JP2011050362A - Expression promoter in issatchenkia orientalis and related species thereof and use thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a high expression promoter in Issatchenkia orientalis and its related species and use of the promoter. <P>SOLUTION: An expression system is constructed by using a promoter and a terminator comprising a DNA having a specific base sequence in Issatchenkia orientalis and its related species and combining a secretion signal. A transformant containing cellulase is produced by using the expression system to obtain the cellulase. Various foreign proteins can be produced in this manner. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to an expression promoter in Issatchenkia orientalis and related species and use thereof.

  In recent years, techniques for converting renewable biomass into useful substances instead of petroleum resources and using them as energy sources and industrial raw materials have been studied. Useful substances such as ethanol produced by fermentation of microorganisms using biomass as a raw material are expected as alternative raw materials from the viewpoint of suppressing consumption of petroleum resources and suppressing an increase in carbon dioxide in the atmosphere. There are various types of biomass, but among these, the use of herbs and woods mainly composed of lignocellulose is considered as a raw material that does not compete with food.

  The main sugars contained in lignocellulose are glucose constituting cellulose and xylose constituting hemicellulose. When lignocellulose is chemically or enzymatically degraded, a saccharified composition mainly containing such a monosaccharide is obtained. In order to industrially produce useful substances from lignocellulose, there is a demand for microorganisms that can efficiently utilize the sugar contained in such a saccharified composition and can be fermented with high yield and high productivity.

  Issatchenkia orientalis MF121 strain is a heat-resistant and salt-resistant ethanol-fermenting yeast, and is a promising strain when producing ethanol from biomass. However, strain MF121 does not have the ability to ferment ethanol from C5 sugar (xylose) or to saccharify high-molecular sugars (cellulose, xylan, starch, etc.). Therefore, in order to confer these abilities, it is necessary to construct a gene recombination system of the MF121 strain and to express heterologous proteins (C5 metabolism-related enzymes, cellulases, etc.) in the MF121 strain. In order to express a heterologous protein in I. orientalis, it is essential to construct an expression system that combines an expression promoter that operates in I. orientalis and a secretion signal.

  In one I. orientalis strain, a method for producing lactic acid by connecting lactate dehydrogenase downstream of the IoPGK1 promoter is disclosed (Patent Document 1).

  The high expression promoter of yeast S. cerevisiae is well known. For example, the promoter sequences of TDH3, ADH1, PGK1, TPI1, and TEF1 genes are used as high expression promoters. The HOR7 promoter has also been reported as a high expression promoter (Patent Document 2).

  Since the URA3 gene sequence of the MF121 strain was the same as that of Candida glycerinogenes URA3, these two strains are considered to be closely related strains. In recent years, C. glycerinogenes has been reported on the development of genetic recombination systems (Non-Patent Documents 1 to 3).

Special Table 2008-545429 JP 2005-137306 JP

Li Y, Shen W, Wang Z, Liu JQ, Rao Z, Tang X, Fang H, Zhuge J (2005), Yeast 22: 423-430 Chen X, Fang H, Rao Z, Shen W, Zhuge B, Wang Z, Zhuge J (2008),. Microbiol Res 163: 531-537 Zhiming R, Zheng M, Wei S, Huiying F, Jian Z (2008), Curr Microbiol 57: 12-17

  In order to highly express a heterologous protein in I. orientalis, a high expression promoter and a secretion signal effective in I. orientalis are essential, but the promoter described in Patent Document 1 is not always a sufficient expression level. Patent Document 2 discloses a high expression promoter in S. cerevisiae. However, according to the study by the present inventors, even a promoter highly expressed in S. cerevisiae is not highly expressed in I. orientalis, and the gene cassette expressed in S. cerevisiae is I. orientalis. It turned out that it cannot necessarily be said that it expresses. Furthermore, Non-Patent Documents 1 to 3 relate to genetic recombination markers and do not relate to high expression promoters.

  Thus, to date, no effective high expression promoter has been provided in I. orientalis, and therefore no effective high expression system has been constructed. Accordingly, one object of the disclosure of the present specification is to provide a high expression promoter and its use in I. orientalis and related species.

  As a result of various studies on promoters effective for high expression of heterologous proteins in I. orientalis, the present inventors have found a high expression promoter effective in I. orientalis. We also found an effective terminator. According to the disclosure of the present specification, these findings provide the following means.

(1) The following (a) to (h):
(A) DNA comprising the base sequence represented by SEQ ID NO: 1
(B) a DNA having a base sequence including at least the 3 ′ end of the base sequence represented by SEQ ID NO: 1 and having promoter activity
(C) DNA having a promoter sequence having 70% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 and having promoter activity
(D) DNA having a promoter activity that hybridizes with all or part of the complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 1.
(E) DNA comprising the base sequence represented by SEQ ID NO: 2
(F) DNA having a nucleotide sequence including at least the 3 ′ end of the nucleotide sequence represented by SEQ ID NO: 2 and having promoter activity
(G) DNA having a nucleotide sequence of 70% or more identity with the nucleotide sequence represented by SEQ ID NO: 2 and having promoter activity
(H) DNA having a promoter activity that hybridizes with all or part of the complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 2
Any DNA selected from
(2) The DNA according to (1), which is selected from (a) to (d).
(3) The DNA according to (1) or (2), wherein the promoter activity is promoter activity in Issatchenkia orientalis or related species.
(4) The DNA according to any one of (1) to (3), which is a promoter for expressing a heterologous protein in Issatchenkia orientalis or a related species thereof.
(5) The DNA according to any one of (1) to (4), wherein the promoter activity is promoter activity in the Issatchenkia orientalis MF121 strain or a related species thereof.
(6) The following (a) to (e):
(A) a peptide comprising the amino acid sequence represented by SEQ ID NO: 3 (b) a peptide having an amino acid sequence of 70% or more identical to the amino acid sequence represented by SEQ ID NO: 3 and having a secretion signal activity in Issatchenkia orientalis ( c) A peptide having an amino acid sequence obtained by substituting, inserting, deleting and adding one or more amino acid residues to the amino acid sequence represented by SEQ ID NO: 3, and having a secretion signal activity (d) A peptide having a secretory signal activity encoded by a base sequence having 70% or more identity with the base sequence represented by SEQ ID NO: 4 (e) All or part of DNA comprising the base sequence represented by SEQ ID NO: 4 Any peptide selected from peptides having a secretory signal activity encoded by a base sequence that hybridizes with the complementary strand of.
(7) The following (a) to (d):
(A) DNA comprising the base sequence represented by SEQ ID NO: 5
(B) DNA having a base sequence including at least the 5 ′ end of the base sequence represented by SEQ ID NO: 5 and having terminator activity
(C) a base sequence having 70% or more identity with the base sequence represented by SEQ ID NO: 5 and having terminator activity (d) all or part of the DNA comprising the base sequence represented by SEQ ID NO: 5 DNA having any base sequence selected from base sequences that hybridize with complementary strands and have terminator activity.
(8) An expression system in Issatchenkia orientalis,
An expression system comprising the DNA according to any one of (1) to (5) as a promoter.
(9) The expression system according to (8), further comprising, as a secretion signal DNA, a DNA encoding the amino acid sequence of the peptide according to (6).
(10) The expression system according to (8) or (9), further comprising the DNA according to (7) as a terminator.
(11) The expression system according to any one of (8) to (10), which is a vector.
(12) A transformant of Issatchenkia orientalis and its related species, which uses the DNA according to any one of (1) to (5) as a promoter and retains a DNA encoding a heterologous protein under the control of the promoter.
(13) The transformant according to (12), which further holds the DNA according to (7) operably as a terminator for the promoter.
(14) The transformant according to (12) or (13), wherein the heterologous protein includes cellulase.
(15) The transformant according to any one of (12) to (14), wherein the host is Issatchenkia orientalis MF121 strain.
(16) A protein production method comprising:
Using Issatchenkia orientalis or a related species thereof as a host, using the DNA according to any one of (1) to (4) as a promoter, and expressing a heterologous protein under the control of the promoter,
A method comprising:
(17) A method for producing useful substances,
Using Issatchenkia orientalis or a related species thereof as a host, using the DNA according to any one of (1) to (4) as a promoter, expressing a heterologous protein under the control of the promoter, and producing the useful substance by fermentation A method comprising:

