JP2011036223A - Method for screening calorie restriction mimetic - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for screening calorie restriction (CR) mimetics. <P>SOLUTION: There is provided the method for screening including steps of: carrying out a reporter assay using a reporter vector containing a consensus sequence found on the upstream side of a gene in which expression is activated by the CR, a promoter, and a reporter gene; comparing the expression level of the reporter gene in the presence of a test substance with that in the absence of the test substance; and selecting the test substance raising the expression level of the reporter gene as the CR mimetics. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a method for screening a calorie restriction mimetic and vectors, kits and the like useful for carrying out the method.

Calorie restriction (CR) is the most reliable intervention method that delays the onset of diseases associated with aging, such as lifestyle-related diseases, cancer, Alzheimer's disease, and prolongs life expectancy.
Therefore, the development of caloric restriction mimetics (CR mimetics) that can be expected to have the same effect as caloric restriction without pain has the potential to prevent disease and control the progression of the disease. It is thought that it has. However, an efficient screening method for calorie restriction mimetics has not been established so far.
Much research has been conducted on genes that contribute to the life extension effect by calorie restriction, and several genes have been listed as candidates for their essential properties. Many of them are related to signal genes belonging to the GH (growth harmone) system or the Insulin system. The present inventor also studied the possibility that the GH-IGF-I (pituitary growth hormone-insulin-like growth factor-I) signal transduction system has its essential form, and created a transgenic rat into which a GH antisense gene was introduced. did. In the transgenic rat, a life extension effect was certainly observed, and it was proved that a part of the effect by calorie restriction was due to the GH-IGF-I signal transduction system. However, in the transgenic rat, the life extension effect is not as great as that in normal mice with calorie restriction, and when the transgenic rat is calorie restricted, the lifespan is further extended. Therefore, the GH-IGF-I signaling system It was considered that there are other mechanisms (Non-Patent Document 1).
As in the past, if one of a plurality of genes contributing to the life extension effect due to calorie restriction is used to track the effect, only the effect related to that gene can be obtained and the gene is affected. Since only caloric restriction mimetics can be screened, the caloric restriction mimics have insufficient screening capabilities.
In addition, it has become clear from studies using knockout mice that PGC-1α is important in preventing neurodegeneration due to oxidative stress (Non-patent Document 2). It has also been reported that a gene expression pattern similar to caloric restriction is shown due to overexpression of HNF-4 or the like (Non-patent Document 3). However, it is known that constitutive activation of PGC-1α and HNF-4 exhibits a phenotype similar to that of diabetes, such as increased gluconeogenesis and increased blood glucose level.

FASEB J.H. 2003 Jun; 17 (9): 1108-9. Epub 2003 Apr 8. St-Pierre J et al. Cell. 2006 Oct 20; 127 (2): 397-408. Rodgers JT et al. , Nature. 2005 Mar 3; 434 (7029): 113-8.

  An object of the present invention is to identify a calorie restriction mimetic and a target molecule thereof that can bring about the same effect as calorie restriction, and to provide a screening method for the calorie restriction mimic using the same.

  The present inventor has paid attention to the fact that if it works on a transcriptional activity regulatory sequence common to the gene related to the effect of calorie restriction, it can cover most of the life extension effects of the downstream gene. In order to solve the problem, the present inventors have intensively studied and found that there is a consensus sequence upstream of a gene whose expression is activated by calorie restriction. As a result of further research, the present invention has been completed.

That is, the present invention provides the following.
(1) A reporter vector,
(A) Any one nucleotide sequence selected from the following (a) to (d):
(A) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4,
(B) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, wherein one or more nucleotides are deleted, substituted, inserted or added;
(C) a nucleotide sequence having at least 70% identity to the nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, and (d) the sequence described in (a) to (c) above A nucleotide sequence complementary to (B) a promoter, and (C) a reporter gene;
The promoter is linked to the 5 ′ side of the reporter gene so that it can drive transcription of the reporter gene; and the nucleotide sequence of (A) can regulate transcription of the reporter gene by the promoter Thus, a reporter vector linked to the 5 ′ side of the promoter.
(2) The nucleotide sequence of (A) is any one selected from the following (a ′) to (d ′), and is a nucleotide sequence capable of binding to HNF-4α (1) Reporter vector:
(A ′) the nucleotide sequence represented by SEQ ID NO: 1,
(B ′) a nucleotide sequence in which one or more nucleotides are deleted, substituted, inserted or added in the nucleotide sequence represented by SEQ ID NO: 1.
(C ′) a nucleotide sequence having at least 70% identity to the nucleotide sequence represented by SEQ ID NO: 1, and (d ′) a nucleotide sequence complementary to the sequences described in (a ′) to (c ′) above .
(3) A transformant introduced with the reporter vector according to (1).
(4) A non-human transgenic mammal into which the reporter vector according to (1) is introduced.
(5) Caloric restriction mimicking substance screening method including the following steps:
1) performing a reporter assay using the reporter vector described in (1) in the presence of a test substance;
2) comparing the expression level of the reporter gene in the presence of the test substance with that in the absence of the test substance; and 3) comparing the test substance whose reporter gene expression level is increased as a result of the comparison. Select as a calorie restriction mimetic candidate.
(6) A kit for screening a calorie restriction mimetic comprising the reporter vector according to (1), a transformant introduced with the reporter vector, or a non-human transgenic mammal introduced with the reporter vector.
(7) A screening method for a substance that extends the life, including the following steps:
1) performing a reporter assay using the reporter vector described in (1) in the presence of a test substance;
2) comparing the expression level of the reporter gene in the presence of the test substance with that in the absence of the test substance; and 3) comparing the test substance whose reporter gene expression level is increased as a result of the comparison. Select as a candidate for a substance that prolongs life.
(8) A kit for screening for a substance that extends life span, including the reporter vector according to (1), a transformant introduced with the reporter vector, or a non-human transgenic mammal introduced with the reporter vector .
(9) The reporter vector according to (2), a transformant introduced with the reporter vector, or a non-human transgenic mammal introduced with the reporter vector, and expression capable of expressing HNF-4α or HNF-4α A combination containing a vector.
(10) The combination according to (9), further comprising an expression vector capable of expressing PGC-1α or PGC-1α.

