JP2011067137A - Modified type formaldehyde dehydrogenase and utilization thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a formaldehyde dehydrogenase having excellent thermostability even under high-temperature conditions. <P>SOLUTION: The modified type formaldehyde dehydrogenase is obtained by modification according to deletion, substitution, addition or insertion of an amino acid in at least one position in an amino acid sequence of a wild type formaldehyde dehydrogenase. The modification occurs in the seventieth to the 150th positions in the amino acid sequence of the wild type formaldehyde dehydrogenase, and the stability is improved as compared with that of the wild type formaldehyde dehydrogenase. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a modified formaldehyde dehydrogenase and use thereof. More specifically, the present invention relates to a modified formaldehyde dehydrogenase, a gene encoding the enzyme, a biosensor containing the enzyme, and an enzyme fuel cell.

  Formaldehyde dehydrogenase (EC 1.2.1.46) (Formaldehyde dehydrogenase: FDH) catalyzes a reaction of oxidizing formaldehyde to produce formic acid. Formaldehyde, which is a substrate for formaldehyde dehydrogenase, is known as one of causative substances that cause chronic allergic symptoms such as sick house syndrome. It is also known as a cytotoxin because it has the effect of irreversibly coagulating cytoplasmic proteins even in dilute solutions, stopping and killing all cell functions. Therefore, it is required to measure formaldehyde in food, air, etc., and to decompose and remove it, and the use of the enzyme activity of formaldehyde dehydrogenase is being studied. For example, it is expected to be applied particularly in the field of environmental technology, such as formaldehyde measurement technology such as quantitative determination of formaldehyde in biological samples, and formaldehyde removal technology such as an air purification filter in which formaldehyde dehydrogenase is immobilized.

  For example, utilization as an enzyme for biosensors that can easily detect and measure aldehyde compounds such as formaldehyde and alcohol compounds has been reported (see, for example, Patent Document 1). Specifically, an enzyme-immobilized biosensor that can easily detect and measure aldehyde compounds and alcohol compounds in the gas phase or liquid phase has been disclosed. This is because alcohol oxidase is immobilized on the surface of a hydrogen peroxide electrode. In addition, a polymer coating is disposed on the outermost surface, and the presence of an aldehyde compound or an alcohol compound is detected from the oxidation current value of hydrogen peroxide or a change thereof.

In recent years, as a clean energy technique, an enzyme fuel cell using biomass such as alcohol as a fuel has been devised, and an oxidoreductase is used as a component of the cell. As an example, in the case of an enzyme fuel cell using methanol as a fuel, alcohol dehydrogenase that acts on methanol as a catalyst to oxidize to formaldehyde, formaldehyde dehydrogenase that acts on formaldehyde to oxidize to formic acid, and acts on formic acid to produce CO ₂ . It can be constituted by using formate dehydrogenase which oxidizes. As a result, methanol is decomposed to CO ₂ and a total of 6 electrons are generated by three-stage oxidation reaction per molecule of methanol.

Formaldehyde dehydrogenase is known to exist widely from bacteria and yeast to mammals, and various formaldehyde dehydrogenases derived from organisms have been reported. For example, a formaldehyde dehydrogenase derived from Saccharomyces Cerevisiae (for example, see Non-Patent Document 1) and a formaldehyde dehydrogenase derived from Paracoccus denitrificans (for example, non-baking yeast) And a formaldehyde dehydrogenase derived from Pseudomonas putida (see, for example, Non-Patent Document 3).

  There are two types of formaldehyde dehydrogenases: glutathione dependence that requires glutathione in the reaction and non-dependency that does not require glutathione. In general, formaldehyde dehydrogenase that is widely present is dependent on glutathione, whereas formaldehyde dehydrogenase derived from Pseudomonas putida is a characteristic enzyme that catalyzes the oxidation-reduction reaction of formaldehyde independently of glutathione. It has been known. This formaldehyde dehydrogenase has been reported to be a homotetrameric enzyme in which each subunit is composed of 376 amino acid residues (see, for example, Non-Patent Document 3) and X-ray crystal structure analysis. Results have been reported, and higher-order structures including active centers have been clarified (for example, see Non-Patent Document 4).

The above conventional documents all relate to wild-type formaldehyde dehydrogenase that exists in nature. On the other hand, there is also a report that the structure of an enzyme is modified using a molecular evolution engineering technique to lower the optimum temperature for enzyme activity (Non-patent Document 5). This is one in which an amino acid mutation was introduced into a wild-type formaldehyde dehydrogenase derived from Pseudomonas putida , and the enzyme activity was improved 1.7 times over the wild-type enzyme in a temperature range as low as about 30 ° C.

  However, it is known that not only formaldehyde dehydrogenase but also an enzyme has a very strong property of selecting a catalytic action. For example, an enzyme exerts the most enzyme activity under mild conditions in which the living body can survive, and has a mechanism that is metabolized in the living body. Therefore, a factor that changes the protein structure constituting the enzyme. The activity of the enzyme is affected by the presence of. That is, the enzyme activity is known to be affected by physical conditions such as temperature, and chemical conditions such as pH and salt concentration, and its use is limited because of its low stability. there were. And since all conventionally well-known formaldehyde dehydrogenases are the wild-type enzymes which exist naturally, stability with respect to heat was low.

  However, for application to biosensors and fuel cells, enzymes that can stably maintain activity in various environments are indispensable, and in particular, improvement in thermal stability, which is said to have a correlation with enzyme life, is required. The All of the conventionally known naturally occurring wild-type formaldehyde dehydrogenases (Non-Patent Documents 1 to 4) have low heat stability. In addition, the formaldehyde dehydrogenase (Non-Patent Document 5), which is a modified form of wild-type formaldehyde dehydrogenase, has a lower thermal stability than the wild-type enzyme at high temperatures because the optimum temperature for activity is lowered. It is lowered, and heat inactivation of the enzyme is likely to occur.

  Therefore, when a conventionally known formaldehyde dehydrogenase is applied to a biosensor or a fuel cell, the storage stability of the enzyme is low, and the amount of enzyme used increases and the accuracy decreases due to thermal inactivation of the enzyme. It was not enough to meet market demands. Therefore, it has been desired to provide a formaldehyde dehydrogenase that can act stably even under high temperature conditions.

JP 2007-139729 A

Steinman CR. Jakoby WB. “Yeast aldehyde dehydrogenase. II. Properties of the homogeneous enzyme preparations.” J Biol Chem., 1968, 243, 730-734. Ras J. Van Ophem PW. Reijnders WN. Van Spanning RJ. Duine JA. Stouthamer AH. Harms N., “Isolation, sequencing, and mutagenesis of the gene encoding NAD- and glutathione-dependent formaldehyde dehydrogenase (GD-FALDH) from Paracoccus denitrificans, in which GD-FALDH is essential for methylotrophicgrowth. ”J Bacteriol., 1995, 177, 247-251 Ito K. Takahashi M. Yoshimoto T. Tsuru D., “Cloning and high-level expression of the glutathione-independent formaldehyde dehydrogenase gene from Pseudomonas putida.” J Bacteriol. 1994, 176, 2483-2491. Tanaka N. Kusakabe Y. Ito K. Yoshimoto T. Nakamura KT., “Crystal structure of formaldehyde dehydrogenase from Pseudomonas putida: the structural origin of the tightly bound cofactor in nicotinoprotein dehydrogenases.” J. Mol. Biol., 2002. 324, 519-533 Fujii Y, Yamasaki Y, Matsumoto M, Nishida H, Hada M, Ohkubo K., “The artificial evolution of an enzyme by random mutagenesis: the development of formaldehyde dehydrogenase.” Biosci Biotechnol Biochem. 2004, 68 (8), 1722 -1727.

  This invention is made | formed in view of the said situation, and it is providing the formaldehyde dehydrogenase excellent in thermal stability also under high temperature conditions.

  As a result of repeated studies to solve the above-mentioned problems, the present inventors have substituted wild-type formaldehyde by substituting at least one amino acid in a specific amino acid sequence region of wild-type formaldehyde dehydrogenase with another amino acid. It was found that thermostability and storage stability can be improved compared to dehydrogenase. Furthermore, it has also been found that the use of such an enzyme can overcome the drawbacks related to the thermal stability of conventional enzymes and provide a biosensor and fuel cell for detecting aldehyde that are more practically advantageous. Based on these findings, the present inventors have completed the present invention.