It is a figure which shows the fermentation test result by using cellobiose and glucose by the MF121 strain | stump | stock which expresses BGL as a carbon source. It is a figure which shows the simultaneous saccharification fermentation test result of the crystalline cellulose by MF121 strain which expresses BGL.

  The disclosure of the present specification relates to a promoter and the like effective for an expression system using I. orientalis and their uses. According to the disclosure of the present specification, heterologous proteins can be easily expressed in I. orientalis and related species including I. orientalis MF121 strain considered to be useful for biomass utilization, Heterologous proteins can be highly expressed. As a result, more excellent fermentative production of various useful substances using heat resistance and salt resistance, which are the advantages of I. orientalis, becomes possible.

The present inventors tried to express a heterologous protein (an endoglucanase cel12A derived from Fanerokete chrysosporium) under the control of the HOR7 promoter in I. orientalis MF121 strain, but could not express cel12A. This indicates that a promoter highly expressed in S. cerevisiae is not necessarily highly expressed in I. orientalis.
In addition, uracil requirement can be complemented by introducing URA3 marker gene derived from S. cerevisiae (marker cassette containing URA3 promoter, URA3 structural gene and URA3 terminator) into uracil requirement mutant of MF121 strain. There wasn't. This indicates that a gene cassette expressed in S. cerevisiae cannot always be expressed in I. orientalis.

  As of May 22, 2003, Issatchenkia orientalis MF121 shares were incorporated by the National Institute of Advanced Industrial Science and Technology and Patent Biological Deposit Center (1-1-1 Tsukuba Center, Tsukuba City, Ibaraki Prefecture, 305-8566, Japan) 6) is deposited under the deposit number FERM P-19368.

  Hereinafter, various embodiments of the present invention will be described in detail.

(Promoter DNA)
The disclosure herein provides preferred promoter DNA for the expression of heterologous proteins in I. orientalis and related species. One embodiment of the DNA is DNA having the base sequence represented by SEQ ID NO: 1. The base sequence represented by SEQ ID NO: 1 is the TDH1 gene promoter DNA (hereinafter simply referred to as TDH1 promoter) of I. orientalis MF121 strain (hereinafter simply referred to as MF121 strain). Another embodiment is a DNA having the base sequence represented by SEQ ID NO: 2. The base sequence represented by SEQ ID NO: 2 is the promoter DNA of the PGK1 gene of the MF121 strain (hereinafter simply referred to as PGK1 promoter).

  The TDH1 promoter and the PGK1 promoter may have a base sequence having a certain relationship with SEQ ID NOs: 1 and 2 as long as they have promoter activity for the expression of heterologous proteins in I. orientalis and its related species.

  Other embodiments of the TDH1 promoter include DNA having promoter activity including at least the 3 ′ end side of the base sequence represented by SEQ ID NO: 1, and 70% or more identity with the base sequence represented by SEQ ID NO: 1 And a DNA having a promoter activity and a DNA having a promoter activity by hybridizing with all or a part of the complementary strand of the DNA comprising the base sequence represented by SEQ ID NO: 1.

  As another embodiment of the PGK1 promoter, the base sequence having at least the 3 ′ end of the base sequence represented by SEQ ID NO: 2 and having promoter activity, 70% or more identical to the base sequence represented by SEQ ID NO: 2 And a base sequence having promoter activity and a base sequence having promoter activity by hybridizing with all or part of a complementary strand of DNA consisting of the base sequence represented by column No. 2.

  According to the present inventors, in the base sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2, it is known that the 3 'end contains an element important for promoter activity. In addition, in hybridization with all or part of the complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 1 or 2, it is preferable to hybridize under stringent conditions.

  The stringent condition refers to, for example, a condition in which a so-called specific hybrid is formed and a non-specific hybrid is not formed. For example, a nucleic acid having high base sequence identity, that is, 70% or more, preferably 80% or more, more preferably 90% or more, more preferably 95% or more, and most preferably 98% or more with the base sequence represented by SEQ ID NO: 1. The complementary strand of DNA which consists of a base sequence which has the identity of (5) is hybridized, and the complementary strand of a nucleic acid having a lower homology is not hybridized. More specifically, the sodium salt concentration is 15 to 750 mM, preferably 50 to 750 mM, more preferably 300 to 750 mM, the temperature is 25 to 70 ° C., preferably 50 to 70 ° C., more preferably 55 to 65 ° C., formamide The condition is that the concentration is 0 to 50%, preferably 20 to 50%, more preferably 35 to 45%. Furthermore, under stringent conditions, the filter washing conditions after hybridization are usually such that the sodium salt concentration is 15 to 600 mM, preferably 50 to 600 mM, more preferably 300 to 600 mM, and the temperature is 50 to 70 ° C., preferably It is 55-70 degreeC, More preferably, it is 60-65 degreeC. In addition, from the above, as yet another aspect, the base sequence represented by SEQ ID NO: 1 or 2 and 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more, more More preferably, it is 98% or more, most preferably DNA having a nucleotide sequence having an identity of 99% or more and having promoter activity.