  According to the method of the present invention, it is possible to screen for a calorie restriction mimetic that can activate transcription of a plurality of genes that bring about a life extension effect by calorie restriction. By using the method of the present invention, it is possible to obtain a substance that is inexpensive and has a high calorie restriction mimicking effect (for example, a life extension effect) within a short period of time. The method of the present invention can be performed both in vitro and in vivo.

The binding analysis result of the motif 2 and HNF-4 (alpha) by a gel shift assay is shown. Lane 1: No Flag-HNF-4α protein. Lane 2: with Flag-HNF-4α protein. Lane 3: with Flag-HNF-4α protein. With anti-Flag antibody. Lane 4: with Flag-HNF-4α protein. Non-biotinylated motif 2 DNA present. The binding confirmation result of HNF-4α upstream of ApoC-II and Gstm genes by chromatin immunoprecipitation is shown. Lane 1: 100 bp DNA marker. Lane 2: DNA not immunoprecipitated in the reaction system (positive control). Lane 3: DNA immunoprecipitated with non-specific IgG antibody (negative control). Lane 4: DNA immunoprecipitated with RNA polymerer antibody (positive control). Lane 5: DNA immunoprecipitated with HNF-4α antibody (binding analysis) 1. Lane 6: DNA immunoprecipitated with HNF-4α antibody (binding analysis) 2. Lane 7: DNA not immunoprecipitated in the reaction system (positive control). Lane 8: DNA immunoprecipitated with non-specific IgG antibody (negative control). Lane 9: DNA immunoprecipitated with RNA polymerer antibody (positive control). Lane 10: DNA immunoprecipitated with HNF-4α antibody (binding analysis) 1. Lane 11: DNA immunoprecipitated with HNF-4α antibody (binding analysis) 2. Lane 12: 100 bp DNA marker. The role of HNF-4α and PGC-1α in reporter activation in 293 cells is shown (24 hours in culture). The role of HNF-4α and PGC-1α in reporter activation in 293 cells is shown (cultured for 48 hours). Figure 6 shows the effect of insulin / dexamethasone addition on cell lines that constitutively express the reporter. The result of the reporter assay by transient gene transfer in the mouse | mouth body is shown.

1. Reporter vector The present invention is a reporter vector comprising:
(A) Any one nucleotide sequence selected from the following (a) to (d):
(A) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4,
(B) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, wherein one or more nucleotides are deleted, substituted, inserted or added;
(C) a nucleotide sequence having at least 70% identity to the nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, and (d) the sequence described in (a) to (c) above A nucleotide sequence complementary to (B) a promoter, and (C) a reporter gene;
The promoter is linked to the 5 ′ side of the reporter gene so that it can drive transcription of the reporter gene; and the nucleotide sequence of (A) can regulate transcription of the reporter gene by the promoter Thus, a reporter vector linked to the 5 ′ side of the promoter is provided.

The nucleotide sequences represented by SEQ ID NOs: 1 to 4 are as follows.
Sequence number 1: agcacttgggaggcagaggcagggggag (motif 2)
Sequence number 2: agaccaggctggcct (motif 1)
Sequence number 3: ctgcctctgcctccc (motif 3)
Sequence number 4: agtgagttccaggccagccag (motif 4)

  As shown in Examples described later, the nucleotide sequences represented by SEQ ID NOs: 1 to 4 are genes whose expression is enhanced in Ames dwarf mice exhibiting longer life than control mice, and are expressed by calorie restriction. Is a motif that is frequently found upstream of a further enhanced gene (43 genes).

  The nucleotide sequence of (b) is a nucleotide sequence in which one or more nucleotides are deleted, substituted, inserted or added in the nucleotide sequence represented by any one of SEQ ID NOS: 1-4, for example, (1) sequence One or more (preferably 1 to 10, more preferably 1 to 5, more preferably 1 or 2) nucleotides in the nucleotide sequence represented by any one of Nos. 1 to 4 were deleted. Nucleotide sequence, (2) One or more nucleotide sequences represented by any one of SEQ ID NOs: 1 to 4 (preferably 1 to 10, more preferably 1 to 5, more preferably 1 or 2) (3) One or more nucleotides represented by any one of SEQ ID NOs: 1 to 4 (preferably 1 to 10, more preferably) Is a nucleotide sequence into which 1 to 5, more preferably 1 or 2 nucleotides are inserted, (4) one or more (preferably, a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 4) A nucleotide sequence in which 1 to 10 nucleotides, more preferably 1 to 5 nucleotides, more preferably 1 or 2 nucleotides) are substituted with other nucleotides, or (5) a combination of (1) to (4) above. Nucleotide sequence (in this case, the sum of the mutated nucleotides is preferably 1 to 10, more preferably 1 to 5, even more preferably 1 or 2).

  The nucleotide sequence of (c) is 70% or more, preferably 80% or more, more preferably 90% or more, and still more preferably 95% or more with the nucleotide sequence represented by any one of SEQ ID NOs: 1-4. It is a nucleotide sequence having identity.

