase activity was enhanced in cells transfected with a reporter vector containing a sensitive haplotype (C-G), but was less potent in cells transfected with a vector containing an insensitive haplotype (FIG. 2D). These findings indicate that haplotypes rs4480162 and rs4376531 can affect ARHGEF10 transcriptional activity through differences in the binding affinity of Sp1 transcription factors.

  Although the function of GEF10 is largely unknown, GEF10 is a member of the Rho guanine nucleotide exchange factor family, which regulates the activity of low molecular weight GTPase Rho by catalyzing the exchange of bound GDP by GTP. To elucidate the role of GEF10 in the pathogenesis of atherothrombotic cerebral infarction, the effect of GEF10 on the activation of RhoA, Rac1, and Cdc42 was examined by a low molecular weight GTPase activity assay. As shown in FIG. 3, overexpression of GEF10 causes an increase in GTP-bound RhoA, indicating that GEF10 can activate RhoA. In contrast, overexpression of GEF10 had no effect on GTP-bound Rac1 or Cdc42. Since Sp1 is expressed in large numbers in many tissues, subjects with disease-susceptible haplotypes are expected to express ARHGEF10 transcripts higher and consequently the RhoA-Rho kinase pathway is more active.

Example 3 Sensitive Haplotype Increases Ischemic Stroke Prevalence Finally, the effect of this functional haplotype on ischemic stroke prevalence was examined using a population-based cohort study. During the 14-year follow-up period of the cohort, 67 cases of the first ischemic stroke were observed among 1,656 subjects who did not have a history of stroke at the baseline survey. FIG. 4 is a Kaplan-Meier estimate of the prevalence of ischemic stroke due to functional haplotypes. The cumulative morbidity in subjects with at least one sensitive haplotype was 6.1%, and the cumulative morbidity in subjects without a sensitive haplotype was 3.6%. The risk of atherothrombotic cerebral infarction, adjusted for age and sex, was significantly higher in subjects with sensitive haplotypes (risk 1.79, 95% CI: 1.05-3.04).

[Example 4] SNP on GABBR1 is associated with cerebral infarction A case-control study using a large-scale tag-SNP marker found that GABBR1 is highly associated with cerebral infarction (Table 6-1). ~ Table 6-3).

Table 6-2 is a continuation table of Table 6-1.

Table 6-3 is a continuation table of Table 6-2.

  It is known that GABBR1 forms a GABA B receptor by heterozygous with GABBR2, which is a family gene. In addition, GABBR1, which was identified as a cerebral infarction-related gene by the tag-SNP marker, was sequenced for exon, UTR and its neighboring regions in the candidate region, and several related SNPs were found. The upper part of FIG. 5 plots the lowest p-value logarithmically converted from the allele frequency, dominant or recessive model for each SNP near the GABBR1 gene on the y-axis and the position on the chromosome on the x-axis. Yes. The lower part shows linkage disequilibrium between SNPs measured by Δ using Haploview ver3.32.

[Example 5] Exon 15-deficient GABBR1 is expressed in vascular smooth muscle cells
A) Confirmation of the presence or absence of exon 15 by PCR method cDNA derived from human fetal brain, thoracic aortic vascular smooth muscle cells, coronary vascular smooth muscle cells, thoracic aortic vascular endothelial cells, coronary vascular endothelial cells and cerebral vascular endothelial cells It was confirmed whether Exon 15 was possessed by performing PCR reaction by the method.

  Primers used: Forward side sequence CAGGGTGGCAGCTACAAGAAG (SEQ ID NO: 10), reverse side sequence GTTGGGCTGTGAGTTCTGGATATAA (SEQ ID NO: 11), and EXPRESS qPCR SuperMix Universal (invitrogen) as a reagent for PCR. Primers were designed so that amplification products were observed at 258 bp when Exon 15 was retained and at 107 bp when it was missing.

  As a result, exon 15 was retained in the fetal brain and exon 15 deficient in other vascular cells (FIG. 6). Of the SNPs that were strongly correlated with cerebral infarction, 6 were present on GABBR1. If you have Exon 15, rs2267633, SNP-A445, SNP-A1226 and rs3025640 are in the 3'-UTR region, rs2076489 and rs29230 are in exon 16, and the two SNPs on exon are amino acids Is coded. On the other hand, when exon 15 is lost, rs2076489 and rs29230 are also included in the 3′-UTR region due to the frame shift. That is, when exon 15 is deleted, these 6 SNPs are all present in the 3′-UTR region.