  As used herein, identity or similarity is a relationship between two or more proteins or two or more polynucleotides determined by comparing sequences, as is known in the art. In the art, “identity” means between protein or polynucleotide sequences, as determined by alignment between protein or polynucleotide sequences, or in some cases by alignment between a series of such sequences. Means the degree of sequence invariance. Similarity is also the correlation between protein or polynucleotide sequences, as determined by alignment between protein or polynucleotide sequences, or in some cases by alignment between a series of partial sequences. Means the degree of More specifically, it is determined by sequence identity and conservation (substitutions that maintain specific amino acids in the sequence or physicochemical properties in the sequence). The similarity is referred to as Similarity in the BLAST sequence homology search result described later. The method for determining identity and similarity is preferably a method designed to align the longest between the sequences to be compared. Methods for determining identity and similarity are provided as programs available to the public. For example, BLAST (Basic Local Alignment Search Tool) program by Altschul et al. (Eg, Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: p403-410 (1990), Altschyl SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: p3389-3402 (1997)). The conditions for using software such as BLAST are not particularly limited, but it is preferable to use default values.

  Having promoter activity means at least an activity to transcribe DNA encoding a protein connected downstream into mRNA. Preferably, it includes the activity of finally translating the protein. The promoter activity is preferably promoter activity in I. orientalis and its related species, more preferably promoter activity for expressing a heterologous protein in I. orientalis or its related species. Furthermore, the promoter activity is preferably the promoter activity in the Issatchenkia orientalis MF121 strain or its related species. Such promoter activity can be obtained by methods known to those skilled in the art in addition to the test methods described in the Examples described later. The level of the promoter activity can be evaluated by comparing with, for example, the PGK1 promoter derived from I. orientalis disclosed in the official method of JP-T-2008-545429. The promoter activity of the promoter DNA disclosed in the present specification is preferably 140% or more, more preferably 150% or more, and 160% of the promoter activity of the PGK1 promoter disclosed in the prior art. More preferably, it is 170% or more, more preferably 180% or more.

  The promoter DNA of the above various embodiments is, for example, a DNA designed from a predetermined yeast, a nucleic acid derived from various cDNA libraries or genomic DNA libraries, etc. using a primer designed based on the sequence of SEQ ID NO: 1 or the like as a template. By performing the PCR amplification, it can be obtained as a nucleic acid fragment. Further, it can be obtained as a nucleic acid fragment by performing hybridization using a nucleic acid derived from the library or the like as a template and a DNA fragment which is a part of the promoter DNA as a probe. Alternatively, the promoter DNA may be synthesized as a nucleic acid fragment by various nucleic acid sequence synthesis methods known in the art such as chemical synthesis methods.

  The promoter DNA of the above-described various embodiments is, for example, a DNA having the nucleotide sequence represented by SEQ ID NO: 1 or 2, which is molecularly evolved using conventional mutagenesis, site-directed mutagenesis, and error-prone PCR. It can be obtained by modifying it by a technique or the like. As such a technique, a known technique such as the Kunkel method or the Gapped duplex method, or a similar method can be mentioned. For example, a mutation introduction kit using site-directed mutagenesis (for example, Mutant-K (manufactured by TAKARA) ), Mutant-G (manufactured by TAKARA)), or the like, or the LA PCR in vitro Mutagenesis series kit from TAKARA.

  In addition, those skilled in the art should refer to Molecular Cloning (Sambrook, J. et al., Molecular Cloning: a Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press, 10 Skyline Drive Plainview, NY (1989)). Thus, for example, various types of promoter DNA can be obtained based on known sequences such as SEQ ID NO: 1 or 2.

(Terminator DNA)
The disclosure herein provides preferred terminator DNA for the expression of heterologous proteins in I. orientalis and related species. One embodiment of the DNA is DNA having the base sequence represented by SEQ ID NO: 5. The TEF1 terminator, which is the promoter DNA of the MF121 strain TEF1 gene (hereinafter simply referred to as TEF1 terminator), is a terminator activity for the expression of heterologous proteins in I. orientalis and its related species. As long as it has, it may have a base sequence having a certain relationship with SEQ ID NO: 5.

  As another aspect of the TEF1 terminator, a DNA having a base sequence including at least the 5 ′ end side of the base sequence represented by SEQ ID NO: 5 and having a terminator activity, a base sequence represented by SEQ ID NO: 1 and 70 % Identity (preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 98% or more, most preferably 99% or more. ), DNA having terminator activity, and DNA having a promoter activity by hybridizing with all or part of the complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 1.

  Having terminator activity means at least the activity of terminating transcription of the DNA encoding the protein connected upstream to mRNA. Preferably, the protein comprises an activity that terminates transcription in a finally translatable manner. Further, the terminator activity is preferably the terminator activity in I. orientalis and its related species, and more preferably the terminator activity for expressing a heterologous protein in I. orientalis or its related species. Furthermore, the terminator activity is preferably promoter activity in the I. orientalis MF121 strain or its related species. The terminator activity is preferably the terminator activity when used in combination with a promoter suitable for I. orientalis disclosed in the present specification. The terminator activity can be obtained by methods known to those skilled in the art in addition to the test methods described in the Examples described later. For example, the presence or absence of terminator activity can be evaluated by using the correct production of the translation product or the activity of the translation product by using it in combination with a promoter whose operation has been confirmed. The level of terminator activity is not particularly limited.

  Regarding the identity and hybridization of the base sequence in the terminator DNA, the identity and hybridization conditions in the promoter DNA described above are applied. Terminator DNA can be obtained by the same method as promoter DNA.

(Signal peptide)
The disclosure herein provides peptides that are preferred as signal peptides for heterologous proteins in I. orientalis and related species. One embodiment of the peptide is a peptide having the amino acid sequence represented by SEQ ID NO: 3. The amino acid sequence represented by SEQ ID NO: 3 is a signal peptide of the SED1 gene of the MF121 strain (hereinafter simply referred to as SED1 signal peptide). The SED1 signal peptide has an amino acid sequence having a certain relationship with SEQ ID NO: 3 as long as it functions as a signal peptide with respect to the expression of a heterologous protein in I. orientalis and its related species (has secretory signal activity). May be.