  As used herein, “identity” refers to an optimal alignment when two nucleotide sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm uses a sequence of sequences for optimal alignment). Means the percentage of identical nucleotide residues relative to all overlapping nucleotide residues in one or both of which can be considered).

  The identity of the nucleotide sequences in this specification is based on the homology calculation algorithm ClassalW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html?) Published on the Internet homepage of EMBL-EBI. Used and calculated under default conditions.

The nucleotide sequence (d) is a sequence complementary to the sequences described in the above (a) to (c).
As used herein, “complementary” refers to a complementarity of about 70% or more, preferably about 80% or more, more preferably about 90% or more, more preferably about 95% or more, and most preferably 100% between nucleotide sequences. It means having. Using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expected value = 10; allow gap; filtering = ON; match score = 1; mismatch score = -3) Can be calculated.

  In this vector, the nucleotide sequence (A) can regulate transcription of a reporter gene by a promoter. “Modulation” includes promotion and repression of transcription. “Promotion” is preferred. Such transcriptional regulation is provided by transcription factors that can bind to the nucleotide sequence of (A). Examples of the transcription factor include HNF-4α.

The nucleotide sequence (A) is preferably any one selected from the following (a ′) to (d ′) and is a nucleotide sequence capable of binding to HNF-4α:
(A ′) the nucleotide sequence represented by SEQ ID NO: 1,
(B ′) In the nucleotide sequence represented by SEQ ID NO: 1, one or more (preferably 1 to 10, more preferably 1 to 5, more preferably 1 or 2) nucleotides are deleted, substituted, Inserted or added nucleotide sequence,
(C ′) a nucleotide sequence having at least 70% (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more) identity to the nucleotide sequence represented by SEQ ID NO: 1, and (d ′ ) A nucleotide sequence complementary to the sequence described in (a ′) to (c ′) above.

  The nucleotide sequences (a ′) to (d ′) above bind to HNF-4α. “Binding of nucleotide sequence X to HNF-4α” means binding of DNA consisting of nucleotide sequence X to HNF-4α. This binding to HNF-4α particularly means binding at physiological conditions in the nucleus of mammalian cells. The binding can be confirmed by gel shift assay using DNA consisting of the nucleotide sequence to be evaluated and isolated or purified HNF-4α. The gel shift assay can be performed using, for example, EMSA: electrophoretic mobility shift assay kit (Pierce).

  HNF-4α is a known nuclear receptor identified as a transcription factor that is abundant in the liver. It is known that certain fatty acyl CoAs are endogenous ligands that activate HNF-4α. In the present specification, HNF-4α particularly means mammalian HNF-4α. In this specification, as mammals, for example, laboratory animals such as rodents such as mice, rats, hamsters, guinea pigs, and rabbits, domestic animals such as pigs, cows, goats, horses, sheep, minks, dogs, cats, etc. Primates such as pets, humans, monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees. The mammal is preferably a rodent (eg mouse) or a primate (eg human).

  Therefore, when the nucleotide sequence of any of the above (a ′) to (d ′) is used as the nucleotide sequence of (A), when the reporter vector of the present invention is introduced into a mammalian cell containing HNF-4α, HNF-4α binds to the nucleotide sequence of (A), and transcription of the reporter gene is promoted.

  “Promoter” refers to a region on DNA that determines the initiation site of transcription of a gene and directly drives its frequency, and is usually a nucleotide sequence that starts binding when RNA polymerase binds. The promoter that can be used in the reporter vector of the present invention is a promoter that can function in mammalian cells. The type of cell is not particularly limited, but a cell that can naturally express at least one of the genes whose expression is increased by caloric restriction listed in Table 1 described later is preferable. Examples of such cells include, but are not limited to, hepatocytes, adipocytes, kidney cells (293 cells, etc.), fibroblasts, and the like. The type of promoter is not particularly limited, and can be appropriately selected according to the purpose of use, the type of cell to be introduced, and the like. As the promoter, a pol I promoter, pol II promoter, pol III promoter, or the like can be used. Specifically, SRα promoter, SV40 promoter, hsp68 promoter / enhancer, LTR promoter, CMV promoter, HSV-TK promoter and the like can be used, but are not limited thereto.

  “Reporter gene” refers to a gene encoding a polypeptide (or mRNA) that is easy to detect. Examples of the reporter gene include, but are not limited to, enzymes and fluorescent proteins. Suitable reporter genes include, for example, luciferase gene, secreted luciferase gene, β-galactosidase gene, alkaline phosphatase gene, secreted alkaline phosphatase (SEAP) gene, peroxidase gene, chloramphenicol acetyltransferase gene, green fluorescein A protein (GFP) gene etc. are mentioned.

  “Reporter vector” means an expression vector capable of expressing a reporter gene.

  In the reporter vector of the present invention, the promoter is linked to the 5 'side of the reporter gene so that transcription of the reporter gene can be driven. The promoter may be located anywhere in the vector as long as it can drive the transcription of the reporter gene of the present invention. However, the promoter is usually about 20 to 30 bp upstream from the transcription start site of the reporter gene (5 Located on the 'side'.

  In the reporter vector of the present invention, the nucleotide sequence (A) is linked to the 5 'side of the promoter so that transcription of the reporter gene by the promoter can be regulated. As long as the transcription of the reporter gene by the promoter can be regulated, the nucleotide sequence of (A) may be linked adjacent to the promoter (that is, not via the spacer region), or linked via the spacer region. May be. The length of the spacer region is not particularly limited as long as the reporter vector of the present invention can stably exist and can regulate transcription of the reporter gene by a promoter, but at most 10 Kbp, for example, 5 Kbp or less, 3 Kbp or less, It is preferably 1 Kbp or less, 500 bp or less, 200 bp or less, 100 bp or less, 50 bp or less, or 25 bp or less. The nucleotide sequence constituting the spacer region is not particularly limited and can be any sequence.