That is, in order to achieve the above object, the following inventions [1] to [13] are provided.
[1] A modified formaldehyde dehydrogenase obtained by modification by deletion, substitution, addition or insertion of an amino acid at at least one position in the amino acid sequence of wild-type formaldehyde dehydrogenase, wherein the modification is A modified formaldehyde dehydrogenase, which is generated at positions 70 to 150 in the amino acid sequence of the formaldehyde dehydrogenase and has improved stability compared to the wild-type formaldehyde dehydrogenase.
[2] The modified formaldehyde dehydrogenase according to [1], wherein the modification occurs at a position corresponding to position 128 of the amino acid sequence.
[3] The modified formaldehyde dehydrogenase according to the above [2], wherein the modification is substitution of aspartic acid with glycine at a position corresponding to position 128 of the amino acid sequence.
[4] The modified formaldehyde dehydrogenase according to [1], wherein the modification occurs at a position corresponding to position 110 of the amino acid sequence.
[5] The modified formaldehyde dehydrogenase according to [4], wherein the modification is substitution of glycine with aspartic acid at a position corresponding to position 110 of the amino acid sequence.
[6] The modified formaldehyde dehydrogenase according to any one of [1] to [5], wherein the wild-type formaldehyde dehydrogenase has the amino acid sequence shown in SEQ ID NO: 2.
[7] An isolated nucleic acid molecule encoding the modified formaldehyde dehydrogenase according to any one of [1] to [6].
[8] A recombinant vector containing the isolated nucleic acid molecule according to [7] above.
[9] A transformant containing the recombinant vector according to [8] above.
[10] A wild-type formaldehyde dehydrogenase comprising the steps of culturing the transformant according to [9] above, and collecting a protein having an ability to catalyze a dehydrogenation reaction of formaldehyde from the obtained culture. A method for producing a modified formaldehyde dehydrogenase having improved thermostability compared to

The modified formaldehyde dehydrogenase having the configuration of [1] to [10] is positioned at positions 70 to 150 in the amino acid sequence of wild-type formaldehyde dehydrogenase (specifically, the amino acid sequence shown in SEQ ID NO: 2). Any one of these amino acids is modified.
This position is close to the binding site of Zn, which is an enzyme prosthetic molecule, and away from the vicinity of the interface between enzyme subunits. It is known that the binding stability of prosthetic molecules such as Zn has a great influence on the stabilization of protein structure, and it is generally considered that introduction of amino acid mutations should be avoided. However, a novel formaldehyde dehydrogenase with improved thermal stability can be provided by modifying the amino acid at a position close to the Zn binding site as in the present application.
Preferably, if the modification is a substitution of glycine with aspartic acid at a position corresponding to position 128 of the amino acid sequence, or a substitution of glycine with aspartic acid at a position corresponding to position 110. Compared to formaldehyde dehydrogenase, it has remarkable thermal stability and long-term stability.
Therefore, the formaldehyde dehydrogenase provided by the present invention can be applied to a technique requiring a dehydrogenation reaction of formaldehyde in various industrial fields such as medical, food and environmental fields. Furthermore, since the amino acid sequence and base sequence of the modified formaldehyde dehydrogenase of the present invention with improved thermostability and high practicality have been clarified, the enzyme can be used as a recombinant using genetic engineering techniques. Can be mass-produced industrially at low cost.

[11] A method for detecting an aldehyde compound, wherein the aldehyde compound is detected using the catalytic activity of the modified formaldehyde dehydrogenase according to any one of [1] to [6].

  According to the configuration of [11] above, a method for detecting an aldehyde compound using the catalytic ability of the modified formaldehyde dehydrogenase of the present invention can be provided, and can be used in various fields such as medical, food, and environmental fields. it can. In particular, since the modified formaldehyde dehydrogenase of the present invention has high thermal stability, it is possible to improve measurement accuracy without degrading the catalytic ability of the enzyme. Furthermore, since the amount of enzyme used can also be reduced, a cost reduction effect is also achieved.

[12] An enzyme sensor in which the modified formaldehyde dehydrogenase according to any one of [1] to [6] is immobilized on an electrode.

  According to the configuration of the above [12], an enzyme sensor for detecting an aldehyde compound using the catalytic ability of the modified formaldehyde dehydrogenase of the present invention can be provided and used in various fields such as medical, food and environmental fields. be able to. In particular, since the modified formaldehyde dehydrogenase of the present invention has high thermal stability, it is possible to improve measurement accuracy without degrading the catalytic ability of the enzyme. Furthermore, since the amount of enzyme used can also be reduced, a cost reduction effect is also achieved.

[13] An anode containing the modified formaldehyde dehydrogenase according to any one of [1] to [6], and receiving electrons generated by an oxidation reaction of an aldehyde compound of the modified formaldehyde dehydrogenase A fuel cell comprising a cathode, a cathode that holds either a catalyst capable of transferring electrons to oxygen or an enzyme, and the anode and the cathode are electrically coupled.

  According to the configuration of [13] above, a fuel cell utilizing the catalytic ability of the modified formaldehyde dehydrogenase of the present invention can be provided. In particular, since the modified formaldehyde dehydrogenase of the present invention has high thermal stability, it is possible to continuously generate power without degrading the catalytic ability of the enzyme, thereby improving the performance of the fuel cell. Furthermore, since the amount of enzyme used can also be reduced, a cost reduction effect is also achieved.

It is a figure which shows the preparation outline of a mutant gene library. It is a figure which shows the position where each primer couple | bonds in a wild type FDH gene and its vicinity region. It is the figure which showed the result of having performed the structure analysis of wild type FDH. It is the figure which showed the result of having performed the structural analysis of D128G ((a) wild type FDH, (b) D128G). It is the figure which showed the result of having performed the structural analysis of G110D. It is the figure which showed the result of the acrylamide gel electrophoresis of purified D128G and wild type FDH. It is the figure which showed the result of having investigated the pH dependence of D128G and wild type FDH. It is the figure which showed the result of having investigated the temperature dependence of modified type FDH and wild type FDH ((a) D128G, (b) G110D). It is the figure which showed the result of having investigated the temperature stability of D128G and wild type FDH ((a) 55 degreeC, (b) 60 degreeC, (c) 65 degreeC). It is the figure which showed the result of having investigated the temperature stability of G110D and wild type FDH ((a) 55 degreeC, (b) 60 degreeC, (c) 65 degreeC). It is the figure which showed the result of having investigated stability of modified type FDH and wild type FDH ((a) comparison of D128G and wild type FDH, (b) comparison of G110D and wild type FDH). It is the figure which showed the result of having investigated stability at normal temperature (25 degreeC) about D128G and wild type FDH. It is the figure which showed the result of having investigated stability at the time of normal temperature (30 degreeC) about D128G and wild type FDH.

Hereinafter, the present invention will be described in detail.
In recent years, an enzyme fuel cell using biomass such as alcohol as a fuel has been devised as a clean energy technology, where an enzyme that catalyzes oxidation / reduction such as formaldehyde dehydrogenase of the present invention is used as an electrode catalyst for the cell. Has been. For example, in the case of an enzyme fuel cell using methanol as fuel, alcohol dehydrogenase that acts on methanol as a catalyst to oxidize to formaldehyde, formaldehyde dehydrogenase that acts on formaldehyde to oxidize to formic acid, and acts on formic acid to produce CO ₂ . Oxidizing formate dehydrogenase can be used. As a result, methanol is decomposed to CO _2, and a total of 6 electrons are generated by a three-stage oxidation reaction per molecule of methanol.

  The modified formaldehyde dehydrogenase (hereinafter abbreviated as “modified FDH”) of the present invention is a deletion, substitution, addition or insertion of an amino acid at least at one position in the amino acid sequence of a naturally occurring wild-type FDH. And has improved thermal stability compared to wild type FDH. Here, “modification by deletion, substitution, addition or insertion of an amino acid at at least one position” means a known DNA recombination technique and a point mutation introduction method for a gene encoding a protein that is the basis of the modification. The number of amino acids that can be deleted, substituted, added, or inserted by the same means is deleted, substituted, added, or inserted, and combinations thereof are also included. Therefore, the modified FDH may have one of these modifications or may be a combination of two or more. Such modifications can be introduced artificially or can occur unintentionally in nature. Therefore, the modified FDH in the present invention includes both modified types.

  Wild-type FDH means that the amino acid sequence of FDH isolated from nature and the base sequence of the nucleic acid molecule encoding the enzyme do not have a modification site where the modification is intentionally or unintentionally performed. means.

“FDH” is a protein having an activity of catalyzing a dehydrogenation reaction for producing formic acid using formaldehyde as a substrate, and requires nicotinamide adenine dinucleotide (NAD) as a coenzyme. The reaction formula is shown below.
Formaldehyde + NAD ⁺ (oxidized form) → Formic acid + NADH (reduced form) + H ⁺

  There are two types of FDH, glutathione-dependent and independent. In the present invention, all are targets, but glutathione independence is preferable.