  As another aspect of the SED1 signal peptide, a peptide having an amino acid sequence having 70% or more identity with the amino acid sequence represented by SEQ ID NO: 3, and having a secretory signal activity in I. orientalis and its related species, A peptide having an amino acid sequence obtained by substituting, inserting, deleting and adding one or more amino acid residues to the amino acid sequence represented by SEQ ID NO: 3 and having a secretory signal activity; A peptide having a secretory signal activity encoded by a base sequence having 70% or more identity with the base sequence represented, and hybridizing with a complementary strand of all or part of the DNA comprising the base sequence represented by SEQ ID NO: 4 Examples thereof include peptides encoded by a base sequence that is soybean and having a secretion signal activity.

  In the other embodiment, the amino acid mutation relative to the amino acid sequence represented by SEQ ID NO: 3 may be any one type of deletion, substitution or addition, or two or more types may be combined. Also good. The total number of these mutations is not particularly limited, but is preferably about 1 or more and 10 or less. More preferably, it is 1 or more and 5 or less. As an example of amino acid substitution, conservative substitution is preferable, and specific examples include substitution within the following groups. (Glycine, alanine) (valine, isoleucine, leucine) (aspartic acid, glutamic acid) (asparagine, glutamine) (serine, threonine) (lysine, arginine) (phenylalanine, tyrosine).

  In another embodiment, the identity to the amino acid sequence represented by SEQ ID NO: 3 is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and still more preferably 95 % Or more, more preferably 98% or more, and most preferably 99% or more.

  For the identity and hybridization of the amino acid sequence and base sequence related to the signal peptide, the identity and hybridization conditions in the promoter DNA described above are applied.

  In another embodiment, the identity to the base sequence represented by SEQ ID NO: 4 is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and still more preferably It is 95% or more, more preferably 98% or more, and most preferably 99% or more.

(Secretory signal DNA)
The DNA encoding a signal peptide (secretory signal DNA) includes DNA having a base sequence encoding such various types of signal peptides. Furthermore, the secretory signal DNA is a base sequence represented by SEQ ID NO: 4, a base sequence encoding a protein having 70% or more identity with the base sequence represented by SEQ ID NO: 4, and having a secretory signal activity, and DNA containing any base sequence selected from a base sequence encoding a protein having a secretory signal activity, which hybridizes with all or part of a complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 4 It is done. Such DNA can also be obtained by the same method as promoter DNA. Note that the amino acid sequence represented by SEQ ID NO: 3 or the base sequence encoding the amino acid sequence having a certain relationship with the amino acid sequence as described above does not change the amino acid sequence of the protein in accordance with the degeneracy of the genetic code. At least one base of a base sequence encoding a predetermined amino acid sequence can be substituted with another kind of base. Accordingly, the DNA encoding the signal peptide disclosed herein also includes DNA encoding a base sequence converted by substitution based on the degeneracy of the genetic code.

  Regarding the identity and hybridization of the base sequence in the secretory signal DNA, the identity and hybridization conditions in the promoter DNA described above are applied. Secretory signal DNA can be obtained in the same manner as promoter DNA.

(Expression system in I. orientalis)
The expression system in I. orientalis disclosed herein can comprise the promoter DNA disclosed in the detailed disclosure disclosed herein. The expression system is preferably intended for the expression of proteins, particularly heterologous proteins, in I. orientalis and related species. The expression system, if intended for secreted expression of the protein, can comprise a secretory signal DNA encoding the signal peptide disclosed herein. Furthermore, the expression system can be provided with the terminator DNA disclosed herein.

  The form of the expression system is not particularly limited as long as it is intended to express the protein in I. orientalis and its related species. For example, the vector may take a form such as a plasmid. In the vector, in addition to the promoter DNA, a secretion signal DNA and / or a terminator DNA can be provided as necessary. When the expression system takes the form of a so-called recombinant vector, it is constructed so as to facilitate insertion of a DNA encoding a protein intended for expression under the control of a promoter DNA, and is provided with a marker gene. Furthermore, when the expression system intends to incorporate a desired DNA fragment into a chromosome such as gene replacement, it has a homologous region with a predetermined region on the chromosome. Such vectors can be obtained by appropriately using commercially available expression vectors for yeast, and methods known to those skilled in the art, for example, T.P. It can be prepared by those skilled in the art by appropriately referring to an experimental document by Maniatis, J. Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, 1982, 1989, 2001). The expression system can also contain necessary restriction enzymes and the like as an expression kit.

(Transformant)
The transformant of I. orientalis and related species disclosed in the present specification can retain the promoter DNA disclosed in the present specification and the DNA encoding the protein under the control of the promoter. According to the transformant disclosed in the present specification, a protein can be produced and a useful substance can be produced by taking advantage of the advantages of I. orientalis and its related species.

  In the transformant disclosed herein, the host is preferably I. orientalis and its related species. As the host microorganism belonging to I. orientalis, the already described MF121 strain can be used. Furthermore, it is also possible to use a variant or mutant having heat resistance and / or salt resistance equal to or higher than that of the MF121 strain. Furthermore, I. orientalis related species can be used. Whether it is a related species is determined by a criterion based on the similarity by a specific gene adopted in microbiology.

  In addition to the promoter DNA, the transformant can retain the terminator DNA disclosed herein so as to be operable as a terminator for this promoter. Furthermore, when the protein is secreted and expressed, the secretory signal DNA can be retained so that the translation product functions as a signal peptide of the intended protein.

  Such DNA may be held outside the chromosome of the host microorganism or may be held on the chromosome. In addition, such a combination of DNAs may hold multiple copies in the host.

  The protein that is intended to be expressed in the transformant is not particularly limited. From the viewpoint of effective use of biomass, various cellulases such as endoglucanase, cellobiohydrolase, β-glucosidase, and other biomass degrading enzymes such as xylanase and hemicellulase can be mentioned. These proteins are preferably secreted and expressed outside of the transformant by a signal peptide. By expressing such proteins, particularly by secreting them, transformants can be grown using the degradation products such as glucose while decomposing biomass-derived cellulose and hemicellulose, and fermenting useful substances. Can be produced.

  Furthermore, the transformant may be modified so that a desired useful substance can be produced by fermentation as described later. Yeast usually produces ethanol by anaerobic fermentation, but may be transformed so that other useful substances can be produced by appropriate genetic engineering modification. The transformant disclosed in the present specification is, for example, a yeast that produces an organic acid such as lactic acid (Japanese Patent Laid-Open No. 2003-259878, Japanese Patent Laid-Open No. 2006-006271, Japanese Patent Laid-Open No. 2006-20602, Japanese Patent Laid-Open No. 2006-20602, 2006-75133, JP-A-2006-2966377, JP-A-2007-89466) and the like.