  In the reporter vector of the present invention, the number of copies of the nucleotide sequence (A) contained in one vector is not particularly limited, and only one copy of the nucleotide sequence (A) is contained in one vector. Alternatively, a plurality of copies of the nucleotide sequence (A) may be contained in one vector in a form linked in tandem. By using a plurality of copies of the nucleotide sequence (A) linked in tandem, transcription of the reporter gene is more strongly regulated (promoted or suppressed). In the case of using multiple copies of the nucleotide sequence of (A) linked in tandem, the number of copies of the linked nucleotide sequence of (A) is not particularly limited as long as it can regulate transcription of the reporter gene by the promoter, For example, it is 2 to 50 copies, preferably 2 to 20 copies, and more preferably about 2 to 10 copies. In consideration of the ease of polynucleotide ligation operation, about 2 to 5 copies are preferred.

  The type of the vector serving as the skeleton of the reporter vector of the present invention is not particularly limited, and can be appropriately selected depending on the purpose of use, the type of cell to be introduced, and the like. Examples of vectors include plasmid vectors (plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), viral vectors (such as animal viruses such as retrovirus, vaccinia virus, baculovirus), plasmids derived from Bacillus subtilis (eg, pUB110). PTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15, pAU001) and the like, and bacteriophages such as λ phage, but are not limited thereto.

  The reporter vector of the present invention may further contain an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin, and the like as desired. Examples of the selectable marker include a dihydrofolate reductase gene (hereinafter sometimes abbreviated as dhfr, methotrexate (MTX) resistance), an ampicillin resistance gene (hereinafter sometimes abbreviated as ampr), and a neomycin resistance gene (hereinafter referred to as amplicon). , Neor, which may be abbreviated as neor). In particular, when dhfr gene-deficient Chinese hamster cells are used and the dhfr gene is used as a selection marker, the target gene can be selected using a medium not containing thymidine.

  The reporter vector of the present invention is useful for carrying out the following screening method for calorie restriction mimics.

2. Transformant The present invention provides a transformant into which the reporter vector of the present invention is introduced. Hosts include, for example, Escherichia coli (Escherichia coli, etc.), Bacillus (Bacillus subtilis, etc.), yeast (Saccharomyces cerevisiae, etc.), insect cells (night stealing larvae) Derived cell lines (Spodoptera frugiperda cells; Sf cells, etc.), mammalian cells (hepatocytes, adipocytes, kidney cells (293 cells, etc.), fibroblasts, etc.) and the like are used. The host is preferably a mammalian cell.

  The transformant of the present invention is prepared by using the above-described reporter vector of the present invention from a gene transfer method known per se (for example, lipofection method, calcium phosphate method, microinjection method, protoplast fusion method, electroporation method, DEAE dextran method, Gene Gun). The gene can be produced by introducing it into the above-mentioned host according to the method for gene introduction by the above. The transformant of the present invention is useful for carrying out the following screening method for calorie restriction mimics.

  Another gene may be introduced into the transformant of the present invention. Although the kind of the gene is not particularly limited, for example, mammalian HNF-4α is preferable. As described above, when any one of the nucleotide sequences (a ′) to (d ′) described above is used as the nucleotide sequence (A), HNF-4α is the nucleotide (A) in the reporter vector of the present invention. Binding to the sequence promotes transcription of the reporter gene. Therefore, the transcription of the reporter gene is promoted by introducing an expression vector capable of expressing HNF-4α into the transformant of the present invention. Further, in the presence of a ligand of HNF-4α such as fatty acyl CoA, it is expected that HNF-4α is activated and transcription of the reporter gene is further promoted. Therefore, the present invention provides the reporter vector of the present invention in which the nucleotide sequence of (A) is any one of the above-described nucleotide sequences (a ′) to (d ′) and an expression vector capable of expressing mammalian HNF-4α. Is also provided, and the transformant is useful as a positive control in the following screening method for calorie restriction mimics.

  Moreover, as shown in the below-mentioned Example, when the nucleotide sequence of any of the above (a ′) to (d ′) is used as the nucleotide sequence of (A), PGC-1α that is a transcription coupling factor is Further enhances the promotion of reporter gene transcription by HNF-4α. Therefore, the present invention provides a reporter vector of the present invention in which the nucleotide sequence of (A) is any one of the above-described nucleotide sequences (a ′) to (d ′), an expression vector capable of expressing mammalian HNF-4α And a transformant into which an expression vector capable of expressing mammalian PGC-1α is introduced. The transformant is useful as a positive control in the following screening method for calorie restriction mimetics. is there.

  The expression vector capable of expressing mammalian HNF-4α and the expression vector capable of expressing mammalian PGC-1α are the components of the reporter vector of the present invention except that the nucleotide sequence of (A) is not required. According to the above, it can be easily manufactured by those skilled in the art.

3. Transgenic Mammal The present invention provides a non-human transgenic mammal into which the above-described reporter vector of the present invention has been introduced. By using the transgenic mammal of the present invention, the following screening method for calorie restriction mimetics can be performed in vivo.

  The transgenic mammal of the present invention can be produced by introducing the above-described reporter vector of the present invention into a mammal individual. In this case, as the promoter contained in the reporter vector, a promoter capable of driving the transcription of the reporter gene in the cells of the mammalian individual into which the reporter vector of the present invention is introduced is selected.