The wild-type FDH serving as the basis of the modified type may be derived from any organism as long as it has the above properties. Specifically, Pseudomonas (Pseudomonas) genus Paracoccus (Paracoccus) genus Pyrococcus (Pyrococcus) etc. derived from bacteria, and Saccharomyces (Saccharomyces) genus FDH like from yeast and the like. Furthermore, FDH derived from mammals such as cattle ( Equus caballus ) and rats ( Rattus norvergicus ) is also included. Preferably, it is FDH derived from Pseudomonas putida , Saccharomyces cerevisiae , Paracoccus denitrificans . However, it is not limited to these.

  “Improved stability” means that the stability of the enzyme against heat and storage is improved, and that the catalytic function of the enzyme is deactivated and its activity is suppressed against heat treatment and storage for a certain period of time. Means. Specifically, it means that the modified FDH has a higher residual rate of the catalytic function of the enzyme maintained after being subjected to heat treatment or storage for a certain period than the wild type FDH. For example, assuming that the enzyme activity value at 25 ° C. at which the activity of wild-type FDH is maintained is 100%, the activity value after the heating treatment is calculated as the residual rate of enzyme activity. If this residual ratio is increased compared to wild-type FDH, it can be determined that the thermal stability of the enzyme has been improved. Moreover, when the residual rate at the time of the preservation | save for a fixed period has increased compared with wild-type FDH, it can be judged that the storage stability of the said enzyme improved. As an example, thermal stability that can maintain a residual activity of 60% or more, particularly 75% or more by heating at 50 ° C. for 30 minutes is preferable. Moreover, the storage stability which can maintain the residual activity of about 60 to 80% even after 30 hours of storage at 45 ° C for 10 hours is preferable.

  The modified FDH of the present invention is not limited to this, but preferred examples include those in which the modification occurs at positions 70 to 150 in the amino acid sequence of wild-type FDH.

  In the amino acid sequence of wild-type FDH, all the amino acid modifications at positions 70 to 150 having any modification at these positions are included in the present invention. Moreover, even if one amino acid in this position is modified, a plurality of amino acids in a plurality of positions may be modified.

  The amino acid sequence shown in SEQ ID NO: 2 is the amino acid sequence of wild-type FDH derived from Pseudomonas putida, but the same position of the homologue of the enzyme derived from other organisms is also modified FDH of the present invention. include.

Here, the modification is particularly preferably substitution with another amino acid. The other amino acid includes any amino acid other than the amino acid before substitution. However, from the viewpoint of protein function modification, an amino acid having a property different from that of the amino acid before substitution in terms of polarity, charge, hydrophilicity, hydrophobicity and the like is preferable.
For example, alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, and tryptophan are both classified as nonpolar amino acids and have similar properties to each other, but substitution with other amino acids has an effect on protein function. It is possible to give.
Examples of the uncharged amino acid include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
Acidic amino acids include aspartic acid and glutamic acid.
Examples of basic amino acids include lysine, arginine, and histidine.
Amino acid substitutions other than those in each of these groups are particularly expected to alter the function of the protein, but are not limited thereto.

  Preferably, in the amino acid sequence of wild-type FDH, substitution of aspartic acid with glycine at a position corresponding to position 128 of the amino acid sequence, or at a position corresponding to position 110 of the amino acid sequence in SEQ ID NO: 2 Illustrative is the replacement of glycine with aspartic acid.

  As an example, when Pseudomonas putida is used as wild-type FDH, the amino acid sequence in which the substitution at position 128 is performed is shown in SEQ ID NO: 4, and the amino acid sequence in which the substitution at position 110 is performed is shown in SEQ ID NO: 6.

Furthermore, as long as the properties of the above-mentioned modified FDH are maintained, an amino acid sequence having a modified site where a specific amino acid is modified may be included. Those skilled in the art can easily predict modifications that retain the enzyme activity of the modified FDH of the present invention upon modification of the amino acid sequence. Specifically, for example, in the case of amino acid substitution, an amino acid having properties similar to the amino acid before substitution in terms of polarity, charge, hydrophilicity, hydrophobicity, etc. can be substituted from the viewpoint of maintaining the protein structure. . Such substitutions are well known to those skilled in the art as conservative substitutions. For example, alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine and tryptophan are classified as nonpolar amino acids, and thus have similar properties to each other. Examples of the uncharged amino acid include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Examples of acidic amino acids include aspartic acid and glutamic acid. Examples of basic amino acids include lysine, arginine, and histidine. Amino acid substitutions within each of these groups are permissible as protein function is maintained.
In addition, for convenience such as subsequent purification and immobilization on a solid phase, those in which a His tag peptide, a FLAG tag peptide, or the like is added to the N- or C-terminus of the amino acid sequence are also preferably exemplified. Such tag peptide can be introduced by a conventional method. Moreover, the cut | disconnected type which cut | disconnected the amino acid residue of the C terminal side or the N terminal side may be sufficient as long as it does not cause the loss of the enzyme activity of this invention. Furthermore, chemical modification such as glucosylation may be added.

  The modified FDH of the present invention can be obtained by a known method. For example, a gene encoding a wild-type FDH that is the basis of the modification is modified, a host cell is transformed using the obtained modified gene, and a protein having the above activity from the culture of such a transformant Can be obtained by sampling.

  A gene encoding wild-type FDH that is the basis of modification can be obtained using a known gene cloning technique. For example, a primer is designed based on gene information that can be obtained by searching a known database such as GenBank, and is obtained by performing PCR using a genomic DNA extracted from an organism capable of producing FDH as a template. can do. It can also be obtained by synthesis by a nucleic acid synthesis method such as a conventional phosphoramidite method based on known gene information. Here, as FDH sequence information suitable as a basis for the modified type of the present invention, the amino acid sequence of FDH derived from wild-type Pseudomonas putida is represented by SEQ ID NO: 2 in the sequence listing, and the base sequence encoding the FDH is represented by the sequence listing. Is shown in SEQ ID NO: 1.

  The method for modifying the gene encoding wild-type FDH is not particularly limited, and mutagenesis techniques for preparing modified proteins known to those skilled in the art can be used. For example, a known mutagenesis technique such as a site-directed mutagenesis method, a PCR abrupt induction method that introduces a mutation using a PCR method, or a transposon insertion mutagenesis method can be used. A commercially available mutation introduction kit (for example, QuikChange (registered trademark) Site-directed Mutagenesis Kit (manufactured by Stratagene)) may be used.

  In particular, preferably obtained by performing PCR using a DNA encoding wild-type FDH as a template and an oligonucleotide containing a sequence subjected to a desired modification (deletion or substitution) as a primer. Here, in the preparation of the modified FDH of the present invention, the primer used when using PCR is designed to contain a sequence complementary to the nucleic acid molecule encoding the wild type FDH and to produce the desired modification. And can be prepared based on conventional methods. For example, a chemical synthesis method based on the phosphoramidite method or the like can be used. When preparing a primer based on a chemical synthesis method, it is designed based on the sequence information of the target nucleic acid prior to synthesis. The primer can be designed using, for example, primer design support software so as to amplify a desired region. After synthesis, the primer is purified by means such as HPLC. Moreover, when performing chemical synthesis, it is also possible to use a commercially available automatic synthesizer. Examples of such primers include oligonucleotides composed of 10 or more, preferably 15 or more, and more preferably about 20-50 bases.

  In addition, by determining the amino acid sequence of the target modified FDH, an appropriate base sequence encoding it can be determined, and the modified FDH of the present invention can be determined using a nucleic acid synthesis technique such as a conventional phosphoramidite method. Can be chemically synthesized.

  Such a modified FDH variant of the present invention can be obtained by screening a protein having the above-mentioned physicochemical properties from mutants generated by natural or artificial mutation.

(Nucleic acid molecule encoding the modified FDH of the present invention)
Nucleic acid molecules encoding the modified FDH of the present invention include those encoding all modified FDHs having the aforementioned physicochemical properties. For example, all polynucleotides encoding a protein comprising the amino acid sequence described in SEQ ID NOs: 4 and 6, and one specific example is a polynucleotide comprising the base sequence shown in SEQ ID NOs: 3 and 5, However, the present invention is not limited to this. Here, the polynucleotide in the present invention includes both DNA and RNA, and in the case of DNA, it does not matter if it is single-stranded or double-stranded.

  Since the nucleic acid molecule encoding the modified FDH of the present invention has been clarified in the present specification, a DNA synthesis method such as a conventional phosphoramidite method is used based on such sequence information. Can be synthesized chemically. It can also be produced by modifying the DNA encoding wild-type FDH that is the basis of modification. Details have been described above.

(Recombinant vector of the present invention)
The recombinant vector of the present invention can be constructed by incorporating a nucleic acid molecule encoding the modified FDH of the present invention into an appropriate vector. The vector that can be used is not particularly limited as long as it can incorporate foreign DNA and can replicate autonomously in a host cell. Accordingly, the vector contains a sequence of at least one restriction enzyme site into which a nucleic acid molecule encoding the modified FDH of the present invention can be inserted. For example, plasmid vectors (pEX system, pUC system, pBR system, etc.), phage vectors (λgt10, λgt11, λZAP, etc.), cosmid vectors, virus vectors (vaccinia virus, baculovirus, etc.) and the like are included.