(Production of transformants)
The transformant disclosed in the present specification can be obtained by transforming the host microorganism with the expression system disclosed in the present specification using a known method. A transformant can be produced using the expression system disclosed in the present specification. For example, vector introduction methods include various conventionally known methods such as calcium phosphate method, transformation method, transfection method, conjugation method, protoplast method, electroporation method, lipofection method, lithium acetate method or other methods. Is mentioned. For a host microorganism into which a vector has been introduced, a transformant can be obtained by selection using a marker gene and selection by active expression. Such a transformation operation is usually performed by those skilled in the art. A person skilled in the art can carry out this method by referring appropriately to an experimental book by Maniatis, J. Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, 1982, 1989, 2001).

(Protein production method)
The method for producing a protein disclosed in the present specification uses I. orientalis or a related species as a host, the promoter DNA disclosed in the present specification as a promoter, and expresses a heterologous protein under the control of this promoter. Proteins can be produced efficiently using advantageous properties. The protein production method can be carried out as a transforming step disclosed in the present specification or a fermentation step using the transformant. The culture or fermentation conditions are set appropriately for I. orientalis or related species. Since I. orientalis is a yeast, culture conditions applicable to yeast are generally applied, and conditions according to the heat resistance and / or salt resistance of I. orientalis are appropriately set. Typically, for example, stationary culture, shaking culture, or aeration and agitation culture can be used for the culture for fermentation. The aeration conditions can be appropriately selected from anaerobic conditions, microaerobic conditions, aerobic conditions, and the like. The culture temperature is not particularly limited, but may be in the range of 25 ° C to 55 ° C. Moreover, although culture | cultivation time is also set as needed, it can be set as several hours-about 150 hours. The pH can be adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, antibiotics such as ampicillin and tetracycline can be added to the medium as necessary.

(Useful substance production method)
The method for producing a useful substance of the present invention comprises using Issatchenkia orientalis or a related species thereof as a host, using the promoter DNA disclosed herein as a promoter, expressing the heterologous protein under the control of the promoter, and A step of fermentative production. Although it does not specifically limit as a useful substance, What is necessary is just what a host microorganism can produce using glucose. The useful substance may be a compound that is not an original metabolite by replacing or adding one or more enzymes of the metabolic system from glucose by genetic recombination of the host microorganism. Specifically, in addition to organic alcohols such as ethanol, propanol and butanol, and organic acids such as lactic acid, fine chemicals (coenzyme Q10, vitamins and their raw materials, etc.) by adding an isoprenod synthesis route, glycerin and plastics by modifying glycolysis -Materials targeted by biorefinery technology, such as chemical raw materials. Since I. orientalis has a high alcohol fermentation ability and is excellent in heat resistance and / or salt resistance, the transformant disclosed herein can produce useful substances such as ethanol with high efficiency. In addition, by using a transformant in which cellulase is expressed so that biomass can be used by the expression system disclosed in this specification, a useful substance can be efficiently produced by effectively using a cellulose-containing material.

  In the fermentation process, a normal carbon source such as glucose can be used. Moreover, when a transformant expresses a cellulase, biomass-derived materials, such as biomass, its processed material, a cellulose, and a hemicellulose, can be used as a carbon source. In the fermentation process, in consideration of the heat resistance and / or salt resistance of I. orientalis, culture conditions generally applied to yeast can be appropriately selected and used.

  By carrying out the fermentation process, useful substances are produced according to the useful substance production capacity of the transformant used. For example, when the transformed yeast of the present invention has ethanol production ability, it is ethanol, and when it is modified so that lactic acid can be produced, it becomes lactic acid or the like. After completion of fermentation, a step of recovering a useful substance-containing fraction from the culture solution, and a step of purifying or concentrating the fraction can also be performed. The recovery process and the purification process are appropriately selected according to the type of useful substance.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated concretely, this invention is not limited to these Examples. The gene recombination operation described below was performed according to Molecular Cloning: A Laboratory Manual (T. Maniatis, et al., Cold Spring Harbor Laboratory). In addition, the culture medium used in the following examples is summarized in Table 1.

(Identification of highly expressed gene of MF121 strain)
In order to highly express a foreign protein in the I. orientalis MF121 strain, a high expression promoter derived from the MF121 strain is required. Therefore, we decided to identify genes with high expression levels by EST (expressed sequence tag) analysis and to obtain their promoter regions.

  The MF121 strain was inoculated into a YPD medium containing 100 g / L of glucose, and alcohol fermentation was performed under microaerobic conditions. After 20 hours, vigorous foaming was observed from the medium, and bacterial cells in a state where active alcohol fermentation was performed were obtained, and total RNA was extracted. MRNA was purified from the obtained total RNA and further subjected to reverse transcription to synthesize cDNA. The obtained cDNA was inserted into a pBluescript vector to prepare a cDNA library. The cDNA library was transformed into E. coli, the vector was extracted from 571 clones selected at random, and sequence analysis was performed from the 5 'end of the cDNA inserted into the vector. These genes existed and were considered to be relatively highly expressed genes. Homologous genes were identified by comparing the amino acid sequence predicted from the sequenced sequence with the publicly available genetic information of Saccharomyces cerevisiae. The following table shows two genes that appear to be highly expressed with a large number of appearing clones.

(Acquisition of high expression promoter of MF121 strain)
A genome library of the MF121 strain was prepared by the adapter ligation method, and an attempt was made to obtain promoter sequences of IoTDH1 and IoPGK1 genes based on the sequence information obtained by the above sequence. According to Current Protocols in Molecular Biology (1997) Section 13.11.2, the genomic DNA of strain MF121 was prepared according to the method for obtaining genomic DNA of yeast (Rapid isolation of yeast chromosomal DNA). After digesting approximately 5 μg of the resulting genomic DNA with the restriction enzyme SspI, heat it at 70 ° C for 15 minutes to inactivate SspI, and then use DNA Clean & Concentrator-5 (Zymo Reserch) to digest the genomic DNA fragment. Was purified. Next, about 2.5 μg of genomic DNA digested with SspI and 25 pmol each of adapter primer F and adapter primer R are mixed, and adapter DNA is ligated to both ends of genomic DNA using the LigaFast DNA Ligation System (Promega). did.