  As a method for introducing the reporter vector of the present invention into a mammal individual, for example, a method of directly injecting the reporter vector into a mammal individual can be used. In this case, a sufficient amount of the reporter vector is injected into the animal individual to ensure that the reporter vector reaches the target cells in the subject non-human mammal individual. In this case, it is preferable to use a viral vector as a reporter vector from the viewpoint of introduction efficiency. When using a plasmid vector as a reporter vector, it is desirable to inject it into a mammal together with an appropriate gene introduction reagent.

  For example, as described in Examples below, the reporter vector of the present invention is introduced into a vein of a non-human mammal together with a gene introduction reagent based on the hydrodynamic method to introduce the reporter vector of the present invention. Non-human transgenic mammals can be produced.

  However, as described above, by direct injection of a reporter vector into a mammal individual, the introduced reporter vector often does not enter the germ line and is not transmitted to offspring. Therefore, in order to introduce the reporter vector of the present invention into the germline more reliably, the above reporter vector is introduced into fertilized eggs, embryonic stem cells (hereinafter abbreviated as ES cells), etc. of non-human mammals, and these cells. By selecting an individual in which the reporter vector of the present invention is integrated on the chromosomes of all cells including germline cells, the reporter vector of the present invention is stably integrated on the chromosome. Non-human transgenic mammals can be produced. The presence of the reporter vector introduced in the germline cells of the produced non-human transgenic mammal means that the produced mammalian progeny are introduced into all of the germline cells and somatic cells of the present invention. Having a vector can be confirmed as an indicator. The selection of an individual is performed by confirming at the DNA level that a reporter vector introduced onto a chromosomal DNA prepared from a part of a tissue constituting the individual, for example, blood tissue, tail, etc. is present. The individual thus selected is usually a heterozygote having the reporter vector of the present invention introduced into one of the homologous chromosomes, so that it was introduced from the offspring by mating the heterozygous individuals. Homozygous animals having a reporter vector on both homologous chromosomes can be obtained. By mating the homozygous male and female animals, all the offspring become homozygotes stably holding the reporter vector of the present invention, so that the non-human transgenic mammal of the present invention can be used in a normal breeding environment. Can be subcultured.

  For example, after introducing the reporter vector of the present invention into a fertilized egg by a microinjection method or a method using a retrovirus, the fertilized egg was artificially transplanted and implanted in a female non-human mammal. A non-human transgenic mammal having a chromosomal DNA incorporating a reporter vector is obtained.

  In addition, after introducing the reporter vector of the present invention into ES cells of non-human mammals, the obtained ES cells are incorporated into fertilized eggs of non-human mammals using the assembly chimera method or the injection chimera method, and the resulting chimeras By artificially transplanting and implanting an embryo into a female non-human mammal, a non-human chimeric mammal partially having cells having chromosomal DNA incorporating the introduced reporter vector of the present invention is obtained.

  The reporter vector of the present invention is introduced into an ES cell by using a known gene transfer technique (for example, calcium phosphate method, electric pulse method, lipofection method, aggregation method, microinjection method, particle gun method, DEAE-dextran). For example, a viral vector method, etc.).

  Furthermore, the introduced reporter is obtained by crossing a non-human chimeric mammal with normal mammals or the chimeric mammals and selecting an individual carrying the introduced reporter vector of the present invention from the next generation (F1) individuals. A non-human transgenic mammal having a chromosomal DNA incorporating the vector is obtained. Selection of mammals (excluding humans) carrying the reporter vector of the present invention was introduced on chromosomal DNA prepared from a part of an individual, such as blood tissue, tail, etc., as described above. This is done by confirming the presence of the reporter vector of the present invention at the DNA level.

4). Screening Method The present invention provides a screening method for a calorie restriction mimetic (or a substance that extends lifespan) comprising the following steps:
1) performing a reporter assay using the above-described reporter vector of the present invention in the presence of a test substance;
2) comparing the expression level of the reporter gene in the presence of the test substance with that in the absence of the test substance; and 3) comparing the test substance whose reporter gene expression level is increased as a result of the comparison. Select as a candidate for calorie restriction mimetics (or substances that extend lifespan).

  As used herein, “calorie restriction mimetics” actually reduce food intake by administration (oral, intravenous injection, etc.) to cells and in vivo as drugs or chemicals (including synthetic and natural products). Rather, it refers to a substance that can obtain the effect obtained when calorie restriction is performed under the condition of about 70% in terms of calories, compared with the standard or free intake. The effects obtained by caloric restriction include, for example, life extension effect, improvement of metabolic diseases, improvement of neurodegenerative diseases, suppression of cancer, suppression of skin wrinkles, sagging, suppression of aging such as suppression of hair loss. is there.

  The test substance used for the screening method of the present invention may be any known compound and novel compound, for example, using nucleic acid, carbohydrate, lipid, protein, peptide, low-molecular-weight organic compound, combinatorial chemistry technique. The prepared compound library, random peptide library, natural components derived from microorganisms, animals and plants, marine organisms, and the like can be mentioned.

  The reporter assay in 1) is performed in vitro or in vivo. In vitro reporter assay is performed by culturing the above-described transformant of the present invention in the presence of a test substance. The test substance and the transformant are brought into contact with each other by bringing the test substance into contact with the transformant by culturing the transformant in a medium to which the test substance is added. The transformant can be cultured by a method generally used for culturing the host cell.