The recombinant vector of the present invention is incorporated so that the nucleic acid molecule encoding the modified FDH of the present invention can express its function. Therefore, other known base sequences necessary for the functional expression of the nucleic acid molecule may be included. For example, a promoter sequence, a leader sequence, a signal sequence, a ribosome binding sequence and the like can be mentioned. As the promoter sequence, for example, when the host is Escherichia coli, lac promoter, trp promoter and the like are preferably exemplified. However, the present invention is not limited to this, and a known promoter sequence can be used.
Furthermore, the recombinant vector of the present invention can also include a marking sequence that can confer phenotypic selection in the host. Examples of such marking sequences include sequences encoding genes such as drug resistance and auxotrophy. Specifically, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene and the like are exemplified.

  The insertion of a nucleic acid molecule encoding the modified FDH of the present invention into a vector is performed by, for example, cleaving the gene of the present invention with an appropriate restriction enzyme and inserting it into a restriction enzyme site or a multiple cloning site of an appropriate vector. A method of coupling can be used, but is not limited thereto. For ligation, a known method such as a method using DNA ligase can be used. Commercially available ligation kits such as DNA Ligation Kit (Takara Bio Inc.) can also be used.

(Transformant of the present invention)
The transformant of the present invention can be constructed by transforming an appropriate cell with a recombinant vector containing a nucleic acid molecule encoding the modified FDH of the present invention. The host cell is not particularly limited as long as it is a host cell that can efficiently express the modified FDH of the present invention. Prokaryotes can suitably used, in particular, can be utilized E. coli E. Coli (DH5α, BL21, JM109 , etc.). In addition, Bacillus subtilis, Bacillus bacteria, Pseudomonas bacteria, and the like can also be used. Furthermore, eukaryotic cells can be used without being limited to prokaryotes. For example, yeasts such as Saccharomyces cerevisiae , insect cells such as Sf9 cells, animal cells such as CHO cells, COS-7 cells, and the like can be used. As a transformation method, a known method such as a calcium chloride method, an electroporation method, a liposome transfection method, a microinjection method, or the like can be used.

(Method for producing modified FDH of the present invention)
The method for producing the modified FDH of the present invention is performed by culturing the above-described transformant of the present invention and collecting a protein having an activity of catalyzing the dehydrogenation reaction of the aldehyde compound from the obtained culture. That is, the method includes a culture step of culturing the transformant of the present invention described above and a recovery step of recovering the protein expressed in the culture step. Thus, mass production of the modified FDH of the present invention can be achieved at low cost by expressing it in an appropriate host.

  The culturing step is carried out by inoculating the transformant of the present invention in an appropriate medium and culturing according to a conventional method. For the culture of the transformant of the present invention, the culture conditions may be selected in consideration of the nutritional physiological properties of the host cells. The medium to be used is not particularly limited as long as it contains nutrients that can be assimilated by the host cell and can efficiently express the protein in the transformant. Therefore, a medium containing a carbon source, a nitrogen source and other essential nutrients necessary for the growth of host cells is preferable, regardless of whether it is a natural medium or a synthetic medium.

  Examples of the carbon source include formaldehyde, dextran, starch, and the like, and examples of the nitrogen source include ammonium salts, nitrates, amino acids, peptone, and casein. As other nutrients, inorganic salts, vitamins, antibiotics, and the like can be included as desired. When the host cell is Escherichia coli, LB medium, M9 medium and the like can be preferably used. Moreover, although there is no restriction | limiting in particular also about a culture | cultivation form, A liquid medium can be utilized suitably from a viewpoint of mass culture.

  Selection of host cells carrying the recombinant vector of the present invention can be performed, for example, by the presence or absence of expression of a marking sequence. For example, when a drug resistance gene is used as the marking sequence, it can be performed by culturing in a drug-containing medium corresponding to the drug resistance gene.

  The purification step may be performed by recovering, that is, isolating and purifying the modified FDH of the present invention from the transformant culture obtained in the above-described culture step. Depending on the fraction in which the enzyme of the present invention is present, a technique according to a general protein isolation and purification method may be applied. Specifically, when the FDH of the present invention is produced outside the host cell, the culture solution is used as it is, or the host cell is removed by means such as centrifugation or filtration to obtain a culture supernatant. Subsequently, the enzyme of the present invention can be isolated and purified by appropriately selecting a known protein purification method for the culture supernatant.

  For example, known isolation and purification techniques such as ammonium sulfate precipitation, dialysis, SDS-PAGE electrophoresis, gel filtration, various types of chromatography such as hydrophobicity, anion, cation, and affinity chromatography can be applied alone or in appropriate combination. . In particular, when affinity chromatography is used, it is preferable to express the enzyme of the present invention as a fusion protein with a tag peptide such as His Tag and use the affinity for such tag peptide. In addition, when the modified FDH of the present invention is produced in a host cell, the host cell is recovered by means such as centrifugation and filtration of the culture.

Subsequently, the host cells are disrupted by an enzymatic disruption method such as lysozyme treatment or a physical disruption method such as ultrasonic treatment, freeze-thawing, and osmotic shock. After crushing, the solubilized fraction is collected by means such as centrifugation or filtration. The obtained solubilized fraction can be isolated and purified by treating in the same manner as in the case where it can be produced extracellularly. Here, since the modified FDH obtained in the present invention has high thermal stability, it is useful and convenient to use heat treatment in combination with the aforementioned isolation and purification steps.
The host cell and culture supernatant obtained from the culture contain various proteins derived from the host cell. However, the host cell-derived contaminating protein is denatured and condensed and precipitated by heat treatment. On the other hand, since the enzyme of the present invention has a modified form and does not cause denaturation, it can be easily separated from host-derived contaminating proteins by centrifugation or the like. In addition, even when the culture solution is used as it is or when a crude extract is used, other proteins are inactivated by heat treatment, so that it is substantially used as an enzyme solution of only the modified FDH of the present invention. be able to. Therefore, even when the modified FDH of the present invention is produced by a genetic engineering technique, other proteins derived from the host can be easily removed. Therefore, there is an advantage that the degree of purification can be improved and a highly reliable enzyme can be produced.

Whether the purified FDH is a modified FDH of the present invention having a modified site where a desired modification has occurred can be confirmed by analysis of its physicochemical properties and sequence. In the case of analysis of physicochemical properties, whether or not the residual activity rate is higher than that of wild-type FDH that has been subjected to heat treatment for a certain period and then measured for the enzyme activity of the enzyme by a known method and does not have a modified site. Can be done by checking. Therefore, it can be carried out by measuring the enzyme activity of dehydrogenating the aldehyde compound as a substrate in a NAD ⁺ dependent manner.

The activity of the enzyme can be performed using any method known as a method for measuring the activity of an enzyme that catalyzes a dehydrogenation reaction of an aldehyde compound in an NAD ⁺ dependent manner. For example, the enzyme of the present invention is reacted with an aldehyde compound in the presence of NAD ⁺ and a change in the amount of NADH produced by the catalytic reaction of the enzyme is detected with a change in absorbance at 340 nm. The change in absorbance can be used as the activity of the enzyme. Therefore, FDH activity can be measured by directly quantifying the produced NADH in a catalytic reaction that produces formic acid and NADH from formaldehyde and NAD ⁺ . That is, formaldehyde is oxidized to formic acid by an enzyme reaction, and at this time, NAD is reduced and NADH is generated (reaction formula: HCHO + NAD ⁺ + H ₂ O → HCOOH + NADH + H ⁺ ). The production of NADH from this NAD was determined as the enzyme activity by measuring the change in absorbance at 340 nm. In the case of this sequence analysis, it can be carried out by a known amino acid analysis method. For example, an automatic amino acid determination method based on Edman degradation can be used.