B) Detection at protein level by Western Blotting method Human thoracic aortic vascular smooth muscle cells and coronary vascular smooth muscle cells (both purchased from Takara Bio Inc.) were seeded in 6 cm culture dishes. Thoracic aortic vascular smooth muscle cells 4 days after seeding, coronary vascular smooth muscle cells 3 days after seeding using the ProteoExtract Transmembrane Protein Extraction Kit (Novagen) according to the manufacturer's instructions, soluble fraction (C) and membrane fraction Fractionated into (M). When the solubility and membrane fraction of both cells were examined with an anti-GABBR1 antibody (Abnova H00002550-M01) by Western blotting, a smaller band was obtained than when GABBR1 isoform e was transiently forced to express in HEK293T cells. Detected (FIG. 7).

  When combined with the results of A) above, human thoracic aortic vascular smooth muscle cells and coronary vascular smooth muscle cells have different molecular weights but have GABBR1 protein similar to isoform e in that exon 15 is missing. It was thought that All cells were incubated in humidified air at 37 ° C. containing 5% carbon dioxide, and the media was in accordance with the supplier's instructions.

[Example 6] GABBR2 is highly expressed in vascular smooth muscle cells in the growth phase
A) Variation in expression with culture period Human thoracic aortic vascular smooth muscle cells and coronary vascular smooth muscle cells were seeded in 24-well culture dishes. Thoracic aortic vascular smooth muscle cells were extracted 2, 4, 7 and 9 days after seeding, and coronary vascular smooth muscle cells were extracted at 2, 3, 6 and 8 days after seeding, and subjected to reverse transcription with random primers. cDNA was obtained. The relative mRNA expression level of GABBR1, GABBR2 or α-actin was calculated by the ratio with the expression level of GAPDH in the same cDNA sample (FIG. 8). In addition, the following reagents and apparatus were used for qPCR measurement of each gene. GABBR1: Assay ID Hs00559488 (Applied Biosystems), GABBR2: Assay ID Hs00193804 (Applied Biosystems), a-actin: Assay ID Hs00426835 (Applied Biosystems) Device: 7500 Fast Real-Time PCR System (Applied Biosystems)

B) Variation in expression by medium Human coronary vascular smooth muscle cells were seeded in 24-well culture dishes. Coronary vascular smooth muscle cells were cultured for 2 days according to the supplier's instructions. Two days later, some cells were replaced with fresh medium having the same composition, and some were replaced with medium (basic medium) excluding all growth stimulating factors including bovine serum.

  The next day (3 days after seeding), mRNA was extracted, and qPCR measurement of GABBR1 and GABBR2 was performed by the same method as above, and the relative mRNA expression level with GAPDH was calculated (FIG. 9).

Claims (32)