Adapter primer F:
5'- tagcggtaaagaccggtgaaactggaatttgctcacaatcgcaggtgtgcgggccaagcg -3 '(SEQ ID NO: 6)
Adapter primer R:
5'-cgcttggcccgcacacctgcgattgtgagcaaattccagtttcaccggtctttac-3 '(SEQ ID NO: 7)

  Next, a fraction larger than 500 bp was collected by agarose gel electrophoresis, and DNA was purified using Zymoclean Gel DNA Recovery Kit (manufactured by Zymo Reserch). Using the obtained DNA as a template, the 5 ′ flanking regions of the IoTDH1 and IoPGK1 genes were PCR amplified by primer set 1 (AP1 and IoTDH + 200R) and primer set 2 (AP1 and IoPGK + 190R), respectively (1st PCR). In addition, Ex-Taq DNA polymerase (made by Takara) was used for PCR. Next, using the DNA purified from the 1st PCR product using DNA Clean & Concentrator-5 as a template, 2nd (nested) using primer set 3 (AP2 and IoTDH + 170R) and primer set 4 (AP2 and IoPGK + 150R) ) PCR was performed.

AP1: 5'-gaccggtgaaactggaatttgc-3 '(SEQ ID NO: 8)
AP2: 5'-acaatcgcaggtgtgcgggc-3 '(SEQ ID NO: 9)
IoTDH + 200R: 5'-gtgatggcattgtccttaccag-3 '(SEQ ID NO: 10)
IoTDH + 170R: 5'- cccttgtacttaccgtgggtg-3 '(sequence number 11)
IoPGK + 190R: 5'- agtgggaagcaagaacaacgtatc-3 '(SEQ ID NO: 12)
IoPGK + 150R: 5'- aacatattcaattgttggaagagcag -3 '(SEQ ID NO: 13)

  The 2nd PCR product was subjected to agarose gel electrophoresis, a band having a size of 400 bp or more was excised, the DNA was purified with Zymoclean Gel DNA Recovery Kit, and then cloned into a PCR-TOPO vector using TOPO TA cloning kit (Invitrogen). By sequencing, 5 'upstream sequences of IoTDH1 gene and IoPGK1 gene were obtained as 629 bp and 545 bp, respectively. These sequences were used below as IoTDH1 promoter (SEQ ID NO: 1) and IoPGK1 promoter (SEQ ID NO: 2).

(Acquisition of secretion signal of MF121 strain)
In order to secrete and express a protein in yeast, it is necessary to fuse a secretory signal to the N-terminus of the target protein. Therefore, a search was made for genes having a relatively high expression level in the EST of the MF121 strain and having a homology with the secreted protein of S. cerevisiae. As a result, an IoSED1 gene was found that is homologous to the SED1 gene that is a secreted protein of S. cerevisiae and encodes a cell surface protein. The secretory signal sequence of the N-terminal sequence of the IoSED1 protein was predicted using the Signal peptide prediction program of Genetyx Win ver9.1.2 (Genetics). Secretory signal sequence from MF121 strain resulting sequence (S ecretion S ignal of M F121 S ED1 homolog; SSMS) as was used in the following (SEQ ID NO: 3, 4).

(Preparation of destination vector pRS333D-MfURA3)
A multi-copy vector pYO323 (NBRP ID: BYP563) having a 2 micron replication sequence was treated with SmaI restriction enzyme (Takara Bio) at 37 ° C, and after electrophoresis, a gel of the desired size was cut and the Zymoclean Gel DNA Recovery kit (Zymo Research) purified DNA from the gel. Using purified DNA, treated with TsAP Thermosensitive Alkaline Phosphatase (Promega) at 65 ° C for 15 minutes, mixed with ccdB gene and DNA sequence containing Gateway Chromaphenicol resistance gene Gateway Reading frame cassette A (Invitrogen), LigaFast Rapid DNA Ligation Ligation reaction was performed at room temperature for 15 minutes with System (Promega). Using 1 μl of the ligation product, the cells were transformed into One Shot ccdB Survival T1 Pharge Resistant cells (Invitrogen) and spread on LB + 50 μg / ml ampicillin + 30 μg / ml chloramphenicol medium. Colonies that grew on the plates were confirmed to be inserts by colony PCR using M13-F and M13-R primers, and named pRS333D.

M13-F: 5′-catggtcatagctgtttcc-3 ′ (SEQ ID NO: 14)
M13-R: 5'-ggaaacagctatgaccatg-3 '(SEQ ID NO: 15)

  Next, the vector pTOPO-IoURA3 carrying the IoURA3 marker gene (disclosed in Japanese Patent Application No. 2008-106114) cloned from the MF121 strain was treated with restriction enzymes NotI and SacI (Takara Bio). After electrophoresis, the IoURA3 sequence was The gel was cut and the DNA was purified from the gel using the Zymoclean Gel DNA Recovery kit. The DNA fragment of the IoURA3 marker gene was about 1600 bp (SEQ ID NO: 16), of which IoURA3ORF encoding the URA3 protein was about 800 bp (SEQ ID NOs: 17 and 18).

  Similarly, after treating pRS333D with restriction enzymes NotI and SacI (Takara Bio), the gel containing the vector was cut, and DNA was purified from the gel with the Zymoclean Gel DNA Recovery kit. The DNA fragments were mixed, ligated by the LigaFast Rapid DNA Ligation System, transformed into DH5α, and spread on LB + 100 μg / ml ampicillin medium. The colony that grew on the plate was confirmed with T7-F and T3-R primers and the insert was named pRS333D-IoURA3.

(Production of entry vector)
Aspergillus aculeatus-derived β-glucosidase (AaBGL) using MF121 strain-derived promoter (IoTDH1p, IoPGK1p) and TDH3 promoter from S. cerevisiae (ScTDH3p: SEQ ID NO: 19) and PGK1 promoter (ScPGK1p: SEQ ID NO: 20) as a comparison A gene (GenBank accession number D64088) expression vector was prepared. In the combinations shown in Table 2, an expression cassette was constructed by sequentially linking a promoter, a secretion signal, an AaBGL1 gene, and a terminator, and cloned into a pBluescript vector. Furthermore, attL1 and attL2 sequences (Invitrogen) for Gateway were added to the 5 ′ upstream side and 3 ′ downstream side of the expression cassette, respectively, to obtain an entry vector.

(Preparation of expression vector)
LR reaction using LR clonase enzyme mix (Invitrogen) was performed overnight at 25 ° C with pRS333D-IoURA3 and 5 types of entry vectors shown in Table 2, mixed with proteinase K, reacted at 37 ° C for 10 minutes, and then DH5α Was transformed into LB + 100 μg / ml ampicillin medium. Inserts were confirmed by colony PCR for colonies that grew on the plates. Table 3 summarizes the construction of the prepared AaBGL expression vector.