(Method of detecting aldehyde compound)
The modified FDH of the present invention can be used for detection of aldehyde compounds in a sample. The detection of the aldehyde compound can be performed, for example, by measuring an enzyme activity that causes a dehydrogenation reaction in an NAD ⁺ dependent manner with respect to the aldehyde compound as a substrate. The activity of the enzyme can be performed using any method known as a method for measuring the activity of an enzyme that catalyzes a dehydrogenation reaction of an aldehyde compound in a NAD ⁺ dependent manner. For example, the enzyme of the present invention is reacted with a sample to be measured in the presence of NAD ⁺ and a change in the amount of NADH produced by the catalytic reaction of the enzyme is detected with a change in absorbance at 340 nm. The change in absorbance can be used as the activity of the enzyme, and the presence of an aldehyde compound can be detected by a change in the amount of NADH. Therefore, FDH activity can be measured by directly quantifying the produced NADH in the catalytic reaction.
As the reaction solution, for example, an aldehyde substrate such as formaldehyde, 2 mM NAD ⁺ , 25 mM MgCl ₂ , 1 M NaCl and the enzyme solution of the present invention are mixed in a 50 mM phosphate buffer (pH 8.8). It can be prepared by making it 200 μL. However, this is a standard condition and can be changed as appropriate. The reaction solution can be subjected to an activity evaluation test by measuring the absorbance at 340 nm at 37 ° C. and determining the increase in absorbance. The absorbance is measured using a known microplate reader (manufactured by Molecular Devices). be able to.
And if appropriate test conditions are selected, this change is linearly proportional to the enzyme activity to be measured. At this time, the aldehyde compound concentration can be obtained based on the obtained absorbance change value by preparing a standard curve in advance with a standard concentration aldehyde compound solution within the target concentration range.

  Here, as a sample, all samples in which the presence of a compound that can serve as a substrate for FDH, such as an aldehyde compound, can be used. Examples include biological samples derived from organisms such as blood, urine, saliva, food samples, environmental samples, and the like, but are not limited thereto. Moreover, the sample which performed the appropriate process to these samples as needed may also be included. In particular, since the modified FDH of the present invention exhibits excellent thermal stability, it can be suitably used for analyzing a sample having a high temperature. And since preservability is also high, it can improve a measurement precision, without causing degradation of the enzyme activity of an enzyme, and since it can reduce an enzyme usage-amount, it can also show a cost reduction effect.

(Biosensor for detecting aldehyde compounds)
The present invention provides a biosensor for detecting an aldehyde compound using the modified FDH of the present invention. The detection sensor is configured by providing a working electrode in which the modified FDH of the present invention is immobilized on an electrode material, and a counter electrode thereof. If necessary, a three-electrode system may be configured by providing a reference electrode. As the electrode, carbon, gold, platinum or the like can be used. Immobilization of the enzyme on the electrode material can be performed by a known method. For example, it is possible to use a carrier binding method that is immobilized through physical adsorption, ionic bond, or covalent bond. In addition, a cross-linking method in which cross-linking and fixing is performed with a reagent having a divalent functional group such as glutaraldehyde can be used. Furthermore, polyaldehyde compounds such as alginic acid and carrageenan, gels having a network structure such as polyacrylamide, and semi-transparent materials can be used. It is also possible to use a comprehensive method that closes and immobilizes in a conductive membrane. Further, coenzyme NAD ⁺ required for the enzymatic activity of FDH of the present invention, oxidase (such as diaphorase) having the ability to oxidize NADH, which is a reduced form of NAD ⁺ , and electron mediator (such as ferrocene and dichloroindophenol) If necessary, it is configured to be fixed on the electrode material.

  In the measurement of the aldehyde compound, for example, when a sample to be measured is brought into contact, the aldehyde compound in the sample reacts with the modified FDH of the present invention immobilized on the working electrode, and then the electron mediator is reduced. Then, a voltage is applied to the electrode system to oxidize the reduced form of the electron acceptor, and the aldehyde compound in the sample can be detected by the change in the obtained oxidation current value. At this time, the aldehyde compound concentration can be determined based on the obtained oxidation current value by preparing a standard curve in advance with a standard concentration aldehyde compound solution within the target concentration range.

  Here, as a sample, all samples in which the presence of an aldehyde compound that can be a substrate of the modified FDH of the present invention can be used. Details are described above. In particular, as described above, the modified FDH of the present invention has high thermal stability and thus can prevent deterioration during the production of the biosensor, and also has high storage stability, so that the enzyme activity of the enzyme is deteriorated. Therefore, the measurement accuracy can be improved and the amount of enzyme used can be reduced, so that a cost reduction effect can be achieved.

(Fuel cell of the present invention)
The present invention provides a fuel cell using the modified FDH of the present invention. The fuel cell of the present invention includes, for example, an anode electrode that performs an oxidation reaction and a cathode electrode that performs a reduction reaction, and includes an electrolyte layer that separates the anode and the cathode as necessary.
On the anode electrode side, the modified FDH of the present invention extracts electrons generated by oxidizing the aldehyde compound to the electrode and generates protons. On the other hand, on the cathode side, the proton generated on the anode side reacts with oxygen to generate water. As the electrode, carbon, gold, platinum or the like can be used. The modified FDH of the present invention is supplied to the anode electrode side and may be supplied in a form dissolved in an appropriate buffer, but it is preferably immobilized on the electrode. At this time, the modified FDH is preferably immobilized together with NAD, and particularly preferably immobilized in the form of a holoenzyme linked to NAD. Moreover, it may be immobilized in the form of an apoenzyme and supplied in a form in which NAD is dissolved in an appropriate buffer.
A catalyst and an enzyme capable of transferring electrons to oxygen may be supplied to the cathode electrode side as necessary. The enzyme can be immobilized on the electrode material by a known method. For example, it is possible to use a carrier binding method that is immobilized through physical adsorption, ionic bond, or covalent bond. In addition, a cross-linking method in which cross-linking and fixing is performed with a reagent having a divalent functional group such as glutaraldehyde can be used. Furthermore, polyaldehyde compounds such as alginic acid and carrageenan, gels having a network structure such as polyacrylamide, and semi-transparent materials can be used. It is also possible to use a comprehensive method that closes and immobilizes in a conductive membrane.

  With the configuration described above, electrons generated when oxidizing the aldehyde compound that is the fuel deliver electrons to the anode electrode. Then, the electrons passed to the anode electrode reach the cathode electrode through an external circuit to generate a current. The aldehyde compound serving as a fuel is not limited as long as it is an aldehyde compound that can serve as a substrate for the modified FDH of the present invention.

The modified FDH of the present invention can also be used in an enzyme fuel cell using methanol as a fuel. In that case, in addition to the modified FDH of the present invention, if necessary, alcohol dehydrogenase that acts on methanol to oxidize to formaldehyde and formate dehydrogenase that acts on formic acid to oxidize to CO ₂ are used in combination. Can be configured.

  Since the fuel cell of the present invention utilizes the catalytic ability of the modified FDH of the present invention having high thermal stability, it can continuously generate power and can be constructed as a high-performance fuel cell. In addition, the modified FDH of the present invention has high thermal stability, so that it can prevent deterioration during the production of the fuel cell, and in turn can reduce the amount of enzyme used, which can also bring about a cost reduction effect.

<Example 1> Cloning of the modified FDH gene of the present invention The cloned FDH gene of the present invention was cloned using an enzyme modification technique called a molecular evolution engineering technique.

  Such molecular evolution engineering techniques are techniques that apply the principles of biological evolution to proteins. As a step, first, mutations are randomly introduced into the genes that are the basis of modification, and as many modified genes as possible are created. Then, a modified protein is prepared from the modified gene, and a gene encoding a protein having a desired property is selected from the modified protein. In this way, even if the design principle is unknown, it is possible to obtain a polymer that retains the desired function and properties, and by studying the mutation site and mutation mode of the acquired gene, research on the polymer design principle Can also show its power.

The three-dimensional structure of wild-type FDH derived from Pseudomonas putida has already been revealed by X-ray analysis, and each subunit has a tetramer structure consisting of 398 amino acid residues. The three-dimensional structure data of wild-type FDH used was published by the Japan Protein Structure Data Bank (http://www.rcsb.org/pdb/explore.do?structureId=1KOL). When the higher order structure based on the X-ray crystal structure analysis of the wild type FDH is examined, a loop region (K76-D79) exists near the interface of the subunit of the tetramer enzyme, and this region is a subunit in the higher order structure. It is suggested that it influences the mutual interaction and dominates the thermal stability.
As a result of earnest examination of the site where the effect of improving the thermal stability can be expected, the amino acid region of position 70 to position 150 (Thr70-Leu150) contributes to the structural stabilization between domains of the tetramer enzyme subunit interface. We thought that it was highly likely to be a spot, and we thought that we could obtain a mutant with optimized structure and improved thermal stability by creating a library with random mutations around this hot spot and conducting screening. . In addition, the three-dimensional structure analysis of a series of enzymes for these studies was performed using Insight-II (software that can display the molecular structure of the enzyme and calculate the structural energy) manufactured by Axcelis. The specific procedure for enzyme modification using molecular evolution engineering techniques is shown below.