As a medium for culturing a transformant whose host is a mammalian cell, for example, a minimal essential medium (MEM) containing about 5 to about 20% fetal bovine serum [Science, Vol. 122, 501 ( 1952)], Dulbecco's modified Eagle medium (DMEM) [Virology, 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association] 199, 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1950)], etc. Is used. The pH of the medium is preferably about 6-8. The concentration of CO ₂ in the atmosphere is usually in the range of about 1 to 10%, preferably about 5%. The humidity in the atmosphere is usually in the range of about 70 to 100%, preferably about 95 to 100%. The culture temperature is usually in the range of about 30 to 40 ° C, preferably about 37 ° C. The culture period is not particularly limited as long as it is long enough to perform a reporter assay, but is usually about 15 to 60 hours. You may perform ventilation | gas_flowing and stirring as needed.

  An in vivo reporter assay is performed by administering a test substance to the above-described non-human transgenic mammal of the present invention. Administration of the test substance can be carried out by injection, but it may also be carried out by rearing using food or drinking water to which the test substance has been added. After the administration, in order to confirm the effect of the test substance, the administered non-human transgenic mammal is bred for an appropriate period (usually about 0.5 to 3 days).

  After an appropriate period, the expression level of the reporter gene in the transformant of the present invention or the non-human transgenic mammal is measured. Measurement of the expression level of a reporter gene in a non-human transgenic mammal is usually performed using tissues or cells isolated from the mammal. The expression level of the reporter gene is measured by an appropriate means depending on the type of the reporter gene. For example, when the reporter gene is a fluorescent protein, the expression level of the reporter gene is measured using the fluorescence intensity as an index. When the reporter gene is an enzyme, homogenize the cells and tissues used in the reporter assay, add a substrate corresponding to the resulting homogenate, incubate, and measure the enzyme activity in the homogenate to determine the reporter gene. The expression level is measured. Each enzyme and its corresponding substrate is well known in the art. In addition, by using a secreted reporter, the enzyme activity of a reporter gene secreted in the blood can be measured. In this case, the transformant or non-human transgenic mammal can be kept alive over time. Activity can be measured.

  Thereafter, the expression level of the reporter gene in the presence of the test substance is compared with that in the absence of the test substance. The comparison of expression levels can be preferably performed based on the presence or absence of a significant difference. Note that the expression level of the reporter gene in the absence of the test substance was a value measured at the same time, even if it was a value measured in advance for the measurement of the expression level of the reporter gene in the presence of the test substance. However, it is preferably a value measured simultaneously from the viewpoint of the accuracy and reproducibility of the experiment.

  Then, there is a positive correlation between the expression level of the reporter gene and the activity that extends the life span. That is, the test substance obtained as a result of the comparison has an increased expression level of the reporter gene (for example, the expression level of the reporter gene is increased by about 20% or more, preferably 30% or more, more preferably about 50% or more. Test substance) is selected as a candidate for calorie restriction mimetic substance (or substance that prolongs life).

Thereafter, a confirmation test may be performed to determine whether the obtained candidate substance actually has a calorie restriction mimicking effect (or an effect of extending the lifetime). The confirmation test includes, for example, the following steps:
1) administering a candidate substance to a non-human mammal and raising it;
2) comparing the lifetime of a non-human mammal that has been administered a candidate substance with that of a non-human mammal that has not been administered a candidate substance; and 3) as a result of the comparison, extending the lifetime of a non-human mammal Selected candidate substances.

  Since the substance obtained by the screening method of the present invention may exert the advantageous effect obtained when calorie restriction is performed (for example, the effect of life extension) without caloric restriction, in order to extend the life. Diseases for anti-aging or associated with aging (eg neurodegenerative diseases (eg Alzheimer's disease, Down's syndrome, polyglutamine disease, Parkinson's disease, amyotrophic lateral sclerosis, prion disease, cerebellar degeneration etc.) ), Eating disorders, lifestyle-related diseases (eg hypertension, arteriosclerosis, ischemic heart disease, cerebrovascular disorder, etc.), cancer) or metabolic diseases (eg obesity, insulin resistance, diabetes, diabetic complications ( Examples: Diabetes neuropathy, diabetic nephropathy, diabetic retinopathy), impaired glucose tolerance, hyperlipidemia) for the development of medicines, animal drugs, foods, feeds or cosmetics Candidate It is useful to.

  Moreover, this invention provides the kit for performing said screening. The kit includes a reporter vector, a transformant or a non-human transgenic animal of the present invention.

  The kit of the present invention may further contain a reagent for carrying out the screening (for example, when the reporter gene is an enzyme, a corresponding substrate, a medium, a positive control), instructions describing the protocol, and the like. it can. Examples of positive controls include expression vectors that can express HNF-4α or HNF-4α. The positive control can further comprise an expression vector capable of expressing PGC-1α or PGC-1α. These positive controls are particularly advantageous when the reporter vector of the present invention in which the nucleotide sequence (A) is any one of the nucleotide sequences (a ') to (d') described above is used for screening. HNF-4α and PGC-1α are usually derived from mammals. HNF-4α and PGC-1α can be produced by using ordinary genetic engineering techniques. HNF-4α and PGC-1α are preferably isolated or purified. Definitions of an expression vector capable of expressing HNF-4α and an expression vector capable of expressing PGC-1α are as described in “2. Transformant”. Each component contained in the kit of the present invention is separately (or possibly mixed) in a suitable container and packaged as a whole in one or more.

Further, the present invention provides the reporter vector of the present invention in which the nucleotide sequence of (A) is any one of the nucleotide sequences (a ′) to (d ′) above, a transformant into which the reporter vector has been introduced, or A non-human transgenic mammal introduced with the reporter vector;
A combination comprising HNF-4α or an expression vector capable of expressing HNF-4α is provided.