(Transformation of β-glucosidase (BGL))
To TTK100 which is ura3 mutant of MF121 strain, pHU-IoTDH1p-AaBGL (IoTEF1t), pHU-IoTDH1p-AaBGL (ScSAG1t), pHU-ScTDH3p-AaBGL (IoTEF1t), pHU-IoPGK1p-AaBGL (ScSAG1) ScPGK1p-AaBGL (IoTEF1t) was transformed. The method was performed as follows. After culturing TTK100 in YPD medium at 30 ° C. for 1 day, 1 ml of the culture solution was inoculated into 10 ml of YPD medium and cultured at 30 ° C. for 5 hours. The culture solution was washed with milliQ water and pelletized. 120 μl of 60% polyethylene glycol 3350, 5 μl of 4 M lithium acetate, 10 μl of 1 M dithiothreitol, 10 μl of 10 mg / ml sperm DNA, 10 μl of vector DNA, 45 μl of cell suspension In addition, a heat shock was applied at 42 ° C. for 2 hours. After washing the cells, the cells were seeded into SD-uracil selective medium, and the grown colonies were purified again with SD-uracil selective medium.
For comparison, S. cereivisiae BY4741 was transformed with pHU-IoTDH1p-AaBGL (IoTEF1t) in the same manner as described above. Transformants were selected using SD-histidine plates.

(BGL activity measurement)
The BGL activity of the transformant obtained in Example 7 was evaluated. The transformant was inoculated into 2 ml of casamino acid medium (0.17% Yeast nitrogen base w / o aa and as, 1% casamino acid, 2% glucose) and cultured at 30 ° C. for 1 day. The culture solution was centrifuged and the supernatant was separated and used for activity measurement. The activity of the supernatant was measured as follows. 20 μl of supernatant, 680 μl of MQ water, 200 μl of 250 mM sodium acetate buffer (pH 5), 100 μl of 20 mM p-nitrophenyl-β-D-glucopyranoside (pNPG; Sigma-Aldrich) were added to make 1 ml. After reacting at 30 ° C. for 30 minutes, 100 μl was added with 50 μl of 1N sodium carbonate aqueous solution to stop the reaction, and A ₄₀₀ was measured. Cell surface activity was measured as follows. After washing the cells twice with MQ water, add 50 μl of cell suspension adjusted to OD ₆₀₀ = 1, 650 μl of MQ water, 200 μl of 250 mM sodium acetate buffer (pH 5), 100 μl of 20 mM pNPG, and add 1 ml. did. The mixture was reacted at 30 ° C. for 30 minutes, 150 μl was centrifuged, 50 μl of 1 N sodium carbonate aqueous solution was added to 100 μl of the supernatant to stop the reaction, and A ₄₀₀ was measured. BGL activity (U; unit) was calculated from the measured values. The amount of 1 μmol of p-nitrophenol liberated per 1 min was defined as 1 U. Table 4 summarizes the number of transformants obtained with each vector and the number of transformants in which BGL activity was observed.

  When MFDH1p and IoPGK1p derived from the MF121 strain were used as promoters, transformants expressing BGL activity were obtained when either IoTER1t or ScSAG1t was used as the terminator. On the other hand, a transformant expressing BGL activity was not obtained when ScTDH3p and ScPGKp derived from S. crevisiae were used as promoters. This revealed that heterologous genes can be expressed using IoTDH1p and IoPGK1p derived from the MF121 strain. On the other hand, it was found that ScTDH3p and ScPGKp derived from S. crevisiae do not function in the MF121 strain.

Next, Table 5 shows the results of quantifying BGL activity using transformants in which the expression of BGL activity was confirmed. Since BGL activity was confirmed in the culture supernatant, it was clarified that the secretion signal SSMS derived from the MF121 strain functions correctly and enables secretion expression of heterologous proteins.
When introduced into TTK100 strain (ura3 mutant of MF121 strain) using the same IoTDH1 promoter, the BGL activity was 20% or more higher when using the IoTEF1 terminator than when using the ScSAG1 terminator. From this, it was found that using MFEF1 terminator derived from MF121 strain as the terminator gave higher activity than using ScSAG1 terminator derived from S. cerevisiae. When the same ScSAG1 terminator was used and the IoTDH1 promoter was compared with the IoPGK1 promoter, the IoTDH1 promoter was 1.8 times higher in the supernatant and 1.7 times higher on the cell surface.

  In addition, when S. cerevisiae BY4741 strain was used as a host, BGL activity was expressed even using IoTDH1 promoter and IoTEF1 terminator. This indicates that the IoTDH1 promoter and IoTEF1-minator of MF-121 strain function in S. cerevisiae. However, the BY4741 strain showed higher activity when ScTDH3p was used.

(Proliferation of BGL expression strain on cellobiose medium)
5 ml of cellobiose-casamino acid medium (0.17% Yeast nitrogen base w / o aa and) each of TTK100 (TTK100 / AaBGL) and BY4741 (BY4741 / AaBGL) transformed with pHU-IoTDH1p-AaBGL (IoTEF1t) as, 1% casamino acid, 2% cellobiose) inoculated into an L-shaped test tube, and cultured using a biophoto recorder (TVA062CA, ADVANTECH) under shaking at 30 ° C and 70rpm. Concentration (OD660) was measured over time. The specific growth rate was calculated from the obtained growth curve (Table 6). The specific growth rate of the TTK100 / AaBGL strain was significantly higher than that of the vector control (TTK / vector) and BY4741 / AaBGL strain.

(Ethanol fermentation from cellobiose of BGL expression strain)
Ethanol fermentation test using cellobiose and glucose as carbon source to evaluate fermentation rate using cellobiose as substrate using TTK100 strain (TTK100 / AaBGL strain) transformed with pHU-IoTDH1p-AaBGL (IoTEF1t) Was carried out at 40 ° C. (FIG. 1). Cells that had been cultured in a casamino acid medium at 30 ° C for 1 day were washed with milliQ water, and then the cells corresponding to OD ₆₀₀ = 10/20 ml were centrifuged, and 20 ml of casamino acid medium-5% glucose (0.17% Yeast nitrogen base w / o aa and as, 1% casamino acid, 5% glucose), or casamino acid-5% cellobiose medium (0.17% Yeast nitrogen base w / o aa and as, 1% casamino acid, 4.75% cellobiose) The mixture was stirred with a stirrer at 40 ° C. Sugar was assimilated 6 to 8 hours after the start of fermentation to produce ethanol. The sugar consumption rates of glucose and cellobiose were almost the same. The ethanol fermentation rate was also the same. Since BGL-secreting yeast has the same ability as glucose even when cellobiose is used as a substrate, it was found that sufficient BGL was secreted to degrade cellobiose. In addition, the TTK100 strain (TTK100 / vector) into which the control vector was introduced could not assimilate cellobiose.