(Step 1) Acquisition of Enzyme Gene Bacteria Pseudomonas putida strain was obtained from NITE (National Institute of Technology and Evaluation) (Accession Number NBRC No. NBRC3738). The genomic DNA was cultured and cultured using the culture solution described in the attached document, and extracted and purified using a genomic DNA extraction kit (Promega). Using this genomic DNA as a template, PCR reaction was performed using the following primers 1 and 2 (SEQ ID NOs: 7 and 8). PCR reaction is prepared by mixing PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.) as a polymerase, 50 ng genomic DNA as a template and each 0.2 μM primer, and measuring up to 50 μL with sterile distilled water. And performed according to the manufacturer's instructions. In the PCR reaction, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was repeated 30 times. For purification of the amplified product, a DNA purification kit (manufactured by GE Healthcare) was used. As a result, the expected DNA amplification product (about 1.2 kbp) could be obtained.

5'-GAGCA TATGT CTGGT AATCG TGGTG T-3 '(Primer 1: SEQ ID NO: 7)
5'-CTAAA GCTTA GGCCG CGCTG AGGTC T-3 '(Primer 2: SEQ ID NO: 8)

(Step 2) Construction of Expression Vector A DNA fragment (about 1.2 kbp) obtained by PCR amplification was cleaved with restriction enzymes NdeI and HindIII, separated by agarose gel electroflow, and purified from the gel. A DNA fragment was incorporated into restriction enzyme sites NdeI and HindIII of a pET23b vector (manufactured by Novagen), a plasmid for protein expression, by ligation reaction to construct an expression vector for the enzyme.
In addition, in order to prepare linear DNA as a template for enzyme synthesis using a cell-free system, a vector in which an enzyme gene was incorporated was used as a template, and the T7 promoter and T7 terminator sequences were amplified by PCR. The PCR reaction uses PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.) as a polymerase, and template DNA (50 ng) and primers 3 and 4 (SEQ ID NOs: 9 and 10, each 0.2 μM) are made up to 50 μL with sterile distilled water. To prepare a reaction solution, which was performed according to the manufacturer's instructions. In the PCR reaction, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was repeated 30 times. For purification of the PCR product, a DNA purification kit (manufactured by GE Healthcare) was used.

5'- ATCTCGATCCCGCGAAATTAATAC -3 '(Primer 3: SEQ ID NO: 9)
5'-TCCGGATATAGTTCCTCCTTTCAG-3 '(Primer 4: SEQ ID NO: 10)

(Step 3) Preparation of Mutant Gene Library In order to prepare a mutant gene library into which random mutations were introduced, error-prone PCR was used as a technique for introducing mutations. In order to create a library, conditions (error-prone PCR conditions with an error rate of around 0.5%) under which mutation introduction at one or two sites was obtained in the enzyme FDH molecule were examined. In order to promote the mistaken base incorporation of polymerase, the magnesium concentration and the manganese concentration were set to [Mg, Mn] = [5, 0.5] mM.
The error-prone PCR reaction was performed by using 2.5 units of Taq DNA polymerase (manufactured by Takara Bio Inc.), 0.5 μM each of primers 5 and 6 (SEQ ID NOs: 11 and 12), 10 mM Tris-HCl (pH 8.3) buffer, Reaction solutions were prepared by mixing 50 mM KCl, 5.0 mM MgCl ₂ and 0.5 mM MnCl ₂ and making up to 50 μL with sterilized distilled water, followed by the manufacturer's instructions.

5'-CGGCCTGGTCCTGGGCCACGAAATC-3 '(Primer 5: SEQ ID NO: 11)
5'-TGGCCTTGTCGCGCTCAGGCAGCTT-3 '(Primer 6: SEQ ID NO: 12)

Next, overlapping PCR was performed in order to link the FDH gene fragment into which mutation was randomly introduced by error-prone PCR and the DNA fragment encoding the remaining part of the FDH gene into which mutation was not introduced.
First, in order to obtain a DNA fragment into which no mutation is introduced, using the expression vector prepared in Step 2 as a template, primers 7, 8 (SEQ ID NOs: 13 and 14) and primers 9, 10 (SEQ ID NOs: 15 and 16) are used. PCR amplification was performed. In the PCR reaction, PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.), template DNA (50 ng) and primer (each 0.2 μM) are mixed as a polymerase and diluted to 50 μL with sterilized distilled water. Prepared and performed according to manufacturer's instructions. In the PCR reaction, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was repeated 30 times. For purification of the amplified product, a DNA purification kit (manufactured by GE Healthcare) was used.

5'- ATCTCGATCCCGCGAAATTAATAC -3 '(Primer 7: SEQ ID NO: 13)
5'-GATTTCGTGGCCCAGGACCAGGCCG-3 '(Primer 8: SEQ ID NO: 14)
5'-TCCGGATATAGTTCCTCCTTTCAG-3 '(Primer 9: SEQ ID NO: 15)
5'- AAGCTGCCTGAGCGCGACAAGGCCA -3 '(Primer 10: SEQ ID NO: 16)

PCR amplification was performed using the obtained three DNA fragments as templates and using primers 7 and 10, and then primers 11 and 12 (SEQ ID NOs: 17 and 18) using the PCR product contained in the reaction end solution as a template. PCR amplification was performed using In the PCR reaction, PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.), template DNA (50 ng) and primer (each 0.2 μM) are mixed as a polymerase and diluted to 50 μL with sterilized distilled water. Prepared and performed according to manufacturer's instructions. In the PCR reaction, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 60 seconds was repeated 30 times. For purification of the PCR product, a DNA purification kit (manufactured by GE Healthcare) was used.
Next, PCR amplification using primer 13 (SEQ ID NO: 19) was performed in order to add a primer sequence for single molecule PCR to the obtained DNA fragment encoding the enzyme gene. In the PCR reaction, PrimeSTAR GXL DNA Polymerase (manufactured by Takara Bio Inc.) and a primer (each 0.3 μM) were mixed as a polymerase and diluted to 50 μL with sterile distilled water to prepare a reaction solution. Followed instructions. In the PCR reaction, a cycle of 94 ° C. for 30 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 60 seconds was repeated 20 times. For purification of the PCR product, a DNA purification kit (manufactured by GE Healthcare) was used. 1 and 2 are schematic diagrams of the contents thus implemented.

5'-GGAGCTAGGGTTTACGAGTGGAATG-ATCTCGATCCCGCGAAATTAATAC-3 '(Primer 11, SEQ ID NO: 17)
5'-GGAGCTAGGGTTTACGAGTGGAATG-TCCGGATATAGTTCCTCCTTTCAG-3 '(Primer 12, SEQ ID NO: 18)
5'-GGAGCTAGGGTTTACGAGTGGAATG-3 '(Primer 13, SEQ ID NO: 19)

  As described above, a mutant gene library in which mutation was introduced into a hot spot (amino acid region Thr70-Leu150) in the coding region of the gene encoding FDH was prepared. The mutant gene library was diluted to 1.5 molecules / μL with a diluent containing dextran, and dispensed into 384 plates. Thereafter, PCR amplification was performed with a 1 μL dilution / 1 reaction well. The calculation formula used to calculate the dilution ratio of the mutant gene library is shown below.

DNA length: 1400 bp
Molecular weight: 0.924 × 10 ⁶
1 μg DNA: 1.08 × 10 ⁻⁶ μmol = 1.08 × 10 ⁻¹² mol
1 μg DNA: equivalent to 6.02 × 10 ²³ × 1.08 × 10 ⁻¹² = 6.5 × 10 ¹¹ molecules

From this calculation, the DNA solution obtained by gel-cutting and purifying the mutant gene (DNA) can be calculated to be 9.1 × 10 ⁹ molecules / μL, and this DNA solution diluted 3 × 10 ^{9 is} used as a template for the next PCR reaction. Used for DNA. As the PCR reaction temperature conditions, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 1 minute was repeated 70 times, and then an extension reaction was performed at 68 ° C. for 10 minutes.

(Step 4) Enzyme synthesis and screening using cell-free protein synthesis system Rabbit translation system RTS100, E.coli HY kit (Roche) according to the instruction manual, reaction time is 4 hours, reaction temperature is 30 Modified FDH was synthesized under the basic condition of ° C.
Using the mutant gene library as a template, proteins are synthesized in a cell-free protein synthesis system of Escherichia coli, screened for enzyme activity against formaldehyde using the above-mentioned conditions, and the enzyme activity whose residual activity after heat treatment is higher than that of wild type FDH A candidate gene for a modified FDH that expresses was selected.

The enzyme activity was measured by mixing 8 μL of the enzyme synthesis end solution with 32 μL of phosphate buffer to make 40 μL, and transferring 16 μL to two new 384-well plates using a dispensing device. One of the two plates was heat-treated (15 minutes, 55 ° C.), then left on ice for 15 minutes, and then 80 μL of activity measurement reaction solution (50 mM phosphate buffer pH 7.4, 40 mM NAD, 0.06% HCHO) was added, and the change in absorbance at 340 nm accompanying the change in NADH from NAD ⁺ was measured with a plate reader.