  The combination can further include an expression vector capable of expressing PGC-1α or PGC-1α.

  Each component contained in the combination is separately placed in a suitable container and packaged as a whole in one or more. Alternatively, the combination may be in the form of a composition in which each component is mixed if possible.

  The combination of the present invention is useful as a kit for the screening of the present invention.

  The present invention will be described in more detail with reference to the following examples, but these are merely examples and do not limit the scope of the present invention.

(Example 1) Isolation of motif sequence Under long-life Ames dwarf mice and control mice, under free calorie restriction (ad libitum: AL) and calorie restriction giving 70% food intake of free feeding group And was bred for 4 months and sacrificed, and then RNA was extracted from the liver. After cDNA synthesis, changes in gene expression were analyzed using the Affmetrix mouse U74Av2 array. As a result, 312 gene expression was changed by Dwarfism, and 177 gene expression was changed by CR. (Tsuchiya et. Al., Physiol Genomics. 2004). Among them, 95 genes were considered that the dwarf (DF) effect and the CR effect were additive (Tsuchiya et. Al., Physiol Genomics. 2004). Furthermore, the following analysis was conducted on 56 genes that enhance the expression of the gene with any effect. Among the 56 genes, 43 genes that were able to obtain 3000 bp upstream from the transcription start point were extracted from the database by EZ retrieve (http://sirieusb.umdnj.edu:18080/EZRetrieve/index.jsp) published on the Internet did. Furthermore, using the sequence upstream of the 43 genes, four types of motif sequences frequently found were identified using MEME (http://meme.sdsc.edu/meme/) available on the Internet. (Table 1. Motifs 1 to 4 are the same as the base sequences described in SEQ ID NOs: 1 to 4 in the present specification, respectively). In addition, Table 2 shows a gene group having a sequence homologous to motif 2 upstream. The larger the number in the table, the higher the gene expression enhancement due to the DF effect and CR effect.

(Example 2) Confirmation of binding between motif 2 and HNF-4α by gel shift assay Among the sequences shown in Table 1, a literature search was performed for motif 2, and HNF-4α (hepatocyte nuclear factor-4α was found in this sequence. ) Were found to bind (eg, Hirota K et. Al., Int J Mol Med. 2005 Mar; 15 (3): 487-90.). Therefore, a gel shift assay was performed using an EMSA: electrophoretic mobility shift assay kit (Pierce) using a DNA probe in which the end of motif 2 was biotinylated. In this experiment, proteins added to the assay system were prepared by in vitro transcription / translation reactions. In vitro transcription / translation was carried out using TNT (registered trademark) System (Promega) on the HNF-4α plasmid having Flag-tag at the N-terminus.
As a result, the possibility of binding of HNF-4α to motif 2 was found (FIG. 1). The arrow is the complex of motif 2 and Flag-HNF-4α (lane 2). Binding was inhibited by addition of the anti-Flag antibody, the band became thin (lane 3), and the band disappeared by competitive reaction with non-biotinylated DNA (lane 4). This band was not seen without the Flag-HNF-4α protein (lane 1).

(Example 3) Analysis of binding of HNF-4α to promoter region of ApoC-II and Gstm gene by chromatin immunoprecipitation method For ApoC-II and Gstm gene, a sequence upstream from the transcription start point homologous to motif 2 A PCR primer was designed to amplify about 400 bp, and the binding analysis with HNF-4α was performed by chromatin immunoprecipitation. Chromatin immunoprecipitation was performed using the Upstate EZ-Chip kit. Genomic DNA used in the reaction was extracted from cultured cells derived from mouse hepatocytes.
The results are shown in FIG. The arrow is the amplified 400 bp base-HNF-4 conjugate. It was suggested that there is a sequence that may bind to HNF-4α upstream of the ApoC-II and Gstm genes.
Examples 1 to 3 strongly suggested binding of HNF-4α to motif 2.

(Example 4) Preparation of reporter assay vector and activation analysis in cultured cells Five motifs 2 in series at the NheI / BglII site of pSEAP2-Control vector (Clontech), a secretory alkaline phosphatase expression vector Introduced side by side. A secretory luciferase expression vector and a pMetLuc-Control vector (Clontech) were used as control vectors for measuring gene transfer efficiency. Using FuGENE (registered trademark) HD transfection reagent (Roche Applied Science) to 293 cells (derived from human fetal kidney), these reporter genes, PNF-1α, which is a coactivator of transcription thereof, and HNF-4α Transfection in combination. After 24 hours and 48 hours, the culture supernatant was collected, and the activities of secreted alkaline phosphatase (SEAP) and luciferase were measured by a Ready-To-Glow Dual Reported System (Clontech). For the activity measurement, a luminescence reader (manufactured by Aroka: AccuFLEX Lumi400) was used, and the amount of luminescence was measured for 15 seconds.
As a result, the HNF-4α expression vector (1 μg), the HNF-4α expression vector (1 μg) + PGC-1α expression vector (1 μg), and the HNF-4α expression vector compared with control (no protein expression vector) after 24 hours. It was revealed that the reporter was activated in the order of (2 μg) + PGC-1α expression vector (2 μg) (FIG. 3). This result was the same even 48 hours after transfection (FIG. 4). Therefore, it was suggested that motif 2 may bind to HNF-4α / PGC-1α in the cell and activate transcription.
It has already been reported that glucose and lipid metabolism-related genes such as PGC-1α are up-regulated by calorie restriction, and that HNF-4α and PGC-1α interact with each other due to calorie restriction (T. Chiba). et al., Molecular and Cellular Endocrinology, Volume 309, Issues 1-2, Pages 17-25).