(Ethanol fermentation from crystalline cellulose of BGL expression strain)
Simultaneous saccharification and fermentation using commercially available cellulase preparation with Avicel PH101, SIGMA, which is crystalline cellulose, using TTK100 strain (TTK100 / AaBGL strain) transformed with pHU-IoTDH1p-AaBGL (IoTEF1t) (FIG. 2). TTK100 / AaBGL strain and reference strain (TTK100 strain into which control vector is introduced; TTK100 / vector) are pre-cultured at 30 ° C, and Avicel casamino acid medium (0.17% YNB, 1% casamino acid so that OD ₆₀₀ = 10) , Avicel 4g / 40ml (100g / l)), and commercially available cellulase enzyme preparation (novozyme) to 15FPU / g Avicel, or cellulase enzyme preparation, 1/5 volume (vol / vol) of BGL additive A cellulase preparation containing BGL prepared by adding (Novozyme188; novozyme) was added with 22.2 FPU / g, and a fermentation test was conducted at 40 ° C. The reference strain produced 7 g / l ethanol after 24 hours with the cellulase enzyme preparation alone and 17 g / l ethanol with the BGL-added cellulase preparation. From this, it was found that the cellulase enzyme preparation alone has insufficient ability to saccharify crystalline cellulose, and it is necessary to add a BGL-added cellulase preparation in order to perform sufficient saccharification. On the other hand, the BGL-secreting strain was a cellulase enzyme preparation alone and produced 18 g / l ethanol after 24 hours, and the BGL-added cellulase preparation produced 19.1 g / l ethanol. From this, it was found that if the TTK100 / AaBGL strain was used, it was possible to sufficiently saccharify and ferment the crystalline cellulose using only the cellulase enzyme preparation, and there was no need to add the BGL-added cellulase preparation. This proved that the cost of the BGL-added cellulase preparation can be reduced.

SEQ ID NOs: 6-15: primers

Claims (17)

The following (a) to (h):
(A) DNA comprising the base sequence represented by SEQ ID NO: 1
(B) a DNA having a base sequence including at least the 3 ′ end of the base sequence represented by SEQ ID NO: 1 and having promoter activity
(C) DNA having a promoter sequence having 70% or more identity with the nucleotide sequence represented by SEQ ID NO: 1 and having promoter activity
(D) DNA having a promoter activity that hybridizes with all or part of the complementary strand of DNA consisting of the base sequence represented by SEQ ID NO: 1.
(E) DNA comprising the base sequence represented by SEQ ID NO: 2
(F) DNA having a nucleotide sequence including at least the 3 ′ end of the nucleotide sequence represented by SEQ ID NO: 2 and having promoter activity
(G) a DNA sequence having a base sequence of 70% or more identical to the base sequence represented by SEQ ID NO: 2 and having promoter activity (h) all of DNA consisting of the base sequence represented by SEQ ID NO: 2 or DNA that hybridizes with some complementary strands and has promoter activity
Any DNA selected from   The DNA according to claim 1, wherein the DNA is selected from (a) to (d).   The DNA according to claim 1 or 2, wherein the promoter activity is promoter activity in Issatchenkia orientalis or related species.   The DNA according to any one of claims 1 to 3, which is a promoter for expressing a heterologous protein in Issatchenkia orientalis or a related species thereof.   The DNA according to any one of claims 1 to 4, wherein the promoter activity is promoter activity in the Issatchenkia orientalis MF121 strain or a related species thereof. The following (a) to (e);
(A) a peptide comprising the amino acid sequence represented by SEQ ID NO: 3 (b) a peptide having an amino acid sequence of 70% or more identical to the amino acid sequence represented by SEQ ID NO: 3 and having a secretion signal activity in Issatchenkia orientalis ( c) A peptide having an amino acid sequence obtained by substituting, inserting, deleting and adding one or more amino acid residues to the amino acid sequence represented by SEQ ID NO: 3, and having a secretion signal activity (d) A peptide having a secretory signal activity encoded by a base sequence having 70% or more identity with the base sequence represented by SEQ ID NO: 4 (e) All or part of DNA comprising the base sequence represented by SEQ ID NO: 4 Any peptide selected from peptides having a secretory signal activity encoded by a base sequence that hybridizes with the complementary strand of. The following (a) to (d):
(A) DNA comprising the base sequence represented by SEQ ID NO: 5
(B) DNA having a base sequence including at least the 5 ′ end of the base sequence represented by SEQ ID NO: 5 and having terminator activity
(C) a base sequence having 70% or more identity with the base sequence represented by SEQ ID NO: 5 and having terminator activity (d) all or part of the DNA comprising the base sequence represented by SEQ ID NO: 5 DNA having any base sequence selected from base sequences that hybridize with complementary strands and have terminator activity. An expression system in Issatchenkia orientalis,
An expression system comprising the DNA according to claim 1 as a promoter.   Furthermore, the expression system of Claim 8 provided with DNA which codes the amino acid sequence of the peptide of Claim 6 as secretion signal DNA.   Furthermore, an expression system comprising the DNA according to claim 7 as a terminator.   The expression system according to any one of claims 8 to 10, which is a vector.   A transformant of Issatchenkia orientalis and its related species, which uses the DNA according to any one of claims 1 to 5 as a promoter and retains a DNA encoding a heterologous protein under the control of the promoter.   Furthermore, the transformant of Claim 12 which hold | maintains DNA of Claim 7 operably as a terminator with respect to the said promoter.   The transformant according to claim 12 or 13, wherein the heterologous protein comprises cellulase.   The transformant according to any one of claims 12 to 14, wherein the host is Issatchenkia orientalis MF121 strain. A protein production method comprising:
Using Issatchenkia orientalis or a related species thereof as a host, using the DNA according to any one of claims 1 to 5 as a promoter, and expressing a heterologous protein under the control of the promoter,
A method comprising: A method for producing useful substances,
Using Issatchenkia orientalis or a related species thereof as a host, using the DNA according to any one of claims 1 to 5 as a promoter, expressing a heterologous protein under the control of the promoter, and producing the useful substance by fermentation. A method of providing.