(Step 5) Analysis of clones selected in screening For the mutant gene library used for the synthesis of the enzyme that was found to have the enzyme activity that remained after heat treatment, the amino acid mutation was identified by analyzing the nucleotide sequence, and the protein synthesis The presence or absence of enzyme activity was also confirmed.
Protein synthesis was performed using a cell-free protein synthesis system rabbit translation system RTS100, E. coli HY kit (Roche) according to the instruction manual. The presence or absence of the enzyme was confirmed by fluorescently labeling the synthetic enzyme according to the instruction manual using FluoroTect (registered trademark) GreenLys in vitro Translation Labeling System (manufactured by Promega).

The enzyme activity was measured by the formaldehyde decomposing activity by formaldehyde dehydrogenase, using NADH absorbance at 340 nm as an index. Enzyme solution was added to 80 μL of activity measurement reaction solution (50 mM phosphate buffer K1K2PO ₄ pH 7.4, 1 mM NAD ⁺ , 2 mM HCHO), and absorbance change at 340 nm accompanying NAD to NADH change was 5 minutes (10 second interval) Measured with a plate reader. The results are shown in Table 1.

In the “amino acid mutation site” in the table, for example, the notation “E76V” indicates that the 76th glutamic acid (E) in SEQ ID NO: 2, which is the amino acid sequence of wild-type FDH, was substituted with valine (V). To express.
The sites where amino acid mutations were observed in this example were the 76th, 81st and 219th positions in clone P16, the 127th and 142nd positions in clone F12, the 97th position in clone K11, No. 148, No. 129 in clone N20, No. 149 in clone P13, No. 128 in clones O6 and P4, No. 110 in clone H1, No. 94 in clone K3 Met. In the present specification, amino acid positions are numbered with methionine as a start codon as 1.

  Among them, the ones in which protein synthesis and enzyme activity were confirmed were clones O6 and P4 (the 128th aspartic acid (D) was replaced by glycine (G)) and clone H1 (the 110th one). Glycine (G) was replaced by aspartic acid (D)).

From the results of Table 1, it was recognized that, except for amino acid mutations D128G and G110D, the enzyme activity was completely eliminated by modification with only one mutation. In other words, it is said that the structural change of a protein with only one amino acid mutation affects the structural change only at a distance of about 10 mm. However, the FDH derived from Pseudomonas putida is an enzyme even in the slight structural change. It can be said that the enzyme has a delicate and complex structure that affects the structural stability of.
Among them, V127D is an amino acid mutation next to D128G. However, since V127D has no enzyme activity, D128G has an enzyme activity, so that D128G improves the stability of FDH derived from Pseudomonas putida. At the same time, it can be presumed that enzyme modification by the conventional method is very difficult.

  Hereinafter, the modified FDH having the amino acid sequence in which the 128th aspartic acid is modified to glycine is referred to as “D128G”, and the modified FDH having the amino acid sequence in which the 110th glycine is modified to aspartic acid is referred to as “G110D”.

<Example 2> Analysis of higher order structure based on three-dimensional structure simulation of modified FDH D128G and G110D three-dimensional structure models were constructed. Modeling was performed by homology modeling using Discovery Studio 21 manufactured by Accelrys Co., Ltd., using X-ray crystallographic data (PDB; 1KOL) as a reference structure.

First, mutation sites were analyzed using wild type FDH (PDB; 1KOL) (FIG. 3).
The catalytic domain and the cofactor binding domain are divided up and down in the vicinity of Zn1. The interaction between NAD and Zn1 is considered to be related to the stability of the position and structure of both domains. D128 (aspartic acid at position 128) and G110 (glycine at position 110) are located at the interface of both domains. In particular, G110 is located near the root of the Zn2 holding loop. The periphery of the Zn2 retaining loop is far from the bifurcation of both domains, and packing may be insufficient or the stability may be low.

The analysis result of the structural model of D128G is as follows (FIG. 4).
FIG. 4A shows a structure model of wild type FDH, and FIG. 4B shows a structure model of D128G. The model is represented by a surface shape traced by the contact points of the solvent that contacts the atoms in the molecule. FIGS. 4 (a) (ii) and 4 (b) (ii) show models obtained by rotating the models of FIGS. 4 (a) (i) and 4 (b) (i) by 90 ° C., respectively.
In wild-type FDH, D128 and R119 (arginine at position 119) are positioned so that side chains are aligned by electrostatic action, and amino acid residues Y126 (tyrosine at position 126) and M129 (methionine at position 129) on the inside thereof. ) Between them. In the D128G mutant, the side chains of D128 and R119 face in the opposite direction from the wild type, and the side chains of the inner amino acid residues (Y126 and M129) face inward, so that D128 and R119 are also inside. It is estimated that it was packed compactly. It was speculated that the lack of extra cavities might have contributed to improved stability.

The analysis result of the structural model of G110D is as follows (FIG. 5).
The main chains of wild type FDH and G110D were superimposed.
G337 (glycine at position 337), Q338 (glutamine at position 338), T339 (threonine at position 339), and P340 (proline at position 340) are amino acid residues that interact with NAD, N93 (position 93) Asparagine at the position was the residue next to the amino acid residue that interacted with NAD, and C112 (the cysteine at position 112) was the Zn2-retained amino acid residue. It was speculated that he had made some contribution to sex.

Example 3 Protein Expression and Purification by Recombinant E. coli Protein expression is performed by transferring a gene encoding a wild type or modified FDH into a multicloning site of pET22b DNA, which is an expression vector for E. coli, and a C-terminal His tag fusion protein. And the constructed plasmid was transformed into E. coli BL21 (DE3). The culture of E. coli was performed at 37 ° C. in Luria-Bertani (LB) medium containing ampicillin (50 mg / L). The transformed E. coli is cultured in an LB medium containing ampicillin (50 mg / L), and 0.5 mM IPTG (isopropyl-sD-thiogalactopyranoside) is added at an absorbance OD ₆₀₀ = 0.6 of the culture solution to induce protein synthesis. Then, the culture was further continued for 4 hours.

The expressed His tag fusion protein was purified using an affinity column. Specifically, the cells recovered by centrifugation were suspended in a phosphate buffer (20 mM phosphate buffer, 0.5 M NaCl, pH 7.4). The cells were crushed with ultrasonic waves. The crushing was performed by repeating the setting of ultrasonic treatment for 30 seconds and ice cooling for 30 seconds 10 times. The supernatant 50 mM NaCl obtained by centrifugation was added, the enzyme solution was passed through Ni ^{2 +} column chromatography, the fusion protein was eluted with a solution containing 300 mM imidazole, the active fractions were collected, and 50 mM phosphate buffer ( Dialysis was performed overnight using pH 7.4) as an external solution for dialysis.
The obtained enzyme solution was dialyzed against 50 mM Tris-HCl buffer (pH 7.4). To confirm the protein, 20 μL of solubilized solution was added to 20 μL of enzyme solution, and the sample heat-treated at 95 ° C. for 3 minutes was electrophoresed on a 12.5% acrylamide gel, and the enzyme was visualized by CBB staining. It was. The result is shown in FIG. Lane 1 is purified modified FDH D128G, and lane 2 is purified wild-type FDH.

  As a result, since a band of about 50 kDa was observed in the same manner as wild type FDH, it was confirmed that D128G was expressed in an expression vector for E. coli.

<Example 4> Confirmation of various properties of enzyme (pH dependency)
Enzyme activity was measured in the range of pH 5.0-10.0. An equal volume of enzyme solution (0.5 mg / mL) is added to an activity measurement solution containing 50 mM buffer, 1 mM NAD ⁺ , and 2 mM HCHO, and the reaction rate of enzyme activity at pH 8.0 at 25 ° C. is set to 1. FIG. 7 shows the result of comparison of the relative activity change in.
From this result, it was found that D128G and wild type FDH showed the same pH characteristics from pH 5.0 to pH 8.0, and the optimum pH was around pH 8.0. On the other hand, at pH 8.0 to pH 10.0, it was found that the decrease in activity was smaller in wild type FDH than in D128G. G110D was also found to exhibit the same pH dependence as D128G (results not shown). In FIG. 7, phosphate buffer was used for pH region A (8 or less), and Tris buffer was used for pH region B (8 or more).

<Example 5> Confirmation of various properties of enzyme (temperature dependence)
Enzyme activity was measured in the temperature range of 45-60 ° C. Add an equal volume of enzyme solution (0.5 mg / mL) to an activity assay solution containing 50 mM sodium phosphate buffer (pH 7.6), 1 mM NAD ⁺ , 2 mM HCHO, and measure the reaction rate of enzyme activity at 45 ° C. FIG. 8 shows the result of comparing the relative activity change at each temperature.
FIG. 8 (a) shows a comparison between D128G and wild type FDH, and FIG. 8 (b) shows a comparison between G110D and wild type FDH. From this result, it was found that the modified FDH has an activity about twice as high as that of the wild type FDH in the temperature range of 50 to 55 ° C. It was also found that G110D and D128G show similar temperature dependence.