(Example 5) Establishment of constitutive expression cell line and analysis of reporter activation by addition of insulin / dexamethasone The 293T cell line that constantly expresses the reporter gene of Example 4 was established by a selective culture method using G418. Using the cells, activation of a reporter by addition of insulin / dexamethasone, which is known to control the activity of HNF-4α / PGC-1α, was examined. The activity measurement was performed in the same manner as in Example 4.
As a result, when the assay was performed using the culture supernatant 24 hours after the addition of insulin / dexamethasone, it was suggested that 100 nM and 1000 nM insulin / dexamethasone was added to activate this reporter. (FIG. 5).
Therefore, by adding candidate molecules (test substances) such as pharmaceuticals and food ingredients in place of the insulin / dexamethasone used in this example, if the reporter of this cell is activated, the gene having motif 2 Activation, that is, transcription of a series of genes considered to be associated with improvement of the long life and metabolic diseases shown in Table 2, is predicted to be activated. Such a molecule has an effect of prolonging the life span, suggesting that it is useful as a candidate molecule for anti-aging, a preventive or therapeutic agent for diseases associated with aging or metabolic diseases.

Example 6 Analysis of Reporter Activation by CR Using Transient Transgenic Mice Whether or not this reporter assay system can actually be used in the body of a mouse is about 8 weeks under 30% calorie restriction. Analysis was carried out using ICR mice (20 weeks old) raised. A reporter gene (5 μg) is introduced from the tail vein of a mouse using TransIT (registered trademark) -EE Hydrodynamic Delivery Solution (Mirus Bio), which is a gene transfer reagent based on the hydrodynamic method, and is secreted into the blood 48 hours later. SEAP was measured. For the activity measurement, a luminescence reader (manufactured by Aroka: AccuFLEX Lumi400) was used, and the amount of luminescence was measured for 15 seconds.
As a result, as shown in FIG. 6, even in the case of introducing a vector having motif 2 in free-fed mice, SEAP activity comparable to that obtained by introducing a vector having no motif 2 was shown. However, when a vector having motif 2 was introduced into calorie restricted mice, the activity of SEAP was significantly increased. This suggested that this assay system functions even in the living body of mice, and as expected, reporter activity is high under calorie restriction. Thus, it was suggested that caloric restriction probably activates transcription factors such as HNF-4α / PGC-1α and increases the expression of genes homologous to motif 2.
In other words, from this, transient and constitutive transgenic mice have SEAP activity secreted in the blood after breeding by adding a candidate molecule (test substance) of a pharmaceutical or functional food to food or drinking water. By quantifying, it was considered possible to screen the candidate molecule for anti-aging and anti-aging disease effects while alive.

Claims (10)

A reporter vector,
(A) Any one nucleotide sequence selected from the following (a) to (d):
(A) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4,
(B) a nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, wherein one or more nucleotides are deleted, substituted, inserted or added;
(C) a nucleotide sequence having at least 70% identity to the nucleotide sequence represented by any one selected from SEQ ID NOs: 1 to 4, and (d) the sequence described in (a) to (c) above A nucleotide sequence complementary to (B) a promoter, and (C) a reporter gene;
The promoter is linked to the 5 ′ side of the reporter gene so that it can drive transcription of the reporter gene; and the nucleotide sequence of (A) can regulate transcription of the reporter gene by the promoter Thus, a reporter vector linked to the 5 ′ side of the promoter. The reporter vector according to claim 1, wherein the nucleotide sequence of (A) is any one selected from the following (a ') to (d') and is a nucleotide sequence capable of binding to HNF-4α. :
(A ′) the nucleotide sequence represented by SEQ ID NO: 1,
(B ′) a nucleotide sequence in which one or more nucleotides are deleted, substituted, inserted or added in the nucleotide sequence represented by SEQ ID NO: 1.
(C ′) a nucleotide sequence having at least 70% identity to the nucleotide sequence represented by SEQ ID NO: 1, and (d ′) a nucleotide sequence complementary to the sequences described in (a ′) to (c ′) above .   A transformant into which the reporter vector according to claim 1 has been introduced.   A non-human transgenic mammal into which the reporter vector according to claim 1 has been introduced. A screening method for calorie restriction mimetics comprising the following steps:
1) performing a reporter assay using the reporter vector according to claim 1 in the presence of a test substance;
2) comparing the expression level of the reporter gene in the presence of the test substance with that in the absence of the test substance; and 3) comparing the test substance whose reporter gene expression level is increased as a result of the comparison. Select as a calorie restriction mimetic candidate.   A kit for screening a calorie restriction mimetic comprising the reporter vector according to claim 1, a transformant into which the reporter vector has been introduced, or a non-human transgenic mammal into which the reporter vector has been introduced. A screening method for substances that extend lifespan, including the following steps:
1) performing a reporter assay using the reporter vector according to claim 1 in the presence of a test substance;
2) comparing the expression level of the reporter gene in the presence of the test substance with that in the absence of the test substance; and 3) comparing the test substance whose reporter gene expression level is increased as a result of the comparison. Select as a candidate for a substance that prolongs life.   A kit for screening a substance that extends life span, comprising the reporter vector according to claim 1, a transformant into which the reporter vector is introduced, or a non-human transgenic mammal into which the reporter vector is introduced. A reporter vector according to claim 2, a transformant introduced with the reporter vector, a non-human transgenic mammal introduced with the reporter vector, and an expression vector capable of expressing HNF-4α or HNF-4α. Combination.   The combination according to claim 9, further comprising an expression vector capable of expressing PGC-1α or PGC-1α.