  A test method for determining whether or not there is a risk predisposition to arteriosclerotic disease, characterized by using the expression of ARHGEF10 gene in a subject as an index.   A method for examining whether or not a subject has a risk predisposition to arteriosclerotic disease, comprising detecting a DNA mutation in the ARHGEF10 gene.   The test method according to claim 2, wherein the mutation is a mutation that changes binding to an Sp1 transcription factor.   A method for examining whether or not a subject has a risk predisposition to arteriosclerotic disease, comprising detecting a DNA mutation in the GABBR1 gene.   The inspection method according to claim 2, wherein the mutation is a polymorphic mutation.   A test method for determining whether or not the subject has a risk predisposition to arteriosclerotic disease, comprising determining a base type of a polymorphic site in the GABBR1 gene.   The polymorphic site is a site on the GABBR1 gene, and (1a) position 1, (2a) position 4572, (3a) position 7333, (4a) position 7599, (5a) in the nucleotide sequence set forth in SEQ ID NO: 1. 7. A polymorphic site at position 7775, (6a) 8114, (7a) 8479, (8a) 10188, (9a) 13327, (10a) 13371, or (11a) 15463. Inspection method described in 1. When the base type in the polymorphic site according to (1a) to (11a) of claim 7 is the following (1b) to (11b) respectively, the subject has a risk predisposition to arteriosclerotic disease The inspection method according to claim 7, wherein the inspection method is determined.
(1b) a site on the GABBR1 gene, wherein the base species at position 1 of the base sequence set forth in SEQ ID NO: 1 is T
(2b) a site on the GABBR1 gene, wherein the base type at position 4572 of the base sequence set forth in SEQ ID NO: 1 is A
(3b) a site on the GABBR1 gene and the base type at position 7333 of the base sequence set forth in SEQ ID NO: 1 is G
(4b) a site on the GABBR1 gene, the base type at position 7599 of the base sequence set forth in SEQ ID NO: 1 is C
(5b) a site on GABBR1 gene, the base type at position 7775 of the base sequence set forth in SEQ ID NO: 1 is A
(6b) a site on the GABBR1 gene, the base type at position 8114 of the base sequence set forth in SEQ ID NO: 1 is G
(7b) A site on the GABBR1 gene, the base type at position 8479 of the base sequence set forth in SEQ ID NO: 1 is A
(8b) a site on the GABBR1 gene and the base type at position 10188 of the base sequence set forth in SEQ ID NO: 1 is G
(9b) A site on the GABBR1 gene, the base type at position 13327 of the base sequence set forth in SEQ ID NO: 1 is A
(10b) a site on the GABBR1 gene, wherein the nucleotide type at position 13371 of the nucleotide sequence set forth in SEQ ID NO: 1 is T
(11b) A site on the GABBR1 gene, the base type at position 15463 of the base sequence set forth in SEQ ID NO: 1 is C A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, wherein a DNA block showing a haplotype described in any of (A) to (C) below is detected: A method determined to have a risk predisposition to arteriosclerotic disease.
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, which are present in a DNA block showing a haplotype described in any of (A) to (C) below and linked to each other An inspection method comprising a step of determining a base type of a polymorphic site characterized by the above.
(A) The polymorphic sites on the GABBR1 gene, the base types of the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are Haplotype (B) GABBR1 gene polymorphic sites that are A, A, G, A, A, and C, respectively, at positions 7775, 8479, 10188 of the nucleotide sequence set forth in SEQ ID NO: 1, The polymorphic sites on the haplotype (C) GABBR1 gene in which the base species at the polymorphic sites at positions 13327, 13371, and 15463 are G, G, A, G, G, and G, respectively, : The base species in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence described in 1 are G, G, G, G, A, and C, respectively. Haplotype A method for examining whether a subject has a risk predisposition to arteriosclerotic disease, comprising the following steps (a) and (b).
(A) Step (b) for determining the base type for the polymorphic site on the GABBR1 gene in the subject, the base type determined in (a) is described in any of the following (A) to (C) When the base type of the polymorphic site in the GABBR1 gene showing the haplotype is determined to have a risk predisposition to arteriosclerotic disease (A), the polymorphic site on the GABBR1 gene, The base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are A, A, G, A, A, and C, respectively. Is a polymorphic site on the haplotype (B) GABBR1 gene in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the nucleotide sequence set forth in SEQ ID NO: 1. Haplotype (C) GABBR1 inheritance whose base species are G, G, A, G, G, and G, respectively The above polymorphic sites, wherein the base types in the polymorphic sites at positions 7775, 8479, 10188, 13327, 13371, and 15463 of the base sequence set forth in SEQ ID NO: 1 are G, G Haplotypes that are G, G, A, and C   The polymorphic site of (a) is a site on the GABBR1 gene, and the 1st, 4572, 7733, 7599, 7575, 8114, 8114, 8479 position in the nucleotide sequence set forth in SEQ ID NO: 1. The test method according to claim 11, which is a polymorphic site of any of positions 10188, 13327, 13371, or 15463.   A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, comprising determining a base type of a polymorphic site in the ARHGEF10 gene.   The test method according to claim 13, wherein the polymorphic site is a site on the ARHGEF10 gene and is the polymorphic site at position (1a) 2225 in the base sequence set forth in SEQ ID NO: 2. The subject is determined to have a risk predisposition to arteriosclerotic disease when the base species in the polymorphic site according to (1a) of claim 14 is the following (1b): Inspection method described.