<Example 6> Confirmation of various properties of enzyme (temperature stability)
In order to investigate the temperature stability of the enzyme, the residual activity after heat treatment was examined in a temperature range of 55 to 65 ° C. Add an equal amount of enzyme in 50 mM sodium phosphate buffer (pH 7.6), heat-treat at 55 ° C., 60 ° C. and 65 ° C. for 0 to 10 minutes, and leave on ice for 30 minutes Activity was measured.
A heat-treated enzyme solution (0.5 mg / mL) was added to an activity measurement solution containing 50 mM sodium phosphate buffer (pH 7.6), 1 mM NAD ⁺ , and 2 mM HCHO, and the result at 0 minutes after each heat treatment was set to 1. A comparison of changes in relative activity at each temperature and each heat treatment time is shown in FIGS. FIG. 9 shows a comparison between D128G and wild type FDH, and FIG. 10 shows a comparison between G110D and wild type FDH.

As a result, in the heat treatment at 55 ° C., the relative activity is about 1/10 in the wild type FDH in the heat treatment for about 6 minutes, whereas the D128G is about 50% (FIG. 9A), and the G110D is about 40%. It was found to have the relative activity of (FIG. 10 (a)).
On the other hand, in the heat treatment at 60 ° C. or higher, the residual activity in both modified FDH and wild type FDH is 20% or less in about 5 minutes (FIGS. 9B, 9C, 10B, 10). c)), it was recognized that the enzyme activity was almost lost by heat denaturation.
From this, it was recognized that the modified FDH of the present invention is less likely to be inactivated by heat than the wild type FDH.

<Example 7> Confirmation of various properties of enzyme (stability)
In order to examine the stability of the enzyme, the residual activity up to 300 minutes at temperatures of 50 ° C. and 45 ° C. was examined. An equal amount of enzyme solution was added to 50 mM sodium phosphate buffer (pH 7.6), and after 0 to 300 minutes, the residual activity after 30 minutes on ice was confirmed.
Heat-treated enzyme solution (0.5 mg / mL) was added to an activity measurement solution containing 50 mM sodium phosphate buffer (pH 7.6), 1 mM NAD ⁺ , and 2 mM HCHO, and the reaction rate of enzyme activity at 0 minutes was set to 1. FIG. 11 shows a comparison of changes in relative activity at each time (minute). FIG. 11A shows a comparison between D128G and wild type FDH at a temperature of 50 ° C., and FIG. 11B shows a comparison between G110D and wild type FDH at a temperature of 45 ° C.
As a result, the half-life of enzyme activity at 50 ° C. was within 30 minutes for wild-type FDH, whereas it was 300 minutes or more for D128G. In addition, the half-life of enzyme activity at 45 ° C. was about 200 minutes for wild-type FDH, but 300 minutes or more for D128G.
From this, it was recognized that the modified FDH of the present invention is superior in thermal stability compared to the wild type FDH.

The stability of D128G at room temperature (25 ° C., 30 ° C.) was examined.
A reaction solution having a composition of 50 mM P1P2PO ₄ , 1 mM HCHO, and 0.5 mM NAD was mixed with a Ni-NTA His / Bind Resin column (manufactured by Takara Bio Inc.) carrying D128G and a Ni-NTA His carrying wild type FDH. -Each was passed through a Bind Resin column. The reaction temperature was 25 ° C., and the flow rate was 0.1 mM / min (linear flow rate 7.9 cm / h). FIG. 12 shows a comparison of changes in relative activity when the absorbance change at 340 nm of the reacted solution that passed through the column was measured and the reaction rate of the enzyme activity before passing was set to 1. The same experiment was conducted when the reaction temperature was 30 ° C.
As a result, when the reaction temperature was 25 ° C., the half-life of the enzyme activity of wild type FDH was about 500 hours, while that of D128G was about 800 hours (FIG. 12). When the reaction temperature was 30 ° C., the enzyme activity of wild type FDH was 80% for about 175 hours, whereas for D128G, it was about 450 hours (FIG. 13).
From this, it was recognized that the modified FDH of the present invention is excellent in stability over a long period of time compared to the wild type FDH.

<Example 8> Confirmation of various properties of enzyme (reaction kinetic analysis)
Enzyme kinetic analysis was performed for mutant and wild-type enzymes.
An enzyme solution (0.5 mg / mL) was added to an activity measurement solution containing 50 mM sodium phosphate buffer (pH 7.6), 1 mM NAD ⁺ , and 0 to 4 mM HCHO, and the initial reaction rate of the enzyme reaction was determined by a Line Weber-Burk plot. The rate constant (Kcat value and Km value) of the enzyme reaction was determined. The results are shown in Table 2.

As a result, the Km value of wild type FDH for HCHO at 25 ° C. and pH 7.6 was 0.35 mM, the Kcat value was 3.2 s ⁻¹ , and the Kcat / Km was 9.1 M ⁻¹ s ⁻¹ . Further, 25 ° C. of D128G, Km value for HCHO in pH7.6 is 0.35 mM, Kcat value is 3.2s ^-1, Kcat / Km is 9.1M ^-1 s ^-1, 25 ℃ of G110D, pH7 Km value for HCHO in .6 0.18 mM, Kcat value is 2.5 s ^-1, Kcat / Km was 13.9 m ^-1 s ^-1.
As described above, it was found that the modified FDH of the present invention is almost the same as the wild type FDH except that the Km value of G110D is small and the substrate affinity is high.

<Example 9> Confirmation of various properties of enzyme (substrate selectivity)
The selectivity of aldehydes and alcohols as substrates was investigated.
50 mM sodium phosphate buffer (pH 7.6), 1 mM NAD ⁺ , 2 mM Each substrate is added with an equal volume of enzyme solution (0.5 mg / mL), and each aldehyde and alcohol are used as a substrate. Table 3 shows a comparison of wild-type FDH and D128G with respect to the relative activity when the reaction rate of the enzyme activity is 1.

  From this result, it was recognized that D128G has a high substrate specificity for formaldehyde, like wild-type FDH.

  The present invention relates to a modified formaldehyde dehydrogenase and a method for using the same, and can be used in various industrial fields such as medical, food, and environmental fields.

Claims (13)

A modified formaldehyde dehydrogenase obtained by modification by deletion, substitution, addition or insertion of an amino acid at at least one position in the amino acid sequence of wild-type formaldehyde dehydrogenase,
The modified formaldehyde dehydrogenase, wherein the modification occurs at positions 70 to 150 in the amino acid sequence of the wild-type formaldehyde dehydrogenase and has improved stability compared to the wild-type formaldehyde dehydrogenase .   The modified formaldehyde dehydrogenase according to claim 1, wherein the modification occurs at a position corresponding to position 128 of the amino acid sequence.   The modified formaldehyde dehydrogenase according to claim 2, wherein the modification is substitution of aspartate with glycine at a position corresponding to position 128 of the amino acid sequence.   The modified formaldehyde dehydrogenase according to claim 1, wherein the modification occurs at a position corresponding to position 110 of the amino acid sequence.   The modified formaldehyde dehydrogenase according to claim 4, wherein the modification is substitution of glycine with aspartic acid at a position corresponding to position 110 of the amino acid sequence.   The modified formaldehyde dehydrogenase according to any one of claims 1 to 5, wherein the wild-type formaldehyde dehydrogenase has an amino acid sequence represented by SEQ ID NO: 2.   An isolated nucleic acid molecule encoding the modified formaldehyde dehydrogenase according to any one of claims 1 to 6.   A recombinant vector containing the isolated nucleic acid molecule of claim 7.   A transformant containing the recombinant vector according to claim 8.   Heating compared to wild-type formaldehyde dehydrogenase, comprising culturing the transformant according to claim 9, and collecting a protein having an ability to catalyze dehydrogenation of formaldehyde from the obtained culture. A method for producing a modified formaldehyde dehydrogenase having improved stability.   The detection method of the aldehyde compound which detects an aldehyde compound using the catalytic activity of the modified | denatured formaldehyde dehydrogenase as described in any one of Claims 1-6.   An enzyme sensor in which the modified formaldehyde dehydrogenase according to any one of claims 1 to 6 is immobilized on an electrode.   An anode for receiving an electron generated by an oxidation reaction of an aldehyde compound of the modified formaldehyde dehydrogenase, comprising the modified formaldehyde dehydrogenase according to any one of claims 1 to 6, and an electron for oxygen A fuel cell comprising a cathode electrode that holds either a catalyst or an enzyme capable of transmitting, wherein the anode electrode and the cathode electrode are electrically coupled.