(1b) A site on the ARHGEF10 gene, the base species at position 2225 of the base sequence shown in SEQ ID NO: 2 is G A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, wherein the risk predisposition to arteriosclerotic disease is detected when a DNA block having a haplotype described in (A) below is detected Method determined to have
(A) A haplotype that is a polymorphic site on the ARHGEF10 gene, and whose base types in the polymorphic sites at positions 2222 and 2225 of the nucleotide sequence set forth in SEQ ID NO: 2 are C and G, respectively. A test method for determining whether or not a subject has a risk predisposition to arteriosclerotic disease, wherein the subject is present in a DNA block showing a haplotype described in (A) below and is linked to each other. A test method comprising a step of determining a base type of a site.
(A) A haplotype that is a polymorphic site on the ARHGEF10 gene and whose base types at the 2222 and 2225 polymorphic sites of the base sequence shown in SEQ ID NO: 2 are C and G, respectively. A method for examining whether a subject has a risk predisposition to arteriosclerotic disease, comprising the following steps (a) and (b).
(A) Steps (b) and (a) for determining the base type for the polymorphic site on the ARHGEF10 gene in the subject, the base type determined in the ARHGEF10 gene showing the haplotype described in (A) below (A) a polymorphic site on the ARHGEF10 gene that is determined to have a risk predisposition to arteriosclerotic disease when it is the same as the base type of the polymorphic site, and is described in SEQ ID NO: 2 Haplotypes whose base types in the polymorphic sites at positions 2222 and 2225 are C and G, respectively.   The test method according to claim 18, wherein the polymorphic site of (a) is a site on the ARHGEF10 gene and is a polymorphic site at position 2222 or position 2225 in the base sequence described in SEQ ID NO: 2. .   The inspection method according to any one of claims 1 to 19, wherein a biological sample derived from a subject is used as a test sample.   An oligo that hybridizes to the polymorphic site according to (1a) to (11a) of claim 7 or the DNA containing the polymorphic site according to (1a) of claim 14 and has a chain length of at least 15 nucleotides The reagent for test | inspecting whether it has the risk predisposition of an arteriosclerosis disease containing a nucleotide.   It comprises a solid phase on which a nucleotide probe that hybridizes with the polymorphic site according to (1a) to (11a) of claim 7 or the DNA containing the polymorphic site according to (1a) of claim 14 is immobilized. A reagent for examining whether or not there is a risk predisposition to arteriosclerotic disease.   An arteriosclerosis comprising a polymorphic site according to (1a) to (11a) of claim 7 or a primer oligonucleotide for amplifying a DNA containing the polymorphic site according to (1a) of claim 14 A reagent for testing whether or not there is a risk predisposition to a disease. A reagent for testing whether or not it has a risk predisposition to arteriosclerotic disease, comprising the following (a) or (b) as an active ingredient.
(A) an oligonucleotide that hybridizes to a transcription product of the ARHGEF10 gene (b) an antibody that recognizes a protein encoded by the ARHGEF10 gene A reagent for screening a drug for treating or preventing arteriosclerotic disease, comprising the following (a) or (b) as an active ingredient.
(A) an oligonucleotide that hybridizes to a transcription product of the ARHGEF10 gene (b) an antibody that recognizes a protein encoded by the ARHGEF10 gene   A drug for treating or preventing arteriosclerotic disease, comprising as an active ingredient a substance that suppresses the expression of the ARHGEF10 gene or the function of the protein encoded by the gene. 27. The agent for treating or preventing arteriosclerotic disease according to claim 26, wherein the ARHGEF10 gene expression inhibitor is a compound selected from the group consisting of the following (a) to (c).
(A) An antisense nucleic acid for the transcript of the ARHGEF10 gene or a part thereof (b) A nucleic acid having a ribozyme activity that specifically cleaves the transcript of the ARHGEF10 gene (c) Has an inhibitory effect on the expression of the ARHGEF10 gene by the RNAi effect Nucleic acid 27. The agent for treating or preventing arteriosclerotic disease according to claim 26, wherein the function inhibitor of the protein encoded by the ARHGEF10 gene is the following compound (a) or (b):
(A) an antibody that binds to a protein encoded by the ARHGEF10 gene (b) a low molecular compound that binds to a protein encoded by the ARHGEF10 gene A drug for treating or preventing arteriosclerotic disease, comprising the following (a) or (b) as an active ingredient.
(A) GABA B receptor ligand formed by GABBR1 deficient in exon 15 (b) RhoA inhibitor   A method for screening a drug for treating or preventing arteriosclerotic disease, comprising selecting a compound that decreases the expression level of the ARHGEF10 gene or the activity of a protein encoded by the gene. A method for screening a drug for treating or preventing an arteriosclerotic disease, comprising the following steps (a) to (c):
(A) a step of bringing a test compound into contact with a cell expressing the ARHGEF10 gene (b) a step of measuring the expression level of the ARHGEF10 gene (c) as compared with the case where the test compound is measured in the absence of the test compound, Selecting a compound that decreases the expression level A method for screening a drug for treating or preventing an arteriosclerotic disease, comprising the following steps (a) to (c):
(A) a step of bringing a test compound into contact with a cell or cell extract containing DNA having a structure in which a transcriptional regulatory region of the ARHGEF10 gene and a reporter gene are functionally linked, and (b) measuring the expression level of the reporter gene (C) a step of selecting a compound that reduces the expression level as compared to the case of measurement in the absence of the